Exon-skipping oligomer conjugates for muscular dystrophy
By designing specific antisense oligonucleotide conjugates to bind to exon 45 of the dystrophin protein gene, exon skipping was achieved, restoring the reading frame of the dystrophin protein. This solves the problem of difficulty in upregulating the production of functional proteins in existing technologies and provides a treatment option for DMD and BMD.
Patent Information
- Application Number
- JP2025134907
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2017-09-22
- Filing Date
- 2025-08-13
- Publication Date
- 2025-11-05
AI Technical Summary
Existing technologies have difficulty effectively upregulating the production of dystrophic proteins using antisense oligonucleotides, especially for the expression of defective proteins in Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) caused by misreading frames or frameless mutations.
An antisense oligonucleotide conjugate was developed, comprising an antisense oligonucleotide that binds to a specific exon 45 of the dystrophin protein gene and a penetrating peptide, which repairs reading frames by mediating exon skipping and restores functional protein production.
By using exon skipping technology, the reading frames of dystrophic proteins were restored, the production of functional proteins was improved, and therapeutic potential for DMD and BMD was provided.
Smart Images

Figure 2025166161000122 
Figure 2025166161000123 
Figure 2025166161000124
Abstract
Description
[Technical Field]
[0001] (Related information) This patent application claims the benefit of U.S. Provisional Patent Application No. 62 / 436,199, filed December 19, 2016, U.S. Provisional Patent Application No. 62 / 443,481, filed January 6, 2017, U.S. Provisional Patent Application No. 62 / 479,177, filed March 30, 2017, and U.S. Provisional Patent Application No. 62 / 562,119, filed September 22, 2017. The entire contents of the above-referenced provisional patent applications are incorporated herein by reference.
[0002] FIELD OF THE DISCLOSURE The present disclosure relates to novel antisense oligomer conjugates and pharmaceutical compositions thereof suitable for skipping exon 45 of the human dystrophin gene. The present disclosure also provides methods for inducing exon 45 skipping using the novel antisense oligomer conjugates, methods for producing dystrophin in subjects with a dystrophin gene mutation that allows exon 45 skipping, and methods for treating subjects with a dystrophin gene mutation that allows exon 45 skipping. [Background technology]
[0003] Antisense technology has been developed using a range of chemistries that affect gene expression at various levels (transcription, splicing, stability, and translation). Much of this research has focused on the use of antisense compounds to correct or compensate for abnormal or disease-related genes for a wide variety of indications. Antisense molecules can specifically inhibit gene expression, and for this reason, much of the research effort on oligomers as modulators of gene expression has focused on inhibiting target gene expression or the function of cis-acting elements. Antisense oligomers are typically directed against the sense strand (e.g., mRNA) or, in the case of some viral RNA targets, the minus strand of RNA. To achieve the desired effect of downregulating a specific gene, oligomers generally promote the decay of the target mRNA, block translation of the mRNA, or block the function of cis-acting RNA elements, thereby effectively interfering with de novo synthesis of the target protein or viral RNA replication.
[0004] However, such techniques are not effective when the goal is to upregulate the production of a native protein or to compensate for mutations such as nonsense or frameshift mutations that induce premature translation termination. In such cases, the transcript of the defective gene must not be subject to targeted degradation or steric inhibition, and therefore the chemistry of the antisense oligomer must not promote the decay of the target mRNA or promote translational block.
[0005] In various genetic disorders, the effect of mutations on final gene expression can be modulated through the process of targeted exon skipping during splicing. The splicing process is directed by a complex, multi-component mechanism that brings adjacent exon-intron junctions of pre-mRNA into close proximity, cleaves phosphodiester bonds at the ends of introns, and then rearranges the exons that are spliced together. This complex and precise process is mediated by relatively short sequence motifs—quasi-conserved RNA segments within pre-mRNA that are subsequently bound by various nuclear splicing factors involved in the splicing reaction. Altering how the splicing machinery reads or recognizes motifs involved in pre-mRNA processing can produce differentially spliced mRNA molecules. While it has been recognized that the majority of human genes are alternatively spliced during normal gene expression, the mechanisms involved remain unclear. Bennett et al. (U.S. Patent No. 6,210,892) describe the antisense modulation of wild-type intracellular mRNA processing using antisense oligomer analogs that do not induce RNAse H-mediated cleavage of the target RNA. This is useful in that it allows for the generation of mRNAs that undergo alternative splicing and lack specific exons (see, for example, the generation of soluble TNF superfamily receptors lacking exons encoding transmembrane domains, as described by Sazani, Kole et al., 2007).
[0006] When a normally functioning protein is terminated by a mutation, antisense technology can be used to restore the production of some functional protein by interfering with the splicing process. It has also been shown that specific deletion of a pathogenic exon from some genes can produce a shortened protein that has the same biological properties as the native protein or sufficient biological activity to ameliorate the disease caused by the mutation in the exon (see, e.g., Sierakowska, Sambade et al., 1996; Wilton, Lloyd et al., 1999; van Deutekom, Bremmer-Bout et al., 2001; Lu, Mann et al., 2003; Aartsma-Rus, Janson et al., 2004). Kole et al. (U.S. Patent No. 5,627,274; U.S. Patent No. 5,916,808; U.S. Patent No. 5,976,879; and U.S. Patent No. 5,665,593) disclose a method for preventing abnormal splicing using modified antisense oligomer analogs that do not promote the decay of target pre-mRNA.Bennett et al. (U.S. Patent No. 6,210,892) also describes the antisense regulation of wild-type intracellular mRNA processing using antisense oligomer analogs that do not induce RNAse H-mediated cleavage of target RNA.
[0007] The process of targeted exon skipping appears to be particularly useful for long genes with many exons and introns, redundant exon organization, or where the protein can function without one or more specific exons. Previous efforts to redirect gene processing for the treatment of genetic disorders associated with truncation due to mutations in various genes have focused on the use of antisense oligomers that (1) fully or partially overlap with elements involved in the splicing process; or (2) bind to pre-mRNA in sufficient proximity to the elements to inhibit the binding and function of splicing factors that mediate the specific splicing reaction that normally occurs at those elements.
[0008] Duchenne muscular dystrophy (DMD) is caused by defective expression of the protein dystrophin. The gene encoding this protein contains 79 exons scattered across more than 2 million nucleotides of DNA. Exonic mutations characterized by altering the reading frame of an exon, introducing a stop codon, or completely removing an out-of-frame exon(s) or duplication of one or more exons can prevent the production of functional dystrophin and result in DMD.
[0009] Becker muscular dystrophy (BMD), a less severe form of muscular dystrophy, is known to occur when mutations, usually deletions of one or more exons, result in the correct reading frame throughout the dystrophin transcript, preventing premature termination of mRNA translation into protein. If processing of the mutated dystrophin pre-mRNA maintains the correct gene reading frame by joining upstream and downstream exons, the resulting mRNA encodes a protein with a short internal deletion that retains some activity, resulting in the Becker phenotype.
[0010] It has long been known that deletion of one or more exons that does not alter the reading frame of the dystrophin protein results in a BMD-type phenotype, whereas exon deletions that result in a frameshift result in DMD (Monaco, Bertelson et al., 1988). In general, dystrophin mutations, including point mutations and exon deletions that alter the reading frame and thus prevent proper protein translation, result in DMD. It is also noteworthy that a proportion of BMD and DMD patients have exon deletions that span multiple exons.
[0011] Regulation of mutant dystrophin pre-mRNA splicing by antisense oligoribonucleotides has been reported both in vitro and in vivo (e.g., Matsuo, Masumura et al., 1991; Takeshima, Nishio et al., 1995; Pramono, Takeshima et al., 1996; Dunckley, Eperon et al., 1997; Dunckley, Manoharan et al., 1998; Wilton, Lloyd et al., 1999; Mann, Honeyman et al., 2002; Errington, Mann et al., 2003).
[0012] Antisense oligomers have been specifically designed to target specific regions of the pre-mRNA, usually exons, to induce skipping of DMD gene mutations, thereby restoring these out-of-frame mutations to in-frame and allowing the production of a truncated but functional dystrophin protein. These antisense oligomers are known to target either entirely within an exon (so-called exon internal sequences) or splice donor or splice acceptor junctions spanning an exon to a portion of an intron.
[0013] The discovery and development of such antisense oligomers for DMD has been an area of research. Such developments include: (1) The University of Western Australia and Sarepta Therapeutics (the assignee of the present application): WO 2006 / 000057; WO 2010 / 048586; WO 2011 / 057350; WO 2014 / 100714; WO 2014 / 153240; WO 2014 / 153220; (2) Academisch Ziekenhuis Leiden / Prosensa Technologies (now BioMarin) Pharmaceutical Co., Ltd.): WO 02 / 24906; WO 2004 / 083432; WO 2004 / 083446; WO 2006 / 112705; WO 2007 / 133105; WO 2009 / 139630; WO 2009 / 054725; WO 2010 / 050801; WO 2010 / 050802; WO 2010 / 123369; WO 2013 / 112053; WO 2014 / 007620; (3) Carolinas Medical Center: International Publication No. 2012 / 109296; (4) Royal Holloway: Patents and applications claiming the benefit thereof, including U.S. Patent Application Nos. 61 / 096,073 and 61 / 164,978; e.g., U.S. Patent No. 8,084,601 and U.S. Patent Application Publication No. 2017-0204413; (4) JCR Pharmaceuticals, Inc. and Matsuo: U.S. Patent No. 6,653,466; patents and applications claiming the benefit thereof, including Japanese Patent Application Publication No. 2000-125448, such as U.S. Patent No. 6,653,467; patents and applications claiming the benefit thereof, including Japanese Patent Application Publication No. 2000-256547, such as U.S. Patent No. 6,727,355; International Publication No. WO 2004 / 048570; (5) Nippon Shinyaku Co., Ltd.: WO 2012 / 029986; WO 2013 / 100190; WO 2015 / 137409; WO 2015 / 194520; and (6) Association Institut de Myologie / Pierre and Marie Curie University / University of Bern / French National Center for Scientific Research / Synthena AG: WO 2010 / 115993; WO 2013 / 053928.
[0014] The discovery and development of cell-penetrating peptide-conjugated antisense oligomers for DMD has also become an area of research (WO 2010 / 048586; Wu, B. et al., The American Journal of Pathology, Vol. 181(2):392-400, 2012; Wu, R. et al., Nucleic Acids Research, Vol. 35(15):5182-5191, 2007; Mulders, S. et al., 19th International Congress of the World Muscle Society, Poster Presentation Berlin, October 2014; Bestas, B. et al., The Journal of Clinical Investigation,doi:10.1172 / JCI76175,2014;Jearawiriyapaisarn,N.et al.,Molecular Therapy,Vol.16(9):1624-1629,2008;Jearawiriyapaisarn,N.et al.,Cardiovascular Research,Vol.85:444-453,2010;Moulton,HMet al.,Biochemical Society Transactions,Vol.35(4):826-828,2007;Yin,H.et al.,Molecular Therapy,Vol.19(7):1295-1303,2011;Abes,R.et al.,J.Pept.Sci.,Vol.14:455-460,2008;Lebleu,B.et al.,Advanced Drug Delivery Reviews, Vol. 60:517-529, 2008; McClorey, G. et al., Gene Therapy, Vol. 13:1373-1381, 2006; Alter, J. et al., Nature Medicine, Vol. 12(2):175-177, 2006; and Youngblood, D. et al., American Chemical Society, Bioconjugate Chem., 2007, 18(1), pp50-60).
[0015] Cell penetrating peptides (CPPs), such as arginine-rich peptide transport moieties, can be effective in increasing the intracellular penetration of, for example, antisense oligomers conjugated to the CPPs. Despite these efforts, there remains a need for improved antisense oligomers targeting exon 45 and corresponding pharmaceutical compositions that are potentially useful in therapies to produce dystrophin and treat DMD. [Prior art documents] [Patent documents]
[0016] [Patent Document 1] U.S. Patent No. 6,210,892 Summary of the Invention [Means for solving the problem]
[0017] The antisense oligomer conjugates provided herein comprise an antisense oligomer moiety conjugated to a CPP. an antisense oligomer 22 subunits in length capable of binding to a selected target and inducing exon skipping in the human dystrophin gene, the antisense oligomer comprising a sequence of bases complementary to a target region of exon 45 of the dystrophin pre-mRNA, designated the annealing site; and Cell-penetrating peptides (CPPs) conjugated with antisense oligomers via a linker moiety The present invention provides an antisense oligomer conjugate comprising:
[0018] In some embodiments, the annealing site is H45A(-03+19).
[0019] In some embodiments, the bases of the antisense oligomer are linked to morpholino ring structures, and the morpholino ring structures are linked by phosphorous-containing intersubunit bonds that connect the morpholino nitrogen of one ring structure to the 5' exocyclic carbon of an adjacent ring structure. In certain embodiments, the cell-penetrating peptide is 6 arginine units ("R6"), and the linker moiety is glycine. In some embodiments, the antisense oligomer comprises the sequence of bases designated as SEQ ID NO: 1.
[0020] In various aspects, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; T is: [ka] is a moiety selected from; R 1 is C1-C6 alkyl; The targeting sequence is complementary to the exon 45 annealing site of the dystrophin pre-mRNA, designated H45A(-03+19).
[0021] In yet another aspect, the present disclosure provides a compound of formula (IV): [ka] or a pharmaceutically acceptable salt thereof.
[0022] In yet another aspect, the present disclosure provides a compound of formula (IVA): [ka] The present invention provides an antisense oligomer conjugate of the formula:
[0023] In another aspect, the present disclosure provides a pharmaceutical composition comprising an antisense oligomer conjugate of the present disclosure and a pharmaceutically acceptable carrier, hi some embodiments, the pharmaceutically acceptable carrier is saline containing a phosphate buffer.
[0024] In yet another aspect, the present disclosure provides a method of treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping, the method comprising administering to the subject an antisense oligomer conjugate of the present disclosure. The present disclosure also relates to the use of an antisense oligomer conjugate of the present disclosure in the manufacture of a medicament for the treatment of Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping.
[0025] In yet another aspect, the present disclosure provides a method of restoring the mRNA reading frame and inducing dystrophin production in a subject having a mutation in the dystrophin gene that allows for exon 45 skipping, comprising administering to the subject an antisense oligomer conjugate of the present disclosure. In yet another aspect, the present disclosure provides a method of excluding exon 45 from dystrophin pre-mRNA during mRNA processing in a subject having a mutation in the dystrophin gene that allows for exon 45 skipping, comprising administering to the subject an antisense oligomer conjugate of the present disclosure. In yet another aspect, the present disclosure provides a method of binding exon 45 of dystrophin pre-mRNA in a subject having a mutation in the dystrophin gene that allows for exon 45 skipping, comprising administering to the subject an antisense oligomer conjugate of the present disclosure.
[0026] In another aspect, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in therapy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the treatment of Duchenne muscular dystrophy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the manufacture of a medicament for use in therapy. In certain embodiments, the present disclosure provides an antisense oligomer conjugate of the present disclosure for use in the manufacture of a medicament for the treatment of Duchenne muscular dystrophy.
[0027] In yet another aspect, the present disclosure also provides a kit for treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping, the kit comprising at least one antisense oligomer conjugate of the present disclosure packaged in a suitable container and instructions for its use.
[0028] These and other objects and features will be more fully understood from the following detailed description of the present disclosure when read in conjunction with the drawings. In certain embodiments, for example, the following are provided: (Item 1) Formula (I) [ka] an antisense oligomeric conjugate of wherein each Nu is a nucleobase that together form a targeting sequence; T, [ka] is a moiety selected from; R 1 is C1-C6 alkyl, the targeting sequence is complementary to the exon 45 annealing site of the dystrophin pre-mRNA designated H45A(-03+19), An antisense oligomer conjugate or a pharmaceutically acceptable salt thereof. (Item 2) 2. The antisense oligomer conjugate of item 1, wherein each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I). (Item 3) 2. The antisense oligomer conjugate of item 1, wherein the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3'), wherein thymine (T) is optionally uracil (U). (Item 4) T [ka] 2. The antisense oligomer conjugate of item 1, wherein the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3'), wherein thymine (T) is optionally uracil (U). (Item 5) T [ka] 2. The antisense oligomer conjugate of item 1, wherein the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3'). (Item 6) Formula (II) [ka] an antisense oligomeric conjugate of In the formula, each Nu from 1 to 22 and 5' to 3' is (SEQ ID NO: 1): [Table 1] In the table, A is [ka] and C is [ka] and G is [ka] and each X is [ka] or a pharmaceutically acceptable salt thereof. (Item 7) Each X [ka] 7. The antisense oligomer conjugate according to item 6, wherein (Item 8) The antisense oligomer has the formula (IIA) [ka] wherein each Nu from 1 to 22 and 5' to 3' is (SEQ ID NO: 1): [Table 2] In the table, A is [ka] and C is [ka] and G is [ka] and each X is [ka] 7. The antisense oligomer conjugate according to item 6, wherein (Item 9) Each X [ka] 7. The antisense oligomer conjugate according to item 6, wherein (Item 10) Formula (IV) [ka] or a pharmaceutically acceptable salt thereof. (Item 11) The antisense oligomer has the formula (IVA) [ka] 10. The antisense oligomer conjugate according to item 9, wherein (Item 12) 12. A pharmaceutical composition comprising the antisense oligomer conjugate according to any one of items 1 to 11 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. (Item 13) 12. A method of treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping, the method comprising administering to the subject the antisense oligomer conjugate of any one of items 1 to 11. (Item 14) Item 15. The method of item 13, wherein the antisense oligomer conjugate is administered weekly. 14. The method of claim 13, wherein the antisense oligomer conjugate is administered every other week. (Item 16) 14. The method of claim 13, wherein the antisense oligomer conjugate is administered every three weeks. (Item 17) Item 18. The method of Item 13, wherein the antisense oligomer conjugate is administered monthly. 12. A method for inducing dystrophin production by restoring the mRNA reading frame in a subject having a mutation in the dystrophin gene that allows exon 45 skipping, the method comprising administering to the subject the antisense oligomer conjugate of any one of items 1 to 11. (Item 19) Item 20. The method of item 18, wherein the antisense oligomer conjugate is administered weekly. 19. The method of claim 18, wherein the antisense oligomer conjugate is administered every other week. (Item 21) 19. The method of claim 18, wherein the antisense oligomer conjugate is administered every three weeks. (Item 22) Item 23. The method of item 18, wherein the antisense oligomer conjugate is administered monthly. 12. A method for treating Duchenne muscular dystrophy (DMD) in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping, the method comprising administering to the subject the pharmaceutical composition of item 11. (Item 24) 12. A method for restoring the mRNA reading frame and inducing dystrophin production in a subject having a mutation in the dystrophin gene that allows exon 45 skipping, comprising administering to the subject the pharmaceutical composition of item 11. (Item 25) 12. A method for excluding exon 45 from dystrophin pre-mRNA during mRNA processing in a subject having a mutation in the dystrophin gene that allows exon 45 skipping, comprising administering to the subject the pharmaceutical composition of item 11. (Item 26) 12. A method for linking exon 45 of dystrophin pre-mRNA in a subject having a mutation in the dystrophin gene that allows exon 45 skipping, the method comprising administering to the subject the pharmaceutical composition of item 11. [Brief explanation of the drawings]
[0029] [Figure 1] Figure 1 shows sections of normal dystrophin pre-mRNA and mature mRNA. [Figure 2] FIG. 2 shows a section of an abnormal dystrophin pre-mRNA (an example of DMD) and the resulting non-functional, unstable dystrophin. [Figure 3] Figure 3 shows Eteplirsen, which is designed to skip exon 51 and restore "in-frame" reading of the pre-mRNA, producing dystrophin with an internal deletion. [Figure 4-1] Figures 4A-4D show representative images of Western blot analysis measuring dystrophin protein in the quadriceps muscles of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at various time points [7 days (5A), 30 days (5B), 60 days (5C), and 90 days (5D)]. [Figure 4-2] Same as above. [Figure 5] Figure 5A is a line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the quadriceps muscles of mdx mice over a 90-day post-injection period, as determined by Western blot analysis. Figure 5B is a line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the quadriceps muscles of mdx mice over a 90-day post-injection period, as determined by RT-PCR. [Figure 6-1] Figures 6A-6D show representative images of Western blot analysis measuring dystrophin protein in the diaphragm of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at various time points [7 days (7A), 30 days (7B), 60 days (7C), and 90 days (7D)]. [Figure 6-2] Same as above. [Figure 7]Figure 7A is a line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the diaphragm of mdx mice over a 90-day period after injection, as determined by Western blot analysis. Figure 7B is a line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the diaphragm of mdx mice over a 90-day period after injection, as determined by RT-PCR. [Figure 8-1] Figures 8A-8D show representative images of Western blot analysis measuring cardiac dystrophin protein from mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at various time points [7 days (9A), 30 days (9B), 60 days (9C), and 90 days (9D)]. [Figure 8-2] Same as above. [Figure 9] Figure 9A is a line graph showing the percentage of wild-type dystrophin induced by PMO (PMO4225) or PPMO (PPMO4225) in the hearts of mdx mice over a 90-day period after injection, as determined by Western blot analysis. Figure 9B is a line graph showing the percentage of exon 23 skipping induced by PMO (PMO4225) or PPMO (PPMO4225) in the hearts of mdx mice over a 90-day period after injection, as determined by RT-PCR. [Figure 10] FIG. 10 shows immunohistochemical analysis showing dystrophin induced in the left quadriceps muscle of mdx mice by PMO (PMO4225) or PPMO (PPMO4225). [Figure 11] Figures 11A-11B are representative images of Western blot analysis measuring dystrophin protein in the hearts of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at various doses, i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 12]FIG. 12 is a bar graph showing the percentage of wild-type dystrophin induced in the hearts of mdx mice by PMO (PMO4225) or PPMO (PPMO4225) at various doses, i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg, as determined by Western blot analysis 30 days after injection. [Figure 13] Figures 13A-B are representative images of Western blot analysis measuring dystrophin protein in the diaphragm of mdx mice treated with PMO (PMO4225) or PPMO (PPMO4225) at various doses, i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 14] FIG. 14 is a bar graph showing the percentage of wild-type dystrophin induced in the diaphragm of mdx mice by PMO (PMO4225) or PPMO (PPMO4225) 30 days after injection at various doses, i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg, as determined by Western blot analysis. [Figure 15] Figures 15A-15B are representative images of Western blot analysis measuring dystrophin protein in the quadriceps muscles of mdx mice treated with various doses of PMO (PMO4225) or PPMO (PPMO4225), i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg. [Figure 16] Figure 16 is a bar graph showing the percentage of wild-type dystrophin induced in the quadriceps muscle of mdx mice by PMO (PMO4225) or PPMO (PPMO4225) 30 days after injection at various doses, i.e., 40 mg / kg, 80 mg / kg, and 120 mg / kg, as determined by Western blot analysis. [Figure 17-1] FIG. 17 shows the coupling cycle carried out by PMO synthesis method B. [Figure 17-2] Same as above. [Figure 17-3] Same as above. [Figure 18]FIG. 18 shows immunohistochemical analysis using mdx and wild-type mice showing dystrophin and laminin induced by PPMO (PPMO4225) in the diaphragm and heart of mdx mice compared with saline. [Figure 19] Figure 19 is a bar graph of the percentage of exon 45 skipping by various concentrations of PMO#1 and PPMO#1 in healthy human myoblasts, measured by RT-PCR 96 hours after treatment. Error bars represent the mean ± SD. The number x represents the relative fold change in the percentage of exon skipping by PPMO#1 at each concentration compared to PMO#1. *, **, and *** represent significant differences between PMO#1 and PPMO#1 with p-values <0.05, p-values <0.005, and p-values <0.0005, respectively. [Figure 20] Figure 20 is a bar graph of the percentage of exon 45 skipping by various concentrations of PMO#1 and PPMO#1 in healthy human myotubes as measured by RT-PCR 96 hours after treatment. Error bars represent the mean ± SD. The number x represents the relative fold change in the percentage of exon skipping by PPMO#1 at each concentration compared to PMO#1. ** and **** represent significant differences between PMO#1 and PPMO#1 with p-values <0.005 and <0.0001, respectively. DETAILED DESCRIPTION OF THE INVENTION
[0030] (Detailed Description of Disclosure) Embodiments of the present disclosure generally relate to improved antisense oligomer conjugates specifically designed to induce exon skipping in the human dystrophin gene and methods of using the same. Dystrophin plays a vital role in muscle function, and various muscle-related diseases are characterized by mutant dystrophin genes. Thus, in certain embodiments, the improved antisense oligomer conjugates described herein induce exon skipping in mutant human dystrophin genes, such as those found in Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD).
