Methods for detecting genetic diseases

Abstract

To provide a method for efficiently and accurately distinguishing two similar diseases that differ in the presence or absence of a mutant allele in the same gene region.SOLUTION: A method for distinguishing between a genetic disease caused by a codon mutation in a gene and another disease includes the steps of: performing an amplification reaction to amplify a genetic region containing the codon, the amplification reaction including adding a DNA primer for amplifying the genetic region containing the codon and a PNA that inhibits the amplification of a normal allele containing the codon; and treating a product obtained by the amplification reaction with a restriction enzyme that specifically recognizes and cleaves either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation, thereby obtaining a restriction enzyme-treated product.SELECTED DRAWING: Figure 3

Description

[Technical Field]

[0001] The present invention relates to the detection of genetic diseases, and more particularly to methods and kits for distinguishing between two similar diseases. [Background technology]

[0002] Intramuscular myxoma (IM) is a benign mesenchymal tumor. It is composed of spindle cells with a background of abundant myxin and hypovascular stroma. It is most commonly seen in middle-aged and elderly people, and most often occurs within the muscles of the limbs, but can also occur subcutaneously. Imaging shows signal changes reflecting the abundant myxin stroma, and is characterized by poor contrast enhancement due to poor blood flow.

[0003] On the other hand, myxoid malignant soft tissue tumors that can be distinguished from intramuscular myxoma include myxofibrosarcoma (MFS), low-grade fibromyxoid sarcoma, myxoid liposarcoma, and extraskeletal myxoid chondrosarcoma. Tumors other than MFS can be distinguished from intramuscular myxoma by specific immunohistochemistry and / or fusion gene searches.

[0004] Myxofibrosarcoma is a relatively common malignant soft tissue tumor occurring in the extremities of middle-aged and elderly patients. Similar to intramuscular myxoma, myxofibrosarcoma exhibits radiological changes reflecting abundant myxoid stroma, with contrast enhancement varying from case to case. Histopathologically, myxofibrosarcoma resembles intramuscular myxoma because it is a tumor composed of abundant myxoid stroma and spindle cells. High-grade myxofibrosarcoma exhibits more severe nuclear hyperplasia, atypia, and mitotic figures than intramuscular myxoma. However, low-grade myxofibrosarcoma lacks these findings, making it difficult to distinguish from intramuscular myxoma. Because treatment approaches differ between intramuscular myxoma and low-grade myxofibrosarcoma (LGMFS), tools for distinguishing between them are needed.

[0005] Intramuscular myxomas have been reported to harbor missense mutations in GNAS. GNAS is located on chromosome 20q13.2-q13.3 and contains 13 exons. This gene is a component of GTP-binding proteins (G proteins) and is involved in cell signal transduction. G proteins are composed of trimers consisting of α, β, and γ, and are activated by G protein-coupled receptors. GNAS has an α subunit (GαS), which is bound to GDP in the inactive form but dissociates from the βγ dimer upon activation. Intramuscular myxomas have been reported to harbor missense mutations at codon 201 in GNAS exon 8 (R201C, R201H, R201S, R201L, R201P) and codon 227 in exon 9 (Q227E), with the majority of these mutations occurring at codon 201 in exon 8. This mutation is reportedly useful for distinguishing between LGMFS and LGMFS because it is not observed in the LGMFS (Non-Patent Document 1).

[0006] However, because intramuscular myxomas have very few tumor cells in tissue and a low frequency of mutant alleles, highly accurate detection methods are required to identify GNAS mutations. Direct sequencing, a common method for determining the base sequence using PCR products directly as templates (also known as direct sequence analysis), has a low positive rate of 29–50% (Non-Patent Documents 1–3). Therefore, next-generation sequencing (NGS) analysis has been used in recent years, and high positive rates of 88–92% have been reported (Non-Patent Documents 4, 5). While NGS analysis can detect GNAS mutations with high accuracy, its use in routine clinical practice is hindered by the limited availability of facilities and the time and cost required for analysis.

