Methods, compositions, and kits for inhibiting adapter dimer formation

Abstract

[0013] A method of reducing adapter dimers in a sequencing library is provided according to an aspect of the disclosure, the method comprising: hybridizing excess 3' adapters to a blocker oligonucleotide to form a hybridization complex, such that the excess 3' adapters are unavailable for adapter dimer formation; the hybridization complex comprises: a first blocker oligonucleotide 3' end adjacent to an adenylated nucleotide at the 5' end of a first unligated 3' adapter; and a second blocker oligonucleotide 3' end adjacent to an adenylated nucleotide at the 5' end of a second unligated 3' adapter, wherein the first blocker oligonucleotide has a 5' portion that is complementary to and hybridizes to the first unligated 3' adapter, the second blocker oligonucleotide has a 5' portion that is complementary to and hybridizes to the second unligated 3' adapter, and the first blocker oligonucleotide has a 3' portion that is complementary to and hybridizes to the 3' portion of the second blocker oligonucleotide.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 323,778, filed March 25, 2022, the entire contents of which are incorporated herein by reference. Sequence Listing This application contains a Sequence Listing that has been submitted electronically as an XML file, which is incorporated by reference in its entirety. The XML file, created on March 24, 2023, has the file name 16NEN27152WO.xml and is 12,732 bytes in size. The present disclosure relates to methods, compositions, and kits for reducing adapter dimers in sequencing libraries. [Background technology]

[0002] Genetic analysis is becoming increasingly commonplace and is useful for a variety of molecular biology applications. For example, personal genetic testing is particularly useful for the early detection of inherited diseases and can play a role in selecting treatments for specific diseases or conditions.

[0003] Massively parallel nucleic acid sequencing technologies play an important role in the genetic analysis of target nucleic acids, but suboptimal results are obtained when non-target nucleic acids are sequenced along with the target nucleic acid.

[0004] To reduce the contamination of non-target sequences in sequencing results, target enrichment methods are often used in massively parallel nucleic acid sequencing technologies. One such enrichment method relies on hybridization capture of target nucleic acid sequence library molecules.

[0005] However, a sequencing library for massively parallel nucleic acid sequencing includes adapter sequences attached to insert sequences in a nucleic acid sequencing library molecule. The adapters include nucleic acid sequences with various functional properties, such as an extension primer binding site, one or more index sequences for sample identification, a sequencing primer binding site, and an amplification primer binding site. During the process of creating a sequencing library, the adapters are ligated to the insert sequences of interest. An undesirable by-product of adapter ligation to the insert sequences is that the adapters may ligate to each other to generate adapter dimers. Even a small number of adapter dimers may adversely affect the quality of sequencing, since the adapter dimers may be effectively amplified by an amplification reaction aimed at enriching the insert sequences of interest.

[0006] Furthermore, adapter dimers may be retained by hybridization capture during the enrichment step, thereby wasting reagents and time on capturing and sequencing the adapter dimers.

[0007] As the range of applications of massively parallel sequencing technologies expands, the need to multiplex many individual libraries in a single run has increased, creating a need to effectively inhibit adapter dimer formation and remove any adapter dimers that do form.

[0008] There is a continuing need for compositions and methods for reducing adapter dimers in sequencing libraries for massively parallel sequencing. Summary of the Invention

[0009] According to an aspect of the disclosure, there is provided a method for reducing adapter dimers in a sequencing library, comprising: combining in a mixture under ligation reaction conditions a population of sample nucleic acids, each having a 5' end and a 3' end, a population of 3' adapters, each having a 5' end portion at least 8 nucleotides in length and a 5' end that is an adenylated nucleotide, and a ligase to generate 1) a first ligation product comprising each 3' end of the sample nucleic acid ligated to the 5' end of the 3' adapter, and 2) an excess of unligated 3' adapters in the mixture; adding a blocker oligonucleotide to the mixture, the blocker oligonucleotide comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion at least 8 nucleotides in length, and ii) at least 1 to 20 nucleotides in length; and a first blocker oligonucleotide 3' portion comprising a first oligonucleotide 3' end, wherein at least one of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion at least 1 to 20 nucleotides in length and comprising a second blocker oligonucleotide 3' end, wherein at least one of the 1 to 20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; wherein both the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are complementary to a 5' terminal portion of the 3' adaptor;and incubating the mixture under hybridization conditions, whereby the first blocker oligonucleotide 3' portion hybridizes to the second blocker oligonucleotide 3' portion and the first blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor, whereby the second blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor to generate a hybridized complex in which the first blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adaptor and the second blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adaptor, thereby reducing the excess unligated 3' adaptor in the mixture to generate a purified mixture;

[0010] According to an aspect of the present disclosure, the first blocker oligonucleotide 3' end and the second blocker oligonucleotide 3' end can both be ligated to the adenylated nucleotide at the 5' end of an excess of unligated 3' adaptors; further comprising ligating the first blocker oligonucleotide 3' end of the hybridized complex to the adjacent adenylated nucleotide located at the 5' end of a first unligated 3' adaptor, and ligating the second blocker oligonucleotide 3' end of the hybridized complex to the adjacent adenylated nucleotide located at the 5' end of a second unligated 3' adaptor to generate a ligated complex, thereby reducing the excess of unligated 3' adaptors in the mixture to generate a purified mixture.

[0011] According to aspects of the present disclosure, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1-20 nucleotides of the first blocker oligonucleotide 3' portion are non-naturally occurring nucleotides, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1-20 nucleotides of the second blocker oligonucleotide 3' portion are non-naturally occurring nucleotides.

[0012] According to aspects of the present disclosure, the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, and the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion.

[0013] According to an embodiment of the invention, the first blocker oligonucleotide and the second blocker oligonucleotide each have a length ranging from 11 to 50 nucleotides.

[0014] According to an embodiment of the invention, the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0015] According to an aspect of the present disclosure, the method for reducing adapter dimers in a sequencing library further includes adding a 5' adapter to the mixture, the 5' adapter having a 3' end, wherein each of the first ligation products comprises the 3' end of the sample nucleic acid ligated to the 5' end of the 3' adapter and the 5' end of the sample nucleic acid ligated to the 3' end of the 5' adapter, thereby generating sequencing library molecules, the sequencing library molecules comprising the sample nucleic acid insert disposed between and bound to the 5' adapter and the 3' adapter.

[0016] According to an embodiment of the present disclosure, the method for reducing adapter dimers in a sequencing library further includes adding a 5' adapter to the purification mixture; and incubating the purification mixture under ligation reaction conditions, thereby 1) ligating the 5' adapter to a first ligation product to generate a sequencing library molecule, the sequencing library molecule including a sample nucleic acid insert disposed between and bound to the 5' adapter and the 3' adapter.

[0017] According to an aspect of the disclosure, there is provided a method of reducing adapter dimers in a sequencing library, where excess unligated 3' adapters are reduced but not removed, whereby ligation includes ligating a 5' adapter to at least a portion of the excess unligated 3' adapters to generate an adapter dimer that includes a 5' adapter attached to the 3' adapter at the interface between the 5' adapter and the 3' adapter. Thus, according to an aspect of the disclosure, there is provided a method of reducing adapter dimers in a sequencing library, which further includes inhibiting adapter dimer amplification in an amplification reaction, whereby the sequencing library molecules are selectively enriched relative to the adapter dimers by the amplification reaction. Inhibiting adapter dimer amplification may include one or more of the following: removing at least a portion of the adapter dimers prior to amplification; specific cleavage of the adapter dimers by an enzyme; cleavage of the adapter dimers by CRISPR / Cas9; gel purification to remove the adapter dimers; size selection based on SPRI bead technology to remove the adapter dimers; and adding an adapter dimer blocker oligonucleotide to the mixture, where the adapter dimer blocker is effective to inhibit the amplification of the adapter dimers.

[0018] According to aspects of the present disclosure, methods are provided for reducing adapter dimers in a sequencing library, comprising adding to a mixture of adapter dimer blocker oligonucleotides, wherein the adapter dimer blocker oligonucleotides are effective to inhibit adapter dimer amplification, where the adapter dimer blocker oligonucleotides are complementary to one or more flanking portions of the adapter dimer, the one or more flanking portions including at least one nucleotide of the 5' adapter at the interface between the 5' adapter and the 3' adapter, and the flanking portion of the 3' adapter includes an amplification primer binding site.

[0019] According to an aspect of the present disclosure, a method for reducing adapter dimers in a sequencing library is provided, wherein the sample nucleic acid is or comprises RNA.

[0020] According to aspects of the present disclosure, methods are provided for reducing adapter dimers in a sequencing library, where the sample nucleic acid is or comprises RNA, and the methods include reverse transcribing the RNA and generating reverse transcribed sequencing library molecules.

[0021] According to an aspect of the present disclosure, there is provided a method for reducing adapter dimers in a sequencing library, further comprising amplifying the sequencing library molecules or the reverse transcribed sequencing library molecules.

[0022] According to an aspect of the present disclosure, there is provided an oligonucleotide pair for reducing adapter dimers in a sequencing library, comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion at least 1-20 nucleotides in length and comprising a first oligonucleotide 3' end, where at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion at least 1-20 nucleotides in length and comprising a second blocker oligonucleotide 3' end, where at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; wherein both the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are complementary to a 5' end portion of a 3' adapter.

[0023] According to an aspect of the present disclosure, the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide can both be ligated to the adenylated nucleotide at the 5' end of an excess of unligated 3' adaptors.

[0024] According to an aspect of the present disclosure, there is provided a blocker oligonucleotide pair for reducing adapter dimers in a sequencing library, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1-20 nucleotides of a first blocker oligonucleotide 3' portion are unnatural nucleotides and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1-20 nucleotides of a second blocker oligonucleotide 3' portion are unnatural nucleotides.

[0025] According to an aspect of the present disclosure, a blocker oligonucleotide pair for reducing adapter dimers in a sequence library is provided, wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, and wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion, when the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0026] According to an aspect of the present disclosure, a blocker oligonucleotide pair for reducing adapter dimers in a sequencing library is provided, where the first blocker oligonucleotide and the second blocker oligonucleotide each have a length ranging from about 11 to about 50 nucleotides.

[0027] According to an aspect of the present disclosure, a blocker oligonucleotide pair for reducing adapter dimers in a sequencing library is provided, where a first blocker oligonucleotide and a second blocker oligonucleotide have the same nucleotide sequence.

[0028] According to an aspect of the present disclosure, a kit for reducing adapter dimers in a sequencing library is provided, comprising one or more blocker oligonucleotide pairs for reducing adapter dimers in a sequencing library.

[0029] According to an aspect of the present disclosure, the kit for reducing adapter dimers in a sequencing library further includes an adapter dimer blocker oligonucleotide effective to inhibit amplification of adapter dimers.

