Oligonucleotide Composition and Method Thereof
Oligonucleotides targeting calpain 2 transcripts with specific modifications offer an effective solution to reduce calpain 2 levels, addressing the limitations of current treatments for calpain 2-associated conditions.
Patent Information
- Application Number
- JP2024566322
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-12
- Filing Date
- 2023-05-09
- Publication Date
- 2025-06-17
AI Technical Summary
Current treatments for conditions associated with calpain 2 lack effectiveness in reducing calpain 2 transcripts and polypeptides, necessitating the development of novel oligonucleotide-based therapies.
The use of oligonucleotides that can hybridize to calpain 2 transcripts, incorporating modifications such as nucleobase, sugar, and internucleotide linkage modifications, to specifically reduce calpain 2 transcript levels and polypeptide production.
These oligonucleotides effectively reduce calpain 2 transcript and protein levels, providing a therapeutic approach for preventing and treating conditions associated with calpain 2.
Smart Images

Figure 2025518487000001_ABST
Abstract
Description
Technical Field
[0001] Cross - reference to related applications This application claims priority to U.S. Provisional Application Nos. 63 / 340,365 (filed May 10, 2022) and 63 / 397,707 (filed Aug. 12, 2022), the entireties of which are incorporated herein by reference.
Background Art
[0002] Oligonucleotides are useful for various applications such as treatment, diagnosis, and / or research. For example, oligonucleotides that target genes may be useful for treating conditions, disorders, or diseases associated with the target gene.
Summary of the Invention
[0003] In particular, this disclosure provides techniques (e.g., oligonucleotides, compositions, methods, etc.) for treating various conditions, disorders, or diseases associated with calpain 2. In some aspects, this disclosure provides oligonucleotides that can hybridize to calpain 2 transcripts and include various modifications such as, for example, modifications of nucleobases, sugars, and internucleotide linkages. In some aspects, this disclosure provides oligonucleotides and their compositions that can reduce the level of calpain 2 transcripts when administered or delivered to a system that contains or expresses calpain 2 transcripts. In some aspects, the techniques provided result in a reduction in the level of calpain 2 transcripts and / or polypeptides in a system. In some aspects, this disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases associated with calpain 2.
[0004] In some embodiments, this disclosure encompasses the recognition that oligonucleotides of a particular nucleotide sequence may be effective by reducing the levels of calpain 2 transcript (e.g., calpain 2 mRNA) and / or its product (e.g., calpain 2 polypeptide). In some embodiments, the nucleotide sequence of the oligonucleotide contains about 5 or more (e.g., about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) consecutive nucleic acid bases of ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT, or GGAAGCTTAGTCCTTGGCTG, where T is independently replaced by U as needed. In some embodiments, the nucleotide sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC, GGCATACTGGTTCAGTTGAT, GCTCAGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCTCTAGT, GTTCCAGCTTGGGCAGTTGT, or GGAAGCTTAGTCCTTGGCTG.
[0005] In some embodiments, the provided oligonucleotides include various modifications such as, for example, modifications of nucleic acid bases, sugars, internucleotide linkages, etc. Various useful modifications are available in the art and may be utilized in this disclosure. In some embodiments, the modifications provide various advantages such as, for example, improved stability, binding affinity, pharmacokinetic profile, pharmacodynamic profile.
[0006] For example, in some embodiments, the provided oligonucleotides include various sugar modifications. In some embodiments, the modified sugar is a sugar of natural RNA having a 2’-OR s modification, where R s may be a substituted C 1-6 aliphatic, and -OR s replaces the 2’-OH group (the “2’-OR s"modified sugar"). In some embodiments, R s is optionally substituted C 1-6 alkyl. In some embodiments, R s is -CH3. In some embodiments, R s is -CH2CH2OCH3
[0007] In some embodiments, the provided oligonucleotide comprises or consists of a wing-core-wing structure, the number of nucleosides in each wing is independently about 1 to 10 (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10), the number of nucleosides in the core is about 5 or more (e.g., about 5 to 20, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, etc.), and each wing independently contains one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) modified sugars. In some embodiments, the sugars in the wings are each independently a modified sugar. In some embodiments, the sugars in the wings are each independently 2'-OR s modified sugar. In some embodiments, the modified sugar is a 2'-MOE modified sugar (R s is -CH2CH2OCH3, a 2'-OR s modified sugar). In some embodiments, each wing independently contains one or more (e.g., about 1, 2, 3, 4, 5, or more) 2'-MOE modified sugars. In some embodiments, the sugars in the wings are each independently 2'-MOE modified sugars. In some embodiments, the core region has fewer modified sugars and / or a lower level of modified sugars compared to the wings on one or both sides. In some embodiments, there are no modified sugars in the core region. In some embodiments, the sugars in the core are each independently the sugar of natural DNA.
[0008] Furthermore, or alternatively, in some embodiments, the provided oligonucleotides contain modified internucleotide linkages. In some embodiments, modification of the internucleotide linkages results in improved properties and / or activities as compared to natural phosphate linkages. There are various internucleotide linkages in the art that can be utilized in this disclosure. In some embodiments, the modified internucleotide linkage is a phosphorothioate internucleotide linkage (-O-P(O)(SH)-O-, which may exist as various salts). In some embodiments, the linkages in the provided oligonucleotides are phosphorothioate internucleotide linkages.
[0009] In some embodiments, this disclosure provides techniques for manufacturing oligonucleotides and their compositions. In some embodiments, the provided oligonucleotides and their compositions are of high purity. In some embodiments, the oligonucleotides are provided as a mixture of diastereomers with respect to chiral linked phosphorus, for example, in phosphorothioate internucleotide linkages. In some embodiments, one or more diastereomers with respect to chiral linked phosphorus are enriched in the provided composition.
[0010] As described herein, the oligonucleotides and compositions of this disclosure can be provided / utilized in various forms. In some embodiments, this disclosure provides one or more forms of oligonucleotides, for example, in acid form (e.g., natural phosphate linkages exist as -OP(O)(OH)-O- and phosphorothioate internucleotide linkages exist as -OP(O)(SH)-O-), in salt form (e.g., one or more or all natural phosphate linkages independently exist in salt form (e.g., sodium salt (-OP(O)(O-Na + )-O-)) and one or more or all phosphorothioate internucleotide linkages exist in salt form (e.g., sodium salt (-OP(O)(S-Na +)-O-)), hydrates, etc., and provides a composition containing the same. As will be understood by those skilled in the art, oligonucleotides can exist in various salt forms including pharmaceutically acceptable salts, and in solutions (e.g., various aqueous buffer systems), cations and anions may dissociate. In some embodiments, this disclosure provides a pharmaceutical composition containing the provided oligonucleotide and / or one or more of its pharmaceutically acceptable salts, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is a buffer or contains a buffer. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid (aCSF). In some embodiments, the pharmaceutically acceptable carrier is cerebrospinal fluid.
[0011] In some embodiments, this disclosure describes useful techniques for evaluating oligonucleotides and their compositions. Specific useful techniques are described in the examples.
[0012] The provided techniques can be utilized for various purposes. For example, in some embodiments, the provided techniques are useful for the prevention and / or treatment of various conditions, disorders, or diseases related to calpain 2. In some embodiments, this disclosure provides a method of preventing a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the provided oligonucleotide or composition to a susceptible subject. In some embodiments, this disclosure provides a method of treating a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the provided oligonucleotide to a subject suffering therefrom. In some embodiments, the oligonucleotide is administered or delivered as a pharmaceutical composition. In some embodiments, the oligonucleotide is administered or delivered in one or more forms, for example, in some embodiments, as one or more pharmaceutically acceptable salts. In some embodiments, the oligonucleotide is administered or delivered as a solution, for example, an aCSF solution. In this technical field, various techniques are available and may be utilized for the administration or delivery of the provided oligonucleotide and its compositions. For example, in some embodiments, the oligonucleotide and its compositions are administered or delivered intrathecally.
[0013] In some embodiments, the condition, disorder or disease is a neurodegenerative condition, disorder or disease. In some embodiments, the condition, disorder or disease is Wallerian degeneration or includes Wallerian degeneration. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder or disease is a neuropathy. In some embodiments, the condition, disorder or disease is a peripheral neuropathy. In some embodiments, the condition, disorder or disease is a chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder or disease is Parkinson's disease. In some embodiments, the condition, disorder or disease is Huntington's disease. In some embodiments, the condition, disorder or disease is Alzheimer's disease. In some embodiments, the condition, disorder or disease is frontotemporal dementia. In some embodiments, the condition, disorder or disease is a brain injury. In some embodiments, the condition, disorder or disease is a traumatic brain injury. In some embodiments, in some embodiments, the condition, disorder or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder or disease is corticobasal degeneration. In some embodiments, the condition, disorder or disease is Wolfram syndrome. In some embodiments, the condition, disorder or disease is Friedreich's ataxia. In some embodiments, the condition, disorder or disease is multiple system atrophy. In some embodiments, the condition, disorder or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder or disease is Pick's disease. In some embodiments, the condition, disorder or disease is progressive muscular atrophy. BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Mode for Carrying Out the Invention
[0015] Detailed Description of Specific Embodiments The technology of this disclosure can be more easily understood by referring to the following detailed description of specific embodiments.
[0016] Definitions In this specification, unless otherwise specified, the following definitions apply. For the purposes of this disclosure, chemical elements are identified according to the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Further, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999 and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.
[0017] Unless otherwise apparent from the context, in this disclosure: (i) the term "a" or "an" is understood to mean "at least one"; (ii) the term "or" is understood to mean "and / or"; (iii) the terms "comprising," "including," and "having" (whether used with or without the phrase "not limited thereto") are understood to include the recited element or step, whether presented by itself or in combination with one or more other elements or steps; (iv) the term "another" is understood to mean at least additional / second or more; (v) the terms "about" and "approximately" are understood to allow for standard variation as would be understood by one of ordinary skill in the art; and (vi) when ranges are indicated, the endpoints are included.