[0007] One method to increase the detection sensitivity of direct sequencing is the peptide nucleic acid (PNA) clamping method. PNA is a DNA mimic in which the deoxyribose phosphate backbone is replaced with a 2-aminoethylglycine backbone. By binding to normal base sequences, PNA primers inhibit PCR amplification of wild-type alleles, resulting in enhanced amplification of mutant alleles. Direct sequencing analysis combined with PNA clamping has been reported to identify mutations in 87.5% of peripheral blood cells from patients with fibrous dysplasia / McCune-Albright syndrome, which has the same GNAS mutation as intramuscular myxoma and is difficult to identify (Non-Patent Document 6). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Willems SM et al., J Cell Mol Med 2009, 13:1291-301. [Non-patent document 2] Delaney D et al., Mod Pathol 2009, 22:718-24. [Non-patent document 3] Walther I et al., Pathol Res Pract 2014, 210:1-4. [Non-patent document 4] Sunitsch S et al., Diagn Pathol 2018, 13:52. [Non-Patent Document 5] Libbrecht L et al., Ann Diagn Pathol 2019, 43:151409. [Non-patent document 6] Lietman SA et al., J Bone Joint Surg Am 2005, 87:2489-94. Summary of the Invention [Problem to be solved by the invention]

[0009] There is a need for an efficient and highly accurate method for distinguishing between two similar diseases that differ in the presence or absence of mutant alleles in the same gene region, as well as a need for a method and test kit that can efficiently and accurately distinguish between intramuscular myxoma and low-grade fibrosarcoma. [Means for solving the problem]

[0010] The present invention encompasses the embodiments described below. Section 1. A method for distinguishing between a genetic disease caused by a codon mutation in a gene and another disease, comprising: a step of carrying out an amplification reaction to amplify a gene region containing the codon, the step comprising adding, in the amplification reaction, a DNA primer for amplifying the gene region containing the codon and a PNA that inhibits amplification of a normal allele containing the codon that does not have the mutation; and The method includes a step of treating the product obtained by the amplification reaction with a restriction enzyme that specifically recognizes and cuts either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation, thereby obtaining a restriction enzyme-treated product. Section 2. Item 1. The method according to Item 1, further comprising the step of subjecting the DNA fragments contained in the restriction enzyme digestion products to electrophoresis. Section 3. Item 3. The method according to Item 2, further comprising, after electrophoresis, a step of performing signal analysis on the DNA fragments separated after electrophoresis, wherein a signal derived from the DNA fragment containing the mutation after electrophoresis serves as an indicator of the possibility of suffering from the genetic disease. Section 4. Item 2. The method according to Item 1, wherein the genetic disease caused by a codon mutation in the gene region is at least one selected from the group consisting of intramuscular myxoma, fibrous dysplasia of the bone, intraductal papillary mucinous tumor of the pancreas, low-grade mucinous tumor of the appendix, villous adenoma of the colon, McCune-Albright syndrome, and Mazabraud syndrome. Section 5. The method is for distinguishing between intramuscular myxoma and low-grade myxofibrosarcoma, the gene region is a gene region including 201 codons of the GNAS gene, the step of carrying out the amplification reaction comprises adding a PNA that inhibits amplification of codon 201, which is a normal allele; Item 1. The method according to Item 1, wherein the step of obtaining a restriction enzyme treatment product comprises applying a restriction enzyme that specifically recognizes and cleaves either a sequence having 201 codons that is a normal allele or a sequence having 201 codons that is a mutant allele. Section 6. Item 6. The method according to Item 5, wherein the restriction enzyme comprises BceA I. Section 7. Item 6. The method according to Item 5, wherein the PNA has the base sequence represented by SEQ ID NO:3. Section 8. Item 6. The method according to Item 5, wherein the DNA primers for amplifying the gene region containing the codon include a primer consisting of the nucleotide sequence represented by SEQ ID NO: 1 and a primer consisting of the nucleotide sequence represented by SEQ ID NO: 2. Section 9. Item 2. The method according to Item 1, wherein the gene region containing the codon is a region of DNA obtained from a tissue or body fluid of a subject. Section 10. Item 10. The method according to any one of Items 1 to 9, wherein the amplification reaction comprises PCR. Section 11. A test kit for distinguishing between a genetic disease caused by a mutation in a codon in a gene region and another disease in which the codon is a normal allele, comprising: a DNA primer for amplifying a gene region containing the codon; a PNA that inhibits amplification of a normal allele containing the codon that does not have the mutation; and a restriction enzyme that specifically recognizes and cleaves either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation in the product obtained by the amplification reaction; A test kit equipped with [Brief explanation of the drawings]

[0011] [Figure 1]Schematic diagram illustrating the amplification of wild-type and mutant sequences by DNA primers supplemented with PNA clamp probes. [Figure 2] Restriction of PCR products with the restriction enzyme BceA I, which recognizes the wild-type sequence. [Figure 3] Capillary electrophoretic signal analysis of each fragment of the wild-type and mutant amplicons. [Figure 4] Changes in wild-type and mutant peaks due to changes in mutant allele frequency. Wild peak: wild-type peak, Mutant peak: mutant peak. [Figure 5] Calculation of cutoff value in fragment analysis. WTC: mutant control, vertical axis: signal ratio (SR) mean ± SEM. DETAILED DESCRIPTION OF THE INVENTION

[0012] As used herein, the term "normal allele" can be used interchangeably with "wild-type allele." The term "mutant allele" can be used interchangeably with "variant allele."