[0030] According to an aspect of the present disclosure, a kit is provided for reducing adapter dimers in a sequencing library, where an adapter dimer blocker oligonucleotide is complementary to one or more flanking portions of an adapter dimer, the one or more flanking portions including at least one nucleotide of the 5' adapter at the interface between the 5' adapter and the 3' adapter, and the flanking portion of the 3' adapter includes an amplification primer binding site. [Brief description of the drawings]

[0031] [Figure 1]FIG. 1 is a schematic diagram of a hybridization complex comprising blocker oligonucleotides and 3' adaptor groups, according to an embodiment of the present disclosure; FIG. 1 includes numbering indicating features of the hybridization complex, including: a first blocker oligonucleotide 20; a first blocker oligonucleotide 3' end 28; a first blocker oligonucleotide 5' portion 30; a first blocker oligonucleotide 3' portion 35; a second blocker oligonucleotide 5' portion 55; a second blocker oligonucleotide 40; a second blocker oligonucleotide 3' end 48; a second blocker oligonucleotide 3' portion 50; a 3' adaptor 60; and a 5' adenylated end of the 3' adaptor 62. [Figure 2A] FIG. 2A is a schematic diagram showing a "single adaptor system" in which blocker oligonucleotides have the same sequence, include a blocker oligonucleotide 5' portion (dark grey), and include a palindrome blocker oligonucleotide 3' portion (light grey) such that the palindrome blocker oligonucleotide 3' portions are complementary and anneal as shown; a "single adaptor system" is used, for example, in methods to generate sequencing libraries that include a single type of adaptor. [Figure 2B] FIG. 2B is a schematic diagram illustrating a "multiple adapter system" that includes at least two different types of blocker oligonucleotides, where each different type of blocker oligonucleotide has a different sequence, includes a different blocker oligonucleotide 5' moiety (top left, dark grey; and bottom left, medium grey), and includes identical palindrome blocker oligonucleotide 3' moieties (light grey) such that the palindrome blocker oligonucleotide 3' moieties are complementary and anneal as shown; a "multiple adapter system" can be used, for example, in methods to generate sequencing libraries that include multiple types of adapters, e.g., each adapter includes a different index sequence. [Figure 2C]FIG. 2C is a schematic diagram illustrating a "single adaptor system" that includes at least two types of blocker oligonucleotides, where each different type of blocker oligonucleotide has a different sequence, includes an identical blocker oligonucleotide 5' portion (dark grey), and includes a different non-palindromic blocker oligonucleotide 3' portion (light grey at top; stippled grey at bottom) such that the non-palindromic blocker oligonucleotide 3' portions are complementary and anneal as shown; a "single adaptor system" may be used, for example, in methods to generate sequencing libraries that include a single type of adaptor. [Diagram 3] 3 is a graph showing inhibition of adapter dimer formation according to an embodiment of the present disclosure. FIG. 3 shows a) the percentage of desired RNA successfully incorporated into sequencing library molecules (dark grey); b) the percentage of adapter dimers (standard dimers) formed and incorporated into sequencing library molecules (medium grey); and c) the percentage of other molecules incorporated into sequencing library molecules (light grey) for methods of reducing adapter dimers in sequencing libraries using: #1) a method that does not inhibit adapter dimer formation; #2) a method that includes the use of one or more blocker oligonucleotides according to an embodiment of the present disclosure; #3) a method that includes removing at least a portion of the adapter dimers prior to amplification; or #4) a method that includes the use of one or more blocker oligonucleotides according to an embodiment of the present disclosure and further includes removing at least a portion of the adapter dimers prior to amplification. [Figure 4]Figure 4 is a graph showing results demonstrating that the percentage of adapter dimers incorporated into the sequencing library was significantly reduced using a method including the use of one or more blocker oligonucleotides according to an embodiment of the invention, resulting in a significantly lower percentage of sequenced dimers compared to a conventional method. Additionally, the percentage of adapter dimers incorporated into the sequencing library was significantly reduced using a method including the use of one or more blocker oligonucleotides according to an embodiment of the invention, resulting in an increased percentage of sequenced mature miRNA compared to a conventional method. In Figure 4, light grey bar 1 represents data obtained using a method including the use of one or more blocker oligonucleotides according to an embodiment of the invention, and dark grey bar 2 represents data obtained using a conventional method. [Diagram 5] 5 is a graph showing results obtained using a method including the use of one or more blocker oligonucleotides according to an embodiment of the present disclosure, with dark grey bar 2 representing data obtained using a conventional method. The results show a comparison of the number of unique miRNAs represented in the sequence data, i.e., only 509 unique single sequences detected using the conventional method at least once, versus 600 unique single sequences detected using a method including one or more blocker oligonucleotides according to an embodiment of the present disclosure at least once; only 424 unique single sequences detected using the conventional method at least three times, versus 471 unique single sequences detected using a method including one or more blocker oligonucleotides according to an embodiment of the present disclosure at least three times; 370 unique single sequences detected using the conventional method at least five times, versus 407 unique single sequences detected using a method including one or more blocker oligonucleotides according to an embodiment of the present disclosure at least five times; only 295 unique single sequences detected using the conventional method at least ten times, versus 339 unique single sequences detected using a method including one or more blocker oligonucleotides according to an embodiment of the present disclosure at least ten times. [Figure 6]6 is a Venn diagram showing a comparison of the number of unique miRNAs detected versus the 5 thresholds that are the same between the 3 replicates using a method involving the use of one or more blocker oligonucleotides according to an embodiment of the present invention (large grey circles) and the 3 replicates obtained using a conventional method (medium sized medium grey circles). The smallest black circle represents the number of unique miRNAs common to both methods. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Scientific and technical terms used herein are intended to have the meanings commonly understood by those of ordinary skill in the art. Such terms are defined and used in context in various standard reference works, e.g., J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002; B. Alberts et al., Molecular Biology of the Cell, 4th Ed., Garland, 2002; DL Nelson and MM Cox, Lehninger Principles of Biochemistry, 4th Ed., WH Freeman & Company, 2004; Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004; Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, 21st Ed., 2005; Including LV Allen, Jr. et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems, 8th Ed., Philadelphia, PA: Lippincott, Williams & Wilkins, 2004; and L. Brunton et al., Goodman & Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill Professional, 12th Ed., 2011.

[0033] The singular terms "a," "an," and "the" are not intended to be limiting and include plural referents unless expressly stated otherwise or unless the context clearly indicates otherwise.

[0034] The term "about" and grammatical equivalents, as used herein in connection with a reference numerical value, refers to the reference numerical value and numerical values ​​within 10% of the reference numerical value, including numerical values ​​that are plus or minus (+ / -) 1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -6%, + / -7%, + / -8%, + / -9%, or + / -10% of the reference numerical value. In the context of stated ranges of reference numerical values, the term "about" and its grammatical equivalents, as used herein, refers to ranges that include numerical values ​​that are + / -1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -6%, + / -7%, + / -8%, + / -9%, or + / -10% of the reference lower limit of that numerical range, and numerical values ​​that are + / -1%, + / -2%, + / -3%, + / -4%, + / -5%, + / -6%, + / -7%, + / -8%, + / -9%, or + / -10% of the reference upper limit of that numerical range. Additionally, unless otherwise specified, numerical entries herein are understood to include all intermediate and fractional values ​​of the listed numerical values, for example, 50%, 60%, 75% are understood to include 55%, 64.5%, 74%.

[0035] As used herein, terms such as "first," "second," and the like may be used in connection with a group or combination of elements, and these terms are used to designate such a group or combination of elements without limitation as to whether the first element and the second element are the same or different from one another.

[0036] Although certain combinations of features are recited in the claims and / or disclosed in the specification, these combinations of features are not intended to limit the disclosure of the various aspects. Not all possible combinations of such features are specifically recited in the claims and / or disclosed in the specification. Although each dependent claim listed below may directly depend on only one claim, the disclosure of the various aspects includes each dependent claim in combination with all other claims in the claim set. As used herein, phrases referring to a list of "at least one" items refer to any combination of those items, including single items. By way of example, "at least one of: a, b, or c" is intended to cover a only; b only; c only; a and b; a and b and c; b and c; a and c; as well as any combination of multiple identical elements such as a and a; a and a and a; a and a and b; a and a and c; a and b and b; a and c and c; and any other combination or permutation of a, b, and c.

[0037] According to an aspect of the present disclosure, there is provided a method of reducing adapter dimers in a sequencing library, comprising: hybridizing excess 3' adapters to a blocker oligonucleotide to form a hybridization complex, rendering the excess 3' adapters unavailable for adapter dimer formation, wherein the hybridization complex comprises a first blocker oligonucleotide having a 5' portion complementary to and hybridized to a first unligated 3' adapter and a second blocker oligonucleotide having a 5' portion complementary to and hybridized to a second unligated 3' adapter, wherein the first blocker oligonucleotide has a 3' portion complementary to and hybridized to the 3' portion of the second blocker oligonucleotide.

[0038] Optionally, the 3' adaptor is covalently attached by ligation to the blocker oligonucleotide in the hybridization complex, thereby forming a ligation complex in which the 3' end of a first blocker oligonucleotide is ligated to the adjacent adenylated nucleotide located at the 5' end of a first unligated 3' adaptor and the 3' end of a second blocker oligonucleotide is ligated to the adjacent adenylated nucleotide located at the 5' end of a second unligated 3' adaptor, where the first blocker oligonucleotide has a 5' portion that is complementary to and hybridizes to the first unligated 3' adaptor and the second blocker oligonucleotide has a 5' portion that is complementary to and hybridizes to the second unligated 3' adaptor, where the first blocker oligonucleotide has a 3' portion that is complementary to and hybridizes to the 3' portion of the second blocker oligonucleotide.

[0039] The terms "blocker oligonucleotide" and "oligonucleotide blocker," as used interchangeably herein, refer to a synthetic oligonucleotide that includes i) a blocker oligonucleotide 5' portion at least 8 nucleotides long adjacent to the 5' end, and ii) a blocker oligonucleotide 3' portion at least 1-20 nucleotides long adjacent to the 3' end. According to embodiments of the present disclosure, the blocker oligonucleotide has a total length ranging from about 9 nucleotides to about 50 nucleotides. According to aspects of the present disclosure, the blocker oligonucleotides have an overall length of about 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, 30 nucleotides, 31 nucleotides, 32 nucleotides, 33 nucleotides, 34 nucleotides, 35 nucleotides, 36 nucleotides, 37 nucleotides, 38 nucleotides, 39 nucleotides, 40 nucleotides, 41 nucleotides, 42 nucleotides, 43 nucleotides, 44 nucleotides, 45 nucleotides, 46 nucleotides, 47 nucleotides, 48 ​​nucleotides, 49 nucleotides, or about 50 nucleotides, or may be shorter or longer.

[0040] According to aspects of the disclosure, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the 1 to 20 nucleotides of the blocker oligonucleotide 3' portion are non-naturally occurring nucleotides.

[0041] According to an embodiment of the present disclosure, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the 1 to 20 nucleotides of the blocker oligonucleotide 3' portion are T. mAccording to an embodiment of the present disclosure, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the 1 to 20 nucleotides of the blocker oligonucleotide 3' portion are LNAs, PNAs, BNAs, or other Ts. m augmented nucleotide analogues, or any two or more thereof 。 According to aspects of the present disclosure, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the 1 to 20 nucleotides of the blocker oligonucleotide 3' portion are LNA monomers.