[0018] Unless otherwise specified, oligonucleotides and their elements (e.g., base sequences, sugar modifications, internucleotide linkages, stereochemistry of the linking phosphorus, patterns thereof, etc.) are described in the 5' to 3' direction. As would be understood by one of ordinary skill in the art, in some embodiments, oligonucleotides may be provided and / or utilized in various forms, such as salts, particularly pharmaceutically acceptable salts (e.g., sodium salts). As would also be understood by one of ordinary skill in the art, in some embodiments, individual oligonucleotides within a composition may be considered to have the same composition and / or structure even if, within the composition (e.g., a liquid composition), at a particular point in time, a particular oligonucleotide exists in different forms (e.g., salts) (which may be dissolved and the oligonucleotide chain may exist as an anion, for example, in a liquid composition). For example, at a given pH, one of ordinary skill in the art understands that the linkages between individual nucleotides of an oligonucleotide chain may be in the acid form (H) or one of a plurality of possible salt forms (e.g., sodium salt or salts of different cations depending on the ions that may be present in a preparation or composition), and that such individual oligonucleotides are appropriately considered to have the same composition and / or structure as long as their acid forms (e.g., replacing all present cations with H + and substituting) have the same composition and / or structure.
[0019] Aliphatic: As used herein, "aliphatic" means a straight-chain (i.e., unbranched) or branched-chain, substituted or unsubstituted hydrocarbon chain that is fully saturated or contains one or more unsaturated units (but is not aromatic), a substituted or unsubstituted, monocyclic, bicyclic or polycyclic hydrocarbon ring that is fully saturated or contains one or more unsaturated units (but is not aromatic), or a combination thereof. In some embodiments, the aliphatic group contains 1 to 50 aliphatic carbon atoms. In some embodiments, the aliphatic group contains 1 to 20 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 10 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 9 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 8 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 7 aliphatic carbon atoms. In other embodiments, the aliphatic group contains 1 to 6 aliphatic carbon atoms. In still other embodiments, the aliphatic group contains 1 to 5 aliphatic carbon atoms, and in still other embodiments, the aliphatic group contains 1, 2, 3 or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, straight-chain or branched-chain, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and their hybrid groups (e.g., (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl).
[0020] Alkyl: As used herein, the term "alkyl" has its ordinary meaning in the art and may include saturated aliphatic groups including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl-substituted cycloalkyl groups and cycloalkyl-substituted alkyl groups. In some embodiments, the alkyl has 1 to 100 carbon atoms. In certain embodiments, the straight-chain or branched-chain alkyl has about 1 to 20 carbon atoms in its backbone (C1 to C for straight-chain and C2 to C for branched-chain). 20 , and C2 to C for branched-chain 20) or has from about 1 to 10 carbon atoms. In some embodiments, when the cycloalkyl ring is monocyclic, bicyclic or polycyclic, the ring structure has from about 3 to 10 carbon atoms, or the ring structure has about 5, 6 or 7 carbon atoms. In some embodiments, the alkyl group may be a lower alkyl group, where the lower alkyl group contains 1 to 4 carbon atoms (e.g., C1 - C4 for straight-chain lower alkyl).
[0021] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage. In some embodiments, "animal" refers to non-human animals at any stage. In certain embodiments, the non-human animal is a mammal (e.g., rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cows, primates and / or pigs). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and / or worms. In some embodiments, the animal may be a genetically modified animal, a genetically engineered animal and / or a clone.
[0022] Characteristic moiety: As used herein, the term "characteristic moiety" refers, in the broadest sense, to a portion of a substance whose presence (or absence) correlates with the presence (or absence) of a particular characteristic, attribute or activity of the substance. In some embodiments, the characteristic moiety of a substance is a portion that is found in substances and related substances that share a particular characteristic, attribute or activity, but is not found in substances that do not share that particular characteristic, attribute or activity. In certain embodiments, the characteristic moiety shares at least one functional characteristic with the complete substance. For example, in some embodiments, the "characteristic moiety" of a nucleic acid is a portion that contains a number of nucleobases that are characteristic of the nucleic acid, and in some embodiments, their consecutive sequences.
[0023] Comparable: As used in this specification, the term "comparable" is used to describe two (or more) sets of conditions or situations that are sufficiently similar to each other to enable a comparison of the resulting outcomes or observed phenomena. In some embodiments, a set of comparable conditions or situations is characterized by a plurality of substantially identical features and one or a small number of different features. One of ordinary skill in the art will understand that sets of conditions are comparable to each other when the differences in the results or observed phenomena obtained with different sets of conditions or situations are characterized by a sufficient number and variety of substantially identical features to warrant a reasonable conclusion that the variations are caused by, or indicative of, changes in those varying features.
[0024] Heteroatom: As used in this specification, the term "heteroatom" means an atom other than carbon or hydrogen. In some embodiments, the heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quaternized forms, forms such as iminium groups, etc.), phosphorus, sulfur, oxygen, etc.). In some embodiments, the heteroatom is silicon, phosphorus, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is silicon, oxygen, sulfur, or nitrogen. In some embodiments, the heteroatom is oxygen, sulfur, or nitrogen.
[0025] Identity: As used herein, the term "identity" refers to the overall relatedness between polymer molecules, such as between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymer molecules are considered to be "substantially identical" to each other if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identical. The percentage of identity between two nucleic acid sequences or polypeptide sequences can be calculated, for example, by aligning the two sequences for optimal comparison (e.g., for optimal alignment, gaps can be introduced into one or both of the first and second sequences, and sequences that are not identical in the comparison can be ignored). In certain embodiments, the length of the sequences aligned for comparison is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. Next, the nucleotides at corresponding positions are compared. If the position in the first sequence and the corresponding position in the second sequence are the same residue (e.g., nucleotide or amino acid), the molecules are identical at that position. The percentage of identity between two sequences is a function of the number of identical positions shared between the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of two sequences and determination of the percentage of identity can be performed using a mathematical algorithm. For example, the percentage of identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller incorporated into the ALIGN program (version 2.0) (CABIOS, 1989, 4: 11-17). In some representative embodiments, comparison of nucleic acid sequences by the ALIGN program uses the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage of identity between two nucleotide sequences can be determined using the GAP program of the GCG software package using the NWSgapdna.CMP matrix.
[0026] Inter-nucleotide linkage In this specification, the term "inter-nucleotide linkage" generally refers to the linkage that connects nucleoside units of oligonucleotides or nucleic acids. In some embodiments, the inter-nucleotide linkage is a phosphodiester linkage widely found in natural DNA and RNA molecules (a natural phosphate linkage (-OP(=O)(OH)O-), which can exist in the form of a salt as understood by those skilled in the art). In some embodiments, the inter-nucleotide linkage is a modified inter-nucleotide linkage (rather than a natural phosphate linkage). In some embodiments, the inter-nucleotide linkage is a "modified inter-nucleotide linkage" in which at least one oxygen atom or -OH of the phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is =S, =Se, =NR’, -SR’, -SeR’ 3、 -S-, -Se-, and -N(R’)-, where each R’ is independently -H, or an optionally substituted C 1~10 aliphatic, C 6~14 aryl, C having 1 to 5 heteroatoms 1~10 heteroaliphatic, a group selected from 5- to 10-membered heteroaryl having 1 to 5 heteroatoms and 3- to 10-membered heterocyclyl having 1 to 4 heteroatoms, or two or more R’ groups together with their intervening atoms form an optionally substituted 3- to 10-membered ring having 0 to 5 heteroatoms in addition to the intervening atoms. In some embodiments, the modified inter-nucleotide linkage is a phosphorothioate linkage. In some embodiments, the inter-nucleotide linkage is, for example, either a PNA (peptide nucleic acid) linkage or a PMO (phosphorodiamidate morpholino oligomer) linkage. Those skilled in the art will understand that the inter-nucleotide linkage may exist as an anion or a cation at a given pH due to the presence of an acid or a base during the linkage.
[0027] in vitro: In this specification, the term "in vitro" refers to events that occur not inside a living organism (e.g., an animal, a plant, and / or a microorganism), but in an artificial environment, such as in a test tube, a reaction vessel, during cell culture, etc.
[0028] In vivo: As used herein, the term "in vivo" refers to an event that occurs inside a living organism (e.g., an animal, a plant, and / or a microorganism).
[0029] Linked phosphorus: The term "linked phosphorus" as defined herein is used to indicate that the particular phosphorus atom is the phosphorus atom present in the internucleotide linkage, which corresponds to the phosphorus atom of the phosphodiester internucleotide linkage in natural DNA and RNA. In some embodiments, the linked phosphorus atom is in a modified internucleotide linkage, where each oxygen atom of the phosphodiester bond is independently substituted, if desired, with an organic or inorganic moiety. In some embodiments, the linked phosphorus atom is chiral (e.g., similar to phosphorothioate internucleotide linkages). In some embodiments, the linked phosphorus atom is achiral (e.g., similar to natural phosphate linkages).
[0030] Modified nucleobase: Terms such as "modified nucleobase," "modified base," etc. refer to a chemical moiety that is chemically different from a nucleobase but can perform at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase having a modification. In some embodiments, a modified nucleobase can perform at least one function of a nucleobase (e.g., formation in a polymer of a moiety capable of base pairing with a nucleic acid containing at least a complementary base sequence). In some embodiments, a modified nucleobase is a substituted A, T, C, G, or U, or a tautomer of a substituted A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of an oligonucleotide refers to a nucleobase that is not A, T, C, G, or U.
[0031] Modified nucleoside: The term "modified nucleoside" refers to a moiety that is derived from a natural nucleoside or has a portion chemically similar to a natural nucleoside but contains a chemical modification that is different from a natural nucleoside. Non-limiting examples of modified nucleosides include those having a modification in the base and / or sugar. Non-limiting examples of modified nucleosides include those having a modified 2'-position of the sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (lacking a nucleobase). In some embodiments, a modified nucleoside can perform at least one function of a nucleobase (e.g., formation in a polymer of a moiety capable of base pairing with a nucleic acid containing at least a complementary base sequence).
[0032] Modified nucleotide: The term "modified nucleotide" includes a chemical moiety that is structurally different from a natural nucleotide but can perform at least one function of a natural nucleotide. In some embodiments, a modified nucleotide includes a modification in the sugar, base, and / or internucleotide linkage. In some embodiments, a modified nucleotide includes a modified sugar, modified nucleobase, and / or modified internucleotide linkage. In some embodiments, a modified nucleotide can perform at least one function of a nucleobase (e.g., formation in a polymer of a subunit capable of base pairing with a nucleic acid containing at least a complementary base sequence).