[0031] These mutant human dystrophin genes express defective dystrophin proteins or no measurable dystrophin due to abnormal mRNA splicing events caused by the mutation, resulting in various forms of muscular dystrophy.To treat this condition, the antisense oligomer conjugate of the present disclosure hybridizes with a selected region of the pre-processed mRNA of the mutant human dystrophin gene, and induces exon skipping and differential splicing of the dystrophin mRNA that would normally be abnormally spliced, thereby allowing muscle cells to produce mRNA transcripts encoding functional dystrophin proteins.In certain embodiments, the resulting dystrophin protein is not necessarily "wild-type" dystrophin, but rather a truncated but still functional dystrophin.
[0032] By increasing the levels of functional dystrophin protein in muscle cells, these and related embodiments are useful for preventing and treating muscular dystrophies, particularly forms such as DMD and BMD that are characterized by expression of defective dystrophin protein due to aberrant mRNA splicing. The specific antisense oligomer conjugates described herein further exhibit improved dystrophin exon-specific targeting over other oligomers, thereby providing significant and practical advantages over alternative methods of treating related forms of muscular dystrophies.
[0033] Accordingly, the present disclosure provides an antisense oligomer conjugate comprising: an antisense oligomer 22 subunits in length capable of binding to a selected target and inducing exon skipping in the human dystrophin gene, the antisense oligomer comprising a sequence of bases complementary to a target region of exon 45 of the dystrophin pre-mRNA designated as the annealing site; and Cell-penetrating peptides (CPPs) conjugated with antisense oligomers via a linker moiety The present invention relates to an antisense oligomer conjugate comprising:
[0034] In some embodiments, the annealing site is H45A(-03+19).
[0035] In some embodiments, the bases of the antisense oligomer are linked to morpholino ring structures, and the morpholino ring structures are linked by a phosphorous-containing intersubunit bond connecting the morpholino nitrogen of one ring structure to the 5' exocyclic carbon of an adjacent ring structure. In certain embodiments, the cell-penetrating peptide is R6, and the linker moiety is glycine. In some embodiments, the antisense oligomer comprises the base sequence designated as SEQ ID NO: 1, wherein each thymine base (T) is optionally a uracil base (U).
[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used to practice or test this disclosure, preferred methods and materials are described. For purposes of this disclosure, the following terms are defined below.
[0037] I. Definition "About" means a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.
[0038] The term "alkyl," as used herein, unless otherwise specified, refers to a saturated, straight- or branched-chain hydrocarbon. In certain embodiments, an alkyl group is a primary, secondary, or tertiary hydrocarbon. In certain embodiments, an alkyl group has 1 to 10 carbon atoms, i.e., C1 to C6. 10and alkyl. In certain embodiments, the alkyl group comprises 1 to 6 carbon atoms, i.e., C1-C6 alkyl. In certain embodiments, the alkyl group is selected from the group consisting of methyl, CF3, CCl3, CFC12, CF2Cl, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl, and 2,3-dimethylbutyl. The term encompasses both substituted and unsubstituted alkyl groups, including halogenated alkyl groups. In certain embodiments, the alkyl group is a fluorinated alkyl group. Non-limiting examples of moieties with which the alkyl group may be substituted are selected from the group consisting of halogen (fluoro, chloro, bromo, or iodo), hydroxyl, amino, alkylamino, arylamino, alkoxy, aryloxy, nitro, cyano, sulfonic acid, sulfate, phosphonic acid, phosphoric acid, or phosphonate, unprotected or, if necessary, protected as known to those skilled in the art, for example, as taught in Greene, et al., Protective Groups in Organic Synthesis, John Wiley and Sons, 2nd Edition, 1991, incorporated herein by reference.
[0039] As used herein, "capable of exon 45 skipping" with respect to a subject or patient is intended to include subjects and patients who have one or more mutations in the dystrophin gene that result in an out-of-frame reading frame unless exon 45 of the dystrophin pre-mRNA is skipped, thereby impairing translation of the pre-mRNA and rendering the subject or patient unable to produce functional or semi-functional dystrophin. Examples of dystrophin gene mutations that allow exon 45 skipping include mutations in exons 7-44, 12-44, 18-44, 44, 46, 46-47, 46-48, 46-49, 46-51, 46-53, 46-55, 46-57, 46-59, 46-60, 46-67, 46-69, 46-75, and 46-78 (Leiden Duchenne Muscular Dystrophy Mutation Database, Leiden University Medical Center, The Netherlands). Determining whether a patient has a mutation in the dystrophin gene that allows for exon skipping is well within the understanding of one of ordinary skill in the art (e.g., Aartsma-Rus et al., (2009) Hum Mutat. 30:293-299, Gurvich et al., Hum Mutat. 2009;30(4)633-640; and Fletcher et al., (2010) Molecular See Therapy 18(6)1218-1223).
[0040] As used herein, the term "oligomer" refers to a series of subunits linked by intersubunit linkages. In certain instances, the term "oligomer" is used in reference to an "antisense oligomer." With respect to an "antisense oligomer," each subunit consists of: (i) a ribose sugar or a derivative thereof; and (ii) a nucleobase associated therewith, such that the order of the base-pairing moieties forms a complementary base sequence to a target sequence in a nucleic acid (usually RNA) by Watson-Crick base pairing, forming a nucleic acid:oligomer heteroduplex within the target sequence, provided that the subunit, the intersubunit linkage, or both, are not naturally occurring. In certain embodiments, the antisense oligomer is a PMO. In other embodiments, the antisense oligomer is a 2'-O-methyl phosphorothioate. In other embodiments, the antisense oligomer of the present disclosure is a peptide nucleic acid (PNA), a locked nucleic acid (LNA), or a bridged nucleic acid (BNA), such as a 2'-O,4'-C-ethylene-bridged nucleic acid (ENA). Further exemplary embodiments are also described herein.
[0041] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each containing a nucleobase sequence) that are related to each other according to the Watson-Crick base-pairing rules. For example, the nucleobase sequence "TGA(5'→3')" is complementary to the nucleobase sequence "ACT(3'→5')." Complementarity can be "partial," in which fewer than all of the nucleobases in a given nucleobase sequence match with another nucleobase sequence according to the base-pairing rules. For example, in some embodiments, the complementarity between a given nucleobase sequence and another nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Alternatively, there can be "full" or "perfect" (100%) complementarity between a given nucleobase sequence and another nucleobase sequence, and examples follow. The degree of complementarity between nucleic acid base sequences has a significant effect on the efficiency and strength of hybridization between the sequences.
[0042] The terms "effective amount" and "therapeutically effective amount" are used interchangeably herein and refer to an amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either as a single dose or as part of a series, that is effective to produce a desired therapeutic effect. For antisense oligomers, this effect is typically achieved by inhibiting translation or natural splice processing of a selected target sequence or by producing a clinically relevant amount of dystrophin (statistical significance).
[0043] In some embodiments, an effective amount is at least 10 mg / kg or at least 20 mg / kg of a composition comprising an antisense oligomer over a period of time during which the subject is treated. In some embodiments, an effective amount to increase the number of dystrophin-positive fibers in a subject to at least 20% of normal is at least 20 mg / kg of a composition comprising an antisense oligomer. In certain embodiments, an effective amount to stabilize, maintain, or improve a patient's walking distance from a 20% deficit relative to healthy counterparts, for example, in a 6MWT, is at least 10 mg / kg or at least 20 mg / kg of a composition comprising an antisense oligomer. In various embodiments, an effective amount is at least 10 mg / kg to about 30 mg / kg, at least 20 mg / kg to about 30 mg / kg, about 25 mg / kg to about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg. In some embodiments, an effective amount is about 10 mg / kg, about 20 mg / kg, about 30 mg / kg, or about 50 mg / kg. In another aspect, the effective amount is at least about 10 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, or about 30 mg / kg to about 50 mg / kg for at least 24 weeks, at least 36 weeks, or at least 48 weeks, thereby increasing the number of dystrophin-positive fibers in the subject to at least 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% of normal and stabilizing or improving the patient's walking distance from a 20% deficit relative to healthy peers, e.g., in a 6MWT. In some embodiments, treatment increases the number of dystrophin-positive fibers in the patient to 20-60% or 30-50% of normal.
[0044] "Enhance" or "enhancing," "increase" or "increasing," or "stimulate" or "stimulating" generally refer to one or more antisense oligomer conjugates or pharmaceutical compositions causing or being able to cause an increased physiological response (i.e., downstream effect) in a cell or subject compared to the response caused in the absence of the antisense oligomer conjugate or by a control compound. An increased physiological response may include increased expression of functional dystrophin protein or increased dystrophin-related biological activity in muscle tissue, among other responses apparent from understanding in the art and the description herein. Increases in muscle function can also be measured, including about a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% increase or improvement in muscle function. The percentage of muscle fibers expressing functional dystrophin can also be measured, including increases in muscle fiber dystrophin expression of about 1%, 2%, 5%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. For example, it has been shown that dystrophin expression in 25-30% of fibers results in an approximately 40% improvement in muscle function (see, e.g., DelloRusso et al., Proc Natl Acad Sci USA 99:12979-12984, 2002). An "increased" or "enhanced" amount is typically a "statistically significant" amount, and can include an increase of 1.1-fold, 1.2-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 30-fold, 40-fold, 50-fold, or more (e.g., 500-fold, 1000-fold, including all integers and decimal points in between and greater than 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) over the amount produced in the absence of the antisense oligomer conjugate (in the absence of drug) or by a control compound.
[0045] As used herein, terms such as "function" and "functionality" refer to biological, enzymatic or therapeutic functions.
[0046] A "functional" dystrophin protein generally refers to a dystrophin protein that has sufficient biological activity to prevent the progressive muscle tissue degradation that is another hallmark of muscular dystrophy, compared to the altered or "defective" dystrophin protein normally present in a particular subject with DMD or BMD. In certain embodiments, a functional dystrophin protein may have approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including any integers therebetween) of the in vitro or in vivo biological activity of wild-type dystrophin, as measured by techniques routine in the art. As an example, dystrophin activity in muscle cultures can be measured in vitro by myotube size, myofibril organization (or disorganization), contractile activity, and spontaneous acetylcholine receptor clustering (see, e.g., Brown et al., Journal of Cell Science. 112:209-216, 1999). Animal models are also valuable resources for studying the causes of disease and provide a means to test the activity of dystrophin. The two most widely used animal models for DMD research are mdx mice and Golden Retriever Muscular Dystrophy (GRMD) dogs, both of which are dystrophin-negative (see, for example, Collins and Morgan, Int J Exp Pathol 84:165-172, 2003). These and other animal models can be used to measure the functional activity of various dystrophin proteins. This includes truncated forms of dystrophin, such as those generated after administration of certain exon-skipping antisense oligomer conjugates disclosed herein.
[0047] The term "mismatch(es)" refers to one or more nucleobases (whether contiguous or separated) within the oligomer nucleobase sequence that do not match the target pre-mRNA according to the rules of base pairing. While perfect complementarity is often desired, some embodiments may include one or more, preferably six, five, four, three, two, or one, mismatches to the target pre-mRNA. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomer conjugates of the present disclosure include variations in the nucleobase sequence near internal terminal variations, when present, typically within about six, five, four, three, two, or one subunit of the 5' and / or 3' ends.
[0048] The terms "morpholino," "morpholino oligomer," and "PMO" refer to the following general structure, as set forth in Figure 2 of Summerton, J. et al., Antisense & Nucleic Acid Drug Development, 7:187-195 (1997): [ka] The morpholino oligomer referred to herein includes all stereoisomers and tautomers of the above general structure. The synthesis, structure and binding properties of morpholino oligomers are described in detail in U.S. Patent Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,521,063; 5,506,337; 8,076,476; and 8,299,206, all of which are incorporated herein by reference.
[0049] In certain embodiments, the morpholino is conjugated to a "tail" moiety at the 5' or 3' end of the oligomer to increase its stability and / or solubility. Exemplary tails include: [ka] Examples include:
[0050] Of the exemplary tail moieties above, "TEG" or "EG3" may be any of the following tail moieties: [ka] Refers to...
[0051] Of the exemplary tail segments above, "GT" refers to the following tail segments: [ka] Refers to...
[0052] As used herein, the terms "-G-R6" and "-G-R6-Ac" are used interchangeably and refer to peptide moieties conjugated to antisense oligomers of the present disclosure. In various embodiments, "G" represents a glycine residue conjugated to "R6" via an amide bond, and each "R" represents an arginine residue conjugated to each other via an amide bond; thus, "R6" refers to six (6) arginine residues conjugated to each other via amide bonds. The arginine residues may have any configuration; for example, the arginine residues may be L-arginine residues, D-arginine residues, or a mixture of D-arginine and L-arginine residues. In certain embodiments, "-G-R6" or "-G-R6-Ac" is conjugated to the morpholine ring nitrogen of the 3'-most morpholino subunit of a PMO antisense oligomer of the present disclosure. In some embodiments, "-G-R6" or "-G-R6-Ac" is conjugated to the 3' end of an antisense oligomer of the present disclosure and has the following formula: [ka] It is of the type.
[0053] The terms "nucleobase" (Nu), "base-pairing moiety," or "base" are used interchangeably to refer to purine or pyrimidine bases (e.g., uracil, thymine, adenine, cytosine, and guanine) found in naturally occurring or "natural" DNA or RNA, as well as analogs of these naturally occurring purines and pyrimidines. These analogs may provide oligomers with improved properties, such as binding affinity. Exemplary analogs include hypoxanthine (the base component of inosine); 2,6-diaminopurine; 5-methylcytosine; C5-propynyl-modified pyrimidines; 10-(9-(aminoethoxy)phenoxazinyl) (G-clamp); and the like.
[0054] Further examples of base-pairing moieties include, but are not limited to, uracil, thymine, adenine, cytosine, guanine, and hypoxanthine (inosine), each of whose amino groups is protected by an acyl protecting group, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pyrimidine analogs such as pseudoisocytosine and pseudouracil, and other modified nucleobases such as 8-substituted purines, xanthines, or hypoxanthines (the latter two being natural degradation products). Also contemplated are modified nucleobases disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048; Limbach et al., Nucleic Acids Research, 1994, 22, 2183-2196; and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313, the contents of which are incorporated herein by reference.
[0055] Further examples of base-pairing moieties include, but are not limited to, nucleobases that have been increased in size by the addition of one or more benzene rings. Nucleobase substitutions described in the Glen Research catalog (www.glenresearch.com); Krueger AT et al., Acc.Chem.Res., 2007, 40, 141-150; Kool, ET, Acc.Chem.Res., 2002, 35, 936-943; Benner SA et al., Nat.Rev.Genet., 2005, 6, 553-543; Romesberg, FE et al., Curr.Opin.Chem.Biol., 2003, 7, 723-733; and Hirao, I., Curr.Opin.Chem.Biol., 2006, 10, 622-627 are contemplated as being useful in the antisense oligomer conjugates described herein, and the contents of the above references are incorporated herein by reference. Examples of nucleobases with increased size include the following: [ka] and tautomeric forms thereof.
[0056] As used herein, the phrases "parenteral administration" and "administering parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal and intrasternal injection and infusion.
[0057] For clarity, the structures of the present disclosure, including, for example, Formula (IV), are continuous from 5' to 3' and include various diagrammatic breaks, labeled "Break A," "Break B," and "Break C," for the convenience of illustrating the entire structure in a compact form. As will be understood by those of skill in the art, each designation, for example, "Break A," indicates that the diagram of the structure is continuous at that point. Those of skill in the art will understand that the same is true for "Break B" and "Break C," respectively, in the above structure. However, none of the diagrammatic breaks are intended to imply that the above structure is actually discontinuous, nor would one of skill in the art understand the diagrammatic breaks to have such meaning.
[0058] As used herein, a set of parentheses used within a structural formula indicates that the structural feature between the parentheses is repeated. In some embodiments, the parentheses used may be "[" and "]", and in certain embodiments, the parentheses used to indicate a repeated structural feature may be "(" and ")". In some embodiments, the number of times the structural feature between the parentheses is repeated is a number shown outside the parentheses, such as 2, 3, 4, 5, 6, 7, etc. In various embodiments, the number of times the structural feature between the parentheses is repeated is indicated by a variable, such as "Z", shown outside the parentheses.
[0059] As used herein, a straight or tortuous bond drawn to a chiral carbon or phosphorus atom in a structural formula indicates that the stereochemistry of the chiral carbon or phosphorus is not fixed, and all forms of chiral center are intended to be included. Examples of such illustrations are shown below. [ka]
[0060] The phrase "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the subject being treated therewith.
[0061] As used herein, the phrase "pharmaceutically acceptable carrier" means a non-toxic, inert solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation auxiliary of any type. Some examples of materials which may serve as pharmaceutically acceptable carriers, at the discretion of the formulator, include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; celluloses and derivatives thereof such as sodium carboxymethylcellulose, ethyl cellulose, and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; phosphate buffers; non-toxic, compatible lubricants such as sodium lauryl sulfate and magnesium stearate; colorants; release agents; coating agents; sweetening agents; flavoring agents; perfuming agents; preservatives, and antioxidants.
[0062] The term "restoration" with respect to dystrophin synthesis or production generally refers to the production of dystrophin protein, including truncated forms of dystrophin, in a patient with muscular dystrophy following treatment with an antisense oligomer conjugate described herein. In some embodiments, treatment increases new dystrophin production in a patient by 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% (including any integers therebetween). In some embodiments, treatment increases the number of dystrophin-positive fibers in a subject to at least about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 95% to 100% of normal. In other embodiments, treatment increases the number of dystrophin-positive fibers in a subject to about 20% to about 60%, or about 30% to about 50% of normal. The percentage of dystrophin-positive fibers in a patient after treatment can be determined by muscle biopsy using known techniques. For example, a muscle biopsy can be taken from a suitable muscle, such as the patient's biceps.
[0063] Analysis of the percentage of dystrophin-positive fibers may be performed before and / or after treatment, or at multiple time points throughout the course of treatment. In some embodiments, a post-treatment biopsy sample is taken from the muscle opposite the pre-treatment biopsy. Pre- and post-treatment dystrophin expression analysis may be performed using any assay suitable for dystrophin. In some embodiments, immunohistochemical detection is performed on tissue sections obtained from muscle biopsies using an antibody, such as a monoclonal or polyclonal antibody, that is a dystrophin marker. For example, the MANDYS106 antibody, a highly sensitive dystrophin marker, may be used. Any suitable secondary antibody may be used.
[0064] In some embodiments, the percentage of dystrophin-positive fibers is calculated by dividing the number of positive fibers by the total number of fibers counted. Normal muscle samples have 100% dystrophin-positive fibers. Therefore, the percentage of dystrophin-positive fibers can be expressed as a percentage of normal. To adjust for the presence of trace amounts of dystrophin in pre-treatment muscle and revertant fibers, a baseline can be established using a section of the patient's pre-treatment muscle when counting dystrophin-positive fibers in post-treatment muscle. This can be used as a threshold for counting dystrophin-positive fibers in sections of the patient's post-treatment muscle. In other embodiments, antibody-stained tissue sections can also be used for dystrophin quantification using Bioquant image analysis software (Bioquant Image Analysis, Nashville, TN). Total dystrophin fluorescent signal intensity can be reported as a percentage of normal. Additionally, Western blot analysis with monoclonal or polyclonal anti-dystrophin antibodies can be used to determine the percentage of dystrophin-positive fibers. For example, the Leica Biosystems anti-dystrophin antibody NCL-Dys1 can be used. The proportion of dystrophin-positive fibers can also be analyzed by determining the expression of components of the sarcoglycan complex (β, γ) and / or neuronal NOS.
[0065] In some embodiments, treatment with an antisense oligomer conjugate of the present disclosure slows or alleviates the progressive respiratory muscle dysfunction and / or failure that would be expected in DMD patients in the absence of treatment. In some embodiments, treatment with an antisense oligomer conjugate of the present disclosure reduces or eliminates the need for respiratory support that would be expected in the absence of treatment. In some embodiments, respiratory function measurements to track the course of the disease and assess potential therapeutic intervention include maximum inspiratory pressure (MIP), maximum expiratory pressure (MEP), and forced vital capacity (FVC). MIP and MEP measure the level of pressure a person can generate during inspiration and expiration, respectively, and are sensitive measures of respiratory muscle strength. MIP is a measure of diaphragmatic muscle weakness.