[0042] According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides in the 5' portion of the blocker oligonucleotide are non-naturally occurring nucleotides. According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides in the 5' portion of the blocker oligonucleotide are non-naturally occurring nucleotides. m According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides in the 5' portion of the blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, or other T-type nucleotides. m According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides in the blocker oligonucleotide 5' portion are LNA monomers.

[0043] According to an embodiment of the present disclosure, the 3' portion of the blocker oligonucleotide is or includes a palindromic nucleotide sequence.

[0044] According to aspects of the present disclosure, oligonucleotides are synthetically produced using chemical synthesis and / or recombinant molecular biology techniques, e.g., as detailed in Herdewijn, P. (Ed.), Oligonucleotide Synthesis: Methods and Applications, Methods in Molecular Biology, Humana Press, 2004.

[0045] An example of a blocker oligonucleotide is 5'-CACCCGAGAATTCCA--C / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO:1).

[0046] 1 diagrammatically illustrates a first blocker oligonucleotide 20 and a second blocker oligonucleotide 40. The first blocker oligonucleotide 20 has a 5' portion 30 and a 3' portion 35. The first blocker oligonucleotide 3' end is indicated at 28. The second blocker oligonucleotide has a 5' portion 55 and a 5' portion 50. The second blocker oligonucleotide 3' end is indicated at 48. The first and second blocker oligonucleotides are shown as being equal in length with a 3' adaptor 60 and its end 62, although the first and second blocker oligonucleotides may be shorter or longer than the 3' adaptor 60 and its end 62.

[0047] 1 shows a hybridization complex in which the first blocker oligonucleotide 3' portion 35 is hybridized to the second blocker oligonucleotide 3' portion 50. Also shown are 3' adaptors 60, each having a 5' adenylated end 62. The 3' adaptor 60 is shown hybridized to the 5' portion of the first blocker oligonucleotide 30 and to the 5' portion of the second blocker oligonucleotide. The 5' adenylated end 62 of the 3' adaptor adjacent to the 3' end of the first blocker oligonucleotide 28 and the 5' adenylated end 62 of the 3' adaptor adjacent to the 3' end of the second blocker oligonucleotide 48 are also shown.

[0048] Optionally, a ligation reaction is performed in which ligation of the 5' adenylated end 62 of the 3' adapter and the adjacent 3' end of the first blocker oligonucleotide 28 occurs under ligation conditions in the presence of a ligase; and ligation of the 5' adenylated end 62 of the 3' adapter and the adjacent 3' end of the second blocker oligonucleotide 48 occurs under ligation conditions in the presence of a ligase to form a ligation complex.

[0049] According to an aspect of the present disclosure, the first and second blocker oligonucleotides are identical in sequence.

[0050] According to an aspect of the present disclosure, the first and second blocker oligonucleotides differ in sequence.

[0051] The 5' portion of the blocker oligonucleotide of the present disclosure is complementary to the 3' adaptor, and the 5' portion of the blocker oligonucleotide hybridizes to the 3' adaptor under hybridization conditions. The blocker oligonucleotide may be longer, shorter, or the same length as the 3' adaptor. The 5' portion of the blocker oligonucleotide may be fully complementary to the 3' adaptor, or may be 50%, 60%, 70%, 80%, 90% or more complementary, using hybridization conditions suitable for the formation of a hybridization complex and subsequent ligation to form a ligation complex.

[0052] The methods, blocker oligonucleotides, and kits described herein may be used to generate a sequence library from a sample nucleic acid derived from any of a variety of sources. Sample nucleic acids, such as DNA or RNA, are typically present in a biological sample, which may be obtained from an individual, such as blood, lymph, buccal swabs, skin tissue, urine, saliva, tissue, sputum, peritoneal fluid, feces, gastric juice, semen, cerebrospinal fluid, biopsy material, wound exudate, and other bodily samples, and cell lines derived therefrom. Prenatal biological sample nucleic acids may be obtained from amniotic fluid, products of conception, blastocysts and blastocysts, chorionic villi, fetal cells, fetal DNA, and / or fetal RNA circulating in maternal blood. Sample nucleic acids may also be obtained from in vitro sources, such as cell lines.

[0053] The methods, blocker oligonucleotides, and kits described herein may be used to generate sequence libraries from sample nucleic acids obtained from any of a variety of organisms, including, but not limited to, humans, non-human primates, rodents, rabbits, dogs, cats, horses, cows, pigs, goats, and sheep. Non-mammalian sources of sample nucleic acids may also be used, including, for example, fish and other aquatic organisms, birds, poultry, bacteria, viruses, plants, insects, reptiles, amphibians, fungi, and mycobacteria. Thus, sample nucleic acids, such as sample DNA or sample RNA, may be obtained from any of these sources.

[0054] The sample nucleic acid, such as DNA or RNA, can be obtained from any source, including, but not limited to, humans, non-human mammals, vertebrates, invertebrates, microorganisms, plants, etc. The sample nucleic acid, such as DNA or RNA, can be obtained ex vivo or in vivo from one or more cells. For example, the sample nucleic acid, such as DNA or RNA, can be obtained from cultured cells, including, but not limited to, cell lines, primary cells, or cells that have been engineered in the laboratory, such as recombinant cells.

[0055] According to an embodiment of the present disclosure, the sample nucleic acid is a "small RNA". The term "small RNA" as used herein refers to an RNA having a length ranging from about 10 nucleotides to about 300 nucleotides, such as an RNA having a length ranging from about 10 nucleotides to about 250 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 200 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 150 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 100 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 90 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 80 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 70 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 60 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 50 nucleotides, an RNA having a length ranging from about 10 nucleotides to about 40 nucleotides, or an RNA having a length ranging from about 10 nucleotides to about 30 nucleotides. The small RNA may be any of the following: RNA fragments, rRNA, viral RNA, microRNA (miRNA), small interfering RNA (SiRNA), transfer RNA (tRNA), short hairpin RNA (shRNA), repeat-associated RNA (rasiRNA), small nucleolar RNA (snoRNA), Piwi-interacting RNA (piRNA), small Cajal body RNA (scaRNA), heterochromatin siRNA (hc-siRNA), and transacting RNA (ta-siRNA).

[0056] As used herein, the term "sequencing library" refers to a plurality of linear double-stranded DNA fragments containing inserts that are the desired sequencing targets derived from sample nucleic acids that may or may not be derived from the same source. The DNA fragments of the sequencing library further contain functional elements on both sides of the insert that provide identification of the DNA fragment, such as barcode or index sequences, binding of amplification primers, binding of sequencing primers, or specific binding to the desired target, allowing for efficient processing in sequencing methods, especially massively parallel sequencing methods. A sequencing library may include an insert flanked by two adapters, a 5' adapter and a 3' adapter, where the 5' adapter is directly or indirectly covalently attached to the 5' end of the insert and the 3' adapter is directly or indirectly covalently attached to the 3' end of the insert. Indirect attachment of the adapter to the insert refers to a configuration in which another DNA sequence is placed between the insert and the adapter.

[0057] The term "massively parallel sequencing" includes "sequencing by synthesis" and also refers to "next-generation sequencing" and "high-throughput sequencing," and refers to the process of simultaneously or nearly simultaneously sequencing a large number of nucleic acid sequence library molecules, e.g., thousands of nucleic acid sequence library molecules. The set of oligonucleotide blockers provided by aspects of the present disclosure are described herein in some cases with particular reference to, but not limited to, the Illumina Nextera and / or TruSeq platforms and configurations. Rather, the compositions and methods of the present disclosure may be used in any of a variety of sequencing protocols and with a variety of sequencing instruments, including, but not limited to, the Tron Trent system.

[0058] The term "adapter" refers to a linear, single-stranded, double-stranded, or partially double-stranded DNA fragment that contains functional elements that provide, for example, identification, amplification, or specific binding of the DNA fragment to a desired target, allowing for effective processing in a sequencing method. An adapter includes one or more functional elements, such as a sequencing primer binding sequence (also called a sequencing primer binding site), an extension primer binding sequence (also called an extension primer binding site), and an index sequence (also called a barcode sequence or unique molecular identifier (UMI)). The term "5' adapter" refers to an adapter that is or is intended to be covalently attached, directly or indirectly, to the 5' end of an insert. The term "3' adapter" refers to an adapter that is or is intended to be covalently attached, directly or indirectly, to the 3' end of an insert. Adaptors are typically about 10-150 nucleotides in length, e.g., about 10-25, 15-30, 25-40, 30-50, 45-75, 50-100, 90-125, or 120-150, etc. Note that the term "adaptor" can also be spelled "adaptor."

[0059] According to aspects of the present disclosure, the 3' adapter is 5' adenylated at the 5' end of the 3' adapter to facilitate ligation of the 3' adapter to the sample nucleic acid and the blocker oligonucleotide.

[0060] According to aspects of the disclosure, the 5' adenylated 3' adaptors included in the methods, compositions, and / or kits are blocked at the 3' end, such as by a 2',3'-dideoxynucleotide or a 3'(C3)propyl spacer.

[0061] The term "terminus" as used herein with respect to a nucleic acid molecule refers to an end of a linear nucleic acid molecule and is used herein interchangeably with grammatically appropriate variations such as the term "terminus" or "termini". The term "terminal portion" as used herein with respect to a nucleic acid molecule refers to a nucleic acid sequence that includes an end of a nucleic acid molecule and adjacent contiguous nucleic acid sequences, but does not refer to the entire length of the nucleic acid sequence of the nucleic acid molecule. According to aspects of the present disclosure, the "terminal portion" of a nucleic acid molecule refers to a nucleic acid sequence that includes an end of a nucleic acid molecule and adjacent contiguous nucleic acid sequences that constitute about half or less of the entire length of the nucleic acid sequence of the nucleic acid molecule.

[0062] The term "adapter dimer" refers to an undesired by-product formed during ligation of 5' and 3' adapters to the 5' and 3' ends of sample nucleic acids in the process of generating a sequencing library. Specifically, adapter dimers are the ligation products of the 5' adenylated end of the 3' adapter and the 3' end of the 5' adapter. Adapter dimers are amplified in the process of generating a sequencing library, and in the embodiment of the process of generating a sequencing library, they are undesirable because they may compete with the sequencing library molecules and compete for binding sites in the flow cell, significantly reducing sequencing quality.

[0063] As used herein, the term "ligation" refers to the covalent joining of two linear nucleic acid molecules, mediated by a ligase enzyme, to form a longer linear nucleic acid molecule.

[0064] The terms "ligase enzyme" and "ligase" are used interchangeably herein and refer to an enzyme that can covalently link two adjacent nucleic acids to form a bond between the two nucleic acids, such as a phosphodiester bond, or a modified covalent bond, such as, but not limited to, a phosphorothioate bond, a phosphoamidate bond, etc., depending on the type of terminal nucleotide. Ligase enzymes include, but are not limited to, T7 ligase, T4 ligase, E. coli ligase, and Taq ligase. Ligase enzymes include ATP-dependent ligases, NAD+-dependent ligases, and include DNA ligases and RNA ligases that are part of the enzyme class EC 6.5, including, but not limited to, EC 6.5.1.1 (ATP-dependent ligases), EC 6.5.1.2 (NAD+-dependent ligases), EC 6.5.1.3 (RNA ligases), EC 6.5.1.6 DNA ligases (ATP or NAD+), EC 6.5.1.7 DNA ligases (ATP, ADP or GTP), and EC 6.5.1.8 3'-phosphate / 5'-hydroxynucleic acid ligases, as defined by the International Union of Biochemistry and Molecular Biology.