[0033] Modified sugar: The term "modified sugar" refers to a moiety that can replace a sugar. A modified sugar mimics the conformation, electronic properties, or other physicochemical properties of a sugar. In some embodiments, as described herein, a modified sugar is a substituted ribose or deoxyribose. In some embodiments, a modified sugar contains a 2'-modification. Examples of useful 2'-modifications are widely utilized in the art and are described herein. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the 2'-modification is 2'-OR, where R is optionally substituted C 1-10It is aliphatic. In some embodiments, the 2'-modification is 2'-OMe. In some embodiments, the 2'-modification is 2'-MOE. In some embodiments, the modified sugar is a bicyclic sugar (e.g., the sugar used in LNA, BNA, etc.). In some embodiments, in the context of an oligonucleotide, the modified sugar is a sugar other than ribose or deoxyribose as commonly found in natural RNA or DNA.
[0034] Nucleic acid: As used herein, the term "nucleic acid" includes any nucleotide and its polymers. As used herein, the term "polynucleotide" refers to a polymer of nucleotides of any length, i.e., ribonucleotides (RNA) or deoxyribonucleotides (DNA) or combinations thereof. These terms refer to the primary structure of the molecule and thus include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. These terms include, without limitation, modified nucleotides and / or polynucleotides such as methylated, protected, and / or capped nucleotides or polynucleotides, and equivalents thereof, such as analogs of RNA or DNA. The term includes poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified internucleotide linkages. The term includes nucleic acids that contain combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges, or modified internucleotide linkages. Examples include, but are not limited to, nucleic acids containing a ribose moiety, nucleic acids containing a deoxyribose moiety, nucleic acids containing both a ribose moiety and a deoxyribose moiety, and nucleic acids containing a ribose moiety and a modified ribose moiety. Unless otherwise specified, the prefix "poly" refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units, and the prefix "oligo" refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.
[0035] Nucleic Acid Base: The term "nucleic acid base" refers to a portion of a nucleic acid that participates in hydrogen bonds that bind one nucleic acid strand to another complementary strand in a sequence-specific manner. The most common natural nucleic acid bases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the natural nucleic acid base is a modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the natural nucleic acid base is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the nucleic acid base includes a heteroaryl ring in which the ring atoms are nitrogen, and in a nucleoside, the nitrogen is bonded to the sugar moiety. In some embodiments, the nucleic acid base includes a heterocyclic ring in which the ring atoms are nitrogen, and in a nucleoside, the nitrogen is bonded to the sugar moiety. In some embodiments, the nucleic acid base is a "modified nucleic acid base", i.e., a nucleic acid base other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, the modified nucleic acid base is a substituted A, T, C, G, or U. In some embodiments, the modified nucleic acid base is a tautomer of a substituted A, T, C, G, or U. In some embodiments, the modified nucleic acid base is a methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, the modified nucleic acid base mimics the spatial arrangement, electronic properties, or other physicochemical properties of a nucleic acid base and retains the properties of hydrogen bonds that bind one nucleic acid strand to another in a sequence-specific manner. In some embodiments, the modified nucleic acid base can pair with all of the natural five bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior of an oligonucleotide duplex, recognition by intracellular enzymes, or activity. As used herein, the term "nucleic acid base" also encompasses structural analogs used in place of natural nucleotides, such as modified nucleic acid bases and nucleic acid base analogs. In some embodiments, the nucleic acid base is an optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, "nucleic acid base" refers to a unit of nucleic acid base within an oligonucleotide or nucleic acid (e.g., A, T, C, G, or U within an oligonucleotide or nucleic acid).
[0036] Nucleoside: The term "nucleoside" refers to the moiety in which a nucleobase or modified nucleobase is covalently bonded to a sugar or modified sugar. In some embodiments, the nucleoside is a natural nucleoside, such as adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine or deoxycytidine. In some embodiments, the nucleoside is a modified nucleoside, such as a substitution product of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine and deoxycytidine. In some embodiments, the nucleoside is a substitution product of a tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine and deoxycytidine. In some embodiments, "nucleoside" refers to the unit of a nucleoside within an oligonucleotide or nucleic acid.
[0037] Nucleotide: As used herein, the term "nucleotide" refers to the monomeric unit of a polynucleotide consisting of a nucleobase, a sugar, and one or more inter-nucleotide linkages (e.g., the phosphate linkages of natural DNA and RNA). Natural bases [guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)] are derivatives of purines or pyrimidines, and include analogs of both naturally occurring and non-naturally occurring bases. Natural sugars are pentoses (5-carbon sugars), deoxyribose (which forms DNA) or ribose (which forms RNA), and include analogs of both naturally occurring and non-naturally occurring sugars. Nucleotides are joined via inter-nucleotide linkages to form nucleic acids or polynucleotides. Many inter-nucleotide linkages are known in the art (e.g., but not limited to, phosphate, phosphorothioate, boranophosphate, etc.). Artificial nucleic acids include PNA (peptide nucleic acid), phosphotriester, phosphorothionate, H-phosphonate, phosphoramidate, boranophosphate, methylphosphonate, phosphonoacetate, thiophosphonoacetate, and other variants of the phosphate backbone of natural nucleic acids described herein. In some embodiments, a natural nucleotide comprises a naturally occurring base, sugar, and inter-nucleotide linkage. As used herein, the term "nucleotide" also encompasses structural analogs used in place of natural nucleotides, e.g., modified nucleotides and nucleotide analogs. In some embodiments, "nucleotide" refers to the unit of a nucleotide within an oligonucleotide or nucleic acid.
[0038] Oligonucleotide: As used herein, the term "oligonucleotide" refers to a polymer or oligomer of nucleotides, and may include combinations of natural and non-natural nucleobases, sugars, and inter-nucleotide linkages.
[0039] The oligonucleotide may be single-stranded or double-stranded. A single-stranded oligonucleotide can have a double-stranded region (formed by two portions of the single-stranded oligonucleotide), and a double-stranded oligonucleotide containing two oligonucleotide strands can have a single-stranded region, for example, in a region where the two oligonucleotide strands are not complementary to each other. Examples of oligonucleotides include, but are not limited to, genes including structural genes, control regions and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermir, aptamers, antimon, antagomirs, Ul adapters, triple helix-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides and decoy oligonucleotides.
[0040] The length of the oligonucleotides of this disclosure may vary. In certain embodiments, the length of the oligonucleotide can be from about 2 to about 200 nucleosides. In various related embodiments, the length of single-stranded, double-stranded or triple-stranded oligonucleotides can be from about 4 to about 10, from about 10 to about 50, from about 20 to about 50, from about 15 to about 30, from about 20 to about 30 nucleosides. In some embodiments, the length of the oligonucleotide is from about 9 to about 39 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 26 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 27 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 28 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 29 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 30 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 31 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 32 to about 70 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 60 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 50 nucleosides. In some embodiments, the length of the oligonucleotide is from about 25 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is from about 30 to about 40 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleosides. In some embodiments, the length of the oligonucleotide is at least 4 nucleosides. In some embodiments, the length of the oligonucleotide is at least 5 nucleosides. In some embodiments, the length of the oligonucleotide is at least 6 nucleosides. In some embodiments, the length of the oligonucleotide is at least 7 nucleosides. In some embodiments, the length of the oligonucleotide is at least 8 nucleosides.In some embodiments, the length of the oligonucleotide is at least 9 nucleosides. In some embodiments, the length of the oligonucleotide is at least 10 nucleosides. In some embodiments, the length of the oligonucleotide is at least 11 nucleosides. In some embodiments, the length of the oligonucleotide is at least 12 nucleosides. In some embodiments, the length of the oligonucleotide is at least 15 nucleosides. In some embodiments, the length of the oligonucleotide is at least 15 nucleosides. In some embodiments, the length of the oligonucleotide is at least 16 nucleosides. In some embodiments, the length of the oligonucleotide is at least 17 nucleosides. In some embodiments, the length of the oligonucleotide is at least 18 nucleosides. In some embodiments, the length of the oligonucleotide is at least 19 nucleosides. In some embodiments, the length of the oligonucleotide is at least 20 nucleosides. In some embodiments, the length of the oligonucleotide is at least 25 nucleosides. In some embodiments, the length of the oligonucleotide is at least 26 nucleosides. In some embodiments, the length of the oligonucleotide is at least 27 nucleosides. In some embodiments, the length of the oligonucleotide is at least 28 nucleosides. In some embodiments, the length of the oligonucleotide is at least 29 nucleosides. In some embodiments, the length of the oligonucleotide is at least 30 nucleosides. In some embodiments, the length of the oligonucleotide is at least 31 nucleosides. In some embodiments, the length of the oligonucleotide is at least 32 nucleosides. In some embodiments, the length of the oligonucleotide is at least 33 nucleosides. In some embodiments, the length of the oligonucleotide is at least 34 nucleosides. In some embodiments, the length of the oligonucleotide is at least 35 nucleosides. In some embodiments, the length of the oligonucleotide is at least 36 nucleosides. In some embodiments, the length of the oligonucleotide is at least 37 nucleosides. In some embodiments, the length of the oligonucleotide is at least 38 nucleosides.In some embodiments, the length of the oligonucleotide is at least 39 nucleosides. In some embodiments, the length of the oligonucleotide is at least 40 nucleosides. In some embodiments, the length of the oligonucleotide is 25 nucleosides. In some embodiments, the length of the oligonucleotide is 26 nucleosides. In some embodiments, the length of the oligonucleotide is 27 nucleosides. In some embodiments, the length of the oligonucleotide is 28 nucleosides. In some embodiments, the length of the oligonucleotide is 29 nucleosides. In some embodiments, the length of the oligonucleotide is 30 nucleosides. In some embodiments, the length of the oligonucleotide is 31 nucleosides. In some embodiments, the length of the oligonucleotide is 32 nucleosides. In some embodiments, the length of the oligonucleotide is 33 nucleosides. In some embodiments, the length of the oligonucleotide is 34 nucleosides. In some embodiments, the length of the oligonucleotide is 35 nucleosides. In some embodiments, the length of the oligonucleotide is 36 nucleosides. In some embodiments, the length of the oligonucleotide is 37 nucleosides. In some embodiments, the length of the oligonucleotide is 38 nucleosides. In some embodiments, the length of the oligonucleotide is 39 nucleosides. In some embodiments, the length of the oligonucleotide is 40 nucleosides. In some embodiments, the nucleosides in the length of the oligonucleotide each independently comprise a nucleobase comprising a ring having at least one nitrogen ring atom. In some embodiments, the nucleosides in the length of the oligonucleotide each independently comprise A, T, C, G or U, optionally substituted A, T, C, G or U, or a tautomer of optionally substituted A, T, C, G or U.