[0013] In this specification, the terms "contain, include, or have" are concepts that encompass "consist essentially only of" and "consist only of."

[0014] As used herein, the term "restriction enzyme treatment" can be used interchangeably with "restriction enzyme digestion."

[0015] Based on a prior art report that a mutation in codon 201 of exon 8 is useful for distinguishing between intramuscular myxoma and low-grade fibrosarcoma (Willems SM et al., J Cell Mol Med 2009, 13:1291-301), the present inventors first attempted to distinguish between these diseases using direct sequencing using samples from patients suffering from these diseases. However, direct sequencing was unable to distinguish between the two diseases with sufficient accuracy.

[0016] One method to increase the detection sensitivity of direct sequencing is the peptide nucleic acid (PNA) clamping method. Lietman SA et al., J Bone Joint Surg Am 2005, 87:2489-94, reported that direct sequencing analysis combined with PNA clamping detected low copy number mutant GNAS in the DNA of peripheral blood cells from patients with fibrous dysplasia / McCune-Albright syndrome.

[0017] Therefore, the inventors attempted to distinguish between intramuscular myxoma and low-grade fibrosarcoma by combining the PNA clamping method with genetic analysis by restriction fragment analysis, a known nucleic acid detection method, and unexpectedly were able to detect the GNAS codon 201 mutation efficiently and with high accuracy. This discrimination method, which combines the PNA clamping method with restriction fragment analysis, can be performed in facilities that do not have next-generation sequencers, and is advantageous in that it is highly versatile, simple, and inexpensive.

[0018] According to a first aspect of the present invention, there is provided a method for distinguishing between a genetic disease caused by a mutation in a codon of a gene and another disease, the method comprising: carrying out an amplification reaction to amplify a genetic region containing the codon, the amplification reaction comprising adding a DNA primer for amplifying the genetic region containing the codon and a PNA that inhibits amplification of a normal allele containing the codon; The method includes a step of treating the product obtained by the amplification reaction with a restriction enzyme that specifically recognizes and cleaves either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation, thereby obtaining a restriction enzyme-treated product.

[0019] The method of the above aspect of the present invention can be regarded as a test method for distinguishing a genetic disease caused by a codon mutation in a gene from other diseases. Furthermore, the method of the above aspect of the present invention can be used as a test method to assist a doctor in making a diagnosis, for example, for a definitive diagnosis.

[0020] Examples of genetic diseases caused by codon mutations in gene regions include at least one selected from the group consisting of intramuscular myxoma, fibrous dysplasia, intraductal papillary mucinous neoplasm of the pancreas, pancreatic cancer, low-grade mucinous tumor of the appendix, villous adenoma of the colon, McCune-Albright syndrome, and Mazabraud syndrome.

[0021] The other disease includes a disease in which the codon in the same gene region does not have a mutation. In some embodiments, the other disease is a neoplastic disease. In some embodiments, the other disease includes at least one selected from the group consisting of low-grade myxofibrosarcoma, low-grade intraosseous osteosarcoma, osteogenic fibroma, pancreatic cancer, appendix mucinous adenocarcinoma, and colorectal cancer.

[0022] The amplification reaction for amplifying the gene region may be carried out by, for example, PCR, NASBA, LCR, SDA, LAMP, etc. In some preferred embodiments, the amplification reaction comprises PCR.

[0023] The sample or specimen used in the amplification reaction is not particularly limited and may be, for example, a biological sample or specimen containing DNA. In some embodiments, the sample or specimen is DNA purified and / or extracted from a pathological specimen. In some embodiments, the sample or specimen is genomic DNA purified and / or extracted from a biopsy. In some specific embodiments, the sample to be tested may be DNA purified and / or extracted from any tissue, body fluid, or cell of a subject (including nails, hair, blood, cells cultured from collected tissue, etc.). For example, genomic DNA extracted from a patient's peripheral blood can be used as the sample or specimen. Furthermore, as long as gene amplification is possible in the amplification reaction, the DNA purification and / or extraction steps may be omitted or simplified.

[0024] The DNA primers may be a pair of primers (forward and reverse primers) consisting of polyoligonucleotides that hybridize to the sequence to be amplified on both sides of the sequence, and the primers can be synthesized by known nucleic acid synthesis methods.

