Enzyme and microorganism capable of defluorinating hydrophilic group-containing fluoroalkane, and use thereof
The enzyme from Pandoraea pnomenusa (DYG4 strain) addresses the limitation of existing enzymes by defluorinating fluoroalkane compounds at both α- and β-positions, providing efficient and environmentally friendly decomposition of organic fluorine compounds.
Patent Information
- Application Number
- JP2025088971
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-28
- Filing Date
- 2025-05-28
- Publication Date
- 2025-12-10
- Estimated Expiration
- 2045-05-28
AI Technical Summary
Existing enzymes are limited in their ability to defluorinate organic fluorine compounds, specifically failing to defluorinate the β-position, and there is a need for a more efficient method to decompose such compounds with minimal environmental impact.
Isolation of an enzyme and microorganism from Pandoraea pnomenusa (DYG4 strain) that can defluorinate fluoroalkane compounds containing hydrophilic groups, including fluorines at both the α- and β-positions, using an enzyme with specific amino acid sequences (SEQ ID NO: 1) and nucleotide sequences (SEQ ID NO: 2), and producing it through genetic engineering.
The enzyme efficiently defluorinates a wide range of fluoroalkane compounds, including those with hydrophilic groups, achieving defluorination rates greater than 10% and enabling simple, energy-saving, and environmentally friendly decomposition.
Smart Images

Figure 2025179836000005 
Figure 2025179836000006 
Figure 2025179836000007
Abstract
Description
[Technical Field]
[0001] The present invention relates to enzymes and microorganisms that defluorinate fluoroalkane compounds containing hydrophilic groups, and their uses. [Background technology]
[0002] There is a need for the development of a technology that can decompose and remove organofluorine compounds with low energy consumption, little environmental impact, and high efficiency. Decomposition by microorganisms or the enzymes they possess is considered to be an energy-saving and environmentally compatible technology that makes use of the capabilities of natural ecosystems. Haloacetate dehydrogenase isolated from microorganisms of the genus Burkholderia is known as an enzyme that decomposes organofluorine compounds (Non-Patent Document 1, etc.). However, known enzymes that decompose / defluorinate organofluorine compounds only defluorinate the α-position, and no enzymes capable of defluorinating the β-position have been reported. [Prior art documents] [Non-patent literature]
[0003] [Non-Patent Document 1] Keiji Jitsumori et.al., JOURNAL OF BACTERIOLOGY,Apr.2009,p.2630-2637 Vol.191,No.8 "X-Ray Crystallographic and Mutational Studies of Fluoroacetate Dehalogenase from Burkholderia sp. Strain FA1" Summary of the Invention [Problem to be solved by the invention]
[0004] An object of the present invention is to provide a new enzyme that defluorinates a wide range of organic fluorine compounds. In particular, an object of the present invention is to provide an enzyme that defluorinates the fluorine at the β-position of organic fluorine compounds. A further object of the present invention is to provide a new method for efficiently and simply defluorinating organic fluorine compounds. [Means for solving the problem]
[0005] As a result of intensive research to solve the above problems, the present inventors isolated an enzyme and a microorganism that defluorinates fluoroalkane compounds containing a hydrophilic group from environmental microorganisms, and found that the enzyme defluorinates fluorines not only at the α-position but also at the β-position relative to the hydrophilic group, thereby completing the present invention.
[0006] That is, the present invention provides the following: [1] A method for defluorinating a fluoroalkane compound containing a hydrophilic group, such as a sulfonic acid, carboxylic acid, phosphoric acid, or a salt thereof, and which may contain oxygen atoms and / or halogen atoms other than fluorine, said method comprising: The amino acid sequence: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) an amino acid sequence in which 1 to 60 amino acids have been substituted, deleted, inserted, or added in the amino acid sequence set forth in SEQ ID NO: 1; (d) an amino acid sequence encoded by the base sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2; A method for defluorination, comprising allowing an enzyme comprising any one of the following to act on the fluoroalkane compound. [2] The method according to [1], wherein the fluorine at the α-position of the fluoroalkane compound is defluorinated. [3] The method according to [1], wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated. [4] The method according to [1], wherein the fluoroalkane compound comprises a carboxylic acid or a salt thereof. [5] The fluoroalkane compound is represented by Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The method according to [4], wherein the compound is a fluoroalkylcarboxylic acid represented by the formula: [6] The method according to any one of [1] to [5], wherein the defluorination activity of the enzyme on the fluoroalkane compound is {(amount of fluorine ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluorine ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment}>10%. [7] An enzyme capable of defluorinating a fluoroalkane compound containing a carboxylic acid or a salt thereof and optionally containing an oxygen atom and / or a halogen atom other than fluorine, the enzyme having the following amino acid sequence: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) an amino acid sequence in which 1 to 60 amino acids have been substituted, deleted, inserted, or added in the amino acid sequence set forth in SEQ ID NO: 1; (d) an amino acid sequence encoded by the base sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2; An enzyme comprising either [8] The enzyme according to [7], which defluorinates the fluorine at the α-position of the fluoroalkane compound. [9] The enzyme according to [7], which defluorinates the fluorine at the β-position of the fluoroalkane compound.