[0065] The conditions for using ligase enzymes are well known.

[0066] Nucleotides, nucleotide analogs, and non-natural nucleotides.

[0067] The term "nucleotide" refers to a molecule that includes a nucleobase, a sugar, and a phosphate. Nucleotides are monomeric units of a nucleic acid sequence, such as a DNA or RNA sequence. The term nucleotide includes ribonucleoside triphosphates, such as ATP, TTP, UTP, CTP, and GTP, and deoxyribonucleoside triphosphates, such as dATP, dCTP, dUTP, dGTP, and dTTP. Nucleotides are commonly designated by the abbreviations A, T, G, C, or U in reference to the nucleobase (see Table I).

[0068] Standard IUPAC nucleotide codes are used herein, as shown in Table I. [Table I]

[0069] The terms "nucleic acid," "nucleotide sequence," and "nucleic acid sequence" refer to RNA, DNA, or RNA / DNA molecules having one or more nucleotides and / or nucleotide analogs in any form, including linear, single-stranded, double-stranded, oligonucleotide, or polynucleotide.

[0070] The term "nucleotide analog" refers to a modified or non-natural nucleotide, particularly a nucleotide analog that can be polymerized with natural and / or non-natural nucleotides by template-directed or non-template-directed nucleic acid polymerization catalyzed by a nucleic acid polymerase. The term "nucleotide analog" refers to a nucleotide that contains one or more modifications in the base and / or sugar and / or phosphate moieties that modify at least one aspect of the chemical nature of the nucleotide analog compared to a reference standard nucleotide, while retaining other properties that enable the nucleotide analog to perform its intended function. Nucleotide analogs and their incorporation into nucleic acids are well known in the art and may be synthesized according to standard procedures and / or obtained commercially.

[0071] Certain nucleotide analogs are capable of Watson-Crick pairing with complementary nucleotides via hydrogen bonds, and illustrative examples include, but are not limited to, natural and unnatural nucleotides and their analogs, including those containing nucleotide base analogs such as substituted purines or pyrimidines, deazapurines, methylpurines, methylpyrimidines, aminopurines, aminopyrimidines, thiopurines, thiopyrimidines, indoles, pyrroles, 7-deazaguanines, 7-deazaadenines, 7-methylguanines, hypoxanthine, pseudocytosine, pseudoisocytosine, isocytosine, isoguanine, 2-thiopyrimidines, 4-thiothymine, 6-thioguanines, nitropyrroles, nitroindoles, and 4-methylindoles. Nucleotide analogs include those containing deoxyribose analogs such as substituted deoxyribose, substituted or unsubstituted arabinose, substituted or unsubstituted xylose, and substituted or unsubstituted pyranoses. Nucleotide analogs include those that contain analogs of phosphate esters, such as phosphorothioates, phosphorodithioates, phosphoramidates, phosphoroselenoates, phosphoroanilothioates, phosphoroanilidates, phosphoramidates, boronophosphates, phosphotriesters, and alkyl phosphonates, such as methyl phosphonate.

[0072] Unnatural nucleotides such as iso-dG and iso-dC form unique base pairs with each other and do not form base pairing (or hybridization) between unnatural nucleotides and natural nucleotide bases, e.g., iso-dG does not pair with dC and iso-dC does not pair with dG. The term "iso-dG" refers to isoguanosine. Note that the term "iisodG" is also used herein to refer to isoguanosine, e.g., that has been incorporated into a sequence. The term "iso-dC" refers to isocytosine. Note that the term "iMe-isodC" is also used herein to refer to isocytosine, e.g., that has been incorporated into a sequence.

[0073] "T mThe terms "melting temperature" and "melting temperature" refer to the temperature at which 50% (half) of a population of double-stranded nucleic acid molecules become dissociated, i.e., single stranded. m Methods for calculating are well known in the art.

[0074] "T m The term "increased nucleotide analogue" refers to the increase in the melting temperature (T m ) compared to the same double-stranded oligonucleotide that does not contain the nucleotide analogue. m The augmented nucleotide analogue may comprise a modified nucleobase, a modified sugar, a modified phosphate, or a combination of any two or more such modifications.

[0075] T m Increased nucleotide analogs include, but are not limited to, locked nucleic acid (LNA) monomers, peptide nucleic acid (PNA) monomers, and bridged nucleic acid (BNA) monomers.

[0076] According to the present specification, various T m Any of the increased nucleotide analogues can be used.

[0077] The term "LNA monomer" is used herein interchangeably with the terms "LNA nucleotide" and "LNA base" and refers to a nucleotide analogue containing a ribose that is locked due to the presence of a covalent bond between the 2' oxygen and the 4' carbon of the ribose ring, i.e., a 2'-O, 4'-C-methylene-β-D-ribofuranosyl monomer that can be incorporated into an oligonucleotide to generate a "locked nucleic acid". LNA monomers have similar or improved Watson-Crick base pairing selectivity compared to conventional nucleotides. Examples of LNA monomers include, but are not limited to, adenine bicyclonucleoside monomers, cytosine bicyclonucleoside monomers, guanine bicyclonucleoside monomers, 5-methylcytosine bicyclonucleoside monomers, thymine bicyclonucleoside monomers, and uracil bicyclonucleoside monomers. The T of an oligonucleotide containing one or more LNA monomers may be selected from the group consisting of nucleotides, nucleotides, and bases. m increases with improved properties such as improved base stacking. Typically, a T of a for each LNA monomer incorporated into an LNA oligonucleotide. m The temperature of the LNA monomer increases by 2-8°C. LNA monomers may be synthesized using well-known methods or obtained commercially. The terms "locked nucleic acid" and LNA are used interchangeably herein to refer to oligonucleotides comprising one or more LNA monomers. According to aspects of the present disclosure, various T-type oligonucleotides, including but not limited to 5-methyl dC, 2,6-diaminopurine, propynyl-deoxyuridine, 5-hydroxybutynyl-2'-deoxyuridine, and combinations of any two or more thereof, are used. m Any of the increased nucleotide analogs can be used. m The increased nucleotide analogs, and / or their derivatives, increase the melting temperature (T m ) can be included as long as they retain the increased functionality compared to a similar double-stranded oligonucleotide that does not contain a nucleotide analogue.

[0078] According to an embodiment of the present disclosure, the blocker oligonucleotide has a T in the range of 55° C. to 100° C. m for example from 60°C to 100°C, such as from 65°C to 100°C, for example from 70°C to 100°C, for example from 75°C to 99°C, for example from 75°C to 90°C, for example from 75°C to 85°C, for example from 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C.

[0079] According to an embodiment of the present disclosure, the set of blocker oligonucleotides has a T range of 55° C. to 100° C. m for example 60°C to 100°C, for example 65°C to 100°C, for example 70°C to 100°C, for example 75°C to 99°C, for example 75°C to 90°C, for example 75°C to 85°C, for example 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100°C .

[0080] According to an embodiment of the present disclosure, the 3' end of one or more blocker oligonucleotides is optionally modified to prevent polymerase extension from the 3' end, for example, in a post-hybridization capture PCR step. Any of a variety of techniques can be used to modify the 3' end of one or more blocker oligonucleotides to prevent polymerase extension from the 3' end, including, but not limited to, removing or modifying the hydroxyl group at the 3' end of the oligonucleotide, such as 3' dideoxy-C (ddC), a phosphate group, or including a 3' spacer. According to an embodiment of the present disclosure, the spacer is present at the 3' end of the blocker oligonucleotide. A non-limiting example is 3' spacer C3 (abbreviated 3SpC3), a three carbon chain (C3) attached to the terminal 3' hydroxyl group of the oligonucleotide blocker. Alternatively, the 3' end of the blocker oligonucleotide is not modified to prevent polymerase extension from the 3' end, for example, if a post-hybridization capture PCR step or other polymerase-mediated extension step of post-hybridization capture is not used.

[0081] The terms "hybridization" and "hybridized" refer to the pairing and binding of complementary nucleic acids. Hybridization can be measured by the degree of complementarity of the nucleic acids, the melting temperature T mThis occurs to varying degrees between two nucleic acids depending on factors such as the stringency of the hybridization conditions and the post-hybridization wash conditions. The term "stringency of hybridization conditions" refers to the conditions of temperature, ionic strength, and composition of the hybridization medium with respect to certain common additives such as formamide, betaine, and polyethylene glycol. The term "stringency of post-hybridization wash conditions" refers to the conditions of temperature, ionic strength, and composition of the hybridization medium, although additives such as detergents, formamide, betaine, and polyethylene glycol are not commonly used in the wash conditions. Specific detergents that can be used include, for example, SDS (sodium dodecyl sulfate), sodium lauroyl sarcosinate (sarkosyl), and CTAB (cetyltrimethylammonium bromide). Determining specific hybridization conditions and post-hybridization wash conditions for a particular nucleic acid is routine and well known in the art, for example, as described in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002. High stringency hybridization conditions are conditions that allow only hybridization of substantially complementary nucleic acids. High stringency post-hybridization wash conditions are conditions that maintain only hybridization of substantially complementary nucleic acids. As used herein, the term "annealing" refers to pairing and binding of an oligonucleotide with a target nucleic acid. There is no intentional distinction between the terms "annealing" and "hybridization".

[0082] As used herein, the term "complementary" includes, but is not limited to, Watson-Crick base pairing between nucleotides, nucleotide analogs, or between nucleotides and nucleotide analogs, where the nucleotides and / or nucleotide analogs hydrogen bond with each other, for example, with a thymine or uracil residue bound to an adenine residue by two hydrogen bonds, and a cytosine and guanine residue bound by three hydrogen bonds. In general, nucleic acids include nucleotide sequences that are described as having a "percent complementarity" to a particular second nucleotide sequence. For example, a nucleotide sequence may have 80%, 90%, or 100% complementarity to a particular second nucleotide sequence, indicating that 8 out of 10, 9 out of 10, or 10 out of 10 nucleotides of the sequence are complementary to the particular second nucleotide sequence. For example, the nucleotide sequence 3'-TCGA-5' is 100% complementary to the nucleotide sequence 5'-AGCT-3'. Furthermore, the nucleotide sequence 3'-TCGA-5' is 100%, or completely complementary, to the region of the nucleotide sequence 5'-TTAGCTGG-3'. As used herein, the term "complementary" refers to a nucleotide sequence that is complementary to a given nucleotide sequence.

[0083] Typically, nucleic acids with about 85-100% complementarity are considered to be highly complementary and will hybridize under high stringency conditions. Moderate stringency conditions are exemplified by conditions under which nucleic acids with moderate complementarity, about 50-84% complementarity, and high complementarity will hybridize. In contrast, low stringency hybridization conditions are conditions under which nucleic acids with low complementarity will hybridize. The terms "specific hybridization" and "specifically hybridize" refer to hybridization of a particular nucleic acid to a target nucleic acid without substantial hybridization to nucleic acids other than the target nucleic acid in a sample.