[0041] May be substituted: As described herein, the disclosed compounds, such as oligonucleotides, may be substituted and / or may contain substituted moieties. In general, the term "substituted" means that one or more hydrogens of the designated moiety are replaced by a suitable substituent. Unless otherwise specified, a "may be substituted" substituent may have a suitable substituent at each substitutable position of the group, and when two or more positions in the structure are substituted by two or more substituents selected from a particular group, the substituents may be the same or different at all positions. In some embodiments, the may be substituted substituent is unsubstituted. The combinations of substituents envisioned in this disclosure preferably result in the formation of stable or chemically feasible compounds. The term "stable" as used herein refers to a compound that does not substantially change when exposed to the conditions of formation, detection, and in certain embodiments, recovery, purification, and use for one or more of the purposes disclosed in the specification. Specific substituents are described below.
[0042] Suitable monovalent substituents for a substitutable atom such as a suitable carbon atom are independently halogen; -(CH2) 0~4 R 〇 ; -(CH2) 0~4 OR 〇 ; -O(CH2) 0~4 R 〇 ; -O-(CH2) 0~4 C(O)OR 〇 ; -(CH2) 0~4 CH(OR 〇 )2; R 〇 -(CH2) optionally substituted with 0~4 Ph; R 〇 -(CH2) optionally substituted with 0~4 O(CH2) 0~1 Ph; R 〇 -CH=CHPh; R optionally substituted with 〇 -(CH2) optionally substituted with 0~4 O(CH2) 0~1 -pyridyl; -NO2; -CN; -N3; -(CH2) 0~4 N(R 〇)2;-(CH2) 0~4 N(R 〇 )C(O)R 〇 ;-N(R 〇 )C(S)R 〇 ;-(CH2) 0~4 N(R 〇 )C(O)NR 〇 2;-N(R 〇 )C(S)NR 〇 2;-(CH2) 0~4 N(R 〇 )C(O)OR 〇 ;-N(R 〇 )N(R 〇 )C(O)R 〇 ;-N(R 〇 )N(R 〇 )C(O)NR 〇 2;-N(R 〇 )N(R 〇 )C(O)OR 〇 ;-(CH2) 0~4 C(O)R 〇 ;-C(S)R 〇 ;-(CH2) 0~4 C(O)OR 〇 ;-(CH2) 0~4 C(O)SR 〇 ;-(CH2) 0~4 C(O)OSiR 〇 3;-(CH2) 0~4 OC(O)R 〇 ;-OC(O)(CH2) 0~4 SR 〇 ;-SC(S)SR 〇 ;-(CH2) 0~4 SC(O)R 〇 ;-(CH2) 0~4 C(O)NR 〇 2;-C(S)NR 〇 2;-C(S)SR 〇 ;-(CH2) 0~4 OC(O)NR 〇 2;-C(O)N(OR 〇 )R 〇 ;-C(O)C(O)R 〇 ;-C(O)CH2C(O)R 〇 ;-C(NOR 〇 )R 〇 ;-(CH2) 0~4 SSR〇 ; -(CH2) 0~4 S(O)2R 〇 ; -(CH2) 0~4 S(O)2OR 〇 ; -(CH2) 0~4 OS(O)2R 〇 ; -S(O)2NR 〇 2; -(CH2) 0~4 S(O)R 〇 ; -N(R 〇 )S(O)2NR 〇 2; -N(R 〇 )S(O)2R 〇 ; -N(OR 〇 )R 〇 ; -C(NH)NR 〇 2; -Si(R 〇 )3; -OSi(R 〇 )3; -B(R 〇 )2; -OB(R 〇 )2; -OB(OR 〇 )2; -P(R 〇 )2; -P(OR 〇 )2; -P(R 〇 )(OR 〇 ); -OP(R 〇 )2; -OP(OR 〇 )2; -OP(R 〇 )(OR 〇 ); -P(O)(R 〇 )2; -P(O)(OR 〇 )2; -OP(O)(R 〇 )2; -OP(O)(OR 〇 )2; -OP(O)(OR 〇 )(SR 〇 ); -SP(O)(R 〇 )2; -SP(O)(OR 〇 )2; -N(R 〇 )P(O)(R 〇 )2; -N(R 〇 )P(O)(OR 〇 )2; -P(R 〇 )2[B(R 〇 )3]; -P(OR 〇 )2[B(R 〇 )3]; -OP(R 〇 )2[B(R 〇 )3]; -OP(OR 〇)2[B(R 〇 )3]; -(C 1~4 linear or branched alkylene)O-N(R 〇 )2; or, -(C 1~4 linear or branched alkylene)C(O)O-N(R 〇 )2, where each R 〇 may be substituted as defined in the specification and is independently hydrogen, C 1~20 heteroaliphatic having 1 to 5 heteroatoms independently selected from aliphatic, nitrogen, oxygen, sulfur, silicon, and phosphorus, -CH2-(C 1~20 aryl), -O(CH2) 6~14 (C 0~1 (aryl), -CH2-(5- to 14-membered heteroaryl ring), a 5- to 20-membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, or, regardless of the above definition, two independent R 6~14 together with the atoms sandwiched between them form a 5- to 20-membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated, or aryl ring having 0 to 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon, and phosphorus, which may be substituted as defined below. 〇 Appropriate monovalent substituents on R
[0043] (or, the ring formed by two independent R 〇 and the atoms sandwiched between them) are independently halogen; -(CH2) 〇 R 0~2 ; -(haloR * ); -(CH2) * OH; -(CH2) 0~2 OR 0~2 ; -(CH2) * CH(OR 0~2 )2; -O(haloR * ); -CN; -N3; -(CH2) * C(O)R 0~2 ; -(CH2) * C(O)OH; -(CH2) 0~2 C(O)OR 0~2 ; *;-(CH2) 0~2 SR * ;-(CH2) 0~2 SH;-(CH2) 0~2 NH2;-(CH2) 0~2 NHR * ;-(CH2) 0~2 NR * 2;-NO2;-SiR * 3;-OSiR * 3;-C(O)SR * ;-(C 1~4 linear or branched alkylene)C(O)OR * ; or, -SSR * and wherein each R * is unsubstituted or, in the case of halo R * is substituted with only one or more halogens and is independently selected from C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, and 5- or 6-membered saturated, partially unsaturated or aryl rings having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur. Suitable divalent substituents for the saturated carbon atoms of R 〇 include =O and =S.
[0044] For example, suitable divalent substituents for suitable carbon atoms are independently =O, =S, =NNR ● 2, =NNHC(O)R ● ,, =NNHC(O)OR ● ,, =NNHS(O)2R ● ,, =NR ● ,, =NOR ● ,, -O(C(R ● 2)) 2~3 O- or -S(C(R ● 2)) 2~3 S- and wherein R ● are each independently hydrogen, C 1~6 aliphatic which may be substituted as defined below, and 5- or 6-membered saturated, partially unsaturated or aryl rings having no substituents and having from 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur. Suitable divalent substituents bonded to the substitutable carbon adjacent to the "optionally substituted" group include -O(CR● 2) 2~3 O⁻ is included, where R ● is, independently, hydrogen, C 1~6 aliphatic which may be substituted as defined below, and selected from 5- or 6-membered saturated, partially unsaturated and aryl rings having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0045] R ● suitable substituents of the aliphatic group are, independently, -R * , -(haloR * ), -OH, -OR * , -O(haloR * ), -CN, -C(O)OH, -C(O)OR * , -NH₂, -NHR * , -NR * ₂ or -NO₂, where each R * is unsubstituted or, in the case of haloR * , substituted only with one or more halogens, and independently, C 1~4 aliphatic, -CH₂Ph, -O(CH₂) 0-1 Ph, or a 5- or 6-membered saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0046] In some embodiments, suitable substituents of replaceable nitrogen are, independently, -R † , -NR † ₂, -C(O)R † , -C(O)OR † , -C(O)C(O)R † , -C(O)CH₂C(O)R † , -S(O)₂R † , -S(O)₂NR † ₂, -C(S)NR † ₂, -C(NH)NR † ₂ or -N(R † )S(O)₂R † where R † is, independently, hydrogen, C 1~6An aliphatic, unsubstituted -OPh, or a 5- or 6-membered saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur and being unsubstituted, or, regardless of the above definition, two independent Rs † together with the atoms sandwiched between them form a 3- to 12-membered, monocyclic or bicyclic, saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur and being unsubstituted.
[0047] R † Suitable substituents for the aliphatic group of R are independently -R * , -(haloR * ), -OH, -OR * , -O(haloR * ), -CN, -C(O)OH, -C(O)OR * , -NH2, -NHR * , -NR * 2 or -NO2, where each R * is unsubstituted or, in the case of haloR * is substituted only with one or more halogens and is independently C 1~4 aliphatic, -CH2Ph, -O(CH2) 0~1 Ph, or a 5- or 6-membered saturated, partially unsaturated or aryl ring having 0 to 4 heteroatoms independently selected from nitrogen, oxygen and sulfur.
[0048] Partially unsaturated: As used herein, the term "partially unsaturated" refers to a ring moiety containing at least one double bond or triple bond. The term "partially unsaturated" is intended to encompass rings having multiple sites of unsaturation but is not intended to include aryl or heteroaryl moieties as defined herein.
[0049] Pharmaceutical composition: In this specification, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in dosage units suitable for administration in a treatment that has a statistically significant probability of achieving a predetermined therapeutic effect when administered to the relevant population. In some embodiments, the pharmaceutical composition is formulated for administration in solid or liquid form, including oral administration (e.g., solutions (aqueous or non-aqueous) or suspensions, e.g., tablets, boluses, powders, granules, pastes for administration to the tongue for buccal, sublingual, and systemic absorption); parenteral administration (e.g., subcutaneous, intramuscular, intravenous, or epidural injection or sustained release formulations as sterile solutions or suspensions); topical administration (e.g., as creams, ointments, sustained release patches, or sprays, for administration to the skin, lung, or oral cavity); intravaginal or rectal administration (e.g., pessaries, creams, foams); sublingual administration; intraocular administration; transdermal administration; or administration to the nasal, lung, and other mucosal surfaces.