[0066] In some embodiments, MEP may decline before other pulmonary function tests, including MIP and FVC, change. In certain embodiments, MEP may be an early indicator of respiratory dysfunction. In certain embodiments, FVC may be used to measure the total volume of air expelled during forced expiration after maximal inspiration. In DMD patients, FVC increases with physical growth until the early teens. However, as disease progression causes growth velocity to slow or stunt, muscle weakness progresses and vital capacity enters a decline phase, declining at an average rate of approximately 8 to 8.5 percent per year after age 10 to 12. In certain embodiments, percent predicted MIP (MIP adjusted for weight), percent predicted MEP (MEP adjusted for age), and percent predicted FVC (FVC adjusted for age and height) are supplementary analyses.
[0067] The terms "subject" and "patient" as used herein include any animal that exhibits or is at risk of exhibiting symptoms that can be treated with the antisense oligomer conjugate of the present disclosure, such as subjects (or patients) that have or are at risk of exhibiting DMD or BMD or any symptoms associated with these conditions (e.g., muscle fiber loss). Suitable subjects (or patients) include experimental animals (such as mice, rats, rabbits, or guinea pigs), livestock and domestic animals, or pets (such as cats or dogs). Non-human primates are also included, preferably human patients (or subjects). Also included is a method for producing dystrophin in a subject (or patient) that has a mutation in the dystrophin gene that allows exon 45 skipping.
[0068] As used herein, the phrases "systemic administration," "administering systemically," "peripheral administration," and "administering peripherally" refer to administration of a compound, drug, or other substance not directly into the central nervous system, but rather in such a way that it enters the patient's entire body and is therefore subject to metabolic and other similar processes, e.g., subcutaneous administration.
[0069] The term "targeting sequence" refers to a stretch of oligomeric nucleobases that is complementary to a sequence of nucleotides in a target pre-mRNA. In some embodiments of the present disclosure, the sequence of nucleotides in the target pre-mRNA is the exon 45 annealing site of the dystrophin pre-mRNA, designated H45A(-03+19).
[0070] "Treatment" of a subject (e.g., a mammal, such as a human) or cell refers to any type of intervention used to alter the natural processes of the subject or cell. Treatment includes, but is not limited to, administration of an oligomer or pharmaceutical composition thereof and may be performed as a prophylactic or after the onset of a pathological event or contact with a pathogen. Treatment includes any desired effect on the symptoms or pathology of a disease or condition associated with dystrophin protein, such as certain forms of muscular dystrophy, and may include, for example, a minimal change or improvement in one or more measurable markers of the disease or condition being treated. Also included is "prophylactic" treatment, which may be aimed at reducing the rate of progression of the disease or condition being treated, delaying the onset of the disease or condition, or reducing the severity of its onset. "Treatment" or "prevention" does not necessarily refer to the complete eradication, cure, or prevention of the disease or condition or its associated symptoms.
[0071] In some embodiments, treatment with an antisense oligomer conjugate of the present disclosure increases new dystrophin production expected in the absence of treatment, delays disease progression, slows or attenuates walking loss, reduces myositis, reduces muscle damage, improves muscle function, attenuates pulmonary function loss, and / or enhances muscle regeneration. In some embodiments, treatment maintains, delays, or slows disease progression. In some embodiments, treatment maintains walking ability or attenuates walking loss. In some embodiments, treatment maintains pulmonary function or attenuates pulmonary function loss. In some embodiments, treatment maintains or increases a patient's stable walking distance, as measured, for example, by the 6-minute walk test (6MWT). In some embodiments, treatment maintains or shortens the time it takes to walk / run 10 meters (i.e., the 10-meter walk / run test). In some embodiments, treatment maintains or shortens the time it takes to stand from a supine position (i.e., the time to stand test). In some embodiments, treatment maintains or reduces the time it takes to climb four standard steps (i.e., the four-step climb test). In some embodiments, treatment maintains or reduces the patient's myositis, as measured, for example, by MRI (e.g., MRI of leg muscles). In some embodiments, MRI measures T2 and / or fat content to confirm muscle degeneration. MRI can confirm changes in muscle structure and composition due to inflammation, edema, muscle damage, and fat infiltration.
[0072] In some embodiments, treatment with the antisense oligomer conjugates of the present disclosure increases new dystrophin production, slowing or alleviating the expected decline in walking ability in the absence of treatment. For example, treatment may stabilize, maintain, improve, or increase a subject's walking ability (e.g., stabilizing walking). In some embodiments, treatment maintains or increases the patient's stable walking distance, as measured by the 6-minute walk test (6MWT), for example, as described by McDonald et al. (Muscle Nerve, 2010; 42:966-74, incorporated herein by reference). Changes in 6-minute walk distance (6MWD) may be expressed as absolute values, percentage changes, or percent predicted changes. In some embodiments, treatment maintains or improves the patient's stable walking distance in the 6MWT from a 20% deficit compared to healthy peers. Calculating percent predicted values can determine the performance of a DMD patient compared to the typical performance of healthy peers in the 6MWT. For example, for men, the equation is: 196.72 + (39.81 x age) - (1.36 x age) 2 ) + (132.28 × height in meters) can be used to calculate % predicted 6MWD. For women, the following equation: 188.61 + (51.50 × age) - (1.86 × age) 2 ) + (86.10 × height in meters) can be used to calculate % predicted 6MWD (Henricson et al., PLoS Curr., 2012, version 2, incorporated herein by reference). In some embodiments, treatment with the antisense oligomer increases a patient's stable walking distance from baseline to greater than 3 meters, 5 meters, 6 meters, 7 meters, 8 meters, 9 meters, 10 meters, 15 meters, 20 meters, 25 meters, 30 meters, or 50 meters (including any integers in between).
[0073] The decline in muscle function in DMD patients may occur against the backdrop of normal childhood growth and development. Indeed, young children with DMD may increase their walking distance on the 6MWT over approximately one year, despite progressive muscle dysfunction. In some embodiments, the 6MWD of DMD patients is compared to existing normative data from typically developing control subjects and age- and sex-matched subjects. In some embodiments, an age- and height-based equation can be applied to normative data to account for normal growth and development. Such an equation can be used to convert the 6MWD of subjects with DMD to a percent predicted (% predicted) value. In certain embodiments, analysis of % predicted 6MWD data provides a way to account for normal growth and development, and can indicate that increased function at a young age (e.g., age 7 years or younger) represents stable rather than improved performance in DMD patients (Henricson et al., PLoS Curr., 2012, version 2, incorporated herein by reference).
[0074] To distinguish between different antisense molecules, a nomenclature for antisense molecules has been proposed and published (see Mann et al., (2002) J Gen Med 4, 644-654). This nomenclature has become particularly important when testing multiple slightly different antisense molecules, all directed against the same target region, as shown below: H#A / D(x:y).
[0075] The first letter represents the species (e.g., H: human, M: mouse, C: dog). A "#" represents the number of the target dystrophin exon. A / D represents the acceptor or donor splice site at the beginning or end of the exon, respectively. (xy) represents the annealing coordinates, where "-" and "+" represent the intron or exon sequence, respectively. For example, A(-6+18) represents the last 6 bases of the intron preceding the target exon and the first 18 bases of the target exon. The nearest splice site is the acceptor, so its coordinate is preceded by an "A." The annealing coordinate at the donor splice site is D(+2-18), where the last 2 exon bases and the first 18 intron bases correspond to the annealing site of the antisense molecule. The entire exon has annealing coordinates represented by A(+65+85) that are between the 65th and 85th nucleotides from the beginning of the exon.
[0076] II. Antisense Oligomers A. Antisense oligomer conjugates designed to induce exon 45 skipping In certain embodiments, the antisense oligomer conjugates of the present disclosure are complementary to the exon 45 target region of the dystrophin gene and induce exon 45 skipping. Specifically, the present disclosure relates to antisense oligomer conjugates complementary to the exon 45 target region of the dystrophin pre-mRNA, designated as the annealing site. In some embodiments, the annealing site is H45A(-03+19).
[0077] The antisense oligomer conjugates of the present disclosure target dystrophin pre-mRNA and induce exon 45 skipping, thereby eliminating or skipping exon 45 from the spliced mature mRNA transcript. Skipping exon 45 restores the disrupted reading frame to an in-frame mutation. While DMD consists of various genetic subtypes, the antisense oligomer conjugates of the present disclosure are specifically designed to skip exon 45 of dystrophin pre-mRNA. DMD mutations that allow exon 45 skipping constitute a subgroup (13%) of DMD patients.
[0078] The nucleobase sequence of the antisense oligomer conjugate that induces exon 45 skipping is designed to be a specific target sequence within exon 45 of the dystrophin pre-mRNA. In some embodiments, the antisense oligomer of the antisense oligomer conjugate is a PMO, and each morpholino ring of the PMO is linked to a nucleobase, including, for example, nucleobases found in DNA (adenine, cytosine, guanine, and thymine).
[0079] B. Chemical Characteristics of Oligomers The antisense oligomer conjugates of the present disclosure can use a variety of antisense oligomer chemistries. Examples of oligomer chemistries include, but are not limited to, morpholino oligomers, phosphorothioate-modified oligomers, 2'O-methyl-modified oligomers, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorothioate oligomers, 2'O-MOE-modified oligomers, 2'-fluoro-modified oligomers, 2'O,4'C-ethylene-bridged nucleic acids (ENAs), tricyclo-DNA, tricyclo-DNA phosphorothioate subunits, 2'-O-[2-(N-methylcarbamoyl)ethyl]-modified oligomers, and combinations of any of the above. Phosphorothioate chemistry can be combined with 2'-O-Me-modified chemistry to create a 2'O-Me-phosphorothioate backbone. See, for example, PCT Publication Nos. WO 2013 / 112053 and WO 2009 / 008725, which are incorporated by reference herein in their entireties. Exemplary embodiments of the oligomer chemistry of the present disclosure are further described below.
[0080] 1. Peptide nucleic acid (PNA) Peptide nucleic acids (PNAs) are DNA analogs whose backbone is structurally isomorphous with a deoxyribose backbone and consists of N-(2-aminoethyl)glycine units linked to pyrimidine or purine bases. PNAs containing natural pyrimidine and purine bases hybridize to complementary oligomers according to the Watson-Crick base-pairing rules, mimicking DNA in terms of base pair recognition (Egholm, Buchardt et al., 1993). The backbone of PNAs is formed by peptide bonds rather than phosphodiester bonds, making them well suited for antisense applications (see structure below). The uncharged backbone results in PNA / DNA or PNA / RNA duplexes that exhibit higher thermal stability than normal. PNAs are not recognized by nucleases or proteases. A non-limiting example of a PNA is illustrated below: [ka]
[0081] Despite their radically altered natural structure, PNAs are capable of sequence-specific helical binding to DNA or RNA. PNAs are characterized by high binding affinity to complementary DNA or RNA, destabilizing effects from single-base mismatches, resistance to nucleases and proteases, salt-independent hybridization to DNA or RNA, and triplex formation with homopurine DNA. PANAGENE™ has developed its proprietary Bts PNA monomer (Bts; benzothiazole-2-sulfonyl group) and a proprietary oligomerization process. PNA oligomerization using the Bts PNA monomer consists of repeated cycles of deprotection, coupling, and capping. PNAs can be synthetically prepared using any technique known in the art. See, for example, U.S. Patent Nos. 6,969,766; 7,211,668; 7,022,851; 7,125,994; 7,145,006; and 7,179,896. For the preparation of PNAs, see also U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. Furthermore, PNA compounds can be found in Nielsen et al., Science, 254:1497-1500, 1991, which teaches the use of PNAs. Each of the above is incorporated herein by reference in its entirety.
[0082] 2. Locked Nucleic Acid (LNA) Antisense oligomer conjugates may also contain "locked nucleic acid" subunits (LNAs). "LNAs" are members of a class of modifications called bridged nucleic acids (BNAs). BNAs are characterized by a covalent bond that locks the conformation of the ribose ring to the C30-endo (Northern) sugar pucker. In LNAs, the bridge consists of a methylene between the 2'-O and 4'-C positions. LNAs promote backbone preorganization and base stacking, increasing hybridization and thermal stability.
[0083] The structure of LNAs can be found, for example, in Wengel et al., Chemical Communications (1998) 455; Koshkin et al., Tetrahedron (1998) 54:3607; Jesper Wengel, Accounts of Chem. Research (1999) 32:301; Obika et al., Tetrahedron Letters (1997) 38:8735; Obika et al., Tetrahedron Letters (1998) 39:5401; and Obika et al., Bioorganic Medicinal Chemistry (2008) 16:9230, the entire contents of which are incorporated herein by reference. Non-limiting examples of LNAs are illustrated below: [ka]
[0084] The antisense oligomer conjugate of the present disclosure may incorporate one or more LNAs; in some cases, the antisense oligomer conjugate may be entirely composed of LNAs.The synthesis of individual LNA nucleoside subunits and the method of incorporating them into oligomers are described, for example, in U.S. Patent Nos. 7,572,582; 7,569,575; 7,084,125; 7,060,809; 7,053,207; 7,034,133; 6,794,499; and 6,670,461, each of which is incorporated by reference in its entirety.Typical intersubunit linkers include phosphodiester moieties and phosphorothioate moieties; alternatively, non-phosphorous acid-containing linkers may be used.A further embodiment includes an LNA-containing antisense oligomer conjugate in which each LNA subunit is separated by a DNA subunit. Certain antisense oligomer conjugates consist of alternating LNA and DNA subunits, with phosphorothioate intersubunit linkers.
[0085] 2'0,4'C-ethylene-bridged nucleic acids (ENAs) are another member of the BNA class. A non-limiting example is illustrated below: [ka]
[0086] ENA oligomers and their preparation are described in Obika et al., Tetrahedron Lett (1997) 38(50):8735, which is incorporated herein by reference in its entirety. The antisense oligomer conjugates of the present disclosure may incorporate one or more ENA subunits.
[0087] 3. Unlocked Nucleic Acid (UNA) Antisense oligomer conjugates can also contain unlocked nucleic acid (UNA) subunits. UNA and UNA oligomers are analogs of RNA in which the C2'-C3' bond of the subunit is broken. While LNA is conformationally restricted (compared to DNA and RNA), UNA is highly flexible. UNA is disclosed, for example, in WO 2016 / 070166. Non-limiting examples of UNA are shown below. [ka]
[0088] Typical intersubunit linkers include phosphodiester and phosphorothioate moieties; alternatively, non-phosphite-containing linkers may be used.
[0089] 4. Phosphorothioate "Phosphorothioates" (or S-oligos) are variants of normal DNA in which one of the non-bridging oxygens is replaced with a sulfur. A non-limiting example of a phosphorothioate is illustrated below: [ka]
[0090] Sulfuration of internucleotide bonds reduces the action of endonucleases and exonucleases, including 5'-3' and 3'-5' DNA POL 1 exonuclease, nucleases S1 and P1, RNases, serum nucleases, and snake venom phosphodiesterases. Phosphorothioates are made by two major routes: by the action of a solution of elemental sulfur in carbon disulfide on hydrogen phosphonate, or by sulfurization of phosphite triesters with tetraethylthiuram disulfide (TETD) or 3H-1,2-bensodithiol-3-one 1,1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55, 4693-4699, 1990, incorporated herein by reference in its entirety). The latter method avoids the problems of elemental sulfur being insoluble in most organic solvents and the toxicity of carbon disulfide. The TETD and BDTD methods also yield phosphorothioates of higher purity.
[0091] 5. TricycloDNA and Tricyclophosphorothioate Subunits Tricyclo-DNA (tc-DNA) is a class of constrained DNA analogues in which each nucleotide is modified by the introduction of a cyclopropane ring to restrict the conformational flexibility of the backbone and optimize the backbone structure of the torsion angle γ. Homobasic adenine- and thymine-containing tc-DNAs form highly stable AT base pairs with complementary RNA. Tricyclo-DNA and its synthesis are described in International Patent Application Publication No. 2010 / 115993, the entire contents of which are incorporated herein by reference. The antisense oligomer conjugates of the present disclosure may incorporate one or more tricyclic DNA subunits; in some cases, the antisense oligomer conjugates may be composed entirely of tricyclic DNA subunits.
[0092] Tricyclophosphorothioate subunits are tricyclic DNA subunits with phosphorothioate intersubunit linkages. Tricyclophosphorothioate subunits and their synthesis are described in International Patent Application Publication No. 2013 / 053928, the entire contents of which are incorporated herein by reference. The antisense oligomer conjugates of the present disclosure may incorporate one or more tricyclic DNA subunits; in some cases, the antisense oligomer conjugates may be entirely composed of tricyclic DNA subunits. Non-limiting examples of tricyclic DNA / tricyclic phosphothioate subunits are illustrated below: [ka]
[0093] 6. 2'O-Methyl, 2'O-MOE, and 2'-F Oligomers A "2'-O-Me oligomer" molecule has a methyl group at the 2'-OH residue of the ribose molecule. 2'-O-Me-RNA also behaves the same as (or similar to) DNA, but is protected from degradation by nucleases. 2'-O-Me-RNA can also be combined with a phosphorothioate oligomer (PTO) for further stabilization. 2'O-Me oligomers (phosphodiester or phosphothioate) can be synthesized by routine techniques in the art (see, for example, Yoo et al., Nucleic Acids Res. 32:2008-16, 2004, which is incorporated herein by reference in its entirety). Non-limiting examples of 2'O-Me oligomers are illustrated below: [ka]
[0094] 2'O-Methoxyethyl oligomers (2'-O MOE) have a methoxyethyl group at the 2'-OH residue of the ribose molecule and are discussed in Martin et al., Helv. Chim. Acta, 78, 486-504, 1995, which is incorporated herein by reference in its entirety. Non-limiting examples of 2'O-MOE subunits are illustrated below: [ka]
[0095] 2'-Fluoro (2'-F) oligomers, in contrast to the alkylated 2'OH ribose derivatives described above, have a fluoro radical at the 2' position instead of the 2'OH. Non-limiting examples of 2'-F oligomers are illustrated below: [ka] 2'-Fluoro oligomers are further described in WO 2004 / 043977, which is incorporated herein by reference in its entirety.
[0096] The 2'O-methyl, 2'O-MOE and 2'F oligomers may also contain one or more phosphorothioate (PS) linkages as illustrated below: [ka]
[0097] Additionally, 2'O-methyl, 2'O-MOE and 2'F oligomers may contain PS intersubunit linkages throughout the oligomer, such as the 2'O-methyl PS oligomer drisapersen illustrated below: [ka]
[0098] Alternatively, the 2'O-methyl, 2'O-MOE and / or 2'F oligomers may contain a PS linkage at the end of the oligomer as illustrated below: [ka] During the ceremony, R is CH2CH2OCH3 (methoxyethyl or MOE); x, y, and z represent the number of nucleotides contained in each of the portions designated as the 5' wing region, the central gap region, and the 3' wing region, respectively.
[0099] The antisense oligomer conjugates of the present disclosure may incorporate one or more 2'O-methyl, 2'O-MOE, and 2'F subunits and may use the intersubunit linkages described herein. In some cases, the antisense oligomer conjugates of the present disclosure may be composed entirely of 2'O-methyl, 2'O-MOE, or 2'F subunits. One embodiment of the antisense oligomer conjugates of the present disclosure is composed entirely of 2'O-methyl subunits.
[0100] 7. 2'-O-[2-(N-methylcarbamoyl)ethyl] oligomer (MCE) MCE is another example of a 2'O-modified ribonucleoside useful in the antisense oligomer conjugates of the present disclosure, where the 2'OH is derivatized to a 2-(N-methylcarbamoyl)ethyl moiety to increase nuclease resistance. A non-limiting example of an MCE oligomer is illustrated below: [ka] MCE and its synthesis are described in Yamada et al., J. Org. Chem. (2011) 76(9):3042-53, which is incorporated herein by reference in its entirety. The antisense oligomer conjugates of the present disclosure may incorporate one or more MCE subunits.
[0101] 8. Stereospecific Oligomers A stereospecific oligomer is an oligomer in which the stereochemistry of each phosphorous-containing linkage is fixed by a synthetic method that results in a substantially stereopure oligomer. Non-limiting examples of stereospecific oligomers are illustrated below: [ka]
[0102] In the above example, each phosphorous acid in the oligomer has the same stereochemistry. Other examples include the oligomers described above. For example, LNA, ENA, tricycloDNA, MCE, 2'O-methyl, 2'O-MOE, 2'-F, and morpholino-based oligomers can be prepared with stereospecific phosphorous acid-containing internucleoside linkages, such as phosphorothioate, phosphodiester, phosphoramidate, phosphorodiamidate, or other phosphorous acid-containing internucleoside linkages. Stereospecific oligomers, methods for preparing such oligomers, chiral controlled synthesis, chiral design, and chiral auxiliary groups are described in, for example, International Publication Nos. 2017192664, 2017192679, 2017062862, 2017015575, 2017015555, and 2017015556, each of which is incorporated herein by reference in its entirety. These are described in detail in Patent Nos. 2015107425, 2015108048, 2015108046, 2015108047, 2012039448, 2010064146, 2011034072, 2014010250, 2014012081, 20130127858 and 2011005761.
[0103] The stereospecific oligomers are R P Configuration or S PThe oligomer may have phosphite-containing internucleoside linkages of any configuration. Chiral phosphite-containing linkages in which the bond configuration is controlled are referred to as "sterically pure," while chiral phosphite-containing linkages in which the bond configuration is not controlled are referred to as "sterically random." In certain embodiments, oligomers of the present disclosure include multiple sterically pure and sterically random linkages, such that the resulting oligomer has sterically pure subunits at pre-specified positions in the oligomer. Figures 7A and 7B of WO 2017 / 062862(A2) provide examples of the locations of sterically pure subunits. In one embodiment, any chiral phosphite-containing linkages within the oligomer are sterically random. In one embodiment, any chiral phosphite-containing linkages within the oligomer are sterically pure.
[0104] In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), all n chiral phosphorous-containing linkages within the oligomer are stereo-random. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), all n chiral phosphorous-containing linkages within the oligomer are stereo-pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 10% (rounded to the nearest integer) of the n phosphorous-containing linkages within the oligomer are stereo-pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 20% (rounded to the nearest integer) of the n phosphorous-containing linkages within the oligomer are stereo-pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 30% (rounded to the nearest integer) of the n phosphorous-containing linkages within the oligomer are stereo-pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 40% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 50% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 60% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer greater than or equal to 1), at least 70% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure. In one embodiment of an oligomer having n chiral phosphorous-containing linkages, where n is an integer greater than or equal to 1, at least 80% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure.In one embodiment of an oligomer having n chiral phosphorous-containing linkages, where n is an integer greater than or equal to 1, at least 90% (rounded to the nearest integer) of the n phosphorous-containing linkages in the oligomer are stereochemically pure.
