Composition containing fermented propionic acid bacteria

Abstract

To provide an anti-obesity composition containing fermented propionic acid bacteria.SOLUTION: Fermented propionic acid bacteria are fed to a subject to exhibit an anti-obesity action.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to an anti-obesity composition comprising a fermentation product of a propionic acid bacterium. [Background technology]

[0002] In recent years, many people in developed countries, including Japan, have become obese and diabetic as a result of excessive energy intake from excessive eating and high-calorie diets, and these have become major social problems. Obesity can lead to diabetes, dyslipidemia (hyperlipidemia), hyperuricemia (gout), heart and cerebrovascular diseases, fatty liver, menstrual disorders, knee pain, back pain, sleep apnea syndrome, and more. Because obesity is a contributing factor to various diseases, research into its prevention and improvement is being widely conducted.

[0003] It has become clear that the intestinal microbiota is involved in host energy regulation and nutrient absorption, affecting pathologies such as obesity and diabetes (see Non-Patent Document 1). Short-chain fatty acids (SCFAs), the main metabolic products of intestinal bacteria, not only provide energy to the host but also contribute to the regulation of host energy metabolism via receptors expressed in intestinal epithelial cells. SCFAs act on the SCFA receptors GPR41 and GPR43, which are primarily expressed in the colon, and are known to enhance the production of the appetite-suppressing hormone PYY (peptide YY) and GLP-1 (glucagon-like peptide 1), which improves insulin sensitivity. In addition, they are known to increase host energy expenditure and suppress adipocyte hypertrophy (see Non-Patent Document 2). Among the SCFAs that act on the host, propionic acid is known to act on both GPR41 and GPR43 (see Non-Patent Document 3).

[0004] However, even if propionic acid is taken orally, most of it is absorbed in the small intestine (see Non-Patent Document 4), making it difficult for it to act on the SCFA receptors expressed in colonic epithelial cells. Furthermore, there is still a need for methods that can be easily taken as food or beverages and that can safely improve obesity, etc. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Ikuo Kimura Experimental Medicine Vol.32 No.5 (Special Edition) 2014 [Non-patent document 2] Junki Miyamoto et al. The Lipid Vol.27 No.2 2016-4 [Non-patent document 3] Andrew J.Brown et al, The American society for biochemistry and molecular biology Vol.278 No.13 p11312-11319 2003 [Non-patent document 4] T. Polyviou et al, Aliment Pharmacol Ther 2016; 44:662-672 Summary of the Invention

[0006] The present inventors have found that when a subject ingests a composition containing a fermentation product of a propionic acid bacterium, it has an anti-obesity effect in the subject. The present invention is based on these findings.

[0007] Therefore, the present invention discloses an anti-obesity composition comprising a fermentation product of a propionic acid bacterium.

[0008] According to the present invention, the following inventions are provided. (1) An anti-obesity composition comprising a fermentation product of a propionic acid bacterium. (2) The composition described in (1) for suppressing weight gain. (3) The composition according to (1) or (2), which is for inhibiting fat accumulation. (4) The composition according to any one of (1) to (3), which is used to promote intestinal hormone production. (5) The composition according to (4), wherein the intestinal hormone is PYY. (6) A composition for promoting intestinal propionic acid production, comprising a fermentation product of a propionic acid bacterium. (7) A composition for promoting the increase of Akkermansia in the intestinal tract or feces, comprising a fermentation product of propionic acid bacteria. (8) A composition for preventing hyperglycemia, preventing hyperinsulinemia, promoting the reduction of triglycerides, or promoting the reduction of cholesterol, comprising a fermentation product of a propionic acid bacterium. (9) A composition for preventing and / or treating obesity, hyperlipidemia, or hypercholesterolemia, comprising a fermentation product of a propionic acid bacterium. (10) A composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium. (11) The composition according to (10), which is for preventing hyperglycemia. (12) The composition according to (10) or (11), which is for promoting intestinal hormone production. (13) The composition according to (12), wherein the intestinal hormone is GLP-1. (14) The composition according to any one of (1) to (13), wherein the propionic acid bacterium is Propionibacterium freudenreichii. (15) The composition according to any one of (1) to (13), wherein the propionic acid bacterium is Propionibacterium freudenreichii ET-3 strain. (16) The composition according to any one of (1) to (15), wherein the fermented product is a whey fermented product. (17) The composition according to any one of (1) to (16), which is a food composition or a pharmaceutical composition. (18) A method for preventing and / or treating obesity, comprising having a subject ingest an effective amount of a fermentation product of a propionic acid bacterium.