[0050] Pharmaceutically acceptable: In this specification, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues of humans and animals within the scope of sound medical judgment, without excessive toxicity, irritation, allergic response, or other problems or complications, and having a reasonable benefit / risk ratio.
[0051] Pharmaceutically acceptable carrier: As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition or vehicle such as a liquid or solid filler, diluent, excipient or solvent encapsulant involved in the transport or delivery of a compound from one organ or body part to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Examples of materials that can be used as pharmaceutically acceptable carriers include sugars such as lactose, glucose, sucrose; starches such as corn starch, potato starch; celluloses and their derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients such as cocoa butter, suppository wax; oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, polyethylene glycol; esters such as ethyl oleate, ethyl laurate; agar; buffering agents such as magnesium hydroxide, aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffering solutions; polyesters, polycarbonates and / or polyanhydrides; and other non-toxic compatible substances used in pharmaceutical formulations, etc.
[0052] Pharmaceutically acceptable salts: As used herein, the term "pharmaceutically acceptable salts" refers to salts of compounds suitable for use as pharmaceuticals, i.e., salts that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of humans and lower animals without causing excessive toxicity, irritation, allergic reactions, etc., and that have a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salts include, but are not limited to, salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, salts of amino groups formed with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or non-toxic acid addition salts of amino groups formed by other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc.In some embodiments, the provided compound includes one or more acidic groups, such as oligonucleotides, and the pharmaceutically acceptable salts are alkali, alkaline earth metal or ammonium salts (e.g., ammonium salts of N(R)3, where R is each independently as defined and described in this disclosure). Representative alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium salts, etc. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed with counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, alkyl groups having 1 to 6 carbon atoms, sulfonates, and arylsulfonates. In some embodiments, the provided compound includes a plurality of acidic groups, such as oligonucleotides (e.g., between natural phosphate linkages and / or modified nucleotide linkages), and may include two or more acidic groups. In some embodiments, the pharmaceutically acceptable salts or common salts of such compounds include two or more cations, which may be the same or different. In some embodiments, in the pharmaceutically acceptable salt (or common salt), all ionizable hydrogens in the acidic group (e.g., having a pKa of about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 or less, in some embodiments 7 or less; in some embodiments 6 or less; in some embodiments 5 or less; in some embodiments 4 or less; in some embodiments 3 or less, in aqueous solution) are replaced by cations. In some embodiments, phosphorothioate groups and phosphate groups each independently exist in salt form (e.g., in the case of sodium salts, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O- respectively). In some embodiments, phosphorothioate groups and phosphate nucleotide linkages each independently exist in salt form (e.g., in the case of sodium salts, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O- respectively). In some embodiments, the pharmaceutically acceptable salt is the sodium salt of the oligonucleotide.In one aspect, the pharmaceutically acceptable salt is the sodium salt of an oligonucleotide in which acidic phosphate groups and, if present, modified phosphate groups (e.g., phosphorothioate, phosphate, etc.) are present in salt form (all sodium salts).
[0053] Protecting group: The term "protecting group" as used herein is well known in the art and is described in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3 rdIncluded are those described in detail in the 1999 edition, John Wiley & Sons (the whole of which is incorporated herein by reference). Also included are protecting groups described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al., 06 / 2012 (the whole of Chapter 2 is incorporated herein by reference), which are particularly suitable for nucleoside and nucleotide chemistry. Suitable amino protecting groups include methyl carbamate, ethyl carbamate, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2,7-dibromo)fluorenylmethyl carbamate, 2,7-di-t-butyl-[9-(10,10-dioxo-10,10,10,10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(1-adamantyl)-1-methylethyl carbamate (Adpoc), 1,1-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-1-(4-biphenylyl)ethyl carbamate (Bpoc), 1-(3,5-di-t-butylphenyl)-1-methylethyl carbamate (t-Bumeoc), 2-(2'- and 4'-pyridyl)ethyl carbamate (Pyoc), 2-(N,N-dicyclohexylcarboxamide)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4-nitrocinnamyl carbamate (Noc), 8-quinolyl carbamate, N-hydroxy piperidinyl carbamate, alkyldithiocarbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitrobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(p-toluenesulfonyl)ethyl carbamate, [2-(1,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), 1,1-dimethyl-2-cyanoethyl carbamate, m-chloro-p-acetyloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, N'-p-toluenesulfonylaminocarbonyl derivative, N'-phenylaminothiocarbonyl derivative, t-amyl carbamate, S-benzylthiocarbamate, p-cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-Dimethoxycarbonylvinyl carbamate, o-(N,N-dimethylcarboxamido)benzyl carbamate, 1,1-dimethyl-3-(N,N-dimethylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isobornyl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p'-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-1-cyclopropylmethyl carbamate, 1-methyl-1-(3,5-dimethoxyphenyl)ethyl carbamate, 1-methyl-1-(p-phenylazophenyl)ethyl carbamate, 1-methyl-1-phenylethyl carbamate, 1-methyl-1-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4,6-tri-t-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, p-phenylbenzamide, o-nitrophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetamide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, N-acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N-1,1,4,4-Tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted 1,3-dimethyl-1,3,5-triazacyclohexan-2-one, 5-substituted 1,3-dibenzyl-1,3,5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyrrolidone, N-methylamine, N-allylamine, N-[2-(trimethylsilyl)ethoxy]methylamine (SEM), N-3-acetoxypropylamine, N-(1-isopropyl-4-nitro-2-oxo-3-pyrrolin-3-yl)amine, quaternary ammonium salt, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosuberlylamine, N-triphenylmethylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7-dichloro-9-fluorenylmethyleneamine, N-ferrocenylmethylamino (Fcm), N-2-picolylamino N'-oxide, N-1,1-dimethylthiomethyleneamine, N-benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneamine, N-(N',N'-dimethylaminomethylene)amine, N,N'-isopropylidenediamine, N-p-nitrobenzylideneamine, N-salicylideneamine, N-5-chlorosalicylideneamine, N-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-1-cyclohexenyl)amine, N-borane derivative, N-diphenylboric acid derivative, N-[phenyl(pentacarbonylchromium or tungsten)carbonyl]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphine amide (Dpp), dimethylthiophosphine amide (Mpt), diphenylthiophosphine amide (Ppt), dialkylphosphoroamidate, dibenzylphosphoroamidate, diphenylphosphoroamidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-Dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), p-toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2,3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2,2,5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methanesulfonamide (Ms), β-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide are included.,
[0054] Properly protected carboxylic acids further include, but are not limited to, carboxylic acids protected with silyl-, alkyl-, alkenyl, allyl- and allylalkyl. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g. p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), 2-picolyl and 4-picolyl.
[0055] Suitable protecting groups for hydroxyl groups include methyl, methoxymethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl, 4-pentenyl oxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, 1-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 1-methyl-1-methoxyethyl, 1-methyl-1-benzyloxyethyl, 1-methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl N-oxide, diphenylmethyl, p,p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'-bromophenacyloxyphenyl)diphenylmethyl, 4,4',4''-tris(4,5-dichlorophthalimidophenyl)methyl, 4,4',4''-tris(levulinoyloxyphenyl)methyl, 4,4',4''-tris(benzoyloxyphenyl)methyl, 3-(imidazol-1-yl)bis(4',4''-dimethoxyphenyl)methyl, 1,1-bis(4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxide, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylhexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate ester, benzoylformate ester, acetate ester, chloroacetate ester, dichloroacetate ester, trichloroacetate ester, trifluoroacetate ester, methoxyacetate ester, triphenylmethoxyacetate ester, phenoxyacetate ester, p-chlorophenoxyacetate ester, 3-phenylpropionate ester, 4-oxopentanoate ester (levulinate ester), 4,4-(ethylenedithio)pentanoate ester (levulinoyldithioacetal), pivalate ester, adamantate ester, crotonate ester, 4-methoxycrotonate ester, benzoate ester, p-phenylbenzoate ester, 2,4,6-trimethylbenzoate ester (mesitoate ester), alkyl carbonate methyl, 9-fluorenylmethyl carbonate (Fmoc), alkyl carbonate ethyl, alkyl carbonate 2,2,2-trichloroethyl (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl)ethyl carbonate (Psec), 2-(triphenylphosphonio)ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate, alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy-1-naphthyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutanoate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butanoate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinate, (E)-2-methyl-2-butenoate, o-(methoxycarbonyl)benzoate, α-naphthoate, nitrate, alkyl N,N,N’,N’-tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts) are included. For the protection of 1,2- or 1,3-diols, the protecting groups are methylene acetal, ethylidene acetal, 1-t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,It includes 4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene orthoester, 1-methoxyethylidene orthoester, 1-ethoxyethylidine orthoester, 1,2-dimethoxyethylidene orthoester, α-methoxybenzylidene orthoester, 1-(N,N-dimethylamino)ethylidene derivative, α-(N,N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene orthoester, di-t-butylsilylene group (DTBS), 1,3-(1,1,3,3-tetraisopropyldisiloxanilidene) derivative (TIPDS), tetra-t-butoxydisiloxane-1,3-diylidene derivative (TBDS), cyclic carbonate, boronic acid cyclic ester, boronic acid ethyl ester and boronic acid phenyl ester.,
[0056] In some embodiments, the protecting group for the hydroxyl group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1-(2-chloroethoxy)ethyl, 2-trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate ester, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, 9-fluorenylmethyl carbonate, mesylate ester, tosylate ester, trifluoromethanesulfonate ester, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl (DMTr) and 4,4',4''-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl, 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4,4',4''-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthen-9-yl (MOX). In some embodiments, each protecting group for the hydroxyl group is independently selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the protecting group for the hydroxyl group is selected from the group consisting of a trityl group, a monomethoxytrityl group and a 4,4'-dimethoxytrityl group.In some embodiments, the protecting group for the phosphorus linkage is a group that binds to the phosphorus linkage (e.g., the internucleotide linkage) throughout the synthesis of the oligonucleotide. In some embodiments, the protecting group is attached to the sulfur atom of the phosphorothioate group. In some embodiments, the protecting group is attached to the oxygen atom of the phosphorothioate linkage between nucleotides. In some embodiments, the protecting group is attached to the oxygen atom of the phosphate linkage between nucleotides. In some embodiments, the protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o-nitrobenzyl, 2-(p-nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-1-propyl, 4-oxopentyl, 4-methylthio-1-butyl, 2-cyano-1,1-dimethylethyl, 4-N-methylaminobutyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, 2-(N-formyl, N-methyl)aminoethyl or 4-[N-methyl-N-(2,2,2-trifluoroacetyl)amino]butyl.