[10] The fluoroalkane compound is represented by Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The enzyme according to [7], wherein the fluoroalkyl carboxylic acid is a fluoroalkyl carboxylic acid represented by the formula:
[11] The following nucleotide: (a) the nucleotide set forth in SEQ ID NO: 2; (b) a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2; or (c) a nucleotide that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2 An expression vector comprising:
[12] A host cell containing the expression vector described in
[11] .
[13] A method for producing an enzyme capable of defluorinating a fluoroalkane compound containing a carboxylic acid or its salt and optionally containing an oxygen atom and / or a halogen atom other than fluorine, comprising culturing the host cell according to
[12] .
[14] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
[15] The method according to
[13] , wherein the enzyme defluorinates the fluorine at the α-position of the fluoroalkane compound.
[16] The fluoroalkane compound is represented by Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The method according to
[13] , wherein the compound is a fluoroalkylcarboxylic acid represented by the formula:
[17] Microorganisms deposited at NITE under accession number NITE ABP-04122 or accession number NITE BP-04122.
[18] An enzyme capable of defluorinating fluoroalkylcarboxylic acids, produced by the microorganism according to
[17] .
[19] A method for producing an enzyme capable of defluorinating a fluoroalkyl carboxylic acid, comprising culturing the microorganism according to
[17] . [Effects of the Invention]
[0007] According to the present invention, there is provided an enzyme capable of defluorinating fluorine at not only the α-position but also the β-position relative to the hydrophilic group of a fluoroalkane compound containing a hydrophilic group. The present invention also provides a microorganism that produces such an enzyme. Therefore, using the enzyme and microorganism according to the present invention, fluoroalkane compounds containing a hydrophilic group and having a wide range of structures can be defluorinated efficiently and simply. [Brief explanation of the drawings]
[0008] [Figure 1] FIG. 1 shows the sequence of SEQ ID NO:1. [Figure 2] FIG. 2 shows the sequence of SEQ ID NO:2. [Figure 3] FIG. 3 is a graph showing the results of an experiment on the degradation of monofluoroacetic acid by cells of the DYG4 strain. [Figure 4] FIG. 4 is a graph showing the results of an experiment on the degradation of difluoroacetic acid by cells of the DYG4 strain. [Figure 5] 5 is a graph showing the results of an experiment to decompose chlorofluoroacetic acid using cells of the DYG4 strain. NC indicates no addition of microorganisms, and DYG4 indicates addition of DYG4 microorganisms. [Figure 6]6 is a graph showing the results of the amount of glyoxylic acid produced by the DYG4 strain cells relative to chlorofluoroacetic acid. NC indicates no addition of microorganisms, and DYG4 indicates addition of DYG4 microorganisms. [Figure 7] FIG. 7 shows a copy of the deposit certificate issued by the international depositary authority for the DYG4 strain obtained in Example 1 in accordance with Regulation 7.1 of the Budavest Treaty. DETAILED DESCRIPTION OF THE INVENTION
[0009] In one aspect, the present invention provides a method for defluorinating a fluoroalkane compound containing a hydrophilic group, the method comprising allowing an enzyme that defluorinates the fluoroalkane compound to act on the fluoroalkane compound.
[0010] As used herein, the phrase "allowing an enzyme capable of defluorinating a fluoroalkane compound containing a hydrophilic group to act on the fluoroalkane compound" refers to contacting the enzyme with the fluoroalkane compound to defluorinate the fluoroalkane compound. Typically, this is carried out in an aqueous medium. For example, the enzyme and the fluoroalkane compound may be added to an aqueous medium and reacted for a certain period of time. Reaction conditions such as temperature, pH, optional factors to be added to the reaction system, and reaction time can be appropriately selected by those skilled in the art. The enzyme may be purified, crude, or partially purified, and may be in the form of a microbial extract or a microbial culture medium. Microbial cells themselves may also be used as the enzyme. The enzyme may be used in a free state or immobilized on a carrier.
[0011] In another aspect, the present invention provides an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group. In this specification, an "enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group" may be simply referred to as an "enzyme."
[0012] The enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is an enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1. The enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1 is an enzyme isolated from an environmental microorganism (a strain of Pandoraea pnomenusa (referred to herein as "DYG4 strain")), and is characterized by its ability to defluorinate fluorines not only at the α-position but also at the β-position of a fluoroalkane compound containing a hydrophilic group.
[0013] The amino acid sequence of the enzyme of the present invention that defluorinates a fluoroalkane compound having a hydrophilic group is shown in SEQ ID NO: 1. The base sequence of DNA encoding the enzyme of the present invention that defluorinates a fluoroalkane compound having a hydrophilic group is shown in SEQ ID NO: 2. In the present invention, an enzyme having the amino acid sequence shown in SEQ ID NO: 1 or an enzyme having an amino acid sequence encoded by the base sequence shown in SEQ ID NO: 2 is preferably used.
[0014] A mutant of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group may be used in the present invention to defluorinate a fluoroalkane compound containing a hydrophilic group. The mutant of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group is described below. In this specification, unless otherwise specified, the term "enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group" includes the mutant.