[0009] Ingestion of the composition of the present invention by a subject is advantageous in that it has an anti-obesity effect in the subject. [Brief explanation of the drawings]

[0010] [Figure 1] Figure 1 shows the changes in body weight (g) over a 6-week intake period (7 to 13 weeks of age) for mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet. "**" indicates a significant difference (P<0.05) between the mice fed the high-fat diet containing propionic acid bacteria fermentation product and the mice fed the control high-fat diet, and "*" indicates a significant trend (P<0.1) between the mice fed the high-fat diet containing propionic acid bacteria fermentation product and the mice fed the control high-fat diet. Statistical analysis was performed using a paired t-test. The same applies to Figures 2 to 12 below. [Figure 2] Figure 2 shows the blood glucose levels (mg / dL) of mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 3] Figure 3 shows the weight of peritepidic (epi), perirenal (peri), and subcutaneous (sub) white adipose tissue in mice fed a high-fat diet containing propionic acid bacteria fermentation product and in mice fed a control high-fat diet after 6 weeks of feeding (13 weeks of age). [Figure 4] Figure 4 shows the blood TG (triglyceride) concentration (mg / dL) of mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 5] Figure 5 shows the total cholesterol concentration (pg / dL) in the blood of mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 6]Figure 6 shows the blood insulin concentration (mg / dL) of mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 7] FIG. 7 shows blood GLP-1 (pM) levels in mice fed a high-fat diet containing a propionic acid bacteria fermentation product and in mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 8] FIG. 8 shows blood PYY (ng / mL) levels in mice fed a high-fat diet containing a propionic acid bacteria fermentation product and in mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 9] FIG. 9 shows the amount of propionic acid (mM) in the cecum of mice fed a high-fat diet containing a propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 10] FIG. 10 shows the amount of propionic acid (mM) in the plasma of mice fed a high-fat diet containing a propionic acid bacteria fermentation product and mice fed a control high-fat diet after 6 weeks of feeding (at 13 weeks of age). [Figure 11] Figure 11 shows the number of Akkermansia bacteria (1 × 10 copies / ng DNA) in the cecum of mice fed a high-fat diet containing propionic acid bacteria fermentation product and mice fed a control high-fat diet 6 weeks after feeding (at 13 weeks of age). [Figure 12] Figure 12 shows the number of Akkermansia bacteria (1 × 10 copies / ng DNA) in the feces of mice that had been fed a high-fat diet containing propionic acid bacteria fermentation product and mice that had been fed a control high-fat diet 6 weeks after feeding (at 13 weeks of age). Specific Description of the Invention

[0011] [Deposit of microorganisms] The Propionibacterium freudenreichii ET-3 strain was deposited on August 9, 2001, at the National Institute of Advanced Industrial Science and Technology (AIST, Tsukuba City, Ibaraki Prefecture, Japan) and subsequently transferred to international deposition, where it was assigned the accession number FERM BP-8115. As stated in Budapest Notification No. 282 (http: / / www.wipo.int / treaties / en / notifications / budapest / treaty_budapest_282.html), the National Institute of Technology and Evaluation (IPOD, NITE) took over the patent microorganism deposit business from the National Institute of Advanced Industrial Science and Technology (AIST, IPOD), and the Propionibacterium freudenreichii ET-3 strain is currently deposited at the National Institute of Advanced Industrial Science and Technology (AIST, IPOD). It has been deposited at the National Institute of Technology and Evaluation (IPOD, NITE) (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) under accession number FERM BP-8115.