[0084] The term "palindromic nucleotide sequence" refers to a nucleotide sequence that is an inverted repeat that results in the same nucleotide sequence when read in the 5' to 3' direction as when read in the 5' to 3' direction on the complementary strand. For example, a palindromic nucleotide sequence read 5' to 3' is 5'-GGATCC-3', which is the same as when read 5' to 3' on the complementary strand, i.e., 3'-CCTAGG-5'.

[0085] At the annealing temperature, annealing of the blocker oligonucleotide to the excess adapter is performed. The annealing temperature depends on factors including the nucleic acid sequence of the blocker oligonucleotide and the target nucleic acid, as well as the composition of the reaction medium, including factors such as salt concentration and concentrations of additives such as formamide, betaine, polyethylene glycol, detergents such as SDS, and DMSO. Typically, the annealing temperature ranges from 30° C. to 65° C., but can be higher or lower. The annealing temperature is determined by the melting temperature (T m ), but typically, blocker oligonucleotides according to embodiments of the present disclosure have a T above the annealing temperature. m , which ensures that the blocker oligonucleotides bind, i.e., hybridize, to the target during annealing. Similarly, one or more post-hybridization washes may be performed to ensure that the T m It may also be carried out at lower temperatures.

[0086] After annealing the blocker oligonucleotides to the excess adapters, a hybridized complex is generated in which the 3' end of the first blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adapter and the 3' end of the second blocker oligonucleotide is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adapter, thereby reducing the excess of unligated 3' adapters.

[0087] Optionally, the 3' end of a first blocker oligonucleotide of the hybridized complex is ligated to the adjacent adenylated nucleotide at the 5' end of a first unligated 3' adaptor, and the 3' end of a second blocker oligonucleotide of the hybridized complex is ligated to the adjacent adenylated nucleotide at the 5' end of a second unligated 3' adaptor to generate a ligation complex, thereby reducing excess unligated 3' adaptors.

[0088] The hybridization complex or ligation complex can be separated from the desired sequence library molecules. The separation of the hybridization complex or ligation complex from the desired sequence library molecules can be by column separation, filter separation, gel separation, or size separation, such as binding either the ligation complex or the desired sequence library molecules to a solid or semi-solid support, followed by separation of unbound material from bound material. According to an aspect of the present disclosure, the solid support includes magnetic beads.

[0089] Template DNA amplification is accomplished using in vitro amplification methods. The terms "amplify," "amplification," and "amplifying" are generally used to refer to methods or techniques for replicating a template nucleic acid, thereby generating a nucleic acid that contains a copy of all or a portion of the template nucleic acid, which is also referred to as an amplicon. Amplification methods encompassed by embodiments of the present invention include nucleic acid polymerase-catalyzed template-directed primer extension using a pair of primers that flank a target nucleic acid, and include, by way of example only, but not limited to, polymerase chain reaction (PCR), reverse transcription PCR (RT-PCR), ligation-mediated PCR (LM-PCR), phi-29 PCR, real-time quantitative PCR (qPCR), whole genome amplification, and other nucleic acid amplification methods described in C.W. Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004; and Kroneis, T. (Ed.), Whole Genome Amplification: Methods and Protocols (Methods in Molecular Biology), 2015, Humana Press ISBN-10: 1493929895.

[0090] The term "isothermal amplification" refers to nucleic acid amplification that includes single-temperature amplification, thus avoiding the need for thermal cycling (as in PCR). Examples of isothermal amplification include, but are not limited to, circular helicase-dependent amplification (cHDA), genomic exponential amplification reaction (GEAR), helicase-dependent amplification (HDA), isothermal multiple displacement amplification (IMDA), loop-mediated isothermal amplification (LAMP), multiple displacement amplification (MDA), nicking enzyme amplification reaction (NEAR), nucleic acid sequence-based amplification (NASBA), divergent amplification (RAM), recombinase polymerase amplification (RPA), rolling circle amplification (RCA), self-sustained sequence replication (3SR), signal-mediated RNA amplification technology (SMART), strand displacement amplification (SDA), single primer isothermal amplification (SPIA), and transcription-mediated amplification (TMA).

[0091] The terms "amplified nucleic acid," "amplified DNA," and "amplicon," and their plurals, refer to the product of a replication process of a target nucleic acid template.

[0092] Amplified nucleic acids can optionally include additional materials such as, but not limited to, nucleic acid sequences present in the primer but not in the original nucleic acid template, functional groups for chemical reactions, detectable labels, etc. Non-limiting examples of primer-derived nucleic acid sequences that can be incorporated into amplicons and thus into the resulting libraries include universal sequences, adapters, index sequences, discrimination sequences, detection sequences, sorting sequences, capture sequences, restriction enzyme cleavage sites, sequencing primer binding site sequences, and amplification primer binding site sequences.

[0093] The term "universal sequence" refers to a nucleic acid sequence present in a plurality of nucleic acid molecules, including nucleic acid sequences that are not common to the plurality of nucleic acid molecules. A universal sequence allows the plurality of nucleic acid molecules to share a common functional aspect, such as binding to a specific primer or capture moiety. Non-limiting examples of universal extension primer binding sites include sequences identical to or complementary to P5 and P7 primers. P5 and P7 primers, their complements, and their uses, such as in capture flow cells on flow cell substrates for next generation sequencing (NGS), are known in the art, for example as detailed in WO2015106941.

[0094] According to an aspect of the present disclosure, index sequences are incorporated into amplicons during library preparation. Index sequences are unique nucleic acid sequences common to a set of amplicons, e.g., proving that the set of amplicons originates from a particular source. Index sequences allow multiplexing, since multiple nucleic acids from different sources can be pooled for sequencing and, if necessary, can be "demultiplexed" later for data analysis.

[0095] The term "primer" refers to an oligonucleotide capable of acting as a point of initiation of synthesis of a template-directed primer extension product under conditions that induce synthesis of an oligonucleotide primer extension product complementary to a template nucleic acid. Such conditions include the presence of nucleotides and / or nucleotide analogs, and a suitable polymerase, at a suitable temperature and pH.

[0096] Primers are typically about 10 to 30 contiguous nucleotides in length, but can be longer or shorter. An oligonucleotide primer is fully or substantially complementary to a region of a template nucleic acid such that, under hybridization conditions, the oligonucleotide primer anneals to the complementary region of the template nucleic acid. Suitable reaction conditions for the synthesis of primer extension products according to embodiments of the present disclosure include the presence of suitable reactant components, including, but not limited to, a polymerase; and nucleotides and / or nucleotide analogs.

[0097] A variety of primers may be used in the methods according to aspects of the present disclosure, including amplification primers, sequencing primers and reverse transcription primers.

[0098] Primer design is well known to those skilled in the art and is designed according to well-known methods and standards. For example, when using a pair of primers in an amplification reaction or the like, the annealing temperatures of the primers should be approximately the same, within a few degrees. In general, primers should not form dimers with each other, and primers should not form secondary structures such as hairpins. Methods and considerations for primer design and amplification procedures are detailed in Yuryev, A., PCR Primer Design, Methods in Molecular Biology, vol. 42, Human Press, 2007; CW Dieffenbach et al., PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2003; V. Demidov et al., DNA Amplification: Current Technologies and Applications, Taylor & Francis, 2004.

[0099] Primer extension to generate a first strand complementary DNA is accomplished using a polymerase enzyme under extension reaction conditions compatible with the polymerase activity generating the complementary strand. Specific conditions and protocols for primer extension are detailed in J. Sambrook and D.W. Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press; 3rd Ed., 2001; and FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.

[0100] According to an aspect of the present disclosure, the sample nucleic acid is RNA, i.e., sample RNA, and the sample RNA is reverse transcribed to generate cDNA. The sample RNA may be reverse transcribed before or after the addition of adapters.

[0101] According to an embodiment of the method of the present disclosure, the method includes annealing a reverse transcription primer to a target nucleic acid comprising RNA; and reverse transcribing the RNA to generate a first strand complementary DNA (cDNA) that is complementary to the RNA.

[0102] Annealing of the reverse transcription primer or set of reverse transcription primers to the target nucleic acid is performed at a certain annealing temperature. The annealing temperature depends on factors including the nucleic acid sequence of the reverse transcription primer or primers, the target nucleic acid, and the composition of the reaction medium, including factors such as salt concentration and the concentration of additives such as, but not limited to, formamide, betaine, polyethylene glycol, SDS, DMSO, etc. Typically, the annealing temperature is 30 o C to 65 o The annealing temperature is in the range of 0.1 to 1.0 C, but may be higher or lower. The annealing temperature is the melting temperature (T m ) of the reverse transcription primer. m Higher, improving the stringency of the reaction.

[0103] The present disclosure provides a method for generating a sequence library, which includes reverse transcription of a target RNA, generating a first strand complementary DNA (cDNA), and using a reverse transcriptase enzyme under reaction conditions compatible with the reverse transcriptase activity reaction to transcribe the target RNA. Specific conditions and protocols for reverse transcription are detailed in J. Sambrook and DW Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor 20 Laboratory Press; 3rd Ed., 2001; and FM Ausubel, Ed., Short Protocols in Molecular Biology, Current Protocols; 5th Ed., 2002.

[0104] According to the present disclosure, there is provided a method for generating a sequencing library, further comprising polymerizing a second strand DNA complementary to the first strand cDNA to generate double stranded cDNA. Polymerizing the second strand DNA complementary to the first strand cDNA may include providing a suitable DNA polymerase and polymerizing to generate double stranded cDNA under reaction conditions compatible with DNA polymerase activity to generate the double stranded cDNA.

[0105] Suitable polymerases may include bacterial DNA polymerase, eukaryotic 30 DNA polymerase, archaeal DNA polymerase, viral DNA polymerase, Taq polymerase, DNA polymerase I, T4 DNA polymerase, Pfu polymerase, and phage DNA polymerases, including the Klenow fragment of DNA polymerase I, SEQUENASE 1.0 and SEQUENASE 2.0 (US Biochemical), T5 DNA polymerase, and Phi29 DNA polymerase, among others.

[0106] Amplicon sequencing is accomplished using any of a variety of sequencing methods, including conventional Sanger sequencing and massively parallel sequencing methods ("next generation sequencing").

[0107] Advantageously, a paired-end read is performed. The term "paired-end read" refers to a sequencing technique that involves one sequence being "read" from both ends of the amplicon and sequenced. This allows for an increased yield of sequencing data and improved reliability of the sequencing results.

[0108] According to an aspect of the present disclosure, since the formation of the hybridization or ligation complex reduces but does not remove the excess unligated 3' adapters, the step of ligating the 5' adapters to the library inserts also includes ligating the 5' adapters to a portion of the excess unligated 3' adapters to generate adapter dimers at the interface between the 5' adapters and the 3' adapters, where the 5' adapters are covalently linked to the 3' adapters by ligation. Thus, according to an aspect of the present disclosure, the method of reducing adapter dimers in a sequencing library further includes inhibiting adapter dimer amplification in an amplification reaction such that the sequencing library molecules are selectively enriched relative to the adapter dimers by the amplification reaction.