[0025] DNA primers are selected so as to amplify, for example, a sequence of at least 10 bases, preferably 10 to 100 bases, more preferably 10 to 50 bases, and / or its complementary sequence. In some embodiments, the lower limit of the length of the DNA primer is at least 12 bases, at least 15 bases, or at least 18 bases. In some embodiments, the upper limit of the length of the DNA primer is 40 bases, 35 bases, or 30 bases. In some embodiments, the DNA primers for amplifying the gene region containing the codon include a primer consisting of the base sequence represented by SEQ ID NO: 1 and a primer consisting of the base sequence represented by SEQ ID NO: 2.

[0026] 5'- CAGGAAACAGCTATGACCACGGCGTTGGCTTTGGTGAGATCC-3' (SEQ ID NO: 1), 5'-TAATACGACTCACTATAGGGTTGTCCACCTGGAACTTGGT-3' (SEQ ID NO: 2)

[0027] The PNA (peptide nucleic acid) refers to a nucleic acid analog in which the pentose-phosphate backbone of a nucleic acid is replaced with a polyamide by a peptide bond of N-(2-aminoethyl)glycine. The PNA probe used herein has a base sequence designed to hybridize with a normal allele containing the codon (i.e., an allele containing a non-mutated codon) and inhibit its amplification, while not hybridizing with a mutant allele containing the codon (i.e., an allele containing a mutated codon), thereby selectively amplifying the mutant allele. The codon may be codon 201. A PNA probe preferably has a base sequence of approximately 10 to 18 bases in length that is identical to the sequence of a normal allele containing the codon, or its complementary sequence. In some embodiments, the PNA has the base sequence represented by SEQ ID NO: 3. N represents an amino group, and C represents a carboxyl group.

[0028] N-GCTGCCGTGTCCT-C (SEQ ID NO: 3)

[0029] The composition of the reaction solution used in the amplification reaction is not particularly limited, and the reaction solution can be prepared with a composition that includes the above-mentioned sample or specimen, DNA primer, and PNA, as well as a buffer solution, DNA polymerase, deoxynucleoside triphosphates (dNTPs), and water.

[0030] The conditions for the amplification reaction can be determined by one skilled in the art using routine skills.

[0031] In the step of carrying out the above-mentioned amplification reaction, the amplification reaction is carried out by adding PNA that inhibits the amplification of normal alleles. Therefore, even if the amount of base sequences containing mutated codons or abnormal alleles in the sample is small, they can be amplified while inhibiting the amplification of normal alleles. Therefore, the detection sensitivity can be improved even for genetic diseases in which the amount of base sequences containing mutated codons or abnormal alleles in the sample is small in the subject's living body.

[0032] The restriction enzyme used in the process of obtaining the restriction enzyme treatment product is not particularly limited as long as it specifically recognizes and cuts either a base sequence containing a codon with the above-mentioned mutation or a base sequence containing a codon without the above-mentioned mutation, but examples thereof include BceA I.

[0033] In the process of obtaining the restriction enzyme treatment product, cleavage with the restriction enzyme makes it possible to distinguish between base sequences in the amplification product that contain codons with the above-mentioned mutation and base sequences that contain codons without the above-mentioned mutation, thereby enabling simple and highly sensitive detection of codon mutations in gene regions.

[0034] In some embodiments, after the step of performing an amplification reaction (which is referred to as the first amplification reaction) and after the step of obtaining a restriction enzyme treatment product, there is no step of performing a second amplification reaction using the product obtained by the amplification reaction as a template.

[0035] In some embodiments, the base sequence including the codon with the mutation is a mutant allele, and the base sequence including the codon without the mutation is a normal allele.

[0036] For example, codon 201 in the normal allele of the GNAS gene encodes arginine (CGT), but diseases such as intramuscular myxoma have missense mutations at codon 201 in exon 8 of the GNAS gene (R201C, R201H, R201S, R201L, R201P) and at codon 227 in exon 9 (Q227E). R201C contains TGT, which encodes cysteine ​​(Cys), while R201H contains CAT, which encodes histidine (His). In diseases such as low-grade myxofibrosarcoma, codon 201 is CGT.

[0037] For this reason, when a gene region containing codon 201 is amplified in the presence of PNA, which inhibits the amplification of normal alleles containing codon 201, in the case of intramuscular myxoma, codon 201 in exon 8 of the GNAS gene is mutated, and therefore is amplified more than in diseases that do not have a mutation in codon 201 in exon 8 of the GNAS gene, such as low-grade myxofibrosarcoma. Therefore, when a restriction enzyme that specifically recognizes and cleaves either a base sequence containing a non-mutated codon or a normal allele, or a base sequence containing a mutated codon or a mutant allele, is applied to the product obtained by the amplification reaction, intramuscular myxoma can be distinguished from other diseases, such as those that do not have a mutation in codon 201 in exon 8 of the GNAS gene, based on the peak of the cleaved fragment.