[0105] In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomers have the same stereo orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least two consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least three consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least four consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least five consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 6 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S PIn one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 7 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 8 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 9 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 10 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 11 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 12 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 13 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S PIn one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 14 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 15 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 16 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 17 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 18 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P In one embodiment of an oligomer having n chiral phosphorous-containing linkages (n is an integer equal to or greater than 1), the oligomer contains at least 19 consecutive stereo-pure phosphorous-containing linkages of the same stereo-orientation (i.e., R P Orientation or S P It contains at least 20 consecutive stereo-pure phosphorous-containing bonds (in either orientation).
[0106] 9. Morpholino Oligomers Exemplary embodiments of the present disclosure include those having the following general structure, as set forth in Figure 2 of Summerton, J. et al., Antisense & Nucleic Acid Drug Development, 7:187-195 (1997): [ka] The present invention relates to a phosphorodiamidate morpholino oligomer of the formula: ##STR1## The morpholino described herein is intended to encompass all stereoisomers and tautomers of the above general structure. The synthesis, structure and binding properties of morpholino oligomers are described in detail in U.S. Patent Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,521,063; 5,506,337; 8,076,476; and 8,299,206, and the above patents are incorporated herein by reference.
[0107] In certain embodiments, the morpholino is conjugated to a "tail" moiety at the 5' or 3' end of the oligomer to increase its stability and / or solubility. Exemplary tails include: [ka] Examples include:
[0108] In various embodiments, the antisense oligomer conjugates of the present disclosure have formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; T is: [ka] is a moiety selected from; R 1 is C1-C6 alkyl; The targeting sequence is complementary to the exon 45 annealing site of the dystrophin pre-mRNA, designated H45A(-03+19).
[0109] In various embodiments, T is [ka] is.
[0110] In various embodiments, R 1 is methyl, CF3, CCl3, CFCl2, CF2Cl, ethyl, CH2CF3, CF2CF3, propyl, isopropyl, butyl, isobutyl, sec-butyl, t-butyl, pentyl, isopentyl, neopentyl, hexyl, isohexyl, 3-methylpentyl, 2,2-dimethylbutyl or 2,3-dimethylbutyl.
[0111] In some embodiments, the antisense oligomer conjugate of Formula (I) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is a 0.6HCl salt.
[0112] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).
[0113] In some embodiments, the targeting sequence is SEQ ID NO:1 (5'-CAATGCCATCCTGGAGTTCCTG-3'), where each thymine (T) is optionally a uracil (U).
[0114] In various embodiments, T is [ka] and the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3'), where each thymine (T) is optionally a uracil (U).
[0115] In various embodiments, T is [ka] and the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3').
[0116] In some embodiments, including for example some embodiments of formula (I), the antisense oligomer conjugate of the present disclosure has formula (II): [ka] or a pharmaceutically acceptable salt thereof, wherein Each Nu is a nucleobase that together form a targeting sequence complementary to the exon 45 annealing site of the dystrophin pre-mRNA designated H45A(-03+19).
[0117] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).
[0118] In various embodiments, each Nu from 1 to 22 and 5' to 3' is (SEQ ID NO: 1): [Table 1] In the table, A is [ka] and C is [ka] and G is [ka] and X is [ka] In certain embodiments, each X is independently [ka] is.
[0119] In some embodiments, the antisense oligomer conjugate of Formula (II) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is a 0.6HCl salt.
[0120] In some embodiments, including for example some embodiments of formula (II), the antisense oligomer conjugate of the present disclosure has formula (IIA): [ka] where each Nu is a nucleobase that together form a targeting sequence complementary to the exon 45 annealing site of the dystrophin pre-mRNA designated H45A(-03+19).
[0121] In some embodiments, each Nu is independently selected from cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).
[0122] In various embodiments, each Nu from 1 to 30 and 5' to 3' is (SEQ ID NO: 1): [Table 2] In the table, A is [ka] and C is [ka] and G is [ka] and X is [ka] In certain embodiments, each X is [ka] is.
[0123] In some embodiments, including, for example, embodiments of the antisense oligomer conjugates of Formula (II) and Formula (IIA), the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3'), where each thymine (T) is optionally uracil (U). In various embodiments, including, for example, embodiments of the antisense oligomer conjugates of Formula (II) and Formula (IIA), the targeting sequence is SEQ ID NO: 1 (5'-CAATGCCATCCTGGAGTTCCTG-3').
[0124] In some embodiments, including for example, embodiments of the antisense oligomer conjugate of formula (I), the antisense oligomer conjugate of the present disclosure has formula (III): [ka] or a pharmaceutically acceptable salt thereof.
[0125] In some embodiments, the antisense oligomer conjugate of Formula (III) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is a 0.6HCl salt.
[0126] In some embodiments, including for example, embodiments of the antisense oligomer conjugate of formula (III), the antisense oligomer conjugate of the present disclosure has formula (IIIA): [ka] This is due to the following.
[0127] In some embodiments of the present disclosure, including some embodiments of the antisense oligomer conjugate of Formula (I) and embodiments of the antisense oligomer conjugate of Formula (III), the antisense oligomer conjugate has Formula (IV): [ka] or a pharmaceutically acceptable salt thereof.
[0128] In some embodiments, the antisense oligomer conjugate of Formula (IV) is its HCl (hydrochloric acid) salt. In certain embodiments, the HCl salt is a 0.6HCl salt.
[0129] In some embodiments, including for example, embodiments of the antisense oligomer conjugate of formula (IV), the antisense oligomer conjugate of the present disclosure has formula (IVA): [ka] This is due to the following.
[0130] 10. Nucleobase Modifications and Substitutions In certain embodiments, the antisense oligomer conjugates of the present disclosure are composed of RNA nucleobases and DNA nucleobases (often simply referred to in the art as "bases"). RNA bases are commonly known as adenine (A), uracil (U), cytosine (C), and guanine (G). DNA bases are commonly known as adenine (A), thymine (T), cytosine (C), and guanine (G). In various embodiments, the antisense oligomer conjugates of the present disclosure are composed of cytosine (C), guanine (G), thymine (T), adenine (A), 5-methylcytosine (5mC), uracil (U), and hypoxanthine (I).
[0131] In certain embodiments, one or more RNA or DNA bases in an oligomer may be modified or replaced with a base other than an RNA or DNA base. Oligomers containing modified or replaced bases include those in which one or more of the purine or pyrimidine bases most commonly found in nucleic acids are replaced with a rare or unnatural base.
[0132] Purine bases have the following general formula: [ka] It contains a pyrimidine ring fused with an imidazole ring, as represented by: Adenine and guanine are the two most common purine nucleobases found in nucleic acids. Other naturally occurring purines include, but are not limited to, N 6 -methyladenine, N 2 -methylguanine, hypoxanthine, and 7-methylguanine.
[0133] The pyrimidine base has the following general formula: [ka] The oligomers described herein contain a six-membered pyrimidine ring, as represented by the formula: Cytosine, uracil, and thymine are the most common pyrimidine bases found in nucleic acids. Other naturally occurring pyrimidines include, but are not limited to, 5-methylcytosine, 5-hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the oligomers described herein contain a thymine base in place of uracil.
[0134] Other suitable bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine or derivatives thereof; N 2 -Cyclopentylguanine (cPent-G), N 2 -cyclopentyl-2-aminopurine (cPent-AP) and N 22-propyl-2-aminopurine (Pr-AP), pseudouracil or its derivatives; and degenerate bases or universal bases such as 2,6-difluorotoluene or non-existent bases such as abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives (azaribose) in which the ring oxygen is replaced with nitrogen). Examples of Super A, Super G and Super T derivatives can be found in U.S. Patent No. 6,683,173 (Epoch Biosciences), the entirety of which is incorporated herein by reference. It has been shown that cPent-G, cPent-AP and Pr-AP have reduced immunostimulatory effects when incorporated into siRNA (Peacock H. et al., J.Am.Chem.Soc.2011,133,9200). Pseudouracil is a naturally occurring isomeric form of uracil that has a C-glycoside, like uridine, rather than the usual N-glycoside. Synthetic mRNAs containing pseudouridine may have an improved safety profile compared to mPvNAs containing uridine (WO2009127230, incorporated herein by reference in its entirety).
[0135] Certain nucleobases are particularly useful for increasing the binding affinity of the antisense oligomer conjugate of the present disclosure.These include 5-substituted pyrimidines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines.5-methylcytosine substitution has been shown to increase the stability of nucleic acid duplexes by 0.6-1.2°C, and is currently a preferred base substitution, particularly when combined with 2'-O-methoxyethyl sugar modification.Further exemplary modified nucleobases include those in which at least one hydrogen atom of the nucleobase is replaced with fluorine.
[0136] 11. Pharmaceutically acceptable salts of antisense oligomer conjugates Certain embodiments of the antisense oligomer conjugates described herein may contain basic functional groups, such as amino or alkylamino, and therefore can form pharmaceutically acceptable salts with pharmaceutically acceptable acids. In this regard, the term "pharmaceutically acceptable salts" refers to relatively non-toxic inorganic or organic acid addition salts of the antisense oligomer conjugates of the present disclosure. These salts can be prepared on-site during the manufacturing process of the administration vehicle or dosage form, or can be prepared separately by reacting the purified free base form of the antisense oligomer conjugate of the present disclosure with an appropriate organic or inorganic acid and then separating the salt thus formed during the purification process. Representative salts include hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, tosylate, citrate, maleate, fumarate, succinate, tartrate, naphthylate, mesylate, glucoheptonate, lactobionate, and lauryl sulfonate (see, e.g., Berge et al., (1977) "Pharmaceutical Salts," J. Pharm. Sci. 66:1-19).
[0137] The pharmaceutically acceptable salt of the target antisense oligomer conjugate includes the conventional non-toxic salt or quaternary ammonium salt of antisense oligomer conjugate, for example, the salt derived from non-toxic organic or inorganic acid.For example, such conventional non-toxic salt includes the salt derived from inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, sulfamic acid, phosphoric acid, nitric acid etc.; and the salt derived from organic acid, such as acetic acid, propionic acid, succinic acid, glycolic acid, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, palmitic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxybenzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethanedisulfonic acid, oxalic acid, isothiocyanic acid etc.
[0138] In certain embodiments, the antisense oligomer conjugates of the present disclosure may contain one or more acidic functional groups, and therefore can form pharmaceutically acceptable salts with pharmaceutically acceptable bases.In this case, the term "pharmaceutically acceptable salts" refers to the relatively non-toxic inorganic and organic base addition salts of the antisense oligomer conjugates of the present disclosure.These salts can also be prepared on-site during the manufacturing process of the administration vehicle or dosage form, or can be prepared separately by reacting the purified free acid form of the antisense oligomer conjugate with a suitable base, such as a hydroxide, carbonate, or bicarbonate salt of a pharmaceutically acceptable metal cation, with ammonia, or with a pharmaceutically acceptable organic primary, secondary, or tertiary amine.Representative alkali or alkaline earth salts include lithium salts, sodium salts, potassium salts, calcium salts, magnesium salts, and aluminum salts.Representative organic amines useful for forming base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, etc. (See, e.g., Berge et al., supra).
[0139] III. Formulations and Modes of Administration In certain embodiments, the present disclosure provides a formulation or pharmaceutical composition suitable for therapeutic delivery of the antisense oligomer conjugates described herein.Therefore, in certain embodiments, the present disclosure provides a pharmaceutically acceptable composition comprising a therapeutically effective amount of one or more antisense oligomer conjugates described herein, formulated with one or more pharmaceutically acceptable carriers (additives) and / or diluents.Although the antisense oligomer conjugates of the present disclosure can be administered alone, it is preferred to administer the antisense oligomer conjugates as a pharmaceutical formulation (composition).In one embodiment, the antisense oligomer conjugate of the formulation is according to formula (III).
[0140] Methods for delivering nucleic acid molecules that can be applied to the antisense oligomer conjugates of the present disclosure are described, for example, in Akhtar et al., 1992, Trends Cell Bio., 2:139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed., Akhtar 1995, CRC Press; and Sullivan et al., WO 94 / 02595. These and other protocols can be used for the delivery of virtually any nucleic acid molecule, including the antisense oligomer conjugates of the present disclosure.
[0141] The pharmaceutical compositions of the present disclosure may be specifically formulated for administration in solid or liquid form, including those suitable for: (1) oral administration, e.g., liquid drenches (aqueous or non-aqueous solutions or suspensions), tablets (buccal, sublingual, or intended for systemic absorption), boluses, powders, granules, or pastes applied to the tongue; (2) parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection or sustained-release formulations, e.g., as a sterile solution or suspension; (3) topical application, e.g., as a cream, ointment, or controlled-release patch or spray applied to the skin; (4) vaginal or rectal administration, e.g., as a pessary, cream, or foam; (5) sublingual; (6) ocular; (7) transdermal; or (8) nasal.
[0142] Some examples of materials that can serve as pharmaceutically acceptable carriers include, but are not limited to: (1) sugars such as lactose, glucose, and sucrose; (2) starches such as corn starch and potato starch; (3) cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients such as cocoa butter and suppository wax; (9) oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) propylene glycol (11) polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffer solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; and (22) other non-toxic, compatible substances used in pharmaceutical formulations.
[0143] Other non-limiting examples of agents suitable for formulation with the antisense oligomer conjugates of the present disclosure include: PEG-conjugated nucleic acids, which can facilitate drug penetration into various tissues; phospholipid-conjugated nucleic acids; nucleic acids containing lipophilic moieties; phosphorothioates; P-glycoprotein inhibitors (such as Pluronic P85); biodegradable polymers, such as poly(D,L-lactide-coglycolide) microspheres for sustained release after implantation (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58) (Alkermes, Cambridge, Massachusetts); and loaded nanoparticles, such as those made of polybutylcyanoacrylate, which can deliver drugs across the blood-brain barrier and alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
[0144] The present disclosure also features the use of compositions comprising surface-modified liposomes containing poly(ethylene glycol) ("PEG") lipids (PEG-modified, branched and unbranched, or a combination thereof, or long-circulating or stealth liposomes). The oligomeric conjugates of the present disclosure may also contain covalently attached PEG molecules of various molecular weights. These formulations provide a method for increasing drug accumulation in target tissues. This class of drug carriers resists opsonization and removal by the mononuclear phagocyte system (MPS or RES), thereby extending the blood circulation time of encapsulated drugs and increasing tissue exposure (Lasic et al., Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to selectively accumulate in tumors, speculatively through extravasation and entrapment in vascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). Long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA compared with conventional cationic liposomes, which are known to accumulate in tissues, particularly in MPS (Liu et al. (e.g., Choi et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., WO 96 / 10391; Ansell et al., WO 96 / 10390; Holland et al., WO 96 / 10392). Long-circulating liposomes may be more effective than cationic liposomes at protecting drugs from nuclease degradation, based on their ability to avoid accumulation in metabolically active MPS tissues such as the liver and spleen.
[0145] In a further embodiment, the present disclosure comprises the antisense oligomer conjugate pharmaceutical composition prepared for delivery as described in U.S. Patent No. 6,692,911; U.S. Patent No. 7,163,695; and U.S. Patent No. 7,070,807.In this regard, in one embodiment, the present disclosure provides the antisense oligomer conjugate of the present disclosure in the form of a composition, comprising lysine and histidine copolymer (HK) (described in U.S. Patent No. 7,163,695; U.S. Patent No. 7,070,807; and U.S. Patent No. 6,692,911) alone or in combination with PEG (for example, branched or unbranched PEG or a mixture of both), in combination with PEG and targeting moiety, or in combination with any of the above in combination with crosslinker.In certain embodiments, the present disclosure provides the antisense oligomer conjugate in the form of a pharmaceutical composition, comprising gluconate-modified polyhistidine or gluconyl-polyhistidine / transferrin-polylysine. Those skilled in the art will also recognize that amino acids with similar properties to His and Lys may be substituted within the composition.
[0146] Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives, and antioxidants may also be present in the composition.
[0147] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium disulfite, sodium sulfite, and the like; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.
[0148] Formulations of the present disclosure include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form can vary depending upon the host treated and the particular mode of administration. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of active ingredient which produces a therapeutic effect. This amount will generally range from about 0.1 percent to about 99 percent of the active ingredient, preferably from about 5 percent to about 70 percent, and most preferably from about 10 percent to about 30 percent.
[0149] In certain embodiments, the formulation of the present disclosure comprises an excipient selected from cyclodextrin, cellulose, liposome, micelle-forming agent, such as bile acid, and polymer carrier, such as polyester and polyanhydride; and an antisense oligomer conjugate of the present disclosure. In one embodiment, the antisense oligomer conjugate of the formulation is according to formula (III). In certain embodiments, the formulation makes the antisense oligomer conjugate of the present disclosure orally bioavailable.
[0150] Methods of preparing these formulations and pharmaceutical compositions include combining the antisense oligomer conjugates of the present disclosure with carriers and, optionally, one or more accessory ingredients. The formulations are generally prepared by uniformly and intimately bringing into association the antisense oligomer conjugates of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
[0151] Formulations of the present disclosure suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (with a flavored base, usually sucrose and gum arabic or tragacanth), powders, granules, or as a solution or suspension in an aqueous liquid or a non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as a pastille (with an inert base such as gelatin and glycerin or sucrose and gum arabic) and / or mouthwash, each containing a predetermined amount of an antisense oligomer conjugate of the present disclosure as an active ingredient. The antisense oligomer conjugates of the present disclosure may also be administered as a bolus, electuary, or paste.
[0152] In solid dosage forms of the present disclosure for oral administration (e.g., capsules, tablets, pills, dragees, powders, granules, trouches, etc.), the active ingredient is combined with one or more pharmaceutically acceptable carriers such as sodium citrate or dicalcium phosphate, and / or any of the following: (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethylcellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and / or gum arabic; (3) humectants, such as glycerol; (4) disintegrants, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain (5) solution retarders such as paraffin; (6) absorption enhancers, such as quaternary ammonium compounds and surfactants such as poloxamers and sodium lauryl sulfate; (7) wetting agents, such as cetyl alcohol, glycerol monostearate, and nonionic surfactants; (8) adsorbents such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) release-controlling agents such as crospovidone or ethylcellulose. In the case of capsules, tablets, and pills, the pharmaceutical compositions may also contain buffering agents. Solid pharmaceutical compositions of a similar type may also be used as fillers in soft and hard-shelled gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.
[0153] Tablets can be made by compressing or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surfactants, or dispersants. Molded tablets can be made by molding a mixture of powdered compound moistened with an inert liquid diluent in a suitable machine.
[0154] Tablets and other solid dosage forms of the pharmaceutical compositions of the present disclosure, such as sugar-coated tablets, capsules, pills, and granules, may be scored or formulated with coatings and shells, such as enteric and other coatings well known in the pharmaceutical formulation art. They may also be formulated to provide sustained or controlled release of the active ingredient therein, for example, using various proportions of hydroxypropylmethylcellulose, other polymer matrices, liposomes, and / or microspheres to achieve the desired release profile. They may also be formulated for immediate release, for example, lyophilized. They may be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating sterilizing agents into the form of a sterile solid pharmaceutical composition that can be dissolved in sterile water or some other sterile injectable medium immediately before use. These pharmaceutical compositions may optionally contain opacifying agents and may be of a composition that releases the active ingredient(s) solely or preferentially in a certain part of the digestive tract, optionally with a delayed release. Examples of embedding compositions that can be used include polymeric substances or waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the excipients noted above.
[0155] The liquid dosage form for oral administration of the antisense oligomer conjugate of the present disclosure includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.In addition to active ingredients, liquid dosage form can contain commonly used inert diluents in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and sorbitan fatty acid ester and its mixtures.
[0156] Besides inert diluents, the oral pharmaceutical compositions can also include adjuvants, such as wetting agents, emulsifying and suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents, and preservatives.
[0157] Suspensions may contain, in addition to the active compound, suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
[0158] Formulations for rectal or vaginal administration may be provided as suppositories, which can be prepared by mixing one or more compounds of the present disclosure with one or more suitable non-irritating excipients or carriers including, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which are solid at room temperature but liquid at body temperature and therefore will melt in the rectum or vaginal cavity and release the active compound(s).
[0159] The preparations or dosage forms of the oligomers provided herein for topical or transdermal administration include powder, spray, ointment, paste, cream, lotion, gel, solution, patch and inhalant.The active oligomer conjugate can be mixed under aseptic conditions with a pharmaceutically acceptable carrier and any preservative, buffer or propellant that may be required.Ointment, paste, cream and gel can contain, in addition to the active compound of the present disclosure, excipients such as animal and vegetable fats, oils, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silicic acid, talc and zinc oxide or mixtures thereof.
[0160] Powders and sprays can contain, in addition to the antisense oligomer conjugates of this disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of the above substances. Sprays can additionally contain conventional propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.
[0161] Transdermal patches have the additional advantage of providing controlled delivery of the antisense oligomer conjugate of the present disclosure into the body.Such dosage forms can be prepared by dissolving or dispersing the oligomer in a suitable medium.Absorption enhancers can be used to increase the flux of the drug through the skin.This flux rate can be controlled by providing a rate-controlling membrane or dispersing the drug in a polymer matrix or gel, among other methods known in the art.
[0162] Pharmaceutical compositions suitable for parenteral administration may comprise one or more oligomeric conjugates of the present disclosure in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted immediately before use into a sterile injectable solution or dispersion, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents. Examples of suitable aqueous or nonaqueous carriers that can be used in pharmaceutical compositions of the present disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. In one embodiment, the antisense oligomeric conjugate of the formulation is according to Formula (III):
[0163] These pharmaceutical compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the action of microorganisms on the subject oligomeric conjugates can be ensured by the inclusion of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, and the like, in the compositions. Furthermore, prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of substances that delay absorption, for example, aluminum monostearate and gelatin.
[0164] In some cases, it is desirable to slow down the absorption rate of drugs from subcutaneous or intramuscular injection in order to prolong the effect of drugs.This can be achieved by using liquid suspension of crystalline or amorphous substance with low water solubility, among other methods known in the art.Therefore, the absorption rate of drug depends on its dissolution rate, which in turn depends on the size and crystalline form of crystals.Alternatively, drug can be dissolved or suspended in oily medium to achieve delayed absorption of parenterally administered drug form.
[0165] Injectable depot formulations can be prepared by forming microencapsulated matrices of the subject oligomer conjugates in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of oligomer to polymer and the nature of the specific polymer used, the rate of oligomer release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Injectable depot formulations can also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.