[0015] In the present invention, a mutant enzyme having an activity to defluorinate a fluoroalkane compound containing a hydrophilic group equivalent to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group is preferably used. The activity to defluorinate a fluoroalkane compound containing a hydrophilic group equivalent to or greater than that of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group refers to an activity that is about 50% or more, preferably about 70% or more, more preferably about 80% or more, and even more preferably about 90% or more of the activity of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group, which comprises the amino acid sequence set forth in SEQ ID NO: 1.
[0016] The activity of an enzyme to defluorinate a fluoroalkane compound containing a hydrophilic group can be measured by reacting the enzyme with a fluoroalkane compound containing a hydrophilic group and analyzing the product.For example, referring to the procedure described in the Examples of this specification, the fluoroalkane compound containing a hydrophilic group and the enzyme are reacted for a certain time, and the resulting reaction mixture is subjected to LC-MS analysis to measure the amount of the defluorinated fluoroalkane compound containing a hydrophilic group or the remaining fluoroalkane compound containing a hydrophilic group, thereby measuring the activity of defluorinating a fluoroalkane compound containing a hydrophilic group.The certain time can be any time, for example, about 4 hours, about 8 hours, about 16 hours, about 24 hours, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, etc. For example, the defluorination activity of an enzyme toward a fluoroalkane compound containing a hydrophilic group can be expressed by the following formula: {(amount of fluorine ions contained in the aqueous solution of the fluoroalkane compound after defluorination) - (amount of fluorine ions contained in the aqueous solution of the fluoroalkane compound before defluorination)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous solution of the fluoroalkane compound before defluorination}. The value obtained from the above formula can also be multiplied by 100 to calculate the percentage (%) of the enzyme that defluorinates the fluoroalkane compound containing a hydrophilic group. The percentage of the fluoroalkane compound containing a hydrophilic group (defluorination rate) defluorinated by the enzyme of the present invention varies depending on the reaction time (a certain time), but may be > about 10%, > about 20%, > about 30%, > about 40%, > about 50%, > about 60%, > about 70%, > about 80%, or > about 90%. The amount of fluorine ions can be measured by well-known techniques, such as ion chromatography, absorptiometry, and ion electrode methods.
[0017] Specific examples of mutants of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group include, but are not limited to, enzymes comprising an amino acid sequence that has at least about 30%, for example, at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%) identity to the amino acid sequence shown in SEQ ID NO: 1, and that have the same or greater activity of defluorinating a fluoroalkane compound containing a hydrophilic group as the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. The identity of amino acid sequences can be determined using known search tools such as FASTA and BLAST.
[0018] Further specific examples of mutants of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group include, but are not limited to, enzymes having an amino acid sequence in which one to several or several tens of amino acids have been substituted, deleted, inserted, or added in the amino acid sequence shown in SEQ ID NO: 1, and which have activity to defluorinate fluoroalkane compounds containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group. "Several" refers to 2, 3, 5, 4, 6, 7, 8, or 9 amino acids. "Several tens" refers to about 10 to about 90 amino acids, such as about 20, 30, 40, 50, 60, 70, 80, or 90 amino acids, or any number between these values. Amino acids in the amino acid sequence may be substituted with any amino acid, but are preferably substituted with amino acids having similar properties and / or structure (conservative amino acid substitutions). For example, the amino acids in the following brackets may be substituted for each other: (G, A), (K, R, H), (D, E), (N, Q), (S, T, Y), (C, M), (F, W, Y, H), (V, L, I).
[0019] Further specific examples of mutants of the enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group of the present invention include mutants that are at least about 30%, for example, at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (for example, at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (for example, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%) of the base sequence shown in SEQ ID NO: 2. Examples of enzymes that can be used include, but are not limited to, enzymes having an amino acid sequence encoded by a nucleotide sequence that has an identity of at least 99.7%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, and that have the same or greater activity in defluorinating a fluoroalkane compound containing a hydrophilic group as the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. The identity of the nucleotide sequence can be determined using known search tools such as FASTA and BLAST.
[0020] Further specific examples of mutants of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group include, but are not limited to, enzymes having an amino acid sequence encoded by a base sequence that hybridizes to a base sequence complementary to the base sequence shown in SEQ ID NO: 2 under stringent conditions, and having activity for defluorinating fluoroalkane compounds containing a hydrophilic group that is equal to or greater than that of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group.
[0021] Stringent conditions are known to those skilled in the art and include, for example, the following conditions: Hybridization for 16 to 24 hours in a buffer containing 0.25 M NaHPO, pH 7.2, 7% SDS, 1 mM EDTA, and 1x Denhardt's solution at a temperature of 60 to 68°C, preferably 65°C, and more preferably 68°C, followed by two 15-minute washes in a buffer containing 20 mM NaHPO, pH 7.2, 1% SDS, and 1 mM EDTA at a temperature of 60 to 68°C, preferably 65°C, and more preferably 68°C; or Prehybridization was performed overnight at 42°C in a hybridization solution containing 25% formamide, or for more stringent conditions, 50% formamide, 4x SSC (sodium chloride / sodium citrate), 50 mM HEPES pH 7.0, 10x Denhardt's solution, and 20 μg / ml denatured salmon sperm DNA, followed by washing at 37°C in a buffer containing 1x SSC and 0.1% SDS, or for more stringent conditions, at 42°C in a buffer containing 0.5x SSC and 0.1% SDS, or for even more stringent conditions, at 65°C in a buffer containing 0.2x SSC and 0.1% SDS. Stringent conditions are not limited to the above examples.