[0012] The composition of the present invention comprises a fermentation product of a propionic acid bacterium and may contain the fermentation product of a propionic acid bacterium as an active ingredient. The fermentation product of a propionic acid bacterium used in the present invention is a fermentation product obtained by culturing a propionic acid bacterium. Nutrient sources for the medium used in the culturing step include dairy products, yeast extract, soybean extract, and enzyme-treated products thereof. The fermentation product of a propionic acid bacterium contained in the composition of the present invention may contain 1,4-dihydroxy-2-naphthoic acid (DHNA). A culture medium containing a dairy product treated with a proteolytic enzyme is preferred. A medium containing a carbon source is preferred, and the carbon source in the present invention refers to a carbon source that can be assimilated by propionic acid bacteria. Examples of carbon sources that can be assimilated by propionic acid bacteria include lactose, glucose, lactic acid, glycerol, gluten, and cellulose, with lactose being particularly preferred. The carbon source content in the medium before the start of culturing is preferably 4 to 12% by mass, more preferably 4 to 9% by mass, and particularly preferably 4 to 8.5% by mass. Among these, media containing lactose as a carbon source include whey powder, casein, skim milk powder, whey protein concentrates obtained by dialyzing whey to reduce the lactose content, and whey protein isolates obtained by further isolating the lactose content to a higher degree. These can be used as is or after protease treatment. The media can be prepared by adding yeast extract, peptones such as trypticase, appropriate amounts of monosaccharides and / or disaccharides that can serve as carbon sources assimilated by propionic acid bacteria, such as glucose, lactose, and lactase-treated lactose, minerals such as lactic acid, glycerol, gluten, cellulose, and whey minerals, and, if necessary, mineral-rich animal or plant foods or extracts thereof, such as oysters and ginger.

[0013] Dairy products that can be used as a nutrient source for the culture medium include raw milk, concentrated milk, whole milk powder, skim milk, skim milk powder, milk protein (MPC (milk protein concentrate)), casein, whey, concentrated whey, whey protein concentrate (WPC), whey protein isolate (WPI), and whey powder, with whey, concentrated whey, and whey protein concentrate being preferred. In the present invention, a fermentation product of propionic acid bacteria using a protease-treated product of whey, concentrated whey, or whey protein concentrate as a nutrient source for the culture medium is referred to as a "propionic acid bacteria whey fermentation product."

[0014] Propionic acid bacteria that can be used in the composition of the present invention include the genera Propionibacterium, Acidipropionibacterium, Propionicimonas, Propioniferax, Propionimicrobium, and Propionivibrio, and are not particularly limited, but bacteria belonging to the genus Propionibacterium are preferred. Examples of bacteria of the genus Propionibacterium include propionic acid bacteria such as Propionibacterium freudenreichii, Propionibacterium thoenii, Propionibacterium jensenii, Propionibacterium avidum, Propionibacterium acnes, Propionibacterium lymphophilum, and Propionibacterium granulosam. Among these, Propionibacterium freudenreichii is more preferred, Propionibacterium freudenreichii IFO12424, Propionibacterium freudenreichii ATCC6207, and Propionibacterium freudenreichii ET-3 strain (FERM BP-8115) are more preferred, and Propionibacterium freudenreichii ET-3 strain (FERM BP-8115) is particularly preferred.

[0015] The fermentation product of propionic acid bacteria can be produced, for example, as follows. The pre-cultured propionic acid bacteria-containing culture solution is inoculated into the culture solution (1-3 L) and then the main culture is carried out. During incubation at 30-40°C, anaerobic incubation is carried out for 50-160 hours with the culture medium sparged with nitrogen gas at 0.1-25 L / min and an agitation speed of 5-50 Hz. After incubation for 1-2 days after inoculation of the propionic acid bacteria, carbohydrates, which are optional components of the medium, may be continuously added at 0.5-20 mL / hr. Furthermore, it is preferable to carry out aerobic culturing following the anaerobic culturing. In this case, nitrogen gas may be replaced with oxygen gas and the culture may be aerated in the same manner, and the aerobic culturing may be carried out for 110 to 130 hours, but this is not essential. By culturing the propionic acid bacteria in this manner, a culture solution of the propionic acid bacteria is obtained, and if necessary, an antioxidant such as ascorbic acid can be added to the culture solution, which can then be used as a propionic acid bacteria fermentation product.