[0166] When the antisense oligomer conjugate of the present disclosure is administered to humans and animals as a pharmaceutical, it can be administered by itself or as a pharmaceutical composition containing, for example, 0.1 to 99% (more preferably 10 to 30%) of the antisense oligomer conjugate together with a pharmaceutically acceptable carrier.
[0167] The formulation or preparation of the present disclosure can be administered orally, parenterally, topically or rectally.Usually, they are administered in the form suitable for each administration route.For example, they are administered in tablet or capsule form, by injection, inhalation, eye drops, ointment, suppository or infusion; by lotion or ointment topically; or by suppository rectally.
[0168] Regardless of the route of administration selected, the antisense oligomer conjugates of the present disclosure and / or pharmaceutical compositions of the present disclosure, which may be used in a suitable hydrated form, may be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient in the pharmaceutical compositions of the present disclosure may vary to provide an amount of the active ingredient effective to obtain the desired therapeutic response without unacceptable toxicity to the patient for a particular patient, composition, and mode of administration.
[0169] The selected dosage level will depend on a variety of factors, including the activity of the particular antisense oligomer conjugate of the present disclosure or its ester, salt, or amide used, the route of administration, the time of administration, the rate of excretion or metabolism of the particular oligomer used, the rate and extent of absorption, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular oligomer used, the age, sex, weight, physical condition, general health, and prior medical history of the patient being treated, and similar factors well known in the medical arts.
[0170] A physician or veterinarian of ordinary skill can readily determine and prescribe the effective amount of pharmaceutical composition required. For example, the physician or veterinarian may start the pharmaceutical composition with a dose of the antisense oligomer conjugate of the present disclosure at a level lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. An appropriate daily dose of the antisense oligomer conjugate of the present disclosure will generally be the amount of antisense oligomer conjugate that is the minimum effective dose to achieve some therapeutic effect. Such an effective amount will generally depend on the factors described herein. When used to achieve the desired effect, oral, intravenous, intracerebroventricular, and subcutaneous doses of the antisense oligomer conjugate of the present disclosure for a patient will generally range from about 0.0001 to about 100 mg per kilogram of body weight per day.
[0171] In some embodiments, antisense oligomer conjugates of the present disclosure are generally administered at a dose of about 10-160 mg / kg or 20-160 mg / kg. In some cases, doses greater than 160 mg / kg may be required. In some embodiments, the intravenous dose is about 0.5 mg-160 mg / kg. In some embodiments, antisense oligomer conjugates are administered at a dose of about 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, or 10 mg / kg. In some embodiments, the antisense oligomer conjugate is administered at about 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, or any combination thereof, including all integers therebetween. In some embodiments, the oligomer is administered at a dose of 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, or 160 mg / kg. In some embodiments, the oligomer is administered at 10 mg / kg. In some embodiments, the oligomer is administered at 20 mg / kg. In some embodiments, the oligomer is administered at 30 mg / kg. In some embodiments, the oligomer is administered at 40 mg / kg. In some embodiments, the oligomer is administered at 60 mg / kg.In some embodiments, the oligomer is administered at 80 mg / kg. In some embodiments, the oligomer is administered at 160 mg / kg. In some embodiments, the oligomer is administered at 50 mg / kg.
[0172] In some embodiments, the antisense oligomer conjugate of Formula (III) is typically administered at a dose of about 10-160 mg / kg or 20-160 mg / kg. In some embodiments, the intravenous dose of the antisense oligomer conjugate of Formula (III) is about 0.5 mg-160 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at a dose of about 0.5 mg / kg, 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, or 10 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at about 10 mg / kg, 11 mg / kg, 12 mg / kg, 15 mg / kg, 18 mg / kg, 20 mg / kg, 21 mg / kg, 25 mg / kg, 26 mg / kg, 27 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 61 mg / kg, 62 mg / kg, 63 mg / kg, 64 mg / kg, 65 mg / kg, 66 mg / kg, 67 mg / kg, 68 mg / kg, 69 mg / kg, 70 mg / kg, 71 mg / kg, 72 mg / kg, 73 mg / kg, 74 mg / kg, 75 mg / kg, 76 mg / kg, 77 mg / kg, 78 mg / kg, 79 mg / kg, 80 mg / kg, 81 mg / kg, 82 mg / kg, 83 mg / kg, 84 mg / kg, 85 mg / kg, 86 mg / kg, 87 mg / kg, In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at a dose of 10 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, 51 mg / kg, 52 mg / kg, 53 mg / kg, 54 mg / kg, 55 mg / kg, 56 mg / kg, 57 mg / kg, 58 mg / kg, 59 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 105 mg / kg, 110 mg / kg, 115 mg / kg, 120 mg / kg, 125 mg / kg, 130 mg / kg, 135 mg / kg, 140 mg / kg, 145 mg / kg, 150 mg / kg, 155 mg / kg, or 160 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 10 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 20 mg / kg.In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 30 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 40 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 60 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 80 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 160 mg / kg. In some embodiments, the antisense oligomer conjugate of Formula (III) is administered at 50 mg / kg.
[0173] If desired, the effective daily amount of the active compound may be administered as two, three, four, five, six or more sub-doses, optionally in unit dosage forms, administered separately at appropriate intervals throughout the day. In certain circumstances, administration is a single daily dose. In certain embodiments, to maintain desired functional dystrophin protein expression, administration is performed every 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, or 14 days as needed, or every 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, or 12 weeks, or every 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or 12 months. In certain embodiments, administration is performed once or multiple times every 2 weeks. In some embodiments, administration is performed once or multiple times every 2 weeks. In various embodiments, administration is performed once or multiple times every month. In certain embodiments, the administration is once a month.
[0174] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg weekly. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg weekly. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg weekly. As used herein, weekly is understood to have its art-recognized meaning of weekly.
[0175] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every other week. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every other week. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every other week. As used herein, biweekly is understood to have the art-recognized meaning of biweekly.
[0176] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg every three weeks. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg every three weeks. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg every three weeks. As used herein, every three weeks is understood to have the art-recognized meaning of once every three weeks.
[0177] In various embodiments, the antisense oligomer conjugate is administered at 10 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 20 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 30 mg / kg monthly. In various embodiments, the antisense oligomer conjugate is administered at 40 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 60 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 80 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 100 mg / kg monthly. In some embodiments, the antisense oligomer conjugate is administered at 160 mg / kg monthly. As used herein, monthly is understood to have its art-recognized meaning.
[0178] As is understood in the art, weekly, biweekly, every three weeks, or monthly administration can be in one or more administrations or one or more sub-doses as discussed herein.
[0179] The nucleic acid molecules and antisense oligomer conjugates described herein can be administered to cells by various methods known to those skilled in the art, including but not limited to, encapsulation in liposomes, iontophoresis, or by incorporating into other media described herein and known in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules and bioadhesive microspheres.In certain embodiments, microemulsification technology can be used to improve the bioavailability of lipophilic (water-insoluble) pharmaceuticals.Examples include trimetrine (Dordunoo, SK et al., Drug Development and Industrial Pharmacy, 17(12), 1685-1713, 1991) and REV5901 (Sheen, PC et al., J Pharm Sci 80(7), 712-714, 1991). Among other benefits, microemulsification increases bioavailability by allowing preferential absorption into the lymphatic system instead of the circulatory system, thereby bypassing the liver and preventing breakdown of the compound in the hepatobiliary circulation.
[0180] In one aspect of the present disclosure, the formulation contains micelles formed from an oligomer provided herein and at least one amphiphilic carrier, the micelles having an average diameter of less than about 100 nm. In a more preferred embodiment, micelles having an average diameter of less than about 50 nm are provided, and in an even more preferred embodiment, micelles having an average diameter of less than about 30 nm or in some cases less than about 20 nm are provided.
[0181] While any suitable amphiphilic carrier is contemplated, presently preferred carriers generally have Generally-Recognized-as-Safe (GRAS) status and are capable of solubilizing the antisense oligomer conjugates of the present disclosure and microemulsifying them when the solution subsequently contacts a complex aqueous phase (such as that found in the human gastrointestinal tract). Amphiphilic components that meet these requirements typically have an HLB (hydrophilic-lipophilic balance) value of 2 to 20 and contain linear aliphatic radicals in the C-6 to C-20 range in their structure. Examples include polyethylene glycolated fatty glycerides and polyethylene glycol.
[0182] Examples of amphiphilic carriers include saturated and monounsaturated polyethylene glycolated fatty acid glycerides, such as those derived from various fully or partially hydrogenated vegetable oils. These oils can be advantageous in that they consist of tri-, di-, and mono-glycerides and the corresponding di- and mono-poly(ethylene glycol) esters of fatty acids, with a particularly favorable fatty acid composition including 4-10% capric acid, 3-9% capric acid, 40-50% lauric acid, 14-24% myristic acid, 4-14% palmitic acid, and 5-15% stearic acid. Another useful class of amphiphilic carriers includes partially esterified sorbitan and / or sorbitol with saturated or monounsaturated fatty acids (SPAN series) or their corresponding ethoxylated analogs (TWEEN series).
[0183] Commercially available amphiphilic carriers may be particularly useful, including the Gelucire series, Labrafil, Labrasol, or Lauroglycol (all manufactured and distributed by Gattefosse of Saint-Priest, France), PEG-mono-oleate, PEG-di-oleate, PEG-mono- and di-laurate, lecithin, polysorbate 80, and the like (manufactured and distributed by numerous companies in the United States and internationally).
[0184] In certain embodiments, delivery of the pharmaceutical compositions of the present disclosure may be achieved by the use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., to introduce them into suitable host cells. Specifically, for delivery, the pharmaceutical compositions of the present disclosure may be formulated by encapsulating them in any of lipid particles, liposomes, vesicles, nanospheres, nanoparticles, etc. The formulation and use of such delivery vehicles may be carried out using known conventional techniques.
[0185] Hydrophilic polymers suitable for use in the present disclosure are those that are readily water-soluble, can be covalently attached to vesicle-forming lipids, and are tolerated in vivo (i.e., biocompatible) without toxic effects. Suitable polymers include poly(ethylene glycol) (PEG), polylactic acid (also known as polylactide), polyglycolic acid (also known as polyglycolide), polylactic-polyglycolic acid copolymers, and polyvinyl alcohol. In certain embodiments, the polymer has a weight-average molecular weight of about 100 or 120 daltons to about 5,000 or 10,000 daltons, or about 300 daltons to about 5,000 daltons. In other embodiments, the polymer is a poly(ethylene glycol) having a weight-average molecular weight of about 100 to about 5,000 daltons, or about 300 to about 5,000 daltons. In certain embodiments, the polymer is a poly(ethylene glycol) having a weight-average molecular weight of about 750 daltons, e.g., PEG(750). Polymers may also be defined by the number of monomers contained therein; preferred embodiments of the present disclosure utilize polymers of at least about three monomers, such three-monomer PEG polymers having a molecular weight of about 132 daltons.
[0186] Other hydrophilic polymers that may be suitable for use in the present disclosure include polyvinylpyrrolidone, polymethoxazoline, polyethyloxazoline, polyhydroxypropylmethacrylamide, polymethacrylamide, polydimethylacrylamide, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.
[0187] In certain embodiments, the formulations of the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic acid esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.
[0188] Cyclodextrins are cyclic oligosaccharides consisting of six, seven, or eight glucose units, designated by the Greek letters α, β, or γ. The glucose units are linked by α-1,4-glucosidic bonds. The chair conformation of the sugar units results in both secondary hydroxyl groups (at C-2 and C-3) located on one side of the ring and both primary hydroxyl groups at C-6 on the other. This results in a hydrophilic exterior, which makes cyclodextrins water-soluble. In contrast, the cyclodextrin cavity is hydrophobic, being lined by hydrogen and ether-like oxygen atoms at C-3 and C-5. These matrices allow complexation with a variety of relatively hydrophobic compounds, including steroid compounds such as 17α-estradiol (see, e.g., van Uden et al., Plant Cell Tiss. Org. Cult. 38:1-3-113 (1994)). Complexation occurs through van der Waals interactions and hydrogen bond formation. For a review of the chemistry of cyclodextrins, see Wenz, Agnew. Chem. Int. Ed. Engl., 33:803-822 (1994).
[0189] The physicochemical properties of cyclodextrin derivatives vary greatly depending on their type and degree of substitution. For example, their aqueous solubility ranges from insoluble (e.g., triacetyl-beta-cyclodextrin) to 147% soluble (w / v) (G-2-beta-cyclodextrin). Furthermore, they are soluble in many organic solvents. This property of cyclodextrins allows for the control of the solubility of various formulation components by increasing or decreasing their solubility.
[0190] Numerous cyclodextrins and methods for their preparation have been described. For example, Parmeter (I) et al. (U.S. Pat. No. 3,453,259) and Gramera et al. (U.S. Pat. No. 3,459,731) describe electrically neutral cyclodextrins. Other derivatives include cyclodextrins with cationic character [Parmeter (II), U.S. Pat. No. 3,453,257], insoluble crosslinked cyclodextrins (Solms, U.S. Pat. No. 3,420,788), and cyclodextrins with anionic character [Parmeter (III), U.S. Pat. No. 3,426,011]. Cyclodextrin derivatives with anionic character include those derived from the parent cyclodextrin by the addition of carboxylic, phosphorous, phosphinic, phosphonic, phosphoric, thiophosphonic, thiosulfinic, and sulfonic acids [Parmeter (III), see above]. Additionally, sulfoalkyl ether cyclodextrin derivatives have been described by Stella et al. (US Pat. No. 5,134,127).
[0191] Liposomes consist of at least one lipid bilayer membrane surrounding an aqueous interior compartment. Liposomes can be characterized by membrane type and size. Small unilamellar vesicles (SUVs) have a single membrane and typically range in diameter from 0.02 to 0.05 μm; large unilamellar vesicles (LUVs) typically are larger than 0.05 μm. Large oligolamellar vesicles and multilamellar vesicles typically have multiple concentric membrane layers and typically are larger than 0.1 μm. Liposomes with multiple non-concentric membranes, i.e., larger vesicles containing multiple smaller vesicles, are called multivesicular vesicles.
[0192] One aspect of the present disclosure relates to a formulation comprising liposomes containing the antisense oligomer conjugates of the present disclosure, wherein the liposome membrane is formulated to provide liposomes with enhanced delivery capacity. Alternatively or additionally, the antisense oligomer conjugates of the present disclosure may be contained within or adsorbed onto the liposome bilayer membrane of the liposome. The antisense oligomer conjugates of the present disclosure may be aggregated with lipid surfactants and delivered into the interior space of the liposome; in such cases, the liposome membrane is formulated to be resistant to the disruptive effects of the active agent-surfactant aggregates.
[0193] In one embodiment of the present disclosure, the lipid bilayer of a liposome contains lipids derivatized with poly(ethylene glycol) (PEG), such that the PEG chains extend from the inner surface of the lipid bilayer into the interior space surrounded by the liposome and from the outside of the lipid bilayer into the surrounding environment.
[0194] The active agent contained within the liposomes of the present disclosure is in a solubilized form. Aggregates of surfactant and active agent (e.g., emulsions or micelles containing the active agent of interest) can be encapsulated within the interior space of liposomes of the present disclosure. The surfactant acts to disperse and solubilize the active agent and can be selected from any suitable aliphatic, alicyclic, or aromatic surfactant, including, but not limited to, biocompatible lysophosphatidylcholine (LPG) of various chain lengths (e.g., about C14 to about C20). Polymer-derivatized lipids, such as PEG lipids, can inhibit micelle / membrane fusion and can also be used to form micelles, as the addition of a polymer to the surfactant molecule lowers the surfactant's CMC and promotes micelle formation. While surfactants with CMCs in the micromolar range are preferred, micelles encapsulated within the liposomes of the present disclosure can also be prepared using surfactants with higher CMCs.
[0195] Liposomes according to the present disclosure can be prepared by any of a variety of techniques known in the art. See, for example, U.S. Pat. No. 4,235,871; WO 96 / 14057; New RRC, Liposomes: A Practical Approach, IRL Press, Oxford (1990), pages 33-104; and Lasic DD, Liposomes from Physics to Applications, Elsevier Science Publishers BV, Amsterdam, 1993. For example, liposomes according to the present disclosure can be prepared by dispersing a lipid derivatized with a hydrophilic polymer within preformed liposomes at a lipid concentration corresponding to the final mole percent of derivatized lipid desired in the liposome, such as by exposing the preformed liposomes to micelles composed of a lipid-grafted polymer. Liposomes containing hydrophilic polymers can also be formed by homogenization, lipid-region hydration, or extrusion techniques known in the art.
[0196] In another exemplary formulation method, the active agent is first dispersed in lysophosphatidylcholine or other low CMC surfactants (including polymer-grafted lipids) that readily solubilize hydrophobic molecules by sonication. The resulting micellar suspension of the active agent is then used to rehydrate a dried lipid sample containing an appropriate mole percent of polymer-grafted lipid or cholesterol. The lipid and active agent suspension is then converted into liposomes using extrusion techniques known in the art, and the resulting liposomes are separated from the unencapsulated solution by standard column separation.
[0197] In one aspect of the present disclosure, liposomes are prepared to have a substantially uniform size within a selected size range. One effective sizing method involves extruding an aqueous suspension of liposomes through a series of polycarbonate membranes with a selected uniform pore size; the pore size of the membrane corresponds approximately to the maximum size of the liposomes obtained by extrusion through the membrane. See, for example, U.S. Patent No. 4,737,323 (April 12, 1988). In certain embodiments, reagents such as DharmaFECT® and Lipofectamine® can be used to introduce polynucleotides or proteins into cells.
[0198] The release characteristics of the disclosed formulations depend on the encapsulation material, the concentration of the encapsulated drug, and the presence of release-modifying agents. For example, release can be engineered to be pH-dependent using a pH-sensitive coating that releases only at low pH, such as in the stomach, or at high pH, such as in the intestine. Enteric coatings can be used to prevent release until after passage through the stomach. Multiple coatings or a mixture of cyanamide encapsulated in various materials can be used to achieve initial release in the stomach and then in the intestine. Release can also be engineered by including salts or pore-forming agents that can increase drug release via water uptake or diffusion from the capsule. Excipients that modify drug solubility can also be used to control the release rate. Agents that promote matrix degradation or release from the matrix can also be incorporated. These can be added to the drug, added as a separate phase (i.e., as microparticles), or co-dissolved in the polymer phase, depending on the compound. In most cases, the amount should be between 0.1 and 30 percent (w / w polymer). Types of degradation accelerators include inorganic salts such as ammonium sulfate and ammonium chloride; organic acids such as citric acid, benzoic acid, and ascorbic acid; inorganic bases such as sodium carbonate, potassium carbonate, calcium carbonate, zinc carbonate, and zinc hydroxide; and organic bases such as protamine sulfate, spermine, choline, ethanolamine, diethanolamine, and triethanolamine, as well as surfactants such as Tween® and Pluronic®. Pore-forming agents, which impart microstructure to the matrix (i.e., inorganic salts and water-soluble compounds such as sugars), are added as microparticles, typically ranging from 1 to 30 percent (w / w polymer).
[0199] Uptake can also be manipulated by changing the residence time of the particles in the gastrointestinal tract. This can be achieved, for example, by coating the particles with a mucoadhesive polymer or by selecting a mucoadhesive polymer as the encapsulating material. Examples include most polymers with free carboxyl groups, such as chitosan, cellulose, and especially polyacrylates (as used herein, polyacrylate refers to polymers containing acrylate groups and modified acrylate groups such as cyanoacrylate and methacrylate).
[0200] The antisense oligomer conjugates can be formulated to fit within a surgical or medical device or implant, or adapted to be released by a surgical or medical device or implant. In certain embodiments, implants can be coated with or otherwise treated with the antisense oligomer conjugates. For example, implants can be coated with the pharmaceutical compositions of the present disclosure using hydrogels or other polymers, such as biocompatible and / or biodegradable polymers (i.e., the use of hydrogels or other polymers can make the composition suitable for use in medical devices). Polymers and copolymers for coating medical devices with drugs are well known in the art. Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prosthetic organs, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter-defibrillators, IV needles, pins, screws, plates, and other devices for bone fixation and formation, as well as other wound healing devices and artificial tissue matrices.
[0201] In addition to the methods provided herein, the antisense oligomer conjugates used in accordance with the present disclosure can be formulated for administration in any convenient manner for use in human or veterinary medicine, just like other pharmaceuticals. The antisense oligomer conjugates and their corresponding formulations can be administered alone or in combination with other therapeutic strategies for the treatment of muscular dystrophy, such as myoblast transplantation, stem cell therapy, administration of aminoglycoside antibiotics, proteasome inhibitors, and upregulation therapy (e.g., upregulation of utrophin, the autosomal paralog of dystrophin).
[0202] In some embodiments, an additional therapeutic agent may be administered prior to, concurrently with, or following administration of an antisense oligomer conjugate of the present disclosure. For example, an antisense oligomer conjugate may be administered in combination with a steroid and / or an antibiotic. In certain embodiments, the antisense oligomer conjugate is administered to a patient receiving background steroid therapy (e.g., intermittent or chronic / continuous background steroid therapy). For example, in some embodiments, the patient is receiving treatment with a corticosteroid prior to administration of the antisense oligomer and continues to receive that steroid treatment. In some embodiments, the steroid is a glucocorticoid or prednisone.
[0203] The routes of administration described are merely guidelines, as one skilled in the art can readily determine the optimum route of administration and any dosage for any particular animal and condition. Several methods have been attempted to introduce functional genetic material de novo into cells in vitro and in vivo (Friedmann (1989) Science, 244:1275-1280). These methods include incorporating the gene to be expressed into modified retroviruses (Friedmann (1989) supra; Rosenberg (1991) Cancer Research 51(18), suppl.:5074S-5079S); into non-retroviral vectors (e.g., adeno-associated virus vectors) (Rosenfeld et al. (1992) Cell, 68:143-155; Rosenfeld et al. (1991) Science, 252:431-434); or by liposomal delivery of the transgene linked to a heterologous promoter-enhancer element (Friedmann (1989) supra; Brigham et al. (1989) Am. J. Med. Sci., 298:278-281; Nabel et al. (1990) Science, 249:1285-1288; Hazinski et al. al. (1991) Am. J. Resp. Cell Molec. Biol., 4:206-209; and Wang and Huang (1987) Proc. Natl. Acad. Sci. (USA), 84:7851-7855); transgene delivery in conjunction with ligand-specific cation-based transport systems (Wu and Wu (1988) J. Biol. Chem., 263:14621-14624) or the use of naked DNA expression vectors (Nabel et al. (1990), supra; Wolff et al. (1990) Science, 247:1465-1468). Direct injection of transgenes into tissues results in only local expression (Rosenfeld (1992) supra; Rosenfeld et al. (1991) supra; Brigham et al. (1989) supra; Nabel (1990) supra; and Hazinski et al. (1991) supra).The group of Brigham et al. (Am. J. Med. Sci. (1989) 298:278-281 and Clinical Research (1991) 39 (abstract)) reported that intravenous or intratracheal administration of DNA-liposome complexes resulted in in vivo transfection exclusively in the lungs of mice. A review of human gene therapy methods is provided by Anderson, Science (1992) 256:808-813.