[0038] The method of distinguishing between a genetic disease caused by a codon mutation in a gene and another disease according to the above aspect of the present invention may further comprise the step of subjecting the DNA fragment contained in the restriction enzyme digestion product to electrophoresis.

[0039] The electrophoresis may be capillary electrophoresis or gel electrophoresis, but capillary electrophoresis is preferred in terms of high detection sensitivity, as it enables signal analysis of DNA fragments after restriction enzyme treatment.

[0040] The method of the present invention for distinguishing between a genetic disease caused by a codon mutation in a gene and another disease may further comprise, after electrophoresis, a step of performing signal analysis on the DNA fragments separated after electrophoresis, where the signal derived from the DNA fragment containing the mutation after electrophoresis serves as an indicator of the possibility of suffering from the genetic disease.

[0041] Fragment signal analysis by restriction enzyme digestion and electrophoresis has been used, for example, to detect missense mutations at FLT3 codon 835 in acute myeloid leukemia (Murphy KM et al., J Mol Diagn 2003, 5:96-102). In this paper, the amplification product of the wild-type allele is digested by digestion with the restriction enzyme EcoRV, and finally, the wild-type and mutant alleles are distinguished by fragment analysis using capillary electrophoresis. This has been commercialized as a companion diagnostic (LeukoStrat (R) CDx FLT3 Mutation Assay). Fragment signal analysis by capillary electrophoresis has superior resolution compared to fragment analysis by gel electrophoresis and allows semi-quantitative determination. Furthermore, since direct sequencing is not necessarily required, the analysis time is short and it is not dependent on the type of missense mutation in the target codon.

[0042] In a specific embodiment, the method for distinguishing between a genetic disease caused by a codon mutation in a gene according to the above aspect of the present invention and another disease is a method for distinguishing between intramuscular myxoma and low-grade myxofibrosarcoma, in which the gene region is a gene region including the 201 codon of the GNAS gene, the step of performing an amplification reaction comprises adding a PNA that inhibits the amplification of the 201 codon, which is a normal allele, and the step of obtaining a restriction enzyme treatment product comprises acting on a restriction enzyme that specifically recognizes and cleaves either a sequence having the 201 codon, which is a normal allele, or a sequence having the 201 codon, which is a mutant allele.

[0043] Diseases caused by missense mutations at codon 201 of the GNAS gene are difficult to distinguish from malignant tumors histopathologically, and detection of genetic mutations is necessary for a definitive diagnosis. However, the method of the above embodiment of the present invention provides a versatile and inexpensive method for identifying diseases.

[0044] According to a second aspect of the present invention, there is provided a test kit for distinguishing between a genetic disease caused by a mutation in a codon in a gene region and another disease in which the codon is a normal allele, the test kit comprising: a DNA primer for amplifying the gene region containing the codon; a PNA that inhibits the amplification of the codon that is a normal allele; and a restriction enzyme that specifically recognizes and cleaves either a base sequence having the codon as a normal allele or a base sequence having the codon as a mutant allele in the product obtained by the amplification reaction.

[0045] The test kit may further comprise instructions for carrying out the method of the first aspect.

[0046] The test kit may further include a first container that contains the DNA primer.

[0047] The test kit may further comprise a second container containing the PNA.

[0048] The test kit may further comprise a third container that contains the restriction enzyme.

[0049] The test kit may further comprise at least one selected from the group consisting of a buffer solution, a DNA polymerase, deoxynucleoside triphosphates (dNTPs), and water.

[0050] The test kit described above can easily and sensitively detect genetic diseases caused by codon mutations in genes and other diseases. When the codon mutation is a mutation in codon 201 of the GNAS gene, it is useful for distinguishing between intramuscular myxoma and low-grade myxofibrosarcoma.

[0051] The following examples are intended for illustrative purposes only and are not intended to limit the scope of the present invention in any way. Unless otherwise specified, reagents are commercially available or are obtained or prepared according to conventional techniques or literature procedures in the art. [Example]

[0052] Example: Development of a highly accurate method for detecting GNAS gene mutations useful for distinguishing between intramuscular myxoma and low-grade myxofibrosarcoma

[0053] 1. Materials and Methods 1.1 Patient Data Between 2009 and 2020, tumor resections were performed at Shinshu University Hospital. DNA was extracted from 10 intramuscular myxoma and 9 low-grade myxofibrosarcoma specimens. Biopsy specimens were also obtained from 2 intramuscular myxoma and 5 low-grade myxofibrosarcoma specimens. Furthermore, specimens were obtained from 4 fibrous dysplasia specimens. The histopathological diagnosis was based on the WHO Classification of Tumors / Soft Tissue and Bone Tumors 5. th edition 27 After the start of this study, three pathologists (MI, KS, HH) retrospectively and blindly re-diagnosed the cases. The re-diagnosis was based solely on histopathological findings, excluding genetic analysis.