[0016] The propionic acid bacteria fermentation product contained in the composition of the present invention is obtained by culturing propionic acid bacteria, and includes both propionic acid bacteria and cultures. The obtained propionic acid bacteria fermentation product may be used as is, or may be appropriately concentrated, diluted, dried, or the like. Furthermore, the propionic acid bacteria contained in the propionic acid bacteria fermentation product may be either live or dead.

[0017] The fermentation product of propionic acid bacteria can also be produced according to known production methods described in WO 2003 / 016544, WO 2005 / 099725, WO 2009 / 107380, WO 2012 / 132913, etc. Alternatively, commercially available products containing the fermentation product of propionic acid bacteria (e.g., BGSPOWDER, manufactured by Meiji Corporation) may be used.

[0018] The composition of the present invention can be used as a fermentation product of a propionic acid bacterium alone or in a mixture with other components. The content of the fermentation product of a propionic acid bacterium in the composition of the present invention (converted to solid content) is not particularly limited as long as the effects of the present invention are exhibited, but can be 1 to 100% by mass, preferably 5 to 95% by mass, more preferably 10 to 90% by mass, even more preferably 10 to 50% by mass, and particularly preferably 10 to 40% by mass.

[0019] According to a preferred embodiment of the composition of the present invention, the fermentation product of a propionic acid bacterium is a whey fermentation product of a propionic acid bacterium. The meaning of the whey fermentation product of a propionic acid bacterium is as described above.

[0020] According to one embodiment of the composition of the present invention, there is provided an anti-obesity composition comprising a fermentation product of a propionic acid bacterium. Here, "anti-obesity" means suppressing weight gain or reducing weight, etc. The anti-obesity composition of the present invention may be an anti-obesity agent, and this anti-obesity agent may comprise a fermentation product of a propionic acid bacterium.

[0021] A preferred embodiment of the composition of the present invention provides an anti-obesity composition for suppressing weight gain, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be an anti-obesity agent used for suppressing weight gain, and the anti-obesity agent used for suppressing weight gain may comprise the fermentation product of a propionic acid bacterium.

[0022] According to another preferred embodiment of the composition of the present invention, there is provided an anti-obesity composition for suppressing fat accumulation, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be an anti-obesity agent used for suppressing fat accumulation, and the anti-obesity agent used for suppressing fat accumulation may comprise the fermentation product of a propionic acid bacterium.

[0023] Another preferred embodiment of the composition of the present invention provides an anti-obesity composition for promoting gut hormone production, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be an anti-obesity agent used to promote gut hormone production, and the anti-obesity agent used to promote gut hormone production may comprise the fermentation product of a propionic acid bacterium. The gut hormone is not particularly limited, but examples include cholecystokinin (CCK), gastric inhibitory peptide (GIP), PYY, and GLP-1, with PYY being preferred.

[0024] According to another aspect of the composition of the present invention, there is provided a composition for promoting intestinal propionic acid production, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be an intestinal propionic acid production promoter, and this intestinal propionic acid production promoter may consist of a fermentation product of a propionic acid bacterium.

[0025] Another aspect of the composition of the present invention provides a composition for promoting the increase of Akkermansia (preferably Akkermansia muciniphila) in the intestinal tract (preferably in the cecum) or feces, comprising a fermentation product of a propionic acid bacterium. The composition for promoting the increase of Akkermansia of the present invention may be an agent for promoting the increase of Akkermansia in the intestinal tract or feces, and this agent may consist of a fermentation product of a propionic acid bacterium.

[0026] Another aspect of the composition of the present invention provides a composition for preventing hyperglycemia, preventing hyperinsulinemia, suppressing elevated blood glucose levels, suppressing elevated insulin levels, promoting triglyceride reduction, or promoting cholesterol reduction, comprising a fermentation product of a propionic acid bacterium. Here, "triglyceride" refers to a simple lipid formed by the combination of glycerin and a fatty acid, preferably a triglyceride. The composition of the present invention may be a hyperglycemia preventive agent, a hyperinsulinemia preventive agent, a blood glucose level increase suppressive agent, an insulin increase suppressive agent, a triglyceride reduction promoter, or a cholesterol reduction promoter, and these agents may be comprised of a fermentation product of a propionic acid bacterium. Furthermore, the composition for preventing hyperglycemia and the composition for preventing hyperinsulinemia can also be used as a composition for treating hyperglycemia and hyperinsulinemia, respectively.