[0057] Subject: As used herein, the term "subject" or "subject of the test" refers to any organism to which a compound (e.g., an oligonucleotide) or composition is administered in this disclosure, for example, for experimentation, diagnosis, prevention and / or treatment. Representative subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates and humans; insects; worms, etc.) and plants. In some embodiments, the subject is a human. In some embodiments, the subject is suffering from and / or is likely to suffer from a disease, disorder and / or condition.
[0058] Sugar: The term "sugar" refers to cyclic and / or acyclic monosaccharides or polysaccharides. In some embodiments, the sugar is a monosaccharide. In some embodiments, the sugar is a polysaccharide. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term "sugar" also encompasses structural analogs that are used in place of conventional sugar molecules, such as glycols, polymers thereof that form the backbone of nucleic acid analogs, glycol nucleic acid ("GNA"), etc. As used herein, the term "sugar" also encompasses structural analogs that are used in place of natural nucleotides, e.g., modified sugars and nucleotide sugars. In some embodiments, the sugar is the sugar of RNA or DNA (ribose or deoxyribose). In some embodiments, the sugar is a modified (e.g., 2'-modified, 5'-modified, etc.) ribose or deoxyribose sugar. As described herein, in some embodiments, in oligonucleotides and / or nucleic acids, modified sugars may provide one or more desirable properties, activities, etc. In some embodiments, the sugar is optionally substituted ribose or deoxyribose. In some embodiments, "sugar" refers to the sugar unit within an oligonucleotide or nucleic acid.
[0059] Prone to: An individual who is "prone to" a disease, disorder, and / or condition is one who has a higher risk of developing the disease, disorder, and / or condition than the general population. In some embodiments, an individual who is prone to a disease, disorder, and / or condition has a constitution that makes them prone to the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, and / or condition may not be diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is prone to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition in the future. In some embodiments, an individual who is prone to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition in the future.
[0060] Therapeutic agent: In this specification, the term "therapeutic agent" generally refers to an agent that elicits a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent that shows a statistically significant effect in an appropriate population is considered a therapeutic agent. In some embodiments, the appropriate population is a population of subjects who have and / or are susceptible to a disease, disorder, or condition. In some embodiments, the appropriate population is a population of model organisms. In some embodiments, the appropriate population may be defined by one or more criteria such as age, gender, genetic background, existing medical conditions, treatment history, etc. In some embodiments, a therapeutic agent is a substance that, when administered to a subject in an effective amount, reduces, improves, alleviates, prevents, delays the onset of, reduces the severity of, and / or decreases the incidence of one or more symptoms or characteristics of the subject's disease, disorder, and / or condition. In some embodiments, a "therapeutic agent" is an agent that has been approved or needs to be approved by a government agency before being marketed for human use. In some embodiments, a "therapeutic agent" is an agent that requires a prescription for administration to humans. In some embodiments, a therapeutic agent is a provided compound, such as a provided oligonucleotide.
[0061] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means the amount of a substance (e.g., a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a treatment. In some embodiments, a therapeutically effective amount of a substance is an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a disease, disorder, and / or condition in a subject who has or is at risk of having the disease, disorder, and / or condition. As will be appreciated by those skilled in the art, the effective amount of a substance may vary depending on factors such as the desired biological endpoint, the substance being delivered, the target cell or tissue, etc. For example, the effective amount of a compound in a formulation for treating a disease, disorder, and / or condition is an amount that reduces, ameliorates, alleviates, inhibits, prevents, delays the onset of, reduces the severity of, and / or decreases the incidence of one or more symptoms or characteristics of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple doses are required to deliver a therapeutically effective amount.
[0062] Treatment: As used herein, the term "treatment" or "treating" refers to a method used to partially or completely reduce, ameliorate, alleviate, inhibit, prevent, delay the onset of, reduce the severity of, and / or decrease the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. Treatment may be performed on a subject who does not exhibit signs of the disease, disorder, and / or condition. In some embodiments, treatment may be performed on a subject who exhibits only early signs of a disease, disorder, and / or condition, for example, to reduce the risk of developing the medical conditions associated with the disease, disorder, and / or condition.
[0063] Wild type: As used herein, the term "wild type" has the meaning understood in the art and refers to an entity having a structure and / or activity that is found in a "normal" state or situation in nature (as contrasted with mutations, diseases, changes, etc.). Those skilled in the art will understand that wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).
[0064] As will be understood by those skilled in the art, the methods and compositions described in the specification for the provided compounds (e.g., oligonucleotides) described in the specification generally apply to pharmaceutically acceptable salts of such compounds.
[0065] In this disclosure, in some embodiments, "one or more" is 1 to 200, 1 to 150, 1 to 100, 1 to 90, 1 to 80, 1 to 70, 1 to 60, 1 to 50, 1 to 40, 1 to 30, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60. In some embodiments, "one or more" is 1. In some embodiments, "one or more" is 2. In some embodiments, "one or more" is 3. In some embodiments, "one or more" is 4. In some embodiments, "one or more" is 5. In some embodiments, "one or more" is 6. In some embodiments, "one or more" is 7. In some embodiments, "one or more" is 8. In some embodiments, "one or more" is 9. In some embodiments, "one or more" is 10. In some embodiments, "one or more" is at least 1. In some embodiments, "one or more" is at least 2. In some embodiments, "one or more" is at least 3. In some embodiments, "one or more" is at least 4. In some embodiments, "one or more" is at least 5. In some embodiments, "one or more" is at least 6. In some embodiments, "one or more" is at least 7. In some embodiments, "one or more" is at least 8. In some embodiments, "one or more" is at least 9. In some embodiments, "one or more" is at least 10.
[0066] In this disclosure, in some embodiments, "at least 1" is "one or more" as described in the specification.
[0067] Description of Specific Embodiments In particular, this disclosure provides various oligonucleotides and their compositions. In some embodiments, the oligonucleotides of this disclosure target calpain 2 and can hybridize to calpain 2 transcripts (e.g., calpain 2 mRNA). In some embodiments, the provided technologies (e.g., oligonucleotides, compositions, methods, etc.) reduce the levels of calpain 2 transcripts and / or their products. The use of natural nucleic acids is limited, for example, by their sensitivity to endonucleases and exonucleases. Therefore, various synthetic counterparts have been developed to avoid these drawbacks and / or to further improve various properties and activities. In some embodiments, the provided oligonucleotides have various chemical modifications (e.g., modification of nucleobases, sugars, internucleotide linkages, etc.), and thus, in particular, these molecules are less prone to degradation and other properties and / or activities are improved. In some embodiments, the oligonucleotide comprises one or more features (e.g., base sequence, length, wing, core, activity, etc.) described in the specification. In some embodiments, the oligonucleotide comprises the base sequence and / or the wing-core-wing structure described in the specification.
[0068] Base sequence The base sequences of the various oligonucleotides are long enough to be able to form a double strand with the complementary sequence of the target nucleic acid for one or more biological functions. In some embodiments, the oligonucleotide specifically targets its target nucleic acid. In some embodiments, the base sequence of the provided oligonucleotide is a sequence complementary to a portion of the target nucleic acid (target portion, such as the calpain 2 gene or its transcript), or includes a sequence complementary to a portion of the target nucleic acid. In some embodiments, the length of the sequence complementary to the target portion is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more nucleic acid bases. In some embodiments, the target portion is a characteristic portion of the nucleic acid sequence (such as the calpain 2 gene or its transcript), or includes the characteristic portion, and such a portion characterizes the nucleic acid sequence relative to other nucleic acid sequences in the relevant organism; for example, the characteristic portion is not present in other genomic nucleic acid sequences (e.g., genes) or their transcripts in the relevant organism (e.g., in human calpain 2, its characteristic portion is not present in other human nucleic acid sequences or their transcripts). In some embodiments, the characteristic portion of the transcript characterizes the transcript relative to other transcripts in the relevant organism; for example, in some embodiments, the characteristic portion is not present in transcripts transcribed from different nucleic acid sequences (e.g., different genes). In some embodiments, variants of transcripts from a nucleic acid sequence (e.g., variants of the mRNA of a gene) may share a common characteristic portion that characterizes them from transcripts of other nucleic acids, e.g., transcripts of other genes. In some embodiments, the characteristic portion in the transcript characterizes the transcript relative to other transcripts of the same nucleic acid sequence (e.g., gene) and / or other alleles of the nucleic acid sequence. In some embodiments, the characteristic portion characterizes a particular allele (and / or its transcript) relative to other alleles (and / or their transcripts). In some embodiments, the characteristic portion includes sequences separated within the nucleic acid. In some embodiments, the characteristic portion is a continuous sequence of nucleic acid bases in the nucleic acid (characteristic sequence). The number of nucleic acid bases in the characteristic portion or sequence varies.In some embodiments, the number of nucleotides in the characteristic portion or sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more; in some embodiments, it is about 10; in some embodiments, it is about 11; in some embodiments, it is about 12; in some embodiments, it is about 13; in some embodiments, it is about 14; in some embodiments, it is about 15; in some embodiments, it is about 16; in some embodiments, it is about 17; in some embodiments, it is about 18; in some embodiments, it is about 19; in some embodiments, it is about 20; in some embodiments, it is about 21; in some embodiments, it is about 22; in some embodiments, it is about 23; in some embodiments, it is about 24; in some embodiments, it is about 25; in some embodiments, it is about 25 or more.
[0069] In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the oligonucleotide comprises a sequence that is identical or complementary to a characteristic portion of a calpain 2 transcript. In some embodiments, the oligonucleotide comprises a sequence that is complementary to a characteristic portion of a calpain 2 transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is identical or complementary to a characteristic portion of a nucleic acid. In some embodiments, the nucleotide sequence of the oligonucleotide is identical or complementary to a characteristic portion of a calpain 2 transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is complementary to a characteristic portion of a calpain 2 transcript. In some embodiments, the characteristic portion is a characteristic sequence.