[0054] 1.2 Analysis target The base sequence of GNAS exon 8 codon 201 was analyzed. Sequence information was obtained from the NCBI Reference Sequence Database, and Accession ID: NM_000516.5 was referenced.

[0055] 1.3 DNA extraction Using HE-stained slides with tumor-rich areas marked by a pathologist (MI), formalin-fixed, paraffin-embedded (FFPE) unstained slides were macrodissected and used for DNA extraction. DNA extraction was performed using the QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol. Extracted DNA was quantified using the Qubit 1X dsDNA High Sensitivity assay kit (Invitrogen, Waltham, Massachusetts, USA) and stored at -20°C.

[0056] 1.4 GNAS gene missense mutation analysis method 1.4.1 PCR-direct sequencing analysis Sequencing tagging primer targeting GNAS exon 8, Forward: 5'- CAGGAAACAGCTATGACC ACGGCGTTGGCTTTGGTGAGATCC-3' (SEQ ID NO: 1), Reverse: 5'- TAATACGACTCACTATAGGG TTGTCCACCTGGAACTTGGT -3' (SEQ ID NO: 2) PCR was performed using the tag sequence (underlined). The PCR product was confirmed by agarose gel electrophoresis and extracted using a QIAEX II Gel extraction kit (Qiagen, Hilden, Germany). TM Sequencing reactions were performed using the Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA), and the base sequences were determined using a 3500 Genetic Analyzer (Applied Biosystems) and DNA Sequencing Analysis software v5.1 (Applied Biosystems).

[0057] 1.4.2 Restriction enzyme digestion after PCR combined with PNA clamping and fragment signal analysis by capillary electrophoresis The PCR reaction using the PNA clamp method used the forward primer shown in 1.4.1 and the reverse primer shown in 1.4.1, fluorescently labeled with 6-FAM at the 5' end. Furthermore, clamp PNA: N-GCTGCCGTGTCCT-C (SEQ ID NO: 3, Panagene Inc., Daejeon, Korea) was used as a PNA clamp probe to inhibit the amplification of wild-type DNA. See Figure 1. The PCR reaction mixture consisted of 1x Ampdirect TM Plus (Shimadzu Corporation, Kyoto, Japan), 1.5 units of BIOTAQ TM The PCR mixture contained HS DNA polymerase (Bioline, London, UK) and 0.4 units of Uracil-DNA Glycosylase Heat-labile (TOYOB, Osaka, Japan). The final PNA concentration was 2.5 μmol / L, the final primer concentration was 0.3 μmol / L, and the reaction volume was 20 μL. The PCR reaction conditions were 25°C for 5 min, 95°C for 10 min, (95°C for 15 sec, 60°C for 30 sec, 72°C for 45 sec) × 40 cycles, and 72°C for 7 min. 6.9 ng (median: 0.5-45.8 ng) of genomic DNA was used as input. For restriction enzyme digestion of the PCR product, 2 μL of PCR product was mixed with a reaction solution containing 1 unit of BceA I (New England BioBabs, Hitchin, UK), and the reaction was carried out at 37°C for 1 hour, followed by 20 minutes at 65°C to inactivate the enzyme (see Figure 2). The restriction enzyme digestion reaction solution was diluted with purified water and then analyzed using a GeneScan™. TM 350 ROX TMThe DNA was mixed with HiDi formamide (Applied Biosystems) containing a dye size standard (Applied Biosystems) and heat denatured. Capillary electrophoresis was then performed using a 3500 Genetic Analyzer (Applied Biosystems). Analysis was performed using GeneMapper software (Applied Biosystems). The peak at 77 bp was designated the wild-type allele peak, and the peak at 105 bp was designated the mutant allele peak (see Figure 3). The allele relative value was calculated as the height of the mutant allele peak divided by the height of the wild-type allele peak.

[0058] 1.4.3 PCR-direct sequencing analysis using PNA clamping Using the PCR products obtained by the method described in 1.4.2, sequence analysis was carried out in the same manner as described in 1.4.1.