[0027] Another aspect of the composition of the present invention provides a composition for preventing and / or treating obesity, hyperlipidemia, or hypercholesterolemia, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be an agent for preventing and / or treating obesity, hyperlipidemia, or hypercholesterolemia, and these agents may consist of a fermentation product of a propionic acid bacterium.

[0028] Another embodiment of the composition of the present invention provides a composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium. The composition of the present invention may be a prophylactic and / or therapeutic agent for diabetes, and this agent may consist of a fermentation product of a propionic acid bacterium. A preferred embodiment of the composition of the present invention is a composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium, for preventing hyperglycemia. A more preferred embodiment of the composition of the present invention is a composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium, for promoting intestinal hormone production. A further preferred embodiment of the composition of the present invention is a composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium, for promoting GLP-1 production.

[0029] Because propionic acid bacteria fermentation products have excellent anti-obesity effects, they can be provided by being incorporated into foods consumed daily or as supplements. That is, a preferred embodiment of the composition of the present invention provides a food composition comprising a propionic acid bacteria fermentation product. The food composition of the present invention may be used for anti-obesity, promoting intestinal propionic acid production, promoting the increase of Akkermansia in the intestinal tract or feces, preventing hyperglycemia, preventing hyperinsulinemia, suppressing elevated blood glucose levels, suppressing elevated insulin levels, promoting the reduction of triglycerides, promoting the reduction of cholesterol, or preventing and / or treating obesity, diabetes, hyperlipidemia, or hypercholesterolemia. This food composition can be produced according to standard production procedures for such foods, except for the inclusion of a propionic acid bacteria fermentation product. Here, the food containing the fermentation product of propionic acid bacteria may be in any form as long as it can contain the fermentation product of propionic acid bacteria, and is not particularly limited as long as it is in an orally ingestible form, such as a solution, suspension, emulsion, powder, paste, semi-solid formed product, or solid formed product. Examples of such food include instant foods such as instant noodles, retort foods, canned foods, microwave foods, instant soups, miso soups, and freeze-dried foods; beverages such as soft drinks, fruit juice drinks, vegetable drinks, soy milk drinks, coffee drinks, tea drinks, powdered drinks, concentrated drinks, and alcoholic beverages; wheat flour products such as bread, pasta, noodles, cake mix, and breadcrumbs; candy, caramel, cheese, and the like. Confectioneries such as chewing gum, chocolate, cookies, biscuits, bars, cakes, pies, snacks, crackers, Japanese sweets, mousse, and desserts; condiments such as sauces, processed tomato seasonings, flavor seasonings, cooking mixes, sauces, dressings, soups, and curry and stew bases; processed oils and fats such as butter, margarine, and mayonnaise; dairy products such as milk drinks, fermented milk, yogurt, lactic acid bacteria drinks, dairy drinks, cheeses, ice cream, cream, infant formula, liquid milk, and solid milk; processed agricultural products such as canned agricultural products, jams, marmalades, and cereals; frozen foods and liquid diets.

[0030] When the propionic acid bacterium fermentation product of the present invention is provided as a food composition, it can be prepared by adding the propionic acid bacterium fermentation product directly to a food, and the food composition is a food containing an effective amount of the propionic acid bacterium fermentation product. Here, "containing an effective amount" of the propionic acid bacterium fermentation product refers to a content such that the propionic acid bacterium fermentation product is ingested in a predetermined range when the amount normally consumed for that particular food is ingested. Note that the scope of the present invention also includes embodiments in which the propionic acid bacterium fermentation product of the present invention itself or a composition containing it is added to a food (e.g., a beverage or yogurt) by the consumer to form a food composition.