[0109] According to aspects of the present disclosure, inhibiting adaptor dimer amplification includes pre-amplification removal of at least a portion of the adaptor dimers.

[0110] According to embodiments of the present disclosure, removal of at least a portion of the adapter dimers prior to amplification includes one or more of: 1) specific cleavage of adapter dimers by an enzyme; 2) CRISPR / Cas9-based cleavage of adapter dimers; 3) gel purification; 4) size selection with SPRI beads; and 5) addition of an adapter dimer blocker oligonucleotide to the mixture, which is effective in inhibiting adapter dimer amplification.

[0111] Specific cleavage of adapter dimers by an enzyme refers to the use of a restriction endonuclease to cleave the adapter dimer into two or more fragments, thereby reducing the number of adapter dimers. The nucleotide sequence of the adapter dimer can be analyzed to determine which restriction endonuclease(s) cleaves the adapter dimer, or various restriction endonucleases can be assayed to determine which restriction endonucleases are effective at cleaving the adapter dimer, preventing amplification of the adapter dimer.

[0112] CRISPR / Ceria slurry cleavage refers to the use of the CRISPR / Cas system to cleave adapter dimers into two or more fragments, thereby reducing the number of adapter dimers. According to an embodiment of the present disclosure, the adapter dimers contain CRISPR stem loops, and the Cas protein recognizes the stem loops and binds to the stem loops with high affinity without cleaving the adapter dimers or without cleaving the adapter dimers, thereby preventing adapter dimer amplification.

[0113] Either immobilizing the adapter dimers onto a solid support and removing the solid support with the immobilized adapter dimers from the mixture, or immobilizing the sequencing library molecules onto a solid support and removing the solid support with the immobilized sequencing library molecules results in elution of the sequencing library molecules from the solid support, and reversible solid phase immobilization (SPRI) bead size selection can be used to separate the adapter dimers from the sequencing library molecules in the mixture.

[0114] The term "adapter dimer blocker oligonucleotide" refers to an oligonucleotide that specifically hybridizes to at least a portion of an adapter dimer that contains an amplification primer binding site, thereby preventing the amplification of the adapter dimer. The length of the adapter dimer blocker oligonucleotide ranges from about 10 to about 300 nucleotides in length, depending on factors such as the size of the adapter dimer and the hybridization conditions used. According to aspects of the present disclosure, the length of the adapter dimer blocker oligonucleotide ranges from about 10 to about 300 nucleotides in length, about 10 to about 200 nucleotides in length, about 10 to about 100 nucleotides in length, about 10 to about 75 nucleotides in length, about 10 to about 50 nucleotides in length, about 10 to about 40 nucleotides in length, about 10 to about 30 nucleotides in length, or about 10 to about 20 nucleotides in length. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adapter dimer blocker oligonucleotide are non-naturally occurring nucleotides. According to aspects of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adaptor dimer blocker oligonucleotide are T m According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adaptor dimer blocker oligonucleotide are LNA monomers, PNA monomers, BNA monomers, other TNA monomers, or other TNA monomers. m According to an embodiment of the present disclosure, about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the nucleotides of the adaptor dimer blocker oligonucleotide are LNA monomers.

[0115] An example of an adaptor dimer blocker oligonucleotide is 5'-C+G+AG+AA+T+T+CC+A+GA+T+CG+T+C+G+GA+C+T+G-3' (SEQ ID NO: 2), where + indicates an LNA base (i.e., an incorporated LNA monomer). In a preferred example, 3SpC3 (3'(C3) propyl spacer) is present at the 3' end.

[0116] According to an aspect of the present disclosure, a kit for reducing adapter dimers in a sequencing library is provided, comprising one or more blocker oligonucleotides and / or blocker oligonucleotide pairs for reducing adapter dimers in a sequencing library.

[0117] According to an aspect of the present disclosure, the kit for reducing adapter dimers in a sequencing library further includes one or more adapter dimer blocker oligonucleotides effective to prevent adapter dimer amplification.

[0118] According to an aspect of the present disclosure, a kit for reducing adapter dimers in a sequencing library is provided, comprising an adapter dimer blocker oligonucleotide complementary to one or more adapter dimer flanking portions, one or more flanking portions comprising at least one nucleotide of the 5' adapter at the interface between the 5' adapter and the 3' adapter, and a 3' adapter flanking portion comprising an amplification primer binding site.

[0119] Kits according to aspects of the present disclosure include one or more blocker oligonucleotides and / or one or more adaptor dimer blocker oligonucleotides in aqueous, buffered, or lyophilized form. The one or more blocker oligonucleotides and / or one or more adaptor dimer blocker oligonucleotides may be packaged together or separately. The one or more blocker oligonucleotides and / or one or more adaptor dimer blocker oligonucleotides may be dispensed in amounts appropriate for use in preparing a sequencing library, or may be packaged in bulk for user dispensing. Additional kit components may include, but are not limited to, reagents such as buffers, diluents, stabilizers, preservatives, nucleotides, nucleotide analogs, and enzymes.

[0120] Compositions and methods according to aspects of the present disclosure have utility in a number of applications, including but not limited to, the reduction of adapter dimers sequenced in sequencing protocols, particularly in sequencing libraries containing small inserts.

[0121] Compositions and methods according to aspects of the present disclosure provide increased sensitivity such that rare nucleic acids present in a sample can be detected more frequently. Reliable detection of rare nucleic acids enables diagnostic and therapeutic methods that analyze nucleic acids in patient samples.

[0122] Embodiments of the compositions and methods of the present invention are described in the following examples, which are provided for illustrative purposes and are not intended to limit the scope of the compositions and methods of the present invention. EXAMPLES

[0123] Example 1

[0124] 3' Adapter Ligation a. Mix the following ingredients on ice: i. Input RNA 1μL (1ng / μL) ii. Nuclease-free water 9.5 μL iii. 3' adapter C3 / 5rApp / TGGAATTCTCGGGTGCCAAGG / 3SpC3 / (SEQ ID NO:3) 1 μL (5 μM) iv. 3' ligation buffer 7μL v. 3' Ligation Enzyme Mix 1.5μL vi. Total reaction volume 20 μL b. Incubate as follows: i. 1 hour at 25°C ii. Hold at 4°C

[0125] Inactivation of unligated 3' adapters Add 1 μL (10 μM) of oligonucleotide blocker with a palindromic 3' end to the reaction on ice and mix until homogenous: 5'-CACCCGAGAATTCCAC / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO: 1). Note that in this example, the palindromic 3' end of the oligonucleotide blocker allows the 3' portions of the two oligonucleotide blocker molecules to hybridize to each other and the 5' portion of the blocker oligonucleotide to hybridize to excess 3' adapter under hybridization conditions to form a hybridization complex. b. Incubate as follows: i. 70℃ for 10 minutes ii. Hold at 4°C.

[0126] 5' Adapter Ligation a. Mix the following ingredients on ice: i. 21 μL of reaction mixture from the previous step ii. 5' Adapter 5'-rGrUrUrCrArGrArGrUrCrUrArCrArGrUrCrCrGrArCrGrArUrC-3' (SEQ ID NO:4) 1.5 μL (2.5 μM) - "r" is used here to emphasize that the indicated nucleotide is a ribonucleotide. iii. ATP 1.5μL (10mM) (NEB cat#P0756L) iv. 5' Ligation Enzyme Mix 2μL v. Total reaction volume 26 μL b. Incubate as follows: i. 1 hour at 20℃ ii. Hold at 4°C.

[0127] Reverse transcription a. Start with 26 μL of the 5' ligation reaction from the previous step on the thermal cycler. b. Program the thermal cycler as follows: i. 70℃ for 2 minutes ii. 50℃ for 30 minutes iii. 90℃ for 5 minutes iv. Hold at 4°C. c. Prepare RT master mix as follows: i. RT buffer 13 μL ii. RT primer 5'-CCTTGGCACCGAGAATTCCA-3' (SEQ ID NO:5) 1 μL (25 μM) iii. EnzScript reverse transcriptase (Enzymatics) 2 μL iv. Total volume 16μL d. Place 26 μL of the mixture from a. in the 5' adapter ligation section above into a thermal cycler and start the program. e. After the thermal cycler cools to 50°C, add 16 µL of RT master mix to the thermal cycler and mix. Do not remove the reactions from the thermal cycler. f. Complete the incubation and reduce temperature to 4°C.

[0128] Bead cleanup a. Add 40 μL of adapter dilution solution and mix. b. Add 40 μL of NEXTFLEX clean-up beads and mix. c. Add 90 μL of isopropanol and mix. d. Incubate at room temperature for 5 minutes. e. Place on magnetic stand for 5 minutes or until solution is clear. f. Aspirate and remove the supernatant. g. Add 200 μL of 80% ethanol, incubate for 30 seconds, and aspirate off the supernatant to wash. h. Repeat the above steps for a total of 2 washes. i. Allow to dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate and remove any liquid that has pooled at the bottom of the wells. j. Remove from magnetic stand and resuspend in 40 μL of nuclease-free water. k. Incubate for 2 minutes. l. Place on the magnetic stand. m. Once the beads have formed a pellet, take 18 μL and add to a strip tube. Keep this clean cDNA as a backup. n. Take another 18 μL and transfer to a new well. This cDNA will be amplified in the next step.

[0129] PCR a. Mix the following ingredients on ice: i. 18 μL of cDNA from previous step 5n ii. NEXTFLEX UDI barcode primer mix 2μL iii. NEXTFLEX PCR Master Mix 5μL iv. long dblock02C3 (or water) 5'-C+G+AG+AA+T+T+CC+A+GA+T+CG+T+C+G+GA+C+T+G / 3SpC3 / (SEQ ID NO: 2) 1μL (10μM) v. Total reaction volume 26 μL b. Incubate the reaction as follows: i. 98℃ for 30 seconds ii. 98℃ for 10 seconds iii. 65°C for 20 seconds, repeating this for a total of 22 cycles iv. 72℃ for 15 seconds v. 72℃ for 2 minutes vi. Keep at 4°C.

[0130] Bead cleanup a. Take 25 μL of the PCR reaction from the previous step. b. Add 48.6 μL of NEXTFLEX clean-up beads and mix. c. Incubate at room temperature for 5 minutes d. Place on magnetic stand for 5 minutes or until solution becomes clear. e. Aspirate the supernatant. f. Add 200 μL of 80% ethanol, incubate for 30 seconds, and aspirate off the supernatant to wash. g. Repeat the above steps for a total of 2 washes. h. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate off any liquid that has accumulated at the bottom of the wells. i. Remove from magnetic stand and resuspend in 20 μL of nuclease-free water. j. Incubate for 2 minutes. k. Place on the magnetic stand. l. Once the beads form a pellet, remove 18 µL. This is your sequencing library.

[0131] Sequencing parameters (MiSeq) a. 2% phiX b. 1x76.

[0132] The results are shown in Figure 3.