[0022] Examples of the base sequence encoding the enzyme that defluorinates the hydrophilic group-containing fluoroalkane compound of the present invention include the following: (a) the nucleotide sequence set forth in SEQ ID NO: 2; (b) a nucleotide sequence having at least about 30%, for example at least about 40%, preferably at least about 50%, more preferably at least about 62%, even more preferably at least about 70% (e.g., at least 75%, at least 80%, at least 85%), and even more preferably at least about 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%) identity to the nucleotide sequence shown in SEQ ID NO: 2, (c) A nucleotide sequence that hybridizes under stringent conditions to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 2. Stringent conditions are as described above. Furthermore, degenerate sequences of the above base sequences (a) to (c) are also encompassed in the base sequence of the present invention that encodes an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0023] The mutant of the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group may be naturally occurring or may be artificially produced using, for example, genetic engineering techniques.
[0024] When the enzyme or variant thereof of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group is naturally derived, it may be derived from any organism, and is preferably derived from a microorganism, particularly a bacterium. Examples of bacteria include bacteria of the genus Pandoraea. Examples of bacteria of the genus Pandoraea include Pandoraea pnomenusa. The organisms from which the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group is derived are not limited to those mentioned above. The gene encoding the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group can be obtained using known cloning methods.
[0025] The fluoroalkane compound containing a hydrophilic group may contain one or more oxygen atoms and / or halogen atoms other than fluorine in the fluoroalkane. Fluoroalkane compounds containing oxygen atoms include, but are not limited to, structures in which -C- is replaced by -O-, -COO-, or -OCO-, structures in which -H is replaced by -OH, or combinations thereof. The number of oxygen atoms contained in the fluoroalkane is not particularly limited. For example, compounds containing one, two, or three oxygen atoms other than the oxygen atoms contained in the hydrophilic group may be mentioned.
[0026] A fluoroalkane compound containing a hydrophilic group may contain one or more oxygen atoms and / or halogen atoms other than fluorine in the fluoroalkane. Fluoroalkane compounds containing halogen atoms other than fluorine include, for example, a structure in which -H is replaced with a halogen atom other than fluorine. The number of halogen atoms other than fluorine contained in the fluoroalkane is not particularly limited. Examples include compounds containing one, two, or three halogen atoms other than fluorine. The halogen atom other than fluorine includes chlorine, bromine, iodine, astatine, tennessine, or any combination thereof. Fluoroalkanes containing one chlorine atom, such as chlorofluoroacetic acid, are particularly exemplified. When a fluoroalkane compound containing a halogen atom other than fluorine is defluorinated, halogen atoms other than fluorine may be eliminated in addition to fluorine. When a fluoroalkane compound containing chlorine is defluorinated, chlorine may be eliminated in addition to fluorine.
[0027] Hydrophilic groups include, but are not limited to, groups that ionize in water and groups that hydrate through hydrogen bonding without ionization. The fluoroalkane may contain one or more hydrophilic groups. One or two groups are preferred, and one is most preferred. Specific examples of hydrophilic groups include, but are not limited to, sulfonic acid groups (-SO3H), carboxylic acid groups (-COOH), phosphate groups (-H2PO4), hydroxyl groups (-OH), amino groups (-NH2), and amide groups (-CONH2). The hydrophilic group may be in the form of a salt. Examples of salts of hydrophilic groups include, but are not limited to, ammonium salts, nitrate salts, potassium salts, sodium salts, calcium salts, magnesium salts, sulfate salts, and phosphate salts.
[0028] The number of carbon atoms constituting the skeleton of the fluoroalkane is typically 1 to 2, or 1 or 2.
[0029] A fluoroalkane is an alkane in which one or more hydrogen atoms bonded to a carbon atom are replaced by a fluorine atom. Fluorine atoms can be present in any number and at any position in the fluoroalkane. The fluorine atoms can be present at the α-position or β-position relative to the hydrophilic group, or any combination thereof. The fluoroalkane can have 1 to 5, 1 to 4, 1 to 3, 1 to 2, 1, or 2 fluorine atoms. The fluorine atoms can be 0 to 3, 0 to 2, 0 to 1, 1 to 3, 1 to 2, 0, 1, 2, or 3 fluorine atoms at the α-position or β-position relative to the hydrophilic group, respectively.