[0031] Another preferred embodiment of the composition of the present invention provides a pharmaceutical composition comprising a fermentation product of a propionic acid bacterium. The pharmaceutical composition of the present invention may be used for anti-obesity, promoting intestinal propionic acid production, promoting the increase of Akkermansia in the intestinal tract or feces, preventing hyperglycemia, preventing hyperinsulinemia, suppressing elevated blood glucose levels, suppressing elevated insulin levels, promoting triglyceride reduction, promoting cholesterol reduction, or preventing and / or treating obesity, diabetes, hyperlipidemia, or hypercholesterolemia. Here, the pharmaceutical composition is prepared as an oral or parenteral formulation according to standard methods using additives acceptable for formulation. When the pharmaceutical composition is an oral formulation, it can take the form of a solid formulation such as a tablet, powder, fine granules, granules, capsules, pills, or sustained-release formulation, or a liquid formulation such as a solution, suspension, or emulsion. When the pharmaceutical composition is a parenteral formulation, it can take the form of an injection or suppository. From the viewpoint of ease of ingestion (administration) to patients, oral formulations are preferred for pharmaceutical compositions. Examples of additives acceptable for formulation include excipients, stabilizers, preservatives, wetting agents, emulsifiers, lubricants, sweeteners, colorants, flavorings, buffers, antioxidants, pH adjusters, etc.

[0032] When the composition of the present invention is provided as a composition containing a single dose of propionic acid bacteria fermentation product, it is preferable to provide the composition in a unit package form so that a single effective dose can be taken. When provided in a packaged form, it is preferable that the package has instructions regarding the amount to be taken so that a single effective dose can be taken, or that a document with such instructions is provided together with the composition. Furthermore, the composition of the present invention can exert a stronger anti-obesity effect when taken continuously. For example, when a daily effective dose is provided in multiple packages, multiple packages containing a daily effective dose can be provided as a set for convenience of intake.

[0033] The packaging form for providing the composition of the present invention is not particularly limited as long as it is a form that specifies a certain amount, and examples include containers that can accommodate the composition, such as wrapping paper, wrapping sheets, bags, soft bags, paper containers, cans, bottles, capsules, and plastic cases.

[0034] The composition of the present invention can be ingested by the consumer, who can determine the amount of intake according to their own preference. Therefore, the composition of the present invention can be provided in a form that allows the consumer to adjust the amount of intake according to their preference, i.e., a form suitable for multiple intake, such as a tablet, powder, gum, gummy candy, or candy. Furthermore, packaging suitable for multiple intake can be provided in a plastic case, can, bottle, wrapping paper, or the like.

[0035] To maximize the effectiveness of the composition of the present invention, it is preferable to take it continuously for 3 days or more, more preferably for 1 week or more, and the administration and intake period is more preferably 1 to 10 weeks, particularly preferably 1 to 6 weeks, and even more preferably 2 to 6 weeks. Here, "continuously" means to take a set amount every day. When the composition of the present invention is provided in a packaged form, it may be provided as a set containing an effective intake amount for a certain period (e.g., 1 week) for continuous intake.

[0036] Another aspect of the present invention provides a method for treating and / or preventing obesity, comprising having a subject ingest an effective amount of a fermentation product of a propionic acid bacterium. Here, the subject may be a non-human animal (such as a livestock animal like a horse or a cow, a pet animal like a dog or a cat, or an ornamental animal kept in a zoo), but is preferably a human. Furthermore, the subject to which an effective amount of the fermentation product of the propionic acid bacterium of the present invention is ingested is preferably a subject in need of suppressing weight gain or a subject in need of weight loss. Another preferred aspect of the present invention provides a method for preventing and / or treating obesity (excluding medical procedures for humans) comprising having a subject ingest an effective amount of the fermentation product of the propionic acid bacterium of the present invention. This refers to the act of having a subject ingest (administer) a pharmaceutical product as prescribed by a physician or other professional.

[0037] A preferred embodiment of the present invention provides a method for inhibiting weight gain, comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject. Another preferred embodiment of the present invention provides a method for inhibiting weight gain (excluding medical procedures for humans), comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject.

[0038] A preferred embodiment of the present invention provides a method for inhibiting fat accumulation, comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject. Another preferred embodiment of the present invention provides a method for inhibiting fat accumulation (excluding medical procedures for humans), comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject.