[0070] In some embodiments, the characteristic sequence of the calpain 2 transcript is a sequence complementary to the sequence of the oligonucleotide of Table 1 or comprises said complementary sequence. In some embodiments, the characteristic sequence is GGAAGCCUACAGAAACUGAU (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is AUCAACUGAACCAGUAUGCC (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is AACCACUGCCUGACCUGAGC (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is AGCUCUGCAAAAAGGCUCUC (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is ACUAGAGGCACAGAGCUGGA (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is ACAACUGCCCAAGCUGGAAC (wherein each U may independently be replaced by T) or comprises it. In some embodiments, the characteristic sequence is CAGCCAAGGACUAAGCUUCC (wherein each U may independently be replaced by T) or comprises it.
[0071] In some embodiments, the oligonucleotide can hybridize to a region of a nucleic acid. In some embodiments, an oligonucleotide that can specifically hybridize to a particular region of a nucleic acid (e.g., by sequence complementarity) can more effectively reduce the level of the nucleic acid than an oligonucleotide that specifically hybridizes to one or more reference regions of the nucleic acid (e.g., by sequence complementarity). In some embodiments, the length of the region is about 20 to 200 (e.g., about 20 to 150, 20 to 100, 30 to 200, 30 to 150, 40 to 200, 40 to 150, 50 to 100, or about 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200) nucleobases. In some embodiments, the length of the region is about 30 nucleobases. In some embodiments, the length of the region is about 40 nucleobases. In some embodiments, the length of the region is about 50 nucleobases. In some embodiments, the length of the region is about 60 nucleobases. In some embodiments, the length of the region is about 70 nucleobases. In some embodiments, the length of the region is about 80 nucleobases. In some embodiments, the length of the region is about 90 nucleobases. In some embodiments, the length of the region is about 100 nucleobases. In some embodiments, the length of the region is about 120 nucleobases. In some embodiments, the length of the region is about 150 nucleobases. In some embodiments, the length of the region is about 200 nucleobases. In some embodiments, the region comprises the nucleotide sequence of the oligonucleotide of Table 1, which is located in the center of the region in some embodiments. For example, in some embodiments, the region is or comprises GGAAGCCUACAGAAACUGAU. In some embodiments, the region is or comprises AUCAACUGAACCAGUAUGCC. In some embodiments, the region is or comprises AACCACUGCCUGACCUGAGC. In some embodiments, the region is or comprises AGCUCUGCAAAAAGGCUCUC. In some embodiments, the region is or comprises ACUAGAGGCACAGAGCUGGA. In some embodiments, the region is or comprises ACAACUGCCCAAGCUGGAAC. In some embodiments, the region is or comprises CAGCCAAGGACUAAGCUUCC.In some embodiments, the reference region is, or includes, UCCCUCACCUUGAAUGAAGA.
[0072] In some embodiments, the nucleotide sequence of the oligonucleotide is the same as, or complementary to, a nucleotide sequence of equal length within the calpain 2 gene or its transcript (e.g., mRNA), and contains or consists of about 10 - 50 (e.g., about 15 - 50, 16 - 50, 17 - 50, 18 - 50, 19 - 50, 20 - 50, 15 - 30, 20 - 30, 15 - 25 or 20 - 25, or at least about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least about 15; in some embodiments, at least about 16; in some embodiments, at least about 17; in some embodiments, at least about 18; in some embodiments, at least about 19; in some embodiments, at least about 20; in some embodiments, at least about 21; in some embodiments, at least about 22; in some embodiments, at least about 23; in some embodiments, at least about 24; in some embodiments, at least about 25) consecutive bases. In some embodiments, these are complementary to a nucleotide sequence of the same length in the calpain 2 transcript.
[0073] In certain embodiments, the nucleotide sequence of the oligonucleotide is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, or 100% complementary to the target sequence in the calpain 2 transcript. In some embodiments, the nucleotide sequence of the oligonucleotide is completely complementary to the target sequence in the calpain 2 transcript.
[0074] In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 80% identity with the nucleotide sequence of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 85% identity with the nucleotide sequence of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 90% identity with the nucleotide sequence of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide has at least about 95% identity with the nucleotide sequence of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa.
[0075] In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 15 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 16 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 17 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 18 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 19 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide comprises a continuous span of at least about 20 bases of the oligonucleotide shown in Table 1, where T can be independently replaced by U, and vice versa.
[0076] In some embodiments, the nucleotide sequence of the oligonucleotide comprises the nucleotide sequence of the oligonucleotide in Table 1, where T may be independently replaced by U, and vice versa. In some embodiments, the nucleotide sequence of the oligonucleotide is the nucleotide sequence of the oligonucleotide in Table 1, where T may be independently replaced by U, and vice versa. For example, in some embodiments, the nucleotide sequence of the oligonucleotide contains ATCAGTTTCTGTAGGCTTCC (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains GGCATACTGGTTCAGTTGAT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains GCTCAGGTCAGGCAGTGGTT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains GAGAGCCTTTTTGCAGAGCT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains TCCAGCTCTGTGCCTCTAGT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains GTTCCAGCTTGGGCAGTTGT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide contains GGAAGCTTAGTCCTTGGCTG (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT (wherein T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT (wherein T may be independently replaced by U).In some embodiments, the nucleotide sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT (wherein each T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT (wherein each T may be independently replaced by U). In some embodiments, the nucleotide sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG (wherein each T may be independently replaced by U).
[0077] In some embodiments, the nucleotide sequence of the oligonucleotide comprises ATCAGTTTCTGTAGGCTTCC. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGCATACTGGTTCAGTTGAT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GCTCAGGTCAGGCAGTGGTT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GAGAGCCTTTTTGCAGAGCT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises TCCAGCTCTGTGCCTCTAGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GTTCCAGCTTGGGCAGTTGT. In some embodiments, the nucleotide sequence of the oligonucleotide comprises GGAAGCTTAGTCCTTGGCTG. In some embodiments, the nucleotide sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC. In some embodiments, the nucleotide sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT. In some embodiments, the nucleotide sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT. In some embodiments, the nucleotide sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT. In some embodiments, the nucleotide sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT. In some embodiments, the nucleotide sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT. In some embodiments, the nucleotide sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG.
[0078] Length As will be understood by those skilled in the art, oligonucleotides vary in length in order to provide the properties and / or activities required for various applications. In this technical field, there are many techniques for evaluating, selecting, and / or optimizing the length of oligonucleotides that can be utilized in this disclosure. As shown in the specification, in many embodiments, the oligonucleotides provided are of a length suitable for hybridizing to a target and reducing the level of the target and / or its product. In some embodiments, the oligonucleotide is of a length sufficient to recognize a target nucleic acid (e.g., calpain 2 mRNA). In some embodiments, the oligonucleotide is long enough to distinguish the target nucleic acid from other nucleic acids (nucleic acids having a base sequence other than the sequence of calpain 2) and reduce off-target effects. In some embodiments, the oligonucleotide is short enough to reduce the complexity of manufacture or production and reduce the cost of the product.
[0079] In some embodiments, the length of the base sequence of the oligonucleotide is 10 to 100 nucleobases. In some embodiments, the length of the base sequence is about 10 to 50 nucleobases. In some embodiments, the length of the base sequence is about 15 to 50 nucleobases. In some embodiments, the length of the base sequence is about 15 to 30 nucleobases. In some embodiments, the length of the base sequence is about 15 to 25 nucleobases. In some embodiments, the length of the base sequence is about 15 to 22 nucleobases. In some embodiments, the length of the base sequence is about 18 to 22 nucleobases. In some embodiments, the length of the base sequence is about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobases. In some embodiments, the length of the base sequence is at least about 12 nucleobases. In some embodiments, the length of the base sequence is at least about 13 nucleobases. In some embodiments, the length of the base sequence is at least about 14 nucleobases. In some embodiments, the length of the base sequence is at least about 15 nucleobases. In some embodiments, the length of the base sequence is at least about 16 nucleobases. In some embodiments, the length of the base sequence is at least about 17 nucleobases. In some embodiments, the length of the base sequence is at least about 18 nucleobases. In some embodiments, the length of the base sequence is at least about 19 nucleobases. In some embodiments, the length of the base sequence is at least about 20 nucleobases. In some embodiments, the length of the base sequence is at least about 21 nucleobases. In some embodiments, the length of the base sequence is at least about 22 nucleobases. In some embodiments, the length of the base sequence is at least about 23 nucleobases. In some embodiments, the length of the base sequence is at least about 24 nucleobases. In some embodiments, the length of the base sequence is at least about 25 nucleobases. In some embodiments, the length of the base sequence is about 15 nucleobases. In some embodiments, the length of the base sequence is about 16 nucleobases. In some embodiments, the length of the base sequence is about 17 nucleobases. In some embodiments, the length of the base sequence is about 18 nucleobases. In some embodiments, the length of the base sequence is about 19 nucleobases. In some embodiments, the length of the base sequence is about 20 nucleobases. In some embodiments, the length of the base sequence is about 21 nucleobases. In some embodiments, the length of the base sequence is about 22 nucleobases.In some embodiments, the length of the base sequence is about 23 nucleobases. In some embodiments, the length of the base sequence is about 24 nucleobases. In some embodiments, the length of the base sequence is about 25 nucleobases. In some other embodiments, the length of the base sequence is at least about 30 nucleobases. In some embodiments, each nucleobase independently comprises an optionally substituted monocyclic, bicyclic or polycyclic ring having at least one ring atom being nitrogen. In some embodiments, each nucleobase independently is an optionally substituted adenine, cytosine, guanosine, thymine or uracil, or a tautomer of an optionally substituted adenine, cytosine, guanosine, thymine or uracil.