[0030] Specific examples of the fluoroalkane compound or its salt that contains a hydrophilic group and may contain an oxygen atom and / or a halogen atom other than fluorine include fluoroalkane compounds that contain a carboxylic acid or its salt and may contain an oxygen atom and / or a halogen atom other than fluorine, such as those represented by the chemical formula: R1-COOH (wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine) Examples of the fluoroalkylcarboxylic acid include, but are not limited to, the fluoroalkylcarboxylic acid represented by the following formula:
[0031] In the fluoroalkylcarboxylic acid, fluorine atoms can be present in any number and at any position. The fluorine atoms may be present at the α-position or β-position relative to the carboxyl group, or any combination thereof. The fluorine atoms may be 1 to 5, 1 to 4, 1 to 3, 1 to 2, 1, or 2 in the fluoroalkylcarboxylic acid. The fluorine atoms may be 0 to 3, 0 to 2, 0 to 1, 1 to 3, 1 to 2, 0, 1, 2, or 3 in the α-position or β-position relative to the carboxyl group, respectively.
[0032] Specific examples of fluoroalkyl carboxylic acids include, but are not limited to, 2-fluoropropanoic acid, 2,2-difluoropropanoic acid, 3-fluoropropanoic acid, 2,3-difluoropropanoic acid, 2,2,3-trifluoropropanoic acid, 3,3-difluoropropanoic acid, 2,3,3-trifluoropropanoic acid, 2,2,3,3-tetrafluoropropanoic acid, 3,3,3-trifluoropropanoic acid, 2,3,3,3-tetrafluoropropanoic acid, or 2,2,3,3,3-pentafluoropropanoic acid.
[0033] Specific examples of fluoroalkylcarboxylic acids include, but are not limited to, monofluoroacetic acid, difluoroacetic acid, trifluoroacetic acid, and chlorofluoroacetic acid.
[0034] When the fluoroalkyl group in the fluoroalkylcarboxylic acid has 2 carbon atoms, the number of fluorine atoms present on each carbon atom is preferably 0 or 1. Specific examples of fluoroalkylcarboxylic acids that are preferably defluorinated in the present application include, but are not limited to, monofluoroacetic acid, difluoroacetic acid, chlorofluoroacetic acid, 2-fluoropropanoic acid, 3-fluoropropanoic acid, and 2,3-difluoropropanoic acid.
[0035] The salt of the fluoroalkyl carboxylic acid may be, but is not limited to, an ammonium salt, a potassium salt, a sodium salt, a calcium salt, or a magnesium salt. The fluoroalkyl carboxylic acid may be a salt in which H in COOH is replaced, such as a sodium salt, or an ammonium salt.
[0036] The enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group and its mutants can be produced using known methods. For example, the gene of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group, or its homolog or ortholog, can be cloned using PCR, ligated into an expression vector, and the expression vector can be introduced into a host cell, followed by culturing the host cell, thereby producing the enzyme and its mutants. For example, the base sequence of the gene of the enzyme of the present invention that defluorinates fluoroalkane compounds containing a hydrophilic group can be modified using known methods such as site-directed mutagenesis, and a mutant of the enzyme can be produced using the modified gene.
[0037] Thus, in one aspect, the present invention provides an expression vector comprising nucleotides of a base sequence encoding the enzyme of the present invention that defluorinates a fluoroalkane compound containing a hydrophilic group. For example, nucleotides of any of the base sequences (a) to (c) above may be incorporated into an expression vector. Alternatively, nucleotides of a degenerate sequence of any of the base sequences (a) to (c) above, designed for codon optimization, may be incorporated into an expression vector.
[0038] In a further aspect, the present invention provides a host cell comprising an expression vector containing a nucleotide sequence encoding an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0039] In a further aspect, the present invention provides a method for producing the enzyme, which comprises culturing a host cell containing an expression vector containing nucleotides of a base sequence encoding an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group. Expression vectors, host cells, and methods for culturing them are known, and those skilled in the art can select and use them as appropriate.
[0040] In a further aspect, the present invention provides the Pandoraea pnomenusa DYG4 strain, which was deposited at the Patent Microorganisms Depositary (NPMD) of the NITE (National Institute of Technology and Evaluation) Biotechnology Center (Address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on May 27, 2024 (Accession No. NITE ABP-04122) and assigned Accession No. NITE BP-04122 on August 1, 2024. The DYG4 strain produces an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, the enzyme comprising the amino acid sequence set forth in SEQ ID NO: 1. Thus, in a further aspect, the present invention provides an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, produced by the DYG4 strain. In a further aspect, the present invention also provides a method for producing an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group, comprising culturing the DYG4 strain.
[0041] In a further aspect, the present invention provides a mutant strain of the above-mentioned DYG4 strain that produces an enzyme that defluorinates a fluoroalkane compound containing a hydrophilic group.
[0042] The polypeptide comprising the amino acid sequence shown in SEQ ID NO: 1 and the polynucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 are novel. Furthermore, their variants may also be novel.
[0043] Thus, in one aspect, the present invention provides a polypeptide comprising an amino acid sequence having at least about 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) to the amino acid sequence set forth in SEQ ID NO:1. In a further aspect, the present invention provides a polynucleotide comprising a nucleotide sequence having at least about 90% identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100%) to the nucleotide sequence shown in SEQ ID NO:2.