[0039] A preferred embodiment of the present invention provides a method for promoting intestinal hormone production, comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject. Another preferred embodiment of the present invention provides a method for promoting intestinal hormone production (excluding medical procedures for humans), comprising ingesting an effective amount of a fermentation product of the propionic acid bacterium of the present invention to a subject. The intestinal hormone is preferably PYY and / or GLP-1.

[0040] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for anti-obesity.

[0041] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for suppressing weight gain.

[0042] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for inhibiting fat accumulation.

[0043] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for promoting intestinal hormone production.

[0044] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for promoting propionic acid production in the intestine.

[0045] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for promoting the increase of Akkermansia in the intestinal tract (preferably in the cecum) or in feces.

[0046] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the manufacture of an anti-obesity composition.

[0047] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the manufacture of a composition for inhibiting weight gain.

[0048] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the production of a composition for inhibiting fat accumulation.

[0049] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the manufacture of a composition for promoting intestinal hormone production.

[0050] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the manufacture of a composition for promoting propionic acid production in the intestine.

[0051] According to another aspect of the present invention, there is provided use of a fermentation product of a propionic acid bacterium for the manufacture of a composition for promoting the increase of Akkermansia in the intestinal tract (preferably in the cecum) or in feces.

[0052] The fermentation product of a propionic acid bacterium used in the method for treating and / or preventing obesity of the present invention may be the same as the fermentation product of a propionic acid bacterium contained in the composition of the present invention described above. [Example]

[0053] The present invention will be specifically described based on the following examples, but the present invention is not limited to these examples.

[0054] Example 1: Confirmation of the anti-obesity effect of propionic acid bacteria fermentation products (1) Method for preparing whey fermentation product of propionic acid bacteria Propionibacterium freudenreichii ET-3 strain (FERM BP-8115) was activated and pre-cultured at 35°C under anaerobic conditions for 48 hours, and then cultured in whey-containing medium for an additional 96 hours at 35°C under anaerobic conditions. The culture was freeze-dried to obtain a freeze-dried powder after adding an excipient (oxidized starch (Stabilose S10)). This freeze-dried powder was used below as a propionic acid bacteria fermentation product (hereinafter also referred to as "fermentation product"). This propionic acid bacteria fermentation product contains at least DHNA as a characteristic component.

[0055] (2) Test method Seven-week-old male C57BL / 6J mice were divided into two groups (n=6) and fed a control diet (containing the culture medium material for Propionibacterium freudenreichii ET-3), a high-fat diet (D12492 (Research Diet)), or a high-fat diet containing propionic acid bacteria fermentation product for six weeks. Body weight changes were recorded during the six-week period. The high-fat diet contained 30% propionic acid bacteria fermentation product. After the challenge (at 13 weeks of age), mice were dissected under isoflurane anesthesia, and various tissue weights and metabolic parameters were measured.

[0056] (3) Test results It was found that weight gain caused by a high-fat diet was significantly suppressed in mice that consumed a high-fat diet containing propionic acid bacteria fermentation products compared to mice that consumed a control high-fat diet (see Figure 1).

[0057] Blood glucose levels were significantly lower in the propionic acid bacteria fermentation product high-fat diet group than in the control high-fat diet group (see Figure 2).

[0058] The increase in peritexillary (epi), perirenal (peri), and subcutaneous (sub) white adipose tissue weight was significantly suppressed in the propionic acid bacteria fermentation product high-fat diet group compared to the control high-fat diet group (see Figure 3).

[0059] Blood biochemistry tests were performed for the following test items: TG (triglyceride), total cholesterol, insulin, GLP-1, and PYY (see Figures 4 to 9).

[0060] TG (triglycerides) and insulin were significantly lower in the propionic acid bacteria fermentation product high-fat diet group than in the control high-fat diet group (see Figures 4 and 6). Total cholesterol tended to be lower (see Figure 5).

[0061] The intestinal hormones GLP-1 and PYY tended to be higher in the propionic acid bacteria fermentation product high-fat diet group than in the control high-fat diet group (see Figures 7 and 8).

[0062] Propionic acid levels in the cecum and plasma were quantified, and the results showed that levels were significantly higher in both the cecum and plasma in the propionic acid bacteria fermentation product high-fat diet group than in the control high-fat diet group (see Figures 9 and 10).