[0133] Example 2

[0134] 1. 3' Adapter Ligation a. Mix the following ingredients on ice: i. Input RNA “X” μL (total RNA 1ng) ii. tRNA / YRNA blocker 1μL ii. Nuclease-free water "Y" μL iv. 3' adenylated adapter 5'-rApp / TGGAATTCTCGGGTGCCAAGG / 3SpC3 / -3' (SEQ ID NO: 3) 1 μL v. 3' Ligation Buffer 12.5μL vi. 3' Ligation Enzyme Mix 1.5μL vii. Total reaction volume: 20 μL (water and RNA total volume is 4 μL) viii. Vortex the viscous reaction mixture for at least 3 seconds until homogenous. c. Incubate as follows: i. 1 hour at 25°C ii. Hold at 4°C. 2. Inactivation of unligated 3' adapters a. On ice, add 4 μL of adapter inactivation mix containing an oligonucleotide blocker with a palindromic 3' end oligonucleotide blocker: 5'-CACCCGAGAATTCCAC / iisodG / / iMe-isodC / / iisodG / / iMe-isodC / G-3' (SEQ ID NO: 1) to the reaction and mix until homogenous. b. Incubate as follows: i. 70℃ for 2 minutes ii. Hold at 4°C. (The reaction should turn yellow.) 3. 5' Adapter Ligation a. Mix the following ingredients on ice: i. 24 μL of reaction mixture from the previous step ii. 5' adapter 5'-UCUUUCCCUACACGACGCUCUUCCGAUCU-3' (SEQ ID NO: 6) 1 μL iii. 5' ligation buffer 3μL iv. 5' Ligation Enzyme Mix 2μL v. Total reaction volume 30 μL b. Incubate as follows: i. 1 hour at 20℃ ii. Hold at 4°C. (The reaction should turn orange.) 4. Reverse Transcription a. Mix the following ingredients on ice: i. RT buffer 7 μL iii. RT enzyme mix 2 μL iv. RT primer 5'-CCTTGGCACCCGAGAATTCCA-3' (SEQ ID NO:5) 1 μL (25 μM) v. Total reaction volume 40 μL b. Incubate as follows: ii. 50℃ for 60 minutes iii. 90℃ for 5 minutes iv. Hold at 4°C. c. Complete the incubation and cool to 4°C. 5. Bead Cleanup a. Add 40 μL of adapter dilution solution and mix. b. Add 40 μL of NEXTFLEX clean-up beads and mix. c. Add 90 μL of isopropanol and mix. d. Incubate at room temperature for 5 minutes. e. Place on magnetic stand for 5 minutes or until solution is clear. f. Aspirate the supernatant. g. Add 200 μL of 80% ethanol, incubate for 30 seconds, and aspirate off the supernatant to wash. h. Repeat the above steps for a total of 2 washes. i. Dry on the magnetic stand for a total of 3 minutes. After 1 minute, aspirate off any liquid that has pooled at the bottom of the wells. j. Remove from magnetic stand and resuspend in 18 μL of nuclease-free water. k. Incubate for 2 minutes. l. Place on the magnetic stand. m. Take 16 μL and transfer to a new well. This cDNA will be amplified in the next step. 6. PCR a. Mix the following ingredients on ice: i. 16 μL of cDNA from the previous step from the bead cleanup section above ii. RNAUDI barcode primer 4μL (12.5μM) iii. NEXTFLEX Small RNA PCR Master Mix 6μL iv. Total reaction volume 26 μL Incubate the reactions as follows: i. 98℃ for 30 seconds ii. 98℃ for 10 seconds iii. 65℃ for 20 seconds iv. 72℃ for 15 seconds Repeat steps ii, iii, and iv for a total of 22 cycles. v. 72℃ for 2 minutes vi. Keep at 4°C. 7. Clean-up of double-sided beads a. Take 26 µL of the PCR reaction from the previous step. b. Add 34 μL of NEXTFLEX clean-up beads and mix. c. Incubate at room temperature for 5 minutes. d. Transfer 56 μL of supernatant to a new well. e. Add 13 μL of NEXTFLEX clean-up beads and mix. d. Place on magnetic stand for 5 minutes or until solution is clear. e. Aspirate the supernatant. f. Add 200 μL of 80% ethanol, incubate for 30 seconds, and aspirate off the supernatant to wash. g. Repeat the above steps for a total of 2 washes. h. Dry on the magnetic stand for a total of 3 minutes. Aspirate off any liquid that has accumulated at the bottom of the wells after 1 minute. i. Remove from magnetic stand and resuspend in 17 μL of nuclease-free water. j. Incubate for 2 minutes. k. Place on the magnetic stand. l. Once the beads form a pellet, remove 15 μL. This is your sequencing library. 8. Sequencing parameters (MiSeq) a. 2% phiX b. 1x75. The results are shown in Figure 4.

[0135] item

[0136] Item 1. A method for reducing adapter dimers in a sequencing library, comprising: combining in a mixture under ligation reaction conditions a population of sample nucleic acids having respective 5' ends and respective 3' ends, respective 5' end portions at least 8 nucleotides in length, a 3' adaptor having a 5' end that is an adenylated nucleotide, and a ligase to produce 1) a first population of ligation products each comprising a 3' end of the sample nucleic acid ligated to the 5' end of the 3' adaptor, and 2) an excess of unligated 3' adaptors in the mixture; adding a blocker oligonucleotide to the mixture, the blocker oligonucleotide comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion at least 1-20 nucleotides in length and including a first oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-natural nucleotide analog; b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion at least 1-20 nucleotides in length and comprising a second blocker oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-natural nucleotide analog; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to a 5' terminal portion of the 3' adaptor; incubating the mixture under hybridization conditions, whereby the first blocker oligonucleotide 3' portion hybridizes to the second blocker oligonucleotide 3' portion and the first blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor, whereby the second blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor to generate a hybridized complex in which the first blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adaptor and the second blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adaptor; thereby reducing the excess unligated 3' adaptors in the mixture and generating a purified mixture.

[0137] Item 2. The method of item 1, wherein the first blocker oligonucleotide 3' end and the second blocker oligonucleotide 3' end are both capable of ligating to an adenylated nucleotide at the 5' end of an excess of an unligated 3' adaptor; and further comprising ligating the first blocker oligonucleotide 3' end of the hybridized complex to the adjacent adenylated nucleotide located at the 5' end of the first unligated 3' adaptor and ligating the second blocker oligonucleotide 3' end of the hybridized complex to the adjacent adenylated nucleotide located at the 5' end of the second unligated 3' adaptor to form a ligation complex, thereby reducing the excess of unligated 3' adaptors in the mixture and producing a purified mixture.

[0138] Item 3. The method of item 1 or 2, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the first blocker oligonucleotide 3' portion are non-natural nucleotide analogs and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the second blocker oligonucleotide 3' portion are non-natural nucleotide analogs.

[0139] Item 4. The method of any of items 1, 2, or 3, wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, and the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion, when the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0140] Item 5. The method according to any one of items 1 to 4, further comprising: adding a 5' adaptor to the mixture, the 5' adaptor having a 3' end, wherein each of the first ligation products comprises a 3' end of the sample nucleic acid bound to the 5' end of the 3' adaptor and a 5' end of the sample nucleic acid bound to the 3' end of the 5' adaptor, thereby generating sequencing library molecules, the sequencing library molecules comprising the sample nucleic acid inserts disposed between and bound to the 5' adaptor and the 3' adaptor.

[0141] Item 6. The method according to any one of items 1 to 5, further comprising: adding a 5' adaptor to the purification mixture; and incubating the purification mixture under binding reaction conditions, thereby 1) ligating the 5' adaptor to the first ligation product to generate sequencing library molecules, the sequencing library molecules comprising the sample nucleic acid insert disposed between and bound to the 5' adaptor and the 3' adaptor.

[0142] Item 7. The method of any one of items 1 to 6, comprising reducing but not removing excess 3' adapters such that 5' adapters are ligated to at least a portion of the excess unligated 3' adapters to generate adapter dimers comprising 5' adapters joined to the 3' adapters at an interface between the 5' adapters and the 3' adapters; and further comprising preventing amplification of the adapter dimers in an amplification reaction such that sequencing library molecules are selectively enriched relative to the adapter dimers by the amplification reaction.

[0143] Item 8. The method of any one of items 1 to 7, wherein inhibiting adaptor dimer amplification comprises removing at least a portion of the adaptor dimers prior to amplification.

[0144] Item 9. The method according to item 7 or item 8, wherein inhibiting adapter dimer amplification comprises one or more of the following: specific cleavage of adapter dimers by an enzyme; CRISPR / Cas9-based cleavage of adapter dimers; gel purification; SPRI bead-based size selection; and addition of an adapter dimer blocker oligonucleotide to the mixture, the adapter dimer blocker oligonucleotide being effective in inhibiting adapter dimer amplification.

[0145] Item 10. The method of item 9, wherein the adapter dimer blocker oligonucleotide is complementary to one or more adapter dimer flanking portions, the one or more flanking portions comprising at least one 5' adapter nucleotide at the interface between the 5' adapter and the 3' adapter, and the 3' adapter flanking portion comprises an amplification primer binding site.

[0146] Item 11. The method according to any one of Items 1 to 10, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0147] Item 12. The method of item 1, wherein the sample nucleic acid is or comprises RNA, and further comprises reverse transcribing the RNA to produce reverse transcribed sequencing library molecules.

[0148] Item 13. The method according to Item 1, wherein the sample nucleic acid is or comprises DNA.

[0149] Item 14. The method according to item 12 or 13, further comprising amplifying the sequencing library molecules.

[0150] Item 15. An oligonucleotide pair for reducing adapter dimers in a sequencing library, comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion at least 1-20 nucleotides in length and comprising a first oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-natural nucleotide analog; and b) a second blocker oligonucleotide comprising: iii) a second oligonucleotide 5' portion that is at least 8 nucleotides in length, and iv) a second blocker oligonucleotide 3' portion that is at least 1-20 nucleotides in length and that includes a second blocker oligonucleotide 3' end, where at least one of the 1-20 nucleotides is a non-natural nucleotide analog; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; The first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' terminal portion of the 3' adaptor.

[0151] Item 16. An oligonucleotide pair for reducing adapter dimers in a sequencing library according to Item 15, wherein the first blocker oligonucleotide 3' end and the second blocker oligonucleotide 3' end are both capable of binding to adenylated nucleotides at the 5' ends of excess unligated 3' adapters.

[0152] Item 17. The oligonucleotide pair for reducing adapter dimers in a sequencing library according to item 15 or 16, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the first blocker oligonucleotide 3' portion are non-natural nucleotide analogs, and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least 1 to 20 nucleotides of the second blocker oligonucleotide 3' portion are non-natural nucleotide analogs.

[0153] Item 18. The oligonucleotide pair for reducing adapter dimers in a sequencing library according to any one of Items 15, 16, or 17, wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, and the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion, when the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are each 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0154] Item 19. An oligonucleotide pair for reducing adapter dimers in a sequencing library according to any one of items 15 to 18, wherein each of the first blocker oligonucleotide and the second blocker oligonucleotide has a length ranging from about 11 to about 50 nucleotides.