[0059] 1.4.4 Sensitivity considerations To examine the sensitivity of mutation detection, the wild-type sequence of GNAS exon 8 was cloned using the TA Cloning Kit with pCR2.1 Vector (Invitrogen) and a recombinant plasmid was prepared. TMAfter transforming and culturing INVαF' Chemically Competent E. coli, plasmid DNA was extracted using a QIAprep Spin Miniprep Kit (Qiagen). Mutations were then introduced into the extracted wild-type sequence plasmid DNA using the PrimeSTAR® Mutagenesis Basal Kit (Takara Bio Inc., Shiga, Japan) to generate mutant sequence plasmids (c.601C>T:p.R201C, c602G>A:p.R201H). The copy number of the resulting plasmids was determined based on the DNA content. The mutant sequence plasmid was diluted with the wild-type sequence plasmid to create a dilution series of 20, 10, 5, 2, and 1%. The resulting mutant sequence plasmids were subjected to PCR with PNA clamping followed by restriction enzyme digestion, fragment signal analysis by capillary electrophoresis, and direct sequencing.

[0060] 1.4.5 Next-generation sequencing analysis A next-generation sequencing (NGS) panel for GNAS optimized for FFPE samples was designed using Ion AmpliSeq Designer (https: / / ampliseq.com / browse.action). To remove uracil bases in template DNA generated by cytosine deamination, uracil DNA glycosylase (UDG) (Thermo Fisher Scientific, Waltham, MA, USA) treatment was performed prior to library preparation. Library preparation was performed using the Ion AmpliSeq Kit for Chef DL8 (Thermo Fisher Scientific) on Ion Chef (Thermo Fisher Scientific). Sequencing was performed using the Ion Chef and Ion GeneStudio S5 (Thermo Fisher Scientific) with the Ion 510, Ion 520, and Ion 530 Kit-Chef and Ion 510 Chip Kit (Thermo Fisher Scientific). Sequencing data were mapped to the human genome hg19 using Torrent Suite software 5.8 (Thermo Fisher Scientific). Variants were detected using the Torrent Variant Caller plugin with default somatic low stringency parameters. Detected variants were annotated using SnpEff and SnpSift (http: / / snpeff.sourceforge.net) using processed vcf files from ClinVar (ftp: / / ftp.ncbi.nlm.nih.gov / pub / clinvar / vcf_GRCh37 / clinvar_20220328), dbNSFP3.4c, and dbscSNV1.1 (https: / / sites.google.com / site / jpopgen / dbNSFP). Variants were described using the NM_000516.5 transcript reference sequence, and variant nomenclature followed the recommendations of the Human Genome Society.

[0061] 1.5 Statistical analysis To set the cutoff value for allele relative values ​​in fragment analysis, a Dunn's test was performed using pooled ranks for nonparametric comparison with the control group. Data analysis software was JMP ver. 14.2 (SAS Institute, Cary, NC, USA), and a p<0.05 was considered significant.

[0062] 2.Results 2.1 Mutation detection sensitivity of the analytical method The results of mutant sequence plasmid analysis using fragment analysis are shown in Figures 4 and 5. For both mutations, plasmid samples with a mutant allele frequency of 5% or higher were distinguished from wild-type sequence plasmid samples (mutant allele frequency 0%) (20%: p>0.01, 10%: p>0.01, 5%: p=0.04). However, there was no significant difference at 2% (p=0.39), suggesting that the sensitivity of this method for mutation detection is between 2% and 5%. The mean allele relative values ​​for the plasmid samples with a mutant allele frequency of 5% were 0.082 for c.601C>T and 0.091 for c.602G>A. Therefore, a positive cutoff value of 0.08 was considered feasible for detecting mutations in samples with a mutant allele frequency of 5% or higher.

[0063] 2.2 GNAS missense mutation analysis 2.2.1 Codon 201 mutation analysis The results of the four analysis methods are shown in Table 1. PCR-direct sequencing revealed mutations in four cases of IM (3 cases of R201C and 1 case of R201H). PCR combined with PNA clamping followed by restriction enzyme digestion and capillary electrophoresis fragment signal analysis yielded positive results in eight IM cases and one LGMFS case. PCR-direct sequencing combined with PNA clamping identified mutations in eight IM cases (R201C in four cases and mR201H in four cases). For NGS, analyses were conducted in which the entire target region was covered, with all regions exceeding 1,000 reads. As a result, nine IM cases and six LGMFS cases were evaluated, and mutations were identified in seven IM cases (R201C in three cases and R201H in four cases). The sensitivity / specificity of each analytical method was 0.4 / 1 for PCR-direct sequencing (Method A), 0.8 / 0.89 for restriction enzyme digestion after PCR combined with PNA clamping and fragment signal analysis by capillary electrophoresis (Method B), 0.8 / 1 for PCR-direct sequencing combined with PNA clamping (Method C), and 0.7 / 1 for NGS (Method D).