[0063] Furthermore, quantitative PCR (Quantitative Polymerase Chain Reaction, qPCR) was used to analyze the intestinal bacterial flora in the cecal contents and feces. The results showed that the number of Akkermansia muciniphila bacteria, which is thought to be involved in anti-obesity, was significantly higher in the cecum and feces of the propionic acid bacteria fermentation product high-fat diet group than in the control high-fat diet group (see Figures 11 and 12).

[0064] The specific measurement and analysis conditions for blood glucose levels, tissue weights, blood biochemistry tests, and qPCR are as follows.

[0065] Blood glucose levels in plasma were measured using a portable blood glucose meter (One Touch Ultra, manufactured by LifeScan).

[0066] Tissue weights were collected and weighed at the time of dissection.

[0067] Plasma TG (triglyceride) and total cholesterol were measured using LabAssay™ (Fujifilm Wako Pure Chemical Industries, Ltd.).

[0068] Insulin was measured by ELISA (Revis (registered trademark) Insulin-Mouse RTU, manufactured by Fujifilm Wako Shibayagi Co., Ltd.).

[0069] Plasma GLP-1 levels were measured by enzyme-linked immunosorbent assay (Levis GLP-1 (Active), Fujifilm Wako Shibayagi Co., Ltd.) after preventing the degradation of active GLP-1 with a dipeptidyl peptidase IV (DPP-IV) inhibitor (Merck Millipore).

[0070] Plasma PYY was measured using a Mouse / Rat PYY ELISA Kit Wako (Fujifilm Wako Pure Chemical Industries, Ltd.).

[0071] The number of Akkermansia muciniphila bacteria in the cecal contents and feces was measured using qPCR with DNA extracted from the cecal contents or feces as a template, under the following conditions: 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds, 58°C for 30 seconds, and 72°C for 1 minute, followed by 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 15 seconds. The sequences of the primers used are as follows: Forward primer: CAGCACGTGAAGGTGGGGAC (SEQ ID NO: 1) Reverse primer: CCTTGCGGTTGGCTTCAGAT (SEQ ID NO: 2) [Accession number]

[0072] FERM BP-8115

Claims

1. An anti-obesity composition comprising a fermentation product of a propionic acid bacterium.

2. The composition according to claim 1, which is for suppressing weight gain.

3. The composition according to claim 1 or 2, which is for inhibiting fat accumulation.

4. The composition according to any one of claims 1 to 3, which is for promoting intestinal hormone production.

5. 5. The composition of claim 4, wherein the gut hormone is PYY.

6. A composition for promoting intestinal propionic acid production, comprising a fermentation product of a propionic acid bacterium.

7. A composition for promoting the growth of Akkermansia in the intestinal tract or feces, comprising a fermentation product of propionic acid bacteria.

8. A composition for preventing hyperglycemia, preventing hyperinsulinemia, promoting the reduction of neutral fats, or promoting the reduction of cholesterol, comprising a fermentation product of a propionic acid bacterium.

9. A composition for preventing and / or treating obesity, hyperlipidemia, or hypercholesterolemia, comprising a fermentation product of a propionic acid bacterium.

10. A composition for preventing and / or treating diabetes, comprising a fermentation product of a propionic acid bacterium.

11. The composition according to claim 10, which is for preventing hyperglycemia.

12. The composition according to claim 10 or 11, which is for promoting intestinal hormone production.

13. The composition of claim 12, wherein the intestinal hormone is GLP-1.

14. The composition according to any one of claims 1 to 13, wherein the propionic acid bacterium is Propionibacterium freudenreichii.

15. The composition according to any one of claims 1 to 13, wherein the propionic acid bacterium is Propionibacterium freudenreichii ET-3 strain.

16. The composition according to any one of claims 1 to 15, wherein the fermentate is a whey fermentate.

17. The composition according to any one of claims 1 to 16, which is a food composition or a pharmaceutical composition.

18. A method for preventing and / or treating obesity, comprising having a subject ingest an effective amount of a fermentation product of a propionic acid bacterium.

Images