[0044] Unless otherwise specified, the terms used herein shall be interpreted as they are commonly understood in the fields of chemistry, biology, biochemistry, etc. In this specification, when "about" is used before a numerical value, it represents a range of ±20%, preferably ±10%, and more preferably ±5% of the numerical value.
[0045] The present invention will be described in more detail and specifically below by showing examples. However, the examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention. [Example]
[0046] [Example 1] Isolation and identification of microorganisms that produce enzymes that defluorinate fluoroalkyl carboxylic acids One gram of a Japanese environmental sample was added to 20 mL of sterilized DYG medium, and difluoroacetic acid was added to a concentration of 50 ppm. The culture was incubated at 30°C with shaking (passage 1). Every two weeks, 200 μL of the culture medium was collected and sterilized by filtration through a 0.22 μm membrane filter. The difluoroacetic acid concentration in the culture supernatant was measured by LC-MS. When the residual difluoroacetic acid concentration reached 25 ppm or less, the culture was transferred to fresh DYG medium at a concentration of 1% (v / v) (passage 2). Difluoroacetic acid was added again to a concentration of 100 ppm. The culture was transferred again (passage 3), and the fluoride ion concentration was measured once decomposition of difluoroacetic acid was confirmed. After detecting fluoride ions, the culture was transferred again (passage 4). After decomposition of difluoroacetic acid was confirmed, the culture was serially diluted and plated on DYG agar medium containing 100 ppm difluoroacetic acid. The resulting colonies were inoculated into DYG medium containing 100 ppm difluoroacetic acid, and the decomposition ability was evaluated to obtain the DYG4 strain. The 16S rRNA gene of strain DYG4 was found to be more than 99.9% identical to that of Pandoraea pnomenusa strain TF-18 (described in Microbiol Resour Announc. 2020 Jan; 9(1): e01008-19), identifying strain DYG4 as a strain of Pandoraea pnomenusa. The DYG4 strain was deposited at the National Institute of Technology and Evaluation (NITE) Biotechnology Center, Patent Microorganism Depositary (NPMD) (Address: Room 122, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture) on May 27, 2024 (Accession No. NITE ABP-04122) and was assigned the accession number NITE BP-04122 on August 1, 2024.
[0047] [Example 2] Cloning of the gene encoding the enzyme that defluorinates fluoroalkyl carboxylic acids from the DYG4 strain The region from the transcription start site to the termination codon of the gene encoding the defluorination enzyme was amplified using DYG4 total DNA as a template and restriction enzyme site-conjugated primers (fac-dex DYG4_F: TTTGGATCCGTAAGGAGGTGTTCATATGGACTTTCCAGGATTCAA, fac-dex DYG4_R: TTTCTCGAGGCCGTTTCGAGCAAGAA). The PCR product was purified and blunt-end ligated into EcoRV-treated pZErO-2. After transformation into E. coli DH5α, transformants were selected for kanamycin resistance. The plasmid was extracted and sequenced to confirm the PCR-amplified sequence was free of mutations. The resulting vector was digested with restriction enzymes, and the fragment containing the target gene was purified. The resulting fragment was ligated into pET-26b(+) and used to transform DH5α. Transformants were selected and the plasmid extracted, and the E. coli BL21 strain was transformed with the plasmid to construct a heterologous expression system. The amino acid sequence of the enzyme that defluorinates fluoroalkylcarboxylic acids was determined as SEQ ID NO: 1. The nucleotide sequence of the gene encoding the enzyme that defluorinates fluoroalkylcarboxylic acids was determined as SEQ ID NO: 2.
[0048] [Example 3] Evaluation of enzyme activity that defluorinates fluoroalkylcarboxylic acids 1. Microbial evaluation (1) Decomposition activity evaluation method 1. The DYG4 strain stored at -80°C was inoculated onto DYG agar medium containing 100 ppm fluoroalkyl carboxylic acid and cultured at 30°C for 3 days. 2. Select a small colony that is thought to have fluoroalkylcarboxylic acid decomposition activity from the formed colonies and inoculate it into DYG liquid medium containing fluoroalkylcarboxylic acid. 3. Analysis of remaining fluoroalkyl carboxylic acid levels from day 0 to day 3 of culture using LC-MS 4. On the second day of culture, measure the fluoride ions in the culture medium using an electrode. (2) Defluorination rate evaluation results (after 2 days): Fluoride ion analysis (n=1) The experimental results are shown in Table 1. [Table 1] - No data (3) Evaluation results of residual fluoroalkylcarboxylic acid :LC-MS analysis (i) Monofluoroacetate The results are shown in Figure 3. In the DYG4 strain-added system, monofluoroacetic acid disappeared after 3 days of reaction, whereas no disappearance of monofluoroacetic acid was observed in the DYG4 strain-free system. (ii) Difluoroacetate The results are shown in Figure 4. In the DYG4 strain-added system, difluoroacetic acid disappeared within 2 days of reaction, whereas no disappearance of difluoroacetic acid was observed in the DYG4 strain-free system. 