[0155] Item 20. An oligonucleotide pair for reducing adapter dimers in a sequencing library according to any one of Items 15 to 19, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

[0156] Item 21. A kit for reducing adapter dimers in a sequencing library, comprising the oligonucleotide pair according to any one of Items 15 to 20.

[0157] Item 22. The kit of item 21, further comprising an adaptor dimer blocker oligonucleotide effective to inhibit adaptor dimer amplification.

[0158] Item 23. The kit of Item 22, wherein the adapter dimer blocker oligonucleotide is complementary to one or more flanking portions of the adapter dimer, the one or more flanking portions comprising at least one nucleotide of the 5' adapter located at the interface between the 5' adapter and the 3' adapter, and the flanking portion of the 3' adapter comprises an amplification primer binding site.

[0159] Item 24. The method according to any one of Items 1 to 14, or the kit according to any one of Items 21 to 23, wherein the first blocker and the second blocker have the same nucleic acid sequence.

[0160] Item 25. The method according to any one of items 1 to 14, or the kit according to any one of items 21 to 24, wherein the first blocker and the second blocker have different nucleic acid sequences.

[0161] Item 26. A method, kit, or oligonucleotide pair substantially as hereinbefore described.

[0162] Item 27. The method of any one of items 1 to 14, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length ranging from about 11 to about 50 nucleotides.

[0163] Any patents or publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference.

[0164] The compositions and methods described herein represent presently preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Modifications and other uses will occur to those skilled in the art. Such modifications and other uses can be made without departing from the scope of the invention, which is set forth in the claims. [Explanation of symbols]

[0165] [Figures 2A, 2B, and 2C] Single adapter System: Single adapter system annealing: annealing Multiple adapter system: Multiple adapter system non-palindromic: non-palindromic [Figure 3] 1 ng MCF7 total RNA input: 1 ng of MCF7 total RNA input % of reads: Percentage of reads Other: Other canonical dimer: standard dimer [Figure 4] 1 ng Human Brain Input: 1 ng human brain input Percent Representation: Percentage of representation % dimer: Dimer percentage % mature miRNA: Mature miRNA percentage [Figure 5] 1 ng Human Brain Input: 1 ng human brain input # of Unique microRNA's: Number of unique microRNA's Threshold: Threshold [Figure 6] Threshold of 5: 351: The threshold of 5 is 351 of 407 = 86.2% miRNA's in common between replicates Threshold of 5: 296: The threshold of 5 is 296 of 370 = 80% miRNAs in common between 1 and 2 / 256: 256 miRNAs in common between 1 and 2

Claims

1. 1. A method for reducing adaptor dimers in a sequencing library, the method comprising: combining in a mixture under ligation reaction conditions a population of sample nucleic acids, each having a 5' end and a 3' end, a population of 3' adaptors, each having a 5' end portion at least 8 nucleotides in length and a 5' end that is an adenylated nucleotide, and a ligase to produce 1) a first population of ligation products, each comprising a 3' end of the sample nucleic acid ligated to a 5' end of a 3' adaptor, and 2) an excess of unligated 3' adaptors in the mixture; adding to said mixture a group of blocker oligonucleotides comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion at least 8 nucleotides in length, and ii) a first blocker oligonucleotide 3' portion having a length of at least 1-20 nucleotides and comprising a first oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide analog; and b) a second blocker oligonucleotide comprising: iii) a 5' portion of a second blocker oligonucleotide at least 8 nucleotides in length; iv) a second blocker oligonucleotide 3' portion having a length of at least 1-20 nucleotides and comprising a second blocker oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide analog; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; wherein the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to a 5' terminal portion of the 3' adaptor; incubating the mixture under hybridization conditions, whereby the first blocker oligonucleotide 3' portion hybridizes to the second blocker oligonucleotide 3' portion, the first blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor group, and the second blocker oligonucleotide 5' portion hybridizes to the excess unligated 3' adaptor group, thereby forming a hybridized complex in which the first blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the first unligated 3' adaptor and the second blocker oligonucleotide 3' end is adjacent to the adenylated 5' terminal nucleotide of the second unligated 3' adaptor, thereby reducing the excess unligated 3' adaptor groups in the mixture to form a purified mixture.

2. 2. The method of claim 1, the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of ligating to the adenylated nucleotides at the 5' ends of the excess unligated 3' adaptors; Additionally, the method includes: ligating the 3' end of a first blocker oligonucleotide of the hybridized complex to the adjacent adenylated nucleotide at the 5' end of a first unligated 3' adaptor, and ligating the 3' end of a second blocker oligonucleotide of the hybridized complex to the adjacent adenylated nucleotide at the 5' end of a second unligated 3' adaptor to generate a ligation complex, thereby reducing excess unligated 3' adaptors in the mixture to generate a purified mixture.

3. 3. The method of claim 1 or 2, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1 to 20 nucleotides of the first blocker oligonucleotide 3' portion are non-naturally occurring nucleotide analogues and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1 to 20 nucleotides of the second blocker oligonucleotide 3' portion are non-naturally occurring nucleotide analogues.

4. 4. The method of claim 1, wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, and wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion, when the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion have a length of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, respectively.

5. 5. The method of any one of claims 1 to 4, further comprising: adding a 5' adaptor having a 3' end to said mixture; Here, the first ligation products each comprise the 3' end of the sample nucleic acid ligated to the 5' end of the 3' adaptor and the 5' end of the sample nucleic acid ligated to the 3' end of the 5' adaptor, thereby generating sequencing library molecules comprising sample nucleic acid inserts positioned between and bound to the 5' adaptor and the 3' adaptor.

6. 6. The method of any one of claims 1 to 5, further comprising: adding a 5' adaptor to the purification mixture; and incubating said purified mixture under ligation reaction conditions; Thereby, 1) a 5' adaptor is ligated to the first ligation product to generate sequencing library molecules that include the sample nucleic acid insert located between and bound to the 5' adaptor and the 3' adaptor.

7. 7. A method according to any one of claims 1 to 6, comprising: the excess unligated 3' adaptors are reduced but not removed, and the ligation comprises ligating a 5' adaptor to at least a portion of the excess unligated 3' adaptors to generate a population of adaptor dimers comprising the 5' adaptor bound to the 3' adaptor at an interface between the 5' adaptor and the 3' adaptor; Additionally, the method includes: Inhibiting the amplification of the adaptor dimer population in an amplification reaction such that sequencing library molecules are selectively enriched relative to the adaptor dimer population.

8. The method of any one of claims 1 to 7, wherein inhibiting amplification of the population of adaptor dimers comprises removing at least a portion of the population of adaptor dimers prior to amplification.

9. 9. The method according to claim 7 or 8, The method of inhibiting the amplification of the adaptor dimer population comprises one or more of the following: Specific cleavage of adapter dimers by enzymes; CRISPR / Cas9-based adapter dimer cleavage; Gel purification; Size selection based on SPRI bead technology; and Adding to the mixture an adaptor dimer blocker oligonucleotide effective to inhibit amplification of adaptor dimers.

10. 10. The method of claim 9, wherein the adapter dimer blocker oligonucleotide is complementary to one or more flanking portions of the adapter dimer, the one or more flanking portions comprising at least one nucleotide of the 5' adapter at the interface between the 5' and 3' adapter, and the flanking portion of the 3' adapter comprises an amplification primer binding site.

11. 11. The method of claim 1, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

12. 2. The method of claim 1, the sample nucleic acid is or comprises RNA, Additionally, the method includes: Reverse transcribing the RNA and generating reverse transcribed sequencing library molecules.

13. The method of claim 1 , wherein the sample nucleic acid is or comprises DNA.

14. The method of claim 12 or 13, further comprising amplifying the sequence library molecules.

15. 1. An oligonucleotide pair for reducing adapter dimer population in a sequencing library, comprising: a) a first blocker oligonucleotide comprising: i) a first blocker oligonucleotide 5' portion having a length of at least 8 nucleotides; and ii) a first blocker oligonucleotide 3' portion having a length of at least 1-20 nucleotides and comprising a first oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide analog; and b) a second blocker oligonucleotide comprising: iii) a second blocker oligonucleotide 5' portion having a length of at least 8 nucleotides; and iv) a second blocker oligonucleotide 3' portion having a length of at least 1-20 nucleotides and comprising a second blocker oligonucleotide 3' end, wherein at least one of the 1-20 nucleotides is a non-naturally occurring nucleotide analog; wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion are equal in length and complementary to each other; Here, the first blocker oligonucleotide 5' portion and the second blocker oligonucleotide 5' portion are both complementary to the 5' end portion of the 3' adaptor.

16. 16. The oligonucleotide pair for reducing an adapter dimer population in a sequencing library according to claim 15, wherein the 3' end of the first blocker oligonucleotide and the 3' end of the second blocker oligonucleotide are both capable of ligating to adenylated nucleotides at the 5' ends of excess unligated 3' adapters.

17. 17. The oligonucleotide pair for reducing the adapter dimer population in a sequencing library of claim 15 or 16, wherein 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1 to 20 nucleotides of the first blocker oligonucleotide 3' portion are non-naturally occurring nucleotide analogues and 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of at least the 1 to 20 nucleotides of the second blocker oligonucleotide 3' portion are non-naturally occurring nucleotide analogues.

18. 18. The oligonucleotide pair for reducing an adapter dimer population in a sequencing library of claim 15, 16, or 17, wherein the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion each comprise a palindromic nucleotide sequence, and wherein the palindromic nucleotide sequence of the first blocker oligonucleotide 3' portion is identical to the palindromic nucleotide sequence of the second blocker oligonucleotide 3' portion when the first blocker oligonucleotide 3' portion and the second blocker oligonucleotide 3' portion have a length of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, respectively.

19. 19. The oligonucleotide pair for reducing an adapter dimer population in a sequencing library according to any one of claims 15 to 18, wherein the first blocker oligonucleotide and the second blocker oligonucleotide each have a length ranging from about 11 to about 50 nucleotides.

20. 20. The oligonucleotide pair for reducing an adaptor dimer population in a sequencing library according to any one of claims 15 to 19, wherein the first blocker oligonucleotide and the second blocker oligonucleotide have the same nucleotide sequence.

21. A kit for reducing adapter dimer populations in a sequencing library, comprising an oligonucleotide pair according to any one of claims 15 to 20.

22. 22. The kit of claim 21, further comprising an adaptor dimer blocker oligonucleotide effective to inhibit amplification of a population of adaptor dimers.

23. 23. The kit of claim 22, wherein the adapter dimer blocker oligonucleotide is complementary to one or more flanking portions of the adapter dimer, the one or more flanking portions comprising at least one nucleotide of the 5' adapter at the interface between the 5' and 3' adapter, and the flanking portion of the 3' adapter comprises an amplification primer binding site.

24. 24. The method of any one of claims 1 to 14 or the kit of any one of claims 21 to 23, wherein the first blocker and the second blocker have the same nucleic acid sequence.

25. 25. The method of any one of claims 1 to 14 or the kit of any one of claims 21 to 24, wherein the first blocker and the second blocker have different nucleic acid sequences.

26. 20. A method, kit or oligonucleotide pair substantially as hereinbefore depicted or described.

Images