[0064] [Table 1]

[0065] 2.2.2 GNAS mutation analysis by NGS In the 15 cases evaluated, no mutations other than the exon 8 codon 201 mutation could be identified.

[0066] 2.2.3 Analysis time and cost The estimated analysis time after DNA extraction was 1 / 6 of that for PCR-direct sequencing (Method A) compared to NGS analysis (Method D), 1 / 10 of that for PCR-post restriction enzyme digestion and capillary electrophoresis fragment signal analysis combined with PNA clamping (Method B), and 1 / 6 of that for PCR-direct sequencing combined with PNA clamping (Method C). Analysis costs excluding labor costs were 1 / 16 of that for PCR-direct sequencing (Method A) compared to NGS analysis (Method D), 1 / 16 of that for PCR-post restriction enzyme digestion and capillary electrophoresis fragment signal analysis combined with PNA clamping (Method B), and 1 / 12 of that for PCR-direct sequencing combined with PNA clamping (Method C).

[0067] 3. Conclusion The missense mutation in GNAS exon 8 codon 201 in IM was detected with high sensitivity by PCR combined with PNA clamping followed by restriction enzyme digestion and capillary electrophoresis fragment signal analysis. Furthermore, combining this detection method with PCR-direct sequencing combined with PNA clamping enabled even more efficient and accurate detection. The GNAS gene codon 201 mutation detection method described in this example can serve as an auxiliary diagnostic tool for distinguishing between IM and LGMFS.

Claims

1. A method for distinguishing between a genetic disease caused by a codon mutation in a gene and another disease, comprising: a step of carrying out an amplification reaction to amplify a gene region containing the codon, the step comprising adding, in the amplification reaction, a DNA primer for amplifying the gene region containing the codon and a PNA that inhibits amplification of a normal allele containing the codon that does not have the mutation; and The method includes a step of treating the product obtained by the amplification reaction with a restriction enzyme that specifically recognizes and cuts either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation, thereby obtaining a restriction enzyme-treated product.

2. The method according to claim 1, further comprising the step of subjecting the DNA fragments contained in the restriction enzyme digestion products to electrophoresis.

3. The method according to claim 2, further comprising a step of performing signal analysis of the DNA fragments separated after electrophoresis, wherein the signal derived from the DNA fragment containing the mutation after electrophoresis is an indicator of the possibility of suffering from the genetic disease.

4. The method of claim 1, wherein the genetic disease caused by a codon mutation in the gene region is at least one selected from the group consisting of intramuscular myxoma, fibrous dysplasia, intraductal papillary mucinous tumor of the pancreas, low-grade mucinous tumor of the appendix, villous adenoma of the colon, McCune-Albright syndrome, and Mazabraud syndrome.

5. The method is for distinguishing between intramuscular myxoma and low-grade myxofibrosarcoma, the gene region is a gene region including 201 codons of the GNAS gene, the step of carrying out the amplification reaction includes adding a PNA that inhibits amplification of the 201 codon, which is a normal allele; The method of claim 1, wherein the step of obtaining the restriction enzyme treatment product comprises applying a restriction enzyme that specifically recognizes and cleaves either a sequence having the 201 codon that is a normal allele or a sequence having the 201 codon that is a mutant allele.

6. The method of claim 5, wherein the restriction enzyme comprises BceA I.

7. The method according to claim 5, wherein the PNA has the base sequence represented by SEQ ID NO:

3.

8. The method according to claim 5, wherein the DNA primers for amplifying the gene region containing the codon include a primer consisting of the base sequence represented by SEQ ID NO: 1 and a primer consisting of the base sequence represented by SEQ ID NO:

2.

9. The method of claim 1, wherein the gene region containing the codon is a region of DNA obtained from a tissue or body fluid of a subject.

10. The method of any one of claims 1 to 9, wherein the amplification reaction comprises PCR.

11. A test kit for distinguishing between a genetic disease caused by a mutation in a codon in a gene region and another disease in which the codon is a normal allele, comprising: a DNA primer for amplifying a gene region containing the codon; a PNA that inhibits amplification of a normal allele containing the codon that does not have the mutation; and a restriction enzyme that specifically recognizes and cleaves either a base sequence containing the codon with the mutation or a base sequence containing the codon without the mutation in the product obtained by the amplification reaction; A test kit equipped with

Images