2. Evaluation with crude enzyme solution (1) Decomposition activity evaluation method 1. The DYG4 strain stored at -80°C was inoculated onto DYG agar medium containing 100 ppm fluoroalkyl carboxylic acid and cultured at 30°C for 3 days. 2. Select a small colony that is thought to have fluoroalkylcarboxylic acid decomposition activity from the formed colonies and inoculate it into DYG liquid medium containing fluoroalkylcarboxylic acid. 3. After culturing for 2 days, the remaining amount of fluoroalkylcarboxylic acid was confirmed by LC-MS. 4. Centrifuge the culture medium at 6,000 x g for 30 minutes at 4°C to collect the cells. 5. Resuspend the cells in Tris-H2SO4 buffer and centrifuge as in step 4. 6. Repeat steps 4 and 5 to wash the cells. 7. Resuspend the washed cells in Tris-H2SO4 buffer and adjust the turbidity to 30. 8. Sonicate on ice, centrifuge at 6,000 x g for 10 minutes at 4°C, collect the supernatant, and then filter it through a 0.45 μm pore size membrane filter. 9. Add fluoroalkylcarboxylic acid to the filtrate to make the concentration 100 ppm and react at 30°C. 10. Collect a portion of the crude enzyme solution and heat it at 90°C for 10 minutes to immediately inactivate it. 11. After 16 hours, the same treatment as in 10 was carried out. 12. The reaction solutions of 10 and 11 are filtered through a membrane filter with a pore size of 0.22 μm, and the remaining amount of fluoroalkylcarboxylic acid is evaluated by LC-MS. Fluoride ions are also detected using an electrode. (2) Decomposition activity evaluation results (after 16 hours) : Fluoride ion analysis (n=2) The results are shown in Table 2. [Table 2] 3. Heterologous expression (E. coli) (1) Decomposition activity evaluation method 1. Introducing the gene sequence expressing the enzyme identified in Example 2 into pET-26b(+) 2. Transform the plasmid constructed in 1 into E. coli BL21 strain. 3. 100 μg mL of the E. coli prepared in 2. -1 Cultured in LB medium containing kanamycin (LB+Km medium) for 16 hours at 37°C. 4. Incubate the E. coli culture in 200 mL of LB+Km medium at 37°C until the turbidity reaches 0.5. Add IPTG to a final concentration of 1 mM and further incubate at 37°C for 3-5 hours. 5. Collect the cells by centrifuging 400 mL of culture medium at 6,000 x g for 30 minutes at 20°C. 6. Wash with 100 mL of NMM4 medium (repeat this step twice) 7. Suspend the cells in NMM4 medium to a turbidity of 30 and dispense 4 mL into a 96-well deep plate. 8. Add the fluoroalkyl carboxylic acid to be evaluated to a concentration of 100 ppm. 9. After mixing thoroughly, immediately withdraw 200 μL and heat at 98°C for 10 minutes to inactivate the enzyme. 10. Filtration through a membrane filter with a pore size of 0.22 μm 11. After 24 hours, the reaction solution is recovered in the same manner and fluoride ions are measured using an electrode. (2) Decomposition activity evaluation results (after 24 hours): Fluoride ion analysis (n=1) The results are shown in Table 3. [Table 3] 4. Evaluation of purified enzyme solution from heterologous expression system (Escherichia coli) (1) Decomposition activity evaluation method 1. The heterologous expression strain prepared in "3. Heterologous Expression (E. coli)" was cultured in 15 mL of LB+Km medium at 37°C for 17 hours, then scaled up to 800 mL and cultured at 37°C for 17 hours. 2. Collect the cells by centrifuging the culture medium at 6000 x g for 30 minutes at 4°C. 3. Wash the cells with 200 mL of Tris-H2SO4 (repeat this step twice). 4. Resuspend the cells in 100 mL of Tris-H2SO4 and sonicate on ice for 5 min. 5. Centrifuge the cell lysate from step 4 at 25,000 x g for 30 minutes at 4°C and collect the supernatant. 6. The supernatant from step 5 is filtered through a 0.22 μm membrane filter and purified using a HisTrap HP column. 7. Take 1 mL from each peak, and confirm the activity using the same method as in "2. Evaluation of crude enzyme solution." Concentrate the active fraction to 150 μL and purify it using a Superdex 200 10 / 300 GL column. 8. Collect the active fraction and replace the buffer with Tris-H2SO4. 9. Add Tris-H2SO4, 0.5 μM of purified enzyme, and 1 mM of the target fluoroalkyl carboxylic acid to a polypropylene tube and react at 30°C. 10. Recover 100 μL of the reaction mixture and immediately inactivate it by adding 2 μL of 2M H2SO4. 11. After 18 hours, the same treatment as in 3 was carried out. 12. The reaction solutions of 2. and 3. are filtered through a membrane filter with a pore size of 0.22 μm, and the remaining amount of the fluoroalkylcarboxylic acid to be evaluated and the amount of glyoxylic acid produced, which is a dechlorinated and defluorinated product of chlorofluoroacetic acid, are evaluated by LC-MS. (2) Decomposition activity evaluation results (after 118 hours): LCMS analysis (n=3) The results are shown in Table 4, Figures 5 and 6. [Table 4] [Industrial Applicability]
[0049] By using the enzyme of the present invention that defluorinates a fluoroalkane compound having a hydrophilic group, or a microorganism that produces the enzyme, the fluoroalkane compound can be defluorinated with low energy, low environmental load, and high efficiency. Therefore, the present invention is useful for environmental purification, environmental protection, health promotion, disease prevention, etc. [Sequence List Free Text]
[0050] SEQ ID NO: 1 shows the amino acid sequence of an enzyme isolated from DYG4 that defluorinates fluoroalkane compounds containing a hydrophilic group. SEQ ID NO: 2 shows the base sequence of DNA isolated from DYG4 that encodes an enzyme that defluorinates fluoroalkane compounds containing a hydrophilic group. SEQ ID NO: 3 shows the forward primer used in Example 2. SEQ ID NO: 4 shows the reverse primer used in Example 2.