[0204] In further embodiments, the pharmaceutical compositions of the present disclosure may further comprise carbohydrates, as described in Han et al., Nat. Comms. 7, 10981 (2016), the entire contents of which are incorporated herein by reference. In some embodiments, the pharmaceutical compositions of the present disclosure may comprise 5% hexose carbohydrates. For example, the pharmaceutical compositions of the present disclosure may comprise 5% glucose, 5% fructose, or 5% mannose. In certain embodiments, the pharmaceutical compositions of the present disclosure may comprise 2.5% glucose and 2.5% fructose. In some embodiments, pharmaceutical compositions of the present disclosure may comprise carbohydrates selected from arabinose present in an amount of 5% by volume, glucose present in an amount of 5% by volume, sorbitol present in an amount of 5% by volume, galactose present in an amount of 5% by volume, fructose present in an amount of 5% by volume, xylitol present in an amount of 5% by volume, mannose present in an amount of 5% by volume, a combination of glucose and fructose, each present in an amount of 2.5% by volume, and a combination of glucose present in an amount of 5.7% by volume, fructose present in an amount of 2.86% by volume, and xylitol present in an amount of 1.4% by volume.
[0205] IV.How to use Restoring the dystrophin reading frame using exon skipping A promising therapeutic approach for treating DMD, which is caused by an out-of-frame mutation in the dystrophin gene, is suggested by a milder form of dystrophinopathy known as BMD, which is caused by an in-frame mutation. If the out-of-frame mutation can be converted to an in-frame mutation, the mRNA reading frame can be hypothetically preserved, resulting in the production of a functional dystrophin protein, albeit with an internal truncation. The antisense oligomer conjugates of the present disclosure are designed to achieve this.
[0206] Hybridization of the PMO with the target pre-mRNA sequence inhibits the formation of the pre-mRNA splicing complex and deletes exon 45 from the mature mRNA. The structure and conformation of the antisense oligomer conjugates disclosed herein allow for sequence-specific base pairing with complementary sequences. For example, eteplirsen, a PMO designed to skip exon 51 of dystrophin pre-mRNA, uses a similar mechanism to allow sequence-specific base pairing with complementary sequences contained in exon 51 of dystrophin pre-mRNA.
[0207] Normal dystrophin mRNA, containing all 79 exons, produces normal dystrophin protein. The diagram in Figure 1 shows a small section of the dystrophin pre-mRNA and mature mRNA, from exon 47 to exon 53. The shape of each exon indicates how the codon is split between exons; noteworthy is that each codon consists of three nucleotides. Rectangular exons begin and end with a complete codon. Arrow-shaped exons begin with a complete codon but end with a split codon that contains only nucleotide #1 of the codon. Nucleotides #2 and #3 of this codon are contained in the next exon, which begins with a chevron.
[0208] DMD typically occurs when the dystrophin mRNA is missing an entire exon from the dystrophin gene. The diagram in Figure 2 illustrates the type of genetic mutation known to cause DMD (deletion of exon 50). Because exon 49 ends with a complete codon and exon 45 begins with the second nucleotide of the codon, the reading frame after exon 49 shifts, resulting in an out-of-frame mRNA reading frame and incorporation of incorrect amino acids downstream of the mutation. This results in the production of an unstable dystrophin protein lacking a functional C-terminal dystroglycan-binding domain.
[0209] Eteplirsen restores the mRNA reading frame by skipping exon 51. Because exon 49 ends with a complete codon and exon 52 begins with the first nucleotide of the codon, deletion of exon 45 restores the reading frame, thereby producing an internally truncated dystrophin protein with an intact dystroglycan binding site, similar to "in-frame" BMD mutations (Figure 3).
[0210] Preclinical studies support the feasibility of using exon skipping to restore the dystrophin mRNA open reading frame and ameliorate the DMD phenotype. Numerous studies using dystrophin animal models of DMD have shown that restoring dystrophin via exon skipping reliably restores muscle strength and function (Sharp 2011; Yokota 2009; Wu 2008; Wu 2011; Barton-Davis 1999; Goyenvalle 2004; Gregorevic 2006; Yue 2006; Welch 2007; Kawano 2008; Reay 2008; van Putten 2012). One compelling example of this is a study comparing dystrophin levels after exon skipping (using PMO) therapy with muscle function in the same tissue. In dystrophin mdx mice, tibialis anterior (TA) muscles treated with a mouse-specific PMO maintained approximately 75% of their maximum load capacity after stress-induced contraction, whereas the contralateral untreated TA muscles maintained only approximately 25% of their maximum load capacity (p<0.05) (Sharp 2011). In another study, three dystrophin CXMD dogs aged 2–5 months underwent exon-skipping therapy with a PMO specific for their gene mutation, administered weekly for 5–7 weeks or biweekly for 22 weeks. All three dogs treated with exon-skipping therapy demonstrated robust dystrophin expression in skeletal muscles throughout their body and maintained or improved walking ability (15-m sprint test) compared to baseline. In contrast, age-matched untreated CXMD dogs showed a significant decline in walking ability throughout the study period (Yokota 2009).
[0211] PMO has been shown to have higher exon skipping activity than phosphorothioates at equimolar concentrations in both mdx mice and humanized DMD (hDMD) mouse models expressing the entire human DMD transcript (Heemskirk 2009). In vivo analysis using reverse transcription-polymerase chain reaction (RT-PCR) and Western blot (WB) in normal human skeletal muscle cells or muscle cells from DMD patients with various mutations that allow exon 51 skipping was performed. In vitro experiments have demonstrated that eteplirsen (PMO) is a potent inducer of exon 51 skipping, and eteplirsen-induced exon 51 skipping has been confirmed in vivo in a mouse model of hDMD (Arechavala-Gomeza 2007).
[0212] Clinical outcomes for analyzing the effect of antisense oligomer conjugates complementary to the target region of exon 45 of human dystrophin pre-mRNA and inducing exon 45 skipping include percent dystrophin-positive fibers (PDPF), 6-minute walk test (6MWT), loss of ambulation ability (LOA), North Star Ambulatory Assessment (NSAA), pulmonary function tests (PFT), ability to stand without external support (from a supine position), de novo dystrophin production, and other functional measures.
[0213] In some embodiments, the present disclosure provides a method for producing dystrophin in a subject with a dystrophin gene mutation that allows exon 45 skipping, comprising administering to the subject an antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof. In certain embodiments, the present disclosure provides a method for restoring the mRNA reading frame to a subject with Duchenne muscular dystrophy (DMD) with a dystrophin gene mutation that allows exon 45 skipping, thereby inducing dystrophin protein production. Protein production can be measured by reverse transcription polymerase chain reaction (RT-PCR), Western blot analysis, or immunohistochemistry (IHC).
[0214] In some embodiments, the present disclosure provides a method for treating DMD in a subject in need thereof, wherein the subject has a mutation in the dystrophin gene that allows for exon 45 skipping, and the method comprises administering to the subject an antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof. In various embodiments, treatment of the subject is measured by delaying disease progression. In some embodiments, treatment of the subject is measured by maintaining the subject's ability to walk or preventing the subject's decline in ability to walk. In some embodiments, walking ability is measured using the 6-minute walk test (6MWT). In certain embodiments, walking ability is measured using the North Start Ambulatory Assessment (NSAA).
[0215] In various embodiments, the present disclosure provides a method for maintaining or preventing the decline of lung function in a subject with DMD, wherein the subject has a mutation in the DMD gene that allows exon 45 skipping, and the method comprises administering to the subject an antisense oligomer conjugate described herein or a pharmaceutically acceptable salt thereof.In some embodiments, lung function is measured as maximum expiratory pressure (MEP).In certain embodiments, lung function is measured as maximum inspiratory pressure (MIP).In some embodiments, lung function is measured as forced vital capacity (FVC).
[0216] In further embodiments, the pharmaceutical composition of the present disclosure may be co-administered with carbohydrates in the same formulation or in separate formulations, as described in Han et al., Nat. Comms. 7, 10981 (2016), the entire contents of which are incorporated herein by reference. In some embodiments, the pharmaceutical composition of the present disclosure may be co-administered with 5% hexose carbohydrates. For example, the pharmaceutical composition of the present disclosure may be co-administered with 5% glucose, 5% fructose, or 5% mannose. In certain embodiments, the pharmaceutical composition of the present disclosure may be co-administered with 2.5% glucose and 2.5% fructose. In some embodiments, a pharmaceutical composition of the present disclosure may be co-administered with a carbohydrate selected from arabinose present in an amount of 5% by volume, glucose present in an amount of 5% by volume, sorbitol present in an amount of 5% by volume, galactose present in an amount of 5% by volume, fructose present in an amount of 5% by volume, xylitol present in an amount of 5% by volume, mannose present in an amount of 5% by volume, a combination of glucose and fructose, each present in an amount of 2.5% by volume, and a combination of glucose present in an amount of 5.7% by volume, fructose present in an amount of 2.86% by volume, and xylitol present in an amount of 1.4% by volume.
[0217] In various embodiments, the antisense oligomer conjugate of the present disclosure is co-administered with a therapeutically effective amount of a nonsteroidal anti-inflammatory compound. In some embodiments, the nonsteroidal anti-inflammatory compound is an NF-kB inhibitor. For example, in some embodiments, the NF-kB inhibitor can be CAT-1004 or a pharmaceutically acceptable salt thereof. In various embodiments, the NF-kB inhibitor can be a conjugate of salicylate and DHA. In some embodiments, the NF-kB inhibitor is CAT-1041 or a pharmaceutically acceptable salt thereof. In certain embodiments, the NF-kB inhibitor is a conjugate of salicylate and EPA. In various embodiments, the NF-kB inhibitor is [ka] or a pharmaceutically acceptable salt thereof.
[0218] In some embodiments, the nonsteroidal anti-inflammatory compound is a TGF-b inhibitor. For example, in certain embodiments, the TGF-b inhibitor is HT-100.
[0219] In certain embodiments, the antisense oligomer conjugates described herein are used for treatment.In certain embodiments, the antisense oligomer conjugates described herein are used for the treatment of Duchenne muscular dystrophy.In certain embodiments, the antisense oligomer conjugates described herein are used for the manufacture of a drug for treatment.In certain embodiments, the antisense oligomer conjugates described herein are used for the manufacture of a drug for the treatment of Duchenne muscular dystrophy.
[0220] V. Kit The present disclosure also provides a kit for treating patients with genetic diseases, which includes at least one antisense molecule (e.g., an antisense oligomer conjugate comprising the antisense oligomer set forth in SEQ ID NO: 1) packaged in a suitable container, along with instructions for its use. The kit may also include certain peripheral reagents, such as buffers, stabilizers, etc. Those skilled in the art should understand that the application of the above method has broad applicability to identifying antisense molecules suitable for use in the treatment of many other diseases. In one embodiment, the kit includes an antisense oligomer conjugate according to formula (III).
[0221] (Example) Although the foregoing disclosure has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those skilled in the art, in light of the teachings of this disclosure, that certain changes and modifications can be made thereto without departing from the spirit or scope of the appended claims. The following examples are for illustrative purposes only and not limiting. Those skilled in the art will readily recognize a variety of non-critical parameters that can be changed or modified to achieve substantially the same results.
[0222] material and method Cell and tissue culture treatment conditions Exon skipping was measured using differentiated human muscle cells (ZenBio). Specifically, myoblasts (ZenBio, SKB-F) were grown in growth medium (SKB-M; ZenBio) at 37°C and 5% CO2 until 80-90% confluence. Differentiation was initiated by replacing the growth medium with differentiation medium (SKM-D; ZenBio). To assay exon 45 skipping, 1 × 10 differentiated cells were cultured. 4 The cells were seeded into a 24-well plate, and 1 mL of differentiation medium (SKM-D; ZenBio) containing various concentrations of PMO or PPMO was added to each well, followed by incubation for 96 hours.
[0223] Western blot analysis For Western blot analysis, tissues were homogenized using homogenization buffer (4% SDS, 4 M urea, 125 mM Tris-HCl (pH 6.8)) at a ratio of 133 μL of buffer to 9–18 × 20 μm tissue sections, approximately 5 mm in diameter. Corresponding lysates were collected and subjected to protein quantification using the RC DC Protein Assay Kit (BioRad, catalog no. 500-0122) according to the manufacturer's instructions. Tissue extract samples were diluted 1:10 with homogenization buffer to fall within the range of the BSA standard curve. Samples were prepared using 25 μl of protein lysate, 7 μl of NuPAGE LDS Sample Buffer (Life Technologies, catalog no. NP0008, Carlsbad, CA, USA), and 3 μl of NuPAGE Reducing Agent (10x) (Life Technologies, catalog no. NP0004) to obtain the desired amount of protein in a 35 μl sample. Protein samples were heated to 95°C for 5 minutes, then centrifuged and the supernatant was loaded onto NuPAGE Novex 10-well, 1 mm, mini 3-8% polyacrylamide tris-acetate gels (Life Technologies, catalog no. EA0375) at a total protein load of up to 50 μg per lane. Gels were run at room temperature at 150 volts until the dye front was removed from the gel. The resulting protein gel was transferred to a PVDF membrane (Life Technologies, catalog no. LC2007) at room temperature for 75 minutes at 30 volts using NuPAGE transfer buffer (Life Technologies, NP006-1), 10% methanol, and 0.1% NuPAGE antioxidant (Life Technologies, NP0005).
[0224] After protein transfer, the PVDF membrane was immersed in TTBS buffer (1×TBS (Amresco, catalog number J640-4L), 0.1% (v / v) Tween-20). The membrane was transferred to blocking buffer (5% (w / v) non-fat dry milk in TTBS (Lab Scientific, Cat. No. M0841) and soaked overnight at 4°C with gentle shaking. After blocking, the membrane was incubated in DYS1 (Leica, Cat. No. NCL-DYS1) diluted 1:20 in blocking buffer for 60 min at room temperature or in anti-α-actinin antibody (Sigma-Aldrich, Cat. No. NA931V) diluted 1:100,000 in blocking buffer for 20 min at room temperature, then washed six times (5 min each time with TTBS). Horseradish peroxidase-conjugated anti-mouse IgG (GE Healthcare, Cat. No. NA931V) diluted 1:40,000 in blocking buffer was applied to the membrane for 45 min (DYS1) or 15 min (α-actinin), followed by six washes. The ECL Prime Western Detection Kit (GE Gels were exposed to film using a fluoroscopy kit (Microscope Imaging Systems, Inc., Cat. No. RPN2232) and developed accordingly. Developed films were scanned and analyzed using ImageQuant TL Plus software (version 8.1), and linear regression analysis was performed using Graphpad software.
[0225] Each Western blot gel contained a 4-point or 5-point dystrophin standard curve prepared using total protein extracted from normal tissues (e.g., mouse quadriceps, diaphragm, or heart, or NHP quadriceps, diaphragm, or smooth muscle (GI)) diluted to 64%, 16%, 4%, 1%, and 0.25% and spiked into extracts of DMD tissues (e.g., MDX mouse quadriceps, diaphragm, or heart). Standard curve samples were processed as described above. Dystrophin protein levels were determined as a percentage of wild-type dystrophin levels (%WT) by comparing the dystrophin band intensity with the gel standard curve.
[0226] RT-PCR analysis For RT-PCR analysis, RNA was isolated from cells using the Illustra GE spin kit according to the manufacturer's protocol. RNA concentration and purity were determined using a NanoDrop.
[0227] After RNA was subjected to RT-PCR, samples were analyzed using a Caliper instrument using gel capillary electrophoresis. The percentage of exon skipping was calculated using the following equation: (area under the curve of the skipped band) / (sum of the areas under the curve of the skipped and non-skipped bands) × 100.
[0228] Immunohistochemistry: Dystrophin staining: Dystrophin was detected in 10-micron frozen sections of mouse quadriceps muscle using a primary dystrophin antibody (rabbit, dilution 1:250, Abcam, catalog no. ab15277) in 10% goat serum + 1% BSA in PBS and a secondary antibody, Alexa-Fluoro 488 goat anti-rabbit (dilution 1:1000) in 10% goat serum + 1% BSA.
[0229] Preparation of morpholino subunits [ka]
[0230] Referring to Scheme 1, where B represents a base-pairing moiety, morpholino subunits can be prepared from the corresponding ribinucleoside (1) as shown. If necessary, morpholino subunit (2) can be protected by reaction with an appropriate protecting group precursor, such as trityl chloride. As described in more detail below, the 3' protecting group is generally removed during solid-phase oligomer synthesis. The base-pairing moiety can be protected by a method appropriate for solid-phase oligomer synthesis. Suitable protecting groups include benzoyl for adenine and cytosine, phenylacetyl for guanine, and pivaloyloxymethyl for hypoxanthine (I). The pivaloyloxymethyl group can be introduced at the N1 position of the hypoxanthine heterocyclic base. While unprotected hypoxanthine subunits can be used, the activation reaction yield is much better when the base is protected. Other suitable protecting groups include those disclosed in U.S. Pat. No. 8,076,476, incorporated herein by reference in its entirety.
[0231] Reaction of 3 with activated phosphorus compound 4 provides the morpholino subunit bearing the desired linking moiety 5.
[0232] Compounds of structure 4 can be prepared using a number of methods known to those skilled in the art. Coupling with the morpholino moiety then proceeds as outlined above.
[0233] To prepare oligomers containing intersubunit linkages, compounds of structure 5 can be used in solid-phase oligomer synthesis. Such methods are well known in the art. Briefly, the 5' end of a compound of structure 5 can be modified to include a linker to a solid support. Once supported, the protecting group of 5 (e.g., trityl at the 3' end) is removed, and the free amine is reacted with the activated phosphorus moiety of a second compound of structure 5. This sequence is repeated until an oligo of the desired length is obtained. The protecting group at the terminal 3' end can be removed, or left in if 3' modification is desired. The oligo can be cleaved from the solid support by a number of methods, exemplified by treatment with a base that cleaves the bond to the solid support.
[0234] The preparation of morpholino oligomers generally and specific morpholino oligomers of the present disclosure is described in further detail in the Examples.
[0235] Preparation of morpholino oligomers The preparation of compounds of the present disclosure is carried out using the following protocol according to Scheme 2: [ka]
[0236] Preparation of trityl piperazine phenylcarbamate 35: To a cooled suspension of compound 11 in dichloromethane (6 mL / g 11) was added a solution of potassium carbonate (3.2 eq) in water (4 mL / g potassium carbonate). To this two-phase mixture was slowly added a solution of phenyl chloroformate (1.03 eq) in dichloromethane (2 g / g phenyl chloroformate). The reaction mixture was warmed to 20 °C. Upon reaction completion (1-2 h), the layers were separated. The organic layer was washed with water and dried over anhydrous potassium carbonate. The product 35 was isolated by crystallization from acetonitrile.
[0237] Preparation of carbamic alcohol 36: Sodium hydride (1.2 eq) was suspended in 1-methyl-2-pyrrolidinone (32 mL / g sodium hydride). To this suspension was added triethylene glycol (10.0 eq) and compound 35 (1.0 eq). The resulting slurry was heated to 95 °C. Upon reaction completion (1-2 h), the mixture was cooled to 20 °C. To this mixture was added 30% dichloromethane / methyl tert-butyl ether (v:v) and water. The organic layer containing the product was washed successively with aqueous NaOH, aqueous succinic acid, and saturated aqueous sodium chloride. Product 36 was isolated by crystallization from dichloromethane / methyl tert-butyl ether / heptane.
[0238] Preparation of terephthalic acid 37: To a solution of compound 36 in tetrahydrofuran (7 mL / g of 36) was added succinic anhydride (2.0 eq) and DMAP (0.5 eq). The mixture was heated to 50 °C. Upon completion of the reaction (5 h), the mixture was cooled to 20 °C and adjusted to pH 8.5 with aqueous NaHCO3. Methyl tert-butyl ether was added, and the product was extracted into the aqueous layer. Dichloromethane was added, and the mixture was adjusted to pH 3 with aqueous citric acid. The organic layer containing the product was washed with a mixture of pH 3 citrate buffer and saturated aqueous sodium chloride. This dichloromethane solution of 37 was used without isolation in the preparation of compound 38.
[0239] Preparation of 38: To a solution of compound 37 was added N-hydroxy-5-norbornene-2,3-dicarboxylic acid imide (HONB) (1.02 eq), 4-dimethylaminopyridine (DMAP) (0.34 eq), and then 1-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) (1.1 eq). The mixture was heated to 55 °C. Upon completion of the reaction (4-5 h), the mixture was cooled to 20 °C and washed successively with 1:1 0.2 M citric acid / brine and brine. A solvent exchange from the dichloromethane solution to acetone and then N,N-dimethylformamide was performed, and the product was isolated by precipitation from the acetone / N,N-dimethylformamide into saturated aqueous sodium chloride. The crude product was reslurried several times in water to remove residual N,N-dimethylformamide and salts.
[0240] Introduction of the activated "tail" onto the anchor-bearing resin was carried out in dimethylimidazolidinone (DMI) by the method used for incorporation of subunits during solid-phase synthesis.
[0241] PMO Synthesis Method A: Use of Disulfide Anchors [ka]
[0242] The method was carried out in a silanized jacketed peptide vessel (ChemGlass, NJ, USA) equipped with a coarse-porosity (40–60 μm) glass frit, an overhead stirrer, and a three-way Teflon stopcock for bubbling N through the frit or vacuum extraction.
[0243] The resin treatment / wash stage of the following methods consists of two basic operations: resin fluidization or stirred-bed reactor and solvent / solution extraction. For resin fluidization, a stopcock was positioned to allow N2 to flow upward through the frit, and the specified resin treatment / wash was added to the reactor and allowed to penetrate and fully wet the resin. Mixing was then started, and the resin slurry was mixed for the specified time. For solvent / solution extraction, mixing and N2 flow were stopped, the vacuum pump was started, and the stopcock was positioned to drain the resin treatment / wash to waste. Unless otherwise noted, the resin treatment / wash volume was 15 mL per gram of resin.
[0244] Aminomethyl polystyrene resin (100-200 mesh; loading based on nitrogen displacement: approximately 1.0 mmol / g; 75 g, 1 eq., Polymer Labs, UK, Part No. 1464-X799) in a silanized jacketed peptide vessel was mixed with 1-methyl-2-pyrrolidinone (NMP; 20 mL / g resin) for 1-2 hours to swell the resin. After draining the swelling solvent, the resin was washed with dichloromethane (2 × 1-2 min), 5% diisopropylethylamine in 25% isopropanol / dichloromethane (2 × 3-4 min), and dichloromethane (2 × 1-2 min). After draining the last wash, the resin was treated with a 1-methyl-2-pyrrolidinone solution of disulfide anchor 34 (0.17 M; 15 mL / g resin, approximately 2.5 eq.), and the resin / reagent mixture was heated at 45 °C for 60 hours. At the end of the reaction, the heat was removed, the anchor solution was drained, and the resin was washed with 1-methyl-2-pyrrolidinone (4 times 3-4 min) and dichloromethane (6 times 1-2 min). The resin was treated with a 10% (v / v) solution of diethyl dicarbonate in dichloromethane (16 mL / g; 2 times 5-6 min) and then washed with dichloromethane (6 times 1-2 min). The resin was dried under a stream of N2 for 1-3 hours and then under vacuum to a constant weight (±2%). Yield: 110-150% of the original resin weight.
[0245] Determination of loading of aminomethylpolystyrene-disulfide resin: The loading of the resin (number of potentially available reactive sites) is determined by spectrophotometric assay of the number of triphenylmethyl (trityl) groups per gram of resin.
[0246] Transfer a known weight of dry resin (25 ± 3 mg) to a silanized 25 mL volumetric flask and add approximately 5 mL of 2% (v / v) trifluoroacetic acid in dichloromethane. Gently swirl the contents to mix, then allow to stand for 30 minutes. Bring the volume to 25 mL with additional 2% (v / v) trifluoroacetic acid in dichloromethane and mix thoroughly. Using a positive-displacement pipette, transfer an aliquot of the trityl-containing solution (500 μL) to a 10 mL volumetric flask and bring the volume to 10 mL with methanesulfonic acid.
[0247] The trityl cation content in the final solution is measured by UV absorbance at 431.7 nm, and the resin loading is calculated as μmol / g trityl groups per gram of resin using the appropriate volume, dilution factor, extinction coefficient (ε: 41 μmol cm), and resin weight. Assays are performed in triplicate, and the average loading is calculated.
[0248] The resin loading method of this example results in a loading of approximately 500 μmol / g of resin. When the disulfide anchor incorporation step was performed at room temperature for 24 hours, loadings of 300-400 μmol / g were obtained.
[0249] Tail loading: The tail can be introduced onto the solid support using the same equipment and volumes as used for preparing the aminomethylpolystyrene-disulfide resin. The anchor-loaded resin was first deprotected under acidic conditions, and the resulting material was neutralized before coupling. For the coupling step, a 0.2 M solution of 38 in DMI containing 4-ethylmorpholine (NEM, 0.4 M) was used instead of the disulfide anchor solution. After 2 h at 45 °C, resin 39 was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and once with DCM. A solution of 0.4 M benzoic anhydride and 0.4 M NEM was added to the resin. After 25 min, the reactor jacket was cooled to room temperature, and the resin was washed twice with 5% diisopropylethylamine in 25% isopropanol / dichloromethane and eight times with DCM. Resin 40 was filtered and dried under high vacuum. The loading of resin 40 is defined as the loading of the original aminomethylpolystyrene-disulfide resin 39 used for tail loading.
[0250] Solid-phase synthesis: Morpholino oligomers were prepared in 2 mL Gilson polypropylene reaction columns (part number 3980270) using a Gilson AMS-422 Automated Peptide Synthesizer. An aluminum block with channels for water flow was placed around the column when it was placed in the synthesizer. Alternatively, the AMS-422 adds reagent / wash solutions, holds for the specified time, and empties the column using vacuum.
[0251] For oligomers ranging in length up to about 25 subunits, aminomethylpolystyrene-disulfide resins with loadings of about 500 μmol / g are preferred. For larger oligomers, aminomethylpolystyrene-disulfide resins with loadings of 300-400 μmol / g are preferred. If molecules with 5' tails are desired, tailed resins are selected using the same loading guidelines.
[0252] The following reagent solutions were prepared: · Detritylation solution: 10% cyanoacetic acid (w / v) in 4:1 dichloromethane / acetonitrile; · Neutralization solution: 5% diisopropylethylamine in 3:1 dichloromethane / isopropanol; Coupling solution: 0.18 M (or 0.24 M for oligomers longer than 20 subunits) activated morpholino subunits of the desired base and linkage type dissolved in 1,3-dimethylimidazolidinone and 0.4 M N ethylmorpholine.
[0253] Dichloromethane (DCM) was used as a transition wash to separate the different reagent solution washes.
[0254] The synthesizer block was set to 42°C, and 2 mL of 1-methyl-2-pyrrolidinone was added to each column containing 30 mg of aminomethylpolystyrene-disulfide resin (or tail resin), and the column was left at room temperature for 30 minutes. After washing twice with 2 mL of dichloromethane, the following synthesis cycle was used: [Table 3]
[0255] Each column was programmed with the appropriate coupling solution (A, C, G, T, I) in the appropriate order. When the oligomer in the column had fully incorporated its last subunit, the column was removed from the block and a final cycle was performed manually using a coupling solution consisting of 4-methoxytriphenylmethyl chloride (0.32 M in DMI) containing 0.89 M 4-ethylmorpholine.
[0256] Cleavage from the resin and removal of base and backbone protecting groups: After methoxytritylation, the resin was washed eight times with 2 mL of 1-methyl-2-pyrrolidinone. One mL of cleavage solution consisting of 0.1 M 1,4-dithiothreitol (DTT) and 0.73 M triethylamine in 1-methyl-2-pyrrolidinone was added, the column was capped, and the column was left at room temperature for 30 minutes. The solution was then poured into a 12 mL Wheaton vial. The significantly shrunk resin was washed twice with 300 μL of cleavage solution. 4.0 mL of concentrated aqueous ammonia (stored at -20°C) was added to the solution, the vial was tightly capped (with a Teflon-lined screw cap), and the mixture was swirled to mix the solution. The vial was placed in a 45°C oven for 16–24 hours to perform cleavage of the base and backbone protecting groups.
[0257] Purification of the crude product: The ammonolysis solution in a vial was removed from the oven and allowed to cool to room temperature. The solution was diluted with 20 mL of 0.28% aqueous ammonia and passed through a 2.5 x 10 cm column containing Macroprep HQ resin (BioRad). The methoxytrityl containing peak was eluted using a salt gradient (A: 0.28% ammonia and B: 1 M sodium chloride in 0.28% ammonia; 0-100% B in 60 min). The combined fractions were pooled and further processed depending on the desired product.
[0258] Demethoxytritylation of morpholino oligomers: Pooled fractions from Macroprep purification were treated with 1M H3PO4 to lower the pH to 2.5. After initial mixing, the sample was allowed to stand at room temperature for 4 minutes, at which point it was neutralized to pH 10-11 using 2.8% ammonia / water. The product was purified by solid phase extraction (SPE).
[0259] Packing and conditioning of SPE columns: A 20 mL fritted column (BioRad Econo-Pac chromatography Columns (732-1011)) was packed with 3 mL of Amberchrome CG-300M (Rohm and Haas; Philadelphia, PA) and the resin was rinsed with 3 mL of the following: 0.28% NH4OH / 80% acetonitrile; 0.5 M NaOH / 20% ethanol; water; 50 mM H3PO4 / 80% acetonitrile; water; 0.5 NaOH / 20% ethanol; water; 0.28% NH4OH.
[0260] SPE purification: The solution obtained from demethoxytritylation was applied to a column, and the resin was rinsed three times with 3-6 mL of 0.28% aqueous ammonia. A 12 mL Wheaton vial was placed under the column, and the product was eluted by washing twice with 2 mL of 45% acetonitrile in 0.28% aqueous ammonia.
[0261] Product isolation: The solution was frozen on dry ice and the vial placed in a freeze-dryer to yield a fluffy white powder. The sample was dissolved in water and syringe-filtered through a 0.22 micron filter (Pall Life Sciences, Acrodisc 25 mm syringe filter with 0.2 micron HT Tuffryn membrane). The absorbance (OD) was measured in a UV spectrophotometer to determine the OD units of oligomers present, and the sample was aliquoted for analysis. The solution was then returned to a Wheaton vial and freeze-dried.
[0262] Analysis of morpholino oligomers by MALDI: MALDI-TOF mass spectrometry was used to characterize the composition of purified fractions and provide evidence of the identity (molecular weight) of the oligomers. Samples were diluted with the matrix solutions 3,5-dimethoxy-4-hydroxycinnamic acid (sinapic acid), 3,4,5-trihydroxyacetophenone (THAP), or alpha-cyano-4-hydroxycinnamic acid (HCCA) and then run.
[0263] PMO synthesis method B: Use of NCP2 anchor Synthesis of NCP2 anchor: 1. Preparation of methyl 4-fluoro-3-nitrobenzoate (1) [ka] A 100 L flask was charged with 12.7 kg of 4-fluoro-3-nitrobenzoic acid, and 40 kg of methanol and 2.82 kg of concentrated sulfuric acid were added. The mixture was refluxed (65°C) for 36 hours with stirring. The reaction mixture was cooled to 0°C. Crystals formed at 38°C. The mixture was held at 0°C for 4 hours and then filtered under nitrogen. The 100 L flask was rinsed, and the filter cake was washed with 10 kg of methanol cooled to 0°C. The solid filter cake was dried on the funnel for 1 hour, transferred to a tray, and dried in a vacuum oven at room temperature to a constant weight of 13.695 kg of methyl 4-fluoro-3-nitrobenzoate (100% yield; HPLC 99%).
[0264] Preparation of 2.3-nitro-4-(2-oxopropyl)benzoic acid A. (Z)-Methyl 4-(3-hydroxy-1-methoxy-1-oxobut-2-en-2-yl)-3-nitrobenzoate (2) [ka] A 100 L flask was charged with 3.98 kg of methyl 4-fluoro-3-nitrobenzoate (1) from the previous step, 9.8 kg of DMF, and 2.81 kg of methyl acetoacetate. The mixture was stirred and cooled to 0°C. 3.66 kg of DBU was added over approximately 4 hours while maintaining the temperature below 5°C. The mixture was stirred for an additional 1 hour. A solution of 8.15 kg of citric acid in 37.5 kg of purified water was added to the reaction flask while maintaining the reaction temperature below 15°C. After the addition, the reaction mixture was stirred for an additional 30 minutes and then filtered under nitrogen. The wet filter cake was returned to the 100 L flask along with 14.8 kg of purified water. The slurry was stirred for 10 minutes and then filtered. The wet mass was returned to the 100 L flask, slurried with 14.8 kg of purified water for 10 minutes, and filtered to give crude (Z)-methyl 4-(3-hydroxy-1-methoxy-1-oxobut-2-en-2-yl)-3-nitrobenzoate.
[0265] B. 3-Nitro-4-(2-oxopropyl)benzoic acid [ka] Crude (Z)-methyl 4-(3-hydroxy-1-methoxy-1-oxobut-2-en-2-yl)-3-nitrobenzoate was placed in a 100 L reaction flask under nitrogen. 14.2 kg of 1,4-dioxane was added and stirred. A solution of 16.655 kg of concentrated HCl and 13.33 kg of purified water (6 M HCl) was added to the mixture over 2 hours, maintaining the reaction mixture temperature below 15°C. After the addition was complete, the reaction mixture was heated to reflux (80°C) for 24 hours, cooled to room temperature, and filtered under nitrogen. The solid cake was triturated with 14.8 kg of purified water, filtered, and then triturated again with 14.8 kg of purified water and filtered. The solid was returned to the 100 L flask along with 39.9 kg of DCM and refluxed with stirring for 1 hour. 1.5 kg of purified water was added to dissolve the remaining solid. The bottom organic layer was separated into a pre-warmed 72 L flask and then transferred back to a clean, dry 100 L flask. The solution was cooled to 0°C, held for 1 hour, and then filtered. The solid cake was washed twice with a solution of 9.8 kg DCM and 5 kg heptane, then dried on the funnel. The solid was transferred to trays and dried to a constant weight of 1.855 kg of 3-nitro-4-(2-oxopropyl)benzoic acid. Overall yield from compound 1 was 42%. HPLC 99.45%.
[0266] 3. Preparation of N-tritylpiperazine succinate (NTP) [ka] To a 72-L jacketed flask, 1.805 kg of triphenylmethyl chloride and 8.3 kg of toluene (TPC solution) were added under nitrogen. The mixture was stirred until the solids dissolved. To a 100-L jacketed reaction flask, 5.61 kg of piperazine, 19.9 kg of toluene, and 3.72 kg of methanol were added under nitrogen. The mixture was stirred and cooled to 0°C. To this was added the TPC solution in small portions over 4 hours, maintaining the reaction temperature below 10°C. The mixture was stirred at 10°C for 1.5 hours and then allowed to warm to 14°C. 32.6 kg of purified water was charged to the 72-L flask and then transferred to the 100-L flask, maintaining the internal batch temperature at 20±5°C. The layers were allowed to separate, and the bottom aqueous layer was separated and saved. The organic layer was extracted three times with 32 kg of purified water, and the aqueous layer was separated and combined with the saved aqueous solution.
[0267] The remaining organic layer was cooled to 18°C, and a solution of 847 g of succinic acid dissolved in 10.87 kg of purified water was slowly added to the organic layer in small portions. The mixture was stirred at 20±5°C for 1.75 hours. The mixture was filtered, and the solid was washed with 2 kg of TBME and 2 kg of acetone, then dried on the funnel. The filter cake was triturated twice, each time with 5.7 kg of acetone, filtered, and washed with 1 kg of acetone between triturations. The solid was dried on the funnel, then transferred to a tray and dried at room temperature in a vacuum oven until it reached a constant weight of 2.32 kg of NTP. Yield: 80%.
[0268] 4. Preparation of (4-(2-hydroxypropyl)-3-nitrophenyl)(4-tritylpiperazin-1-yl)methanone A. Preparation of 1-(2-nitro-4(4-tritylpiperazine-1-carbonyl)phenyl)propan-2-one [ka] A 100 L jacketed flask was charged with 2 kg of 3-nitro-4-(2-oxopropyl)benzoic acid (3), 18.3 kg of DCM, and 1.845 kg of N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC.HCl) under nitrogen. The solution was stirred until a homogeneous mixture was formed. 3.048 kg of NTP was added over 30 minutes at room temperature and stirred for 8 hours. 5.44 kg of purified water was added to the reaction mixture and stirred for 30 minutes. The layers were separated, and the bottom organic layer containing the product was removed and saved. The aqueous layer was extracted twice with 5.65 kg of DCM. The combined organic layers were washed with a solution of 1.08 kg of sodium chloride in 4.08 kg of purified water. The organic layer was dried over 1.068 kg of sodium sulfate and filtered. The sodium sulfate was washed with 1.3 kg of DCM. The combined organic layers were slurried with 252 g of silica gel and filtered through a filter funnel containing 252 g of silica gel bed. The silica gel bed was washed with 2 kg of DCM. The combined organic layers were evaporated on a rotary evaporator. 4.8 kg of THF was added to the residue, which was then evaporated on a rotary evaporator until 2.5 volumes of crude 1-(2-nitro-4(4-tritylpiperazine-1-carbonyl)phenyl)propan-2-one was obtained in THF.
[0269] B. Preparation of (4-(2-hydroxypropyl)-3-nitrophenyl)(4-tritylpiperazin-1-yl)methanone (5) [ka] A 100-L jacketed flask was charged with 3600 g of 4 from the previous step and 9800 g of THF under nitrogen. The stirred solution was cooled to below 5°C. The solution was diluted with 11,525 g of ethanol, and 194 g of sodium borohydride was added over approximately 2 hours at below 5°C. The reaction mixture was stirred for an additional 2 hours at below 5°C. The reaction was quenched by the slow addition of a solution of approximately 1.1 kg of ammonium chloride in approximately 3 kg of water, maintaining the temperature below 10°C. The reaction mixture was stirred for an additional 30 minutes, filtered to remove inorganics, and then recharged into the 100-L jacketed flask and extracted with 23 kg of DCM. The organic layer was separated, and the aqueous layer was extracted twice more, each time with 4.7 kg of DCM. The combined organic layers were washed with a solution of approximately 800 g of sodium chloride in approximately 3 kg of water and then dried over 2.7 kg of sodium sulfate. The suspension was filtered, and the cake was washed with 2 kg of DCM. The combined filtrate was concentrated to 2.0 volumes, diluted with approximately 360 g of ethyl acetate, and evaporated. The crude product was loaded onto a silica gel column packed with 4 kg of silica and DCM under nitrogen and diluted with 2.3 kg of ethyl acetate / DCM. The mixture was eluted with 7.2 kg of toluene. The combined fractions were evaporated and the residue was dissolved in 11.7 kg of toluene. The toluene solution was filtered and the cake was washed twice with 2 kg of toluene each time. The cake was dried to a constant weight of 2.275 kg of compound 5 (46% yield from compound 3). HPLC 96.99%.
[0270] 5. Preparation of 2,5-dioxopyrrolidin-1-yl(1-(2-nitro-4-(4-triphenylmethylpiperazine-1-carbonyl)phenyl)propan-2-yl)carbonate (NCP2 anchor) [ka] Add 4.3 kg (based on residual toluene) of compound 5 to a 100 L jacketed flask. 1 12.7 kg of pyridine (weight adjusted by NMR; all subsequent reagents were weighed accordingly) was charged under nitrogen. This was analyzed by DSC with 3.160 kg (H 1The reaction mixture was aged at ambient temperature for approximately 22 hours and then filtered. The filter cake was washed with 200 g of pyridine. In two batches, each containing half the volume of filtrate, the filtrate washes were slowly added to a 100 L jacketed flask containing a solution of approximately 11 kg of citric acid in approximately 50 kg of water and stirred for 30 minutes to allow the solid to settle. The solid was collected on a filter funnel, washed twice with 4.3 kg of water each, and dried on the filter funnel under vacuum.
[0271] The combined solids were placed in a 100 L jacketed flask, dissolved in 28 kg of DCM, and washed with 900 g of potassium carbonate in 4.3 kg of water. After 1 hour, the layers were allowed to separate and the aqueous layer was removed. The organic layer was washed with 10 kg of water, separated, and dried over 3.5 kg of sodium sulfate. The DCM was filtered, evaporated, and dried under vacuum to yield 6.16 kg of NCP2 anchor (114% yield).
[0272] Synthesis of NCP2 anchor-loaded resin A 75 L solid-phase synthesis reactor equipped with a Teflon stopcock was charged with approximately 52 L of NMP and 2300 g of aminomethyl polystyrene resin. The resin was stirred in NMP for approximately 2 hours to swell, then drained. The resin was washed twice with approximately 4 L of DCM, then twice with 39 L of neutralization solution, then twice with 39 L of DCM. The NCP2 anchor solution was slowly added to the stirred resin solution, stirred at room temperature for 24 hours, and drained. The resin was washed four times with 39 L of NMP and six times with 39 L of DCM. The resin was treated with half of the DEDC capping solution for 30 minutes, stirred, drained, and then treated with half of the DEDC capping solution for 30 minutes, stirred, and drained. The resin was washed six times with 39 L portions of DCM and then dried in an oven to a constant weight of 3573.71 g of anchor-loaded resin.
[0273] 50L solid-phase synthesis of Casimersen (PMO#1) crude drug substance 1.Raw materials [Table 4] JPEG2025166161000086.jpg167160
[0274] Chemical structure of the starting material: A. Activated EG3 tail [ka] B. Activated C Subunit (for preparation, see U.S. Pat. No. 8,067,571) [ka] C. Activated A Subunit (for preparation, see U.S. Pat. No. 8,067,571) [ka] D. Activated DPG Subunits (for preparation, see WO 2009 / 064471) [ka] E. Activated T Subunit (for preparation, see WO 2013 / 082551) [ka] F. Anchor-supported resin [ka] In the formula, R 1 is the support medium.
[0275] [Table 5]
[0276] 2. Synthesis of Casimersen crude drug substance A. Resin swelling 750 g of the anchor-loaded resin and 10.5 L of NMP were placed in a 50 L silanization reactor and stirred for 3 hours. The NMP was drained, and the anchor-loaded resin was washed twice with 5.5 L of DCM and twice with 5.5 L of 30% TFE / DCM.
[0277] B. Cycle 0: Coupling of EG3 tail The anchor-loaded resin was washed three times with 5.5 L of 30% TFE / DCM, drained, washed with 5.5 L of CYTFA solution for 15 minutes, drained, and washed again with 5.5 L of CYTFA solution for 15 minutes. Without draining, 122 mL of 1:1 NEM / DCM was added, the suspension was stirred for 2 minutes, and drained. The resin was washed twice with 5.5 L of neutralization solution for 5 minutes, drained, and then washed twice with 5.5 L of DCM each, drained. A solution of 706.2 g of activated EG3 tail (MW 765.85) and 234 mL of NEM in 3 L of DMI was added to the resin, stirred for 3 hours at room temperature, and drained. The resin was washed twice with 5.5 L of neutralization solution for 5 minutes each, and once with 5.5 L of DCM, drained. A solution of 374.8 g of benzoic anhydride and 195 mL of NEM in 2680 mL of NMP was charged, stirred for 15 minutes, and drained. The resin was stirred with 5.5 L of neutralization solution for 5 minutes, then washed once with 5.5 L of DCM and twice with 5.5 L each of 30% TFE / DCM. The resin was suspended in 5.5 L of 30% TFE / DCM and held for 14 hours.
[0278] C. Subunit coupling cycles 1-22 i. Treatment before coupling Before each coupling cycle described in Figure 17, the resin was: 1) washed with 30% TFE / DCM; 2) a) treated with CYTFA solution for 15 minutes and drained, b) treated with CYTFA solution for 15 minutes, to which 1:1 NEM / DCM was added, vortexed, and drained; 3) vortexed with neutralization solution three times; and 4) washed twice with DCM. See Figure 17.
[0279] ii. Post-coupling treatment After draining each subunit solution as described in Figure 17, the resin was: 1) washed with DCM; 2) washed twice with 30% TFE / DCM. If the resin was held for a period of time before the next coupling cycle, the second TFE / DCM wash was not drained, but the resin was held in the TFE / DCM wash solution. See Figure 17.
[0280] iii. Activation subunit coupling cycle Coupling cycles were performed as described in FIG.