Claims
1. A method for defluorinating a fluoroalkane compound containing a hydrophilic group, such as a sulfonic acid, carboxylic acid, phosphoric acid or salt thereof, and which may contain oxygen atoms and / or halogen atoms other than fluorine, said method comprising: The following amino acid sequence: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) an amino acid sequence in which 1 to 60 amino acids are substituted, deleted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 1; (d) an amino acid sequence encoded by the base sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2; A method for defluorination, comprising allowing an enzyme comprising any one of the following to act on the fluoroalkane compound.
2. The method according to claim 1, wherein the fluorine at the α-position of the fluoroalkane compound is defluorinated.
3. The method according to claim 1, wherein the fluorine at the β-position of the fluoroalkane compound is defluorinated.
4. The method of claim 1 , wherein the fluoroalkane compound comprises a carboxylic acid or a salt thereof.
5. The fluoroalkane compound has Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The method according to claim 4, wherein the fluoroalkylcarboxylic acid is a fluoroalkylcarboxylic acid represented by the formula:
6. The method according to any one of claims 1 to 5, wherein the defluorination activity of the enzyme on the fluoroalkane compound satisfies {(amount of fluorine ions contained in the aqueous fluoroalkane solution after defluorination treatment) - (amount of fluorine ions contained in the aqueous fluoroalkane solution before defluorination treatment)} / {fluorine atoms bonded to the fluoroalkane compound contained in the aqueous fluoroalkane solution before defluorination treatment} > 10%.
7. An enzyme capable of defluorinating a fluoroalkane compound which contains a carboxylic acid or a salt thereof and may contain an oxygen atom and / or a halogen atom other than fluorine, said enzyme having the following amino acid sequence: (a) the amino acid sequence set forth in SEQ ID NO: 1; (b) an amino acid sequence having at least 80% identity to the amino acid sequence set forth in SEQ ID NO: 1; (c) an amino acid sequence in which 1 to 60 amino acids are substituted, deleted, inserted or added in the amino acid sequence set forth in SEQ ID NO: 1; (d) an amino acid sequence encoded by the base sequence set forth in SEQ ID NO: 2; (e) an amino acid sequence encoded by a nucleotide sequence having at least 80% identity to the nucleotide sequence set forth in SEQ ID NO: 2, or (f) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2; An enzyme comprising either
8. The enzyme according to claim 7, which defluorinates the fluorine at the α-position of the fluoroalkane compound.
9. The enzyme according to claim 7, which defluorinates the fluorine at the β-position of the fluoroalkane compound.
10. The fluoroalkane compound has Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The enzyme according to claim 7, which is a fluoroalkyl carboxylic acid represented by the formula:
11. The following nucleotides: (a) a nucleotide sequence set forth in SEQ ID NO: 2; (b) a nucleotide having at least 80% identity to the base sequence set forth in SEQ ID NO: 2, or (c) a nucleotide that hybridizes under stringent conditions with a nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO: 2; An expression vector comprising:
12. A host cell comprising the expression vector of claim 11.
13. A method for producing an enzyme capable of defluorinating a fluoroalkane compound containing a carboxylic acid or a salt thereof and optionally containing an oxygen atom and / or a halogen atom other than fluorine, comprising culturing the host cell according to claim 12.
14. The method according to claim 13, wherein the enzyme defluorinates the fluorine at the β-position of the fluoroalkane compound.
15. The method according to claim 13, wherein the enzyme defluorinates the fluorine at the α-position of the fluoroalkane compound.
16. The fluoroalkane compound has Formula I: R1-COOH (I) [wherein R1 represents a fluoroalkyl group having 1 to 2 carbon atoms which may contain an oxygen atom and / or a halogen atom other than fluorine] The method according to claim 13, wherein the fluoroalkyl carboxylic acid is a fluoroalkyl carboxylic acid represented by the formula:
17. The microorganism was deposited at NITE under accession number NITE BP-04122.
18. An enzyme capable of defluorinating a fluoroalkyl carboxylic acid, produced by the microorganism according to claim 17.
19. A method for producing an enzyme capable of defluorinating a fluoroalkyl carboxylic acid, comprising culturing the microorganism according to claim 17.
Citation Information
Patent Citations
Gene to code haloacetate dehalogenase
JP1990109981A