[0281] iv. Final IPA wash After the final coupling step was carried out as described in Figure 17, the resin was washed 8 times with 19.5 L of IPA each time and dried under vacuum at room temperature for approximately 63.5 hours to a weight of 4523 g.
[0282] C. Cutting The resin-bound Casimersen crude drug substance was divided into two lots, and each lot was treated as follows: 1) Two 2261.5 g resin lots were each: 1) agitated with 10 L of NMP for 2 hours, followed by draining the NMP; 2) washed three times with 10 L of 30% TFE / DCM; 3) treated with 10 L of CYTFA solution for 15 minutes; and 4) treated with 10 L of CYTFA solution for 15 minutes, followed by addition of 130 ml of 1:1 NEM / DCM, agitated for 2 minutes, and drained. The resin was treated three times with 10 L of neutralization solution, washed six times with 10 L of DCM, and washed eight times with 10 L of NMP. The resin was then treated for 2 hours with a cleavage solution consisting of 1530.4 g of DTT and 2980 DBU in 6.96 L of NMP to release the Casimersen crude drug substance from the resin. The cleavage solution was drained and kept in a separate container. The reactor and resin were washed with 4.97 L of NMP, which was combined with the cleavage solution.
[0283] D. Deprotection The combined cleavage solution and NMP wash were transferred to a pressure vessel and 9.8 L of NHOH (NH HO) (pre-chilled to -10°C to -25°C in a freezer) was added. The pressure vessel was sealed and heated to 45°C for 16 hours, then cooled to 25°C. The deprotected solution, containing the Casimersen crude drug substance, was diluted 3:1 with purified water and the pH adjusted to 3.0 with 2 M phosphoric acid, then to 8.03 with NHOH. HPLC: C18 80.93% and SCX-10 84.4%.
[0284] Purification of Casimersen crude drug substance The deprotected solution containing the Casimersen crude drug substance obtained in Part D above was applied to a column of ToyoPearl Super-Q 650S anion exchange resin (Tosoh Bioscience) and eluted with a gradient of 0 to 35% B over 17 column volumes (Buffer A: 10 mM sodium hydroxide; Buffer B: 1 M sodium chloride in 10 mM sodium hydroxide). Fractions of acceptable purity (C18 and SCX HPLC) were pooled to obtain the purified drug product solution. HPLC: 97.74% (C18), 94.58% (SCX).
[0285] The purified drug substance solution was desalted and lyophilized to yield 1477.82 g of purified Casimersen drug substance. Yield: 63.37%; HPLC: 96.045% (C18) 96.346% (SCX).
[0286] [Table 6]
[0287] CPP conjugation [ka] Analytical Procedure: Matrix-assisted laser desorption / ionization time-of-flight mass spectra (MALDI-TOF-MS) were recorded on a Bruker Autoflex™ Speed using a sinapinic acid (SA) matrix. SCX-HPLC was performed on a Thermo Dionex UltiMate 3000 system equipped with a 3000 diode array detector and a ProPac™ SCX-20 column (250 x 4 mm) at a flow rate of 1.0 mL / min (pH = 2; column temperature 30 °C). The mobile phases were A (25% aqueous acetonitrile containing 24 mM H3PO4) and B (25% aqueous acetonitrile containing 1 M KCl and 24 mM H3PO4). The following gradient elution was used: 0 min, 35% B; 2 min, 35% B; 22 min, 80% B; 25 min, 80% B; 25.1 min, 35% B; 30 min, 35% B.
[0288] To a mixture of PMO#1 (1.82 g, 0.177 mmol, freshly dried by lyophilization for 2 days), Ac-L-Arg-L-Arg-L-Arg-L-Arg-L-Arg-L-Arg-Gly-OH hexatrifluoroacetate (614.7 mg, 0.354 mmol), and 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate (HATU, 134.4 mg, 0.354 mmol), dimethyl sulfoxide (DMSO, 20 mL) was added. The mixture was stirred at room temperature for 3 h, and then N,N-diisopropylethylamine (DIPEA, 68.5 mg, 0.530 mmol) was added. After 5 min, the cloudy mixture became a clear solution. The reaction was monitored by SCX-HPLC. After 2 hours, 20 mL of 10% ammonium hydroxide solution (2.8% NH3) was added. The mixture was stirred at room temperature for an additional 2 hours. The reaction was quenched by adding 400 mL of water. To this solution was added trifluoroethanol (2.0 mL).
[0289] The solution was divided into two portions, and each portion was purified using a WCX column (10 g of resin per column). Each WCX column was first washed with 20% aqueous acetonitrile (v / v) to remove the PMO#1 starting material. The washing (225 mL per column) was stopped when the PMO#1 signal disappeared in MALDI-TOF mass spectrometry analysis. Each column was then washed with water (100 mL per column). The desired product, PPMO#1, was eluted with 2.0 M guanidine HCl (140 mL per column). The purified PPMO#1 solution was pooled and then divided into two portions, each of which was desalted using an SPE column (10 g of resin per column).
[0290] First, the SPE columns were washed with 1.0 M aqueous NaCl (100 mL for each column) to obtain the hexahydrochloride salt of PPMO#1. Then, each SPE column was washed with water (200 mL for each column). The final desalted PPMO#1 was eluted with 50% aqueous acetonitrile (v / v, 150 mL for each column). The acetonitrile was removed by vacuum evacuation. The resulting aqueous solution was lyophilized to obtain the desired conjugate PPMO#1 hexahydrochloride (1.93 g, 94.5% yield).
[0291] Example 1: PMO#1 PMO#1 was synthesized using the protocol for PMO synthesis method B above: [ka] In the formula, each Nu from 1 to 22 and 5' to 3' is (SEQ ID NO: 1): [Table 7] and In the table, A is [ka] and C is [ka] and G is [ka] and T is [ka] is. HPLC: 71.85%; Conditions: Dionex DNAPac (DNX#97) Gradient: 75% A + 20% B + 5% C at 0 min; 50% A at 20 min; 25% A + 75% C at 21 min. Mobile phase A: 10 mM NaOH / 20 mM NaCl; C: 10 mM NaOH / 0.5 M NaCl. Column temperature: 45°C; Flow rate: 1.0 mL / min.
[0292] Example 2: PPMO#1 Using the protocol above, PPMO#1 can be synthesized from PMO#1: [ka] In the formula, each Nu from 1 to 22 and 5' to 3' is (SEQ ID NO: 1): [Table 8] and In the table, A is [ka] and C is [ka] and G is [ka] and T is [ka] is.
[0293] Example 3: In vitro exon 45 skipping Two compounds targeting human dystrophin exon 45, PMO#1 and PPMO#1, listed in the table below, are assembled into the same sequence and their ability to induce exon 45 skipping is evaluated.
[0294] [Table 9]
[0295] Specifically, we used differentiated human muscle cells to determine the ability of the compounds to induce exon 45 skipping at various concentrations (i.e., 40 μM, 20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM). After differentiation, the cells were incubated with the compounds for 96 hours, followed by RNA isolation and RT-PCR analysis of exon 45 skipping as described above.
[0296] Example 4: mdx Mouse Study The mdx mouse contains a mutation in exon 23 of the dystrophin gene and is a recognized and well-characterized animal model of Duchenne muscular dystrophy (DMD). The M23D antisense sequence (SEQ ID NO: 2) has been shown to induce exon 23 skipping and restore functional dystrophin expression. Six- to seven-week-old mdx mice were injected into the tail vein with a single 40 mg / kg dose of PPMO4225 or PMO4225 (see table below) or a single injection of saline.
[0297] [Table 10] PMO4225 and PPMO4225 were prepared by the PMO Method A and CPP conjugation methods described above, respectively.
[0298] Seven, 30, 60, and 90 days after the single-dose injection, treated mice (n = 6 per group) were sacrificed. The diaphragm, heart, and right quadriceps were subjected to Western blot analysis to measure dystrophin protein production and RT-PCR analysis to measure the rate of exon skipping, and the left quadriceps was subjected to immunohistochemistry and H / E staining, as described above.
[0299] Dystrophin protein recovery was quantified by Western blot and the rate of exon 23 skipping was measured by RT-PCR using the forward primer SEQ ID NO: 5 (5'-CACATCTTTGATGGTGTGAGG-3') and the reverse primer SEQ ID NO: 6 (5'-CAACTTCAGCCATCCATTTCTG-3'), respectively, as described above.
[0300] The RT-PCR results are shown in Figures 4A-9B and in the table below. Surprisingly, PPMO4225 induced significantly higher and more sustained levels of dystrophin restoration and exon 23 skipping compared with PMO4225, with maximal levels observed 30 days after injection. Even more surprisingly, PPMO4225 increased cardiac dystrophin levels even though PMO4225 did not; PMO4225 did not increase cardiac dystrophin or exon skipping at any time point.
[0301] [Table 11]
[0302] [Table 12]
[0303] The immunohistochemistry results are shown in Figure 10. PPMO4225 restores dystrophin throughout the quadriceps muscle, whereas 4225 exhibits a "patchy" pattern of expression. PPMO4225 treatment results in a uniform distribution of dystrophin, demonstrating its ability to target a wide range of skeletal muscle. PPMO4225 offers significantly improved in vivo delivery compared to PMO4225.
[0304] Example 5: Exon 45 skipping in NHPs Cynomolgus monkeys will be injected intravenously with PPMO#1, PMO#1 or saline according to the administration schedule in the table below: [Table 13]
[0305] Animals will be monitored throughout the study, including clinical observations (e.g., skin and coat, respiratory assessment) and weight measurements. Blood and urine samples will be collected at least prior to study initiation and 24 hours after the first and last doses (if applicable). At scheduled necropsies or euthanasia in moribund conditions, sections of the biceps, deltoid, diaphragm, kidney, esophageal smooth muscle, duodenum, quadriceps, aorta, brain (left frontal lobe), heart, and anus will be collected and snap-frozen. Additionally, sections of the quadriceps, deltoid, diaphragm, and heart will be embedded in OCT and frozen on dry ice.
[0306] Example 6: Dose-response study in mdx mice Six to seven-week-old mdx mice were injected with a single dose of PPMO4225 or PMO4225 at a dose of 40 mg / kg, 80 mg / kg, or 120 mg / kg into the tail vein (n = 6 per group).
[0307] Thirty days after injection, treated mice were sacrificed. Diaphragm, quadriceps, and heart were processed for Western blot analysis to measure dystrophin protein production based on the Western blot protocol described above (e.g., that used in Example 4), with the following modifications: [Table 14]
[0308] Dystrophin protein restoration in % of wild type is shown in the table below and in Figures 11-14.
[0309] [Table 15]
[0310] Surprisingly, the data show that a single dose of PPMO4225 significantly and significantly increases dystrophin levels in mdx mice compared to PMO4225 in a dose-dependent manner.
[0311] Example 7: IHC study on the diaphragm and heart of mdx mice Six- to seven-week-old mdx mice were given a single tail vein injection of PPMO4225 at a dose of 80 mg / kg or a single injection of saline, and six- to seven-week-old wild-type mice were given a single injection of saline. Thirty days after the single-dose injection, the treated mdx mice, saline mdx mice, and wild-type mice were sacrificed (n=4 per group). The immunohistochemistry results are shown in Figure 18. The results demonstrate that mdx mice treated with PPMO4225 exhibit a consistent increase in dystrophin in tissues associated with DMD morbidity and mortality.
[0312] Example 8: Exon 51 skipping in vitro (myoblasts) The DMD exon 45 skipping of two compounds listed in the table below, PMO#1 and PPMO#1, which target human dystrophin (DMD) exon 45 and contain the same sequence, was evaluated in healthy human myoblasts.
[0313] [Table 16] Sequences of PMO#1 and PPMO#1 for human DMD exon 45.
[0314] Specifically, healthy human myoblasts (passages 5–6, SKB-F-SL, purchased from Zen-Bio) were plated at approximately 40% confluence and treated with various concentrations of PMO#1 or PPMO#1 (i.e., 40 μM, 20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) in SKM-M medium (Zen-Bio). After 96 h of incubation, the myoblasts were washed with PBS and lysed in RA1 lysis buffer using the Illustra GE RNAspin 96 Kit (catalog no. 25-055-75, GE Healthcare Bio-Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40 μL of RNase-free water was used for RNA elution.
[0315] To determine exon 45 skipping by both compounds, we performed two-step end-point RT-PCR. Specifically, 11 μL of total RNA was reverse transcribed into cDNA using the SuperScript IV First-Strand Synthesis Kit (Cat. No. 18091200, Invitrogen) according to the manufacturer's instructions using random hexamers. 9 μL of cDNA was then subjected to PCR using Platinum Taq DNA polymerase. PCR was performed by adding Supermix High Fidelity (Cat. No. 12532024, Invitrogen) with primers targeting human DMD exons 43 and 46 [forward primer: CTACAGGAAGCTCTCTCCCAG (SEQ ID NO: 7); reverse primer (SEQ ID NO: 8): GTTATCTGCTTCCTCCAACCA]. PCR amplification was performed using a BioRad CFX96 real-time thermocycler with the program shown in the table below. 32 μL of the PCR product was run on the LabChip GX system and analyzed using DNA High Sensitivity PCR. The expression of PCR products with and without skipping was assessed using a Reagent Kit (CLS760672, Perkin Elmer). The rate of DMD exon 45 skipping was calculated as the ratio of the molar concentration (nmol / L) of the exon 45 skipped band (301 bp) to the combined molar concentration of the skipped band (301 bp) and the non-skipped band (477 bp).
[0316] An unpaired two-tailed Student's t-test (homogeneous variance) was used to assess whether the means of the two groups at each dose were statistically different from each other. A P value of <0.05 was considered statistically significant.
[0317] [Table 17]
[0318] The results showing that PPMO#1 significantly increases DMD exon 45 skipping in human myoblasts compared to PMO#1 are shown in the table below and in FIG.
[0319] [Table 18]
[0320] Example 9: Exon 51 skipping in vitro (myotubes) The DMD exon 45 skipping of two compounds, PMO#1 and PPMO#1, which target human dystrophin (DMD) exon 45 and contain the same sequence, listed in the table below, was evaluated in healthy human myotubes.
[0321] [Table 19]
[0322] Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL, purchased from Zen-Bio) were cultured in SKM-M medium until they reached 80-90% confluence, and then differentiated by incubation in low-serum medium (SKM-D, Zen-Bio). Five days after differentiation, mature myotubes were incubated with various concentrations of the above compounds (i.e., 40 μM, 20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM). After 96 hours of incubation, myotubes were washed with PBS and lysed in RA1 lysis buffer using the Illustra GE RNAspin 96 Kit (catalog no. 25-055-75, GE Healthcare Bio-Sciences). Total RNA was isolated according to the manufacturer's recommendations, except that 40 μL of RNase-free water was used for RNA elution.
[0323] To determine DMD exon 45 skipping by both compounds, two-step endpoint RT-PCR was performed. Specifically, 11 microliters of total RNA was reverse transcribed into cDNA using random hexamers with the SuperScript IV First-Strand Synthesis Kit (Cat. No. 18091200, Invitrogen) according to the manufacturer's instructions. PCR was performed by adding 9 μL of cDNA to Platinum Taq DNA Polymerase PCR Supermix High Fidelity (Cat. No. 12532024, Invitrogen) with primers targeting human DMD exons 43 and 46 [forward primer (SEQ ID NO: 7): CTACAGGAAGCTCTCTCCCAG; reverse primer (SEQ ID NO: 8): GTTATCTGCTTCCTCCAACCA]. PCR amplification was performed using a BioRad CFX96 real-time thermocycler using the program shown in the table below. 32 μL of the PCR product was run on the LabChip GX system, and the expression of the skipped or non-skipped PCR products was assessed using a DNA High Sensitivity Reagent kit (CLS760672, Perkin Elmer). The percentage of DMD exon 45 skipping was calculated as the ratio of the molar concentration (nmol / L) of the exon 45 skipped band (301 bp) to the combined molar concentration of the skipped band (301 bp) and the non-skipped band (477 bp).
[0324] An unpaired two-tailed Student's t-test (homogeneous variance) was used to assess whether the means of the two groups at each dose were statistically different from each other. A P value of <0.05 was considered statistically significant.
[0325] [Table 20]
[0326] The results showing that PPMO#1 significantly increases DMD exon 45 skipping compared to PMO#1 are shown in the table below and in FIG.
[0327] [Table 21]
[0328] All publications and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0329] (References) Aartsma-Rus, A., AAJanson, et al. (2004). “Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense.” Am J Hum Genet 74(1):83-92. Abes, R., et al. (2008). “Arginine-rich cell penetrating peptides:design, structure-activity, and applications to alter pre-mRNA splicing by steric-block oligonucleotides.” J Pept. Sci. 14:455-460. Alter, J., et al. (2006). of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology.” Nat.Med. 12(2):175-177. Bestas, B., et al. (2014). “Splice-correcting ligonucleotides restore BTK function in X-linked agammaglobulinemia model.” J. Clin. Invest. Cirak,S.,V.Arechavala-Gomeza,et al.(2011).“Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment:an open-label,phase 2,dose-escalation study.” Lancet 378(9791):595-605. Dunckley,M.G.,I.C.Eperon,et al.(1997).“Modulation of splicing in the DMD gene by antisense oligoribonucleotides.” Nucleosides & Nucleotides 16(7-9):1665-1668. Dunckley,M.G.,M.Manoharan,et al.(1998).“Modification of splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides.” Hum Mol Genet 7(7):1083-90. Errington,S.J.,C.J.Mann,et al.(2003).“Target selection for antisense oligonucleotide induced exon skipping in the dystrophin gene.” J Gene Med 5(6):518-27. Goemans,N.M.,M.Tulinius,et al.(2011).“Systemic Administration of PRO051 in Duchenne’s Muscular Dystrophy.” N Engl J Med . Jearawiriyapaisarn,N.,H.M.Moulton,et al.(2008).“Sustained Dystrophin Expression Induced by Peptide-conjugated Morpholino Oligomers in the Muscles of mdx Mice.” Mol Ther . Jearawiriyapaisarn,N.,et al.(2010).“Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers.” Cardiovascular Research 85:444-453. Kinali,M.,V.Arechavala-Gomeza,et al.(2009).“Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy:a single-blind,placebo-controlled,dose-escalation,proof-of-concept study.” Lancet Neurol 8(10):918-28. Leblue,B.,et al.(2008).“Cell penetrating peptide conjugates of steric block oligonucleotides.” Adv.Drug Deliv.Rev. 60:517-529. Lu,Q.L.,C.J.Mann,et al.(2003).“Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse.” Nat Med 9(8):1009-14. Mann,C.J.,K.Honeyman,et al.(2002).“Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy.” J Gene Med 4(6):644-54. Marshall,N.B.,S.K.Oda,et al.(2007).“Arginine-rich cell-penetrating peptides facilitate delivery of antisense oligomers into murine leukocytes and alter pre-mRNA splicing.” Journal of Immunological Methods 325(1-2):114-126. Matsuo,M.,T.Masumura,et al.(1991).“Exon skipping during splicing of dystrophin mRNA precursor due to an intraexon deletion in the dystrophin gene of Duchenne muscular dystrophy kobe.” J Clin Invest 87(6):2127-31. McClory,G.,et al.(2006).“Antisense oligonucleotide-induced exon skipping restored dystrophin expression in vitro in a canine model of DMD.” Gene Therapy 13:1373-1381. Monaco,A.P.,C.J.Bertelson,et al.(1988).“An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus.” Genomics 2(1):90-5. Moulton,H.M.,(2007).“Cell-penetrating peptide-morpholino conjugates alter pre-mRNA splicing of DMD(Duchenne muscular dystrophy)and inhibit murine coronavirus replication in vivo.” Biochem.Society Trans 35(4):826-828. Pramono,Z.A.,Y.Takeshima,et al.(1996).“Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence.” Biochem Biophys Res Commun 226(2):445-9. Sazani,P.,R.Kole,et al.(2007).Splice switching oligomers for the TNF superfamily receptors and their use in treatment of disease. PCT WO2007058894 ,University of North Carolina Sierakowska,H.,M.J.Sambade,et al.(1996).“Repair of thalassemic human beta-globin mRNA in mammalian cells by antisense oligonucleotides.” Proc Natl Acad Sci USA 93(23):12840-4. Summerton,J.and D.Weller(1997).“Morpholino antisense oligomers:design,preparation,and properties.” Antisense Nucleic Acid Drug Dev 7(3):187-95. Takeshima,Y.,H.Nishio,et al.(1995).“Modulation of in vitro splicing of the upstream intron by modifying an intra-exon sequence which is deleted from the dystrophin gene in dystrophin Kobe.” J Clin Invest 95(2):515-20. van Deutekom,J.C.,M.Bremmer-Bout,et al.(2001).“Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells.” Hum Mol Genet 10(15):1547-54. van Deutekom,J.C.,A.A.Janson,et al.(2007).“Local dystrophin restoration with antisense oligonucleotide PRO051.” N Engl J Med 357(26):2677-86. Wilton,S.D.,A.M.Fall,et al.(2007).“Antisense oligonucleotide-induced exon skipping across the human dystrophin gene transcript.” Mol Ther 15(7):1288-96. Wilton,S.D.,F.Lloyd,et al.(1999).“Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides.” Neuromuscular Disord 9(5):330-8. Wu,B.,H.M.Moulton,et al.(2008).“Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer.” Proc Natl Acad Sci USA 105(39):14814-9. Wu,B.,et al.(2012).“Long-term rescue of dystrophin expression and improvement in muscle pathology and function in dystrophic mdx mice by peptide-conjugated morpholino.” The Am. J. Pathol. 181(2):392-400. Wu,P.,et al.(2007)“Cell-penetrating peptides as transporters for morpholino oligomers:effects of amino acid composition on intracellular delivery and cytotoxicity.” Nucleic Acids Research 35(15):5182-5191. Yin,H.,H.M.Moulton,et al.(2008).“Cell-penetrating peptide-conjugated antisense oligonucleotides restore systemic muscle and cardiac dystrophin expression and function.” Hum Mol Genet 17(24):3909-18. Yin,H.,et al.(2011).“Pip5 transduction peptides direct high efficiency oligonucleotide-mediated dystrophin exon skipping 在mdx小鼠的心脏和表型校正中。 Mol.Ther 19(7):1295 - 1303。 扬布拉德,D.等人(2006年)。“ 细胞穿透肽 - 吗啉代寡聚物缀合物在人血清和细胞中的稳定性。” Am.Chem.Soc.
[0330]
Table 22
Claims
[Claim 1] The invention as set forth in the drawings.
Citation Information
Patent Citations
Alteration of cellular behavior by antisense modulation of mRNA processing
US6210892B1