[0080] Nucleobase In the oligonucleotides provided, various nucleobases may be utilized in this disclosure. In some embodiments, the nucleobases are natural nucleobases, the most common ones being A, T, C, G, and U. In some embodiments, the nucleobases are modified nucleobases that are not A, T, C, G, or U. In some embodiments, the nucleobases are A, T, C, G, or U that may be substituted, or tautomers of substituted A, T, C, G, or U. In some embodiments, the nucleobases are A, T, C, G, or U that may be substituted, such as 5mC, 5-hydroxymethyl C, etc. In some embodiments, the nucleobases are alkyl-substituted A, T, C, G, or U. In some embodiments, the nucleobase is A. In some embodiments, the nucleobase is T. In some embodiments, the nucleobase is C. In some embodiments, the nucleobase is G. In some embodiments, the nucleobase is U. In some embodiments, the nucleobase is 5mC. In some embodiments, the nucleobases are substituted A, T, C, G, or U. In some embodiments, the nucleobases are tautomers of substituted A, T, C, G, or U. In some embodiments, the substitution protects specific functional groups of the nucleobase and minimizes unwanted reactions during oligonucleotide synthesis. Techniques suitable for nucleobase protection in oligonucleotide synthesis are widely known in the art and may be utilized in this disclosure. In some embodiments, the modified nucleobases improve the properties and / or activities of the oligonucleotides. For example, in many cases, 5mC may be utilized instead of C to modulate certain unwanted biological effects, such as the immune response. In some embodiments, when determining sequence identity, substituted nucleobases having the same hydrogen bonding pattern are treated the same as unsubstituted nucleobases. For example, 5mC may be treated the same as C [e.g., an oligonucleotide having 5mC instead of C (e.g., AT5mCG) is considered to have the same nucleotide sequence as an oligonucleotide having C at the corresponding position (e.g., ATCG).]
[0081] In some embodiments, the oligonucleotide comprises one or more of A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more optionally substituted A, T, C, G, or U. In some embodiments, the oligonucleotide comprises one or more of 5-methylcytosine (5mC), 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine. In some embodiments, the oligonucleotide comprises one or more of 5mC. In some embodiments, the nucleobases of the oligonucleotide are each independently selected from optionally substituted A, T, C, G, and U, and tautomers of optionally substituted A, T, C, G, and U. In some embodiments, the nucleobases of the oligonucleotide are each independently optionally protected A, T, C, 5mC, G, and U. In some embodiments, the nucleobases of the oligonucleotide are each independently optionally substituted A, T, C, G, or U. In some embodiments, the nucleobases of each oligonucleotide are selected from the group consisting of A, T, C, G, U, and 5mC.
[0082] In some embodiments, the nucleobase is optionally substituted 2AP or DAP. In some embodiments, the nucleobase is optionally substituted 2AP. In some embodiments, the nucleobase is optionally substituted DAP. In some embodiments, the nucleobase is 2AP. In some embodiments, the nucleobase is DAP.
[0083] In some embodiments, the nucleobases are natural nucleobases or modified nucleobases derived from natural nucleobases. Examples include uracil, thymine, adenine, cytosine, and guanine, each with its respective amino group protected by an acyl protecting group as necessary, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine, and pyrimidine analogs such as pseudouracil, and other modified nucleobases such as 8-substituted purines, xanthine, or hypoxanthine (the latter two being natural degradation products). Specific examples of modified nucleobases are disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313.
[0084] In some embodiments, the provided oligonucleotide contains one or more 5-methylcytosines. In some embodiments, this disclosure provides oligonucleotides whose base sequences are disclosed in the specification, such as Table 1, where T may be independently substituted with U, and vice versa, and in some cases, cytosine may be independently substituted with 5-methylcytosine, and vice versa. As will be understood by those skilled in the art, in some embodiments, 5mC may be treated as C in the base sequence of the oligonucleotide, and such oligonucleotides contain nucleobase modifications at the C position (see, for example, the various oligonucleotides in Table 1 or A2). In the description of oligonucleotides, unless otherwise specified, the nucleobases, sugars, and internucleotide linkages are unmodified.
[0085] In some embodiments, the modified nucleobase is a modified nucleobase known in the art (e.g., WO 2017 / 210647). In some embodiments, the modified nucleobase is a nucleobase having an enlarged size with one or more aryl rings and / or heteroaryl rings, such as a phenyl ring, attached thereto.
[0086] The nucleobase may be protected during oligonucleotide synthesis. There are various protection techniques available and can be utilized in this disclosure.
[0087] In some embodiments, the modified nucleobase is a 5-substituted pyrimidine, 6-azapyrimidine, alkyl- or alkynyl-substituted pyrimidine, alkyl-substituted purine, or an N-2, N-6, and O-6 substituted purine. In certain embodiments, the modified nucleobase is 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza, and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoyl cytosine, 4-N-benzoyl uracil, 5-methyl 4-N-benzoyl cytosine, 5-methyl 4-N-benzoyl uracil, universal bases, hydrophobic bases, degenerate bases, size-expanded bases, and fluorinated bases. In some embodiments, the modified nucleobase is a tricyclic pyrimidine, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, or 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). In some embodiments, the modified nucleobase is one in which a purine or pyrimidine base is substituted with another heterocycle, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, or 2-pyridone.
[0088] In some embodiments, the modified nucleobase is substituted. In some embodiments, the modified nucleobase is substituted to include, for example, a heteroatom, an alkyl group, or a fluorescent moiety, a biotin or avidin moiety, or a linking moiety conjugated to another protein or peptide. In some embodiments, the modified nucleobase is a "universal base" that is not a nucleobase in the most classical sense but functions similarly to a nucleobase. An example of a universal base is 3-nitropyrrole.
[0089] In some embodiments, the nucleosides available for use in the provided technology are modified nucleobases and / or modified sugars, such as 4-acetylcytidine; 5-(carboxyhydroxylmethyl)uridine; 2'-O-methylcytidine; 5-carboxymethylaminomethyl-2-thiouridine; 5-carboxymethylaminomethyluridine; dihydrouridine; 2'-O-methylpseudouridine; β,D-galactosylqueuosine; 2'-O-methylguanosine; N 6 -isopentenyladenosine; 1-methyladenosine; 1-methylpseudouridine; 1-methylguanosine; 1-methylinosine; 2,2-dimethylguanosine; 2-methyladenosine; 2-methylguanosine; N 7 -methylguanosine; 3-methylcytidine; 5-methylcytidine; 5-hydroxymethylcytidine; 5-formylcytosine; 5-carboxycytosine; N 6 -methyladenosine; 7-methylguanosine; 5-methylaminoethyluridine; 5-methoxyaminomethyl-2-thiouridine; β,D-mannosylqueuosine; 5-methoxycarbonylmethyluridine; 5-methoxyuridine; 2-methylthio-N 6-Isopentenyladenosine; N-((9-β,D-ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine; N-((9-β,D-ribofuranosylpurin-6-yl)-N-methylcarbamoyl)threonine; methyl uridine-5-oxyacetate; uridine-5-oxyacetic acid (v); pseudouridine; queuosine; 2-thiocytidine; 5-methyl-2-thiouridine; 2-thiouridine; 4-thiouridine; 5-methyluridine; 2'-O-methyl-5-methyluridine and 2'-O-methyluridine.
[0090] In some embodiments, a nucleobase, such as a modified nucleobase, includes one or more biomolecule binding moieties such as, for example, an antibody, an antibody fragment, biotin, avidin, streptavidin, a receptor ligand, or a chelating moiety. In other embodiments, the nucleobase is 5-bromouracil, 5-iodouracil, or 2,6-diaminopurine. In some embodiments, the nucleobase includes substitution by a fluorescent moiety or a biomolecule binding moiety. In some embodiments, the substituent is a fluorescent moiety. In some embodiments, the substituent is biotin or avidin.
[0091] In some embodiments, the nucleobase is described in U.S. Patent Nos. 9,394,333; 9,744,183; 9,605,019; 9,598,458; 9,982,257; 10,160,969; 10,479,995; U.S. Patent Application Publication Nos. 2020 / 0056173; 2018 / 0216107; 2019 / 0127733; U.S. Patent No. 10,450,568; U.S. Patent Application Publication Nos. 2019 / 0077817; 2019 / 0249173; 2019 / 0375774; International Publication Nos. 2018 / 223056; 2018 / 223073; 2018 / 223081; 2018 / 237194; 2019 / 032607; 2019 / 055951; 2019 / 075357; 2019 / 200185; 2019 / 217784; and / or 2019 / 032612, each of which nucleobase is incorporated herein by reference.
[0092] Sugar A variety of sugars, including modified sugars, are available for use in this disclosure. In some embodiments, this disclosure provides sugar modifications and their patterns (e.g., nucleobase modifications and their patterns, internucleotide linkage modifications and their patterns, etc.) that, when incorporated into oligonucleotides, can improve properties and / or activities, optionally in combination with other structural elements.
[0093] The most common natural nucleosides include ribose sugars (e.g., in RNA) or deoxyribose sugars (e.g., in DNA) linked to the nucleobases adenosine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). In some embodiments, sugars, such as the various sugars in many of the oligonucleotides in Table 1 (unless otherwise specified), are the sugars of natural DNA (in a DNA nucleic acid or oligonucleotide), with the 1'-position linked to the nucleobase and the 3'- and 5'-positions linked to the internucleotide linkage.
[0094] [Chemical formula]
[0095] Having the structure of, and when at the 5'-end of an oligonucleotide (as understood by those skilled in the art), the 5'-position may be linked to a 5'-terminal group (e.g., -OH), and when at the 3'-end of an oligonucleotide, the 3'-position may be linked to a 3'-terminal group (e.g., -OH). In some embodiments, the sugar is the sugar of natural RNA (in an RNA nucleic acid or oligonucleotide), with the 1'-position linked to the nucleobase and the 3'- and 5'-positions linked to the internucleotide linkage.
[0096] [Chemical formula]
[0097] Having the structure, (as understood by those skilled in the art,) when at the 5'-end of the oligonucleotide, the 5'-position may be linked to a 5'-terminal group (e.g., -OH), and when at the 3'-end of the oligonucleotide, the 3'-position may be linked to a 3'-terminal group (e.g., -OH). In some embodiments, the sugar is a modified sugar that is not the sugar of natural DNA or natural RNA. In particular, the modified sugar may improve stability and / or affinity. In some embodiments, the modified sugar can be used to modify and / or optimize one or more hybridization properties. In some embodiments, the modified sugar can be used to modify and / or optimize target recognition. In some embodiments, the modified sugar can be used to optimize Tm. In some embodiments, the modified sugar can be used to improve oligonucleotide activity.
[0098] The sugar can be linked to the internucleotide bond at various positions. By way of non-limiting example, the internucleotide bond can be linked to the 2', 3', 4' or 5'-position of the sugar. As most commonly seen in natural nucleic acids, the internucleotide bond usually links one sugar at the 5'-position and another sugar at the 3'-position, unless otherwise specified.
[0099] In some embodiments, the sugar is an optionally substituted sugar of natural DNA or RNA. In some embodiments, the sugar is optionally substituted
[0100]
Chemical formula
[0101] is. In some embodiments, the 2'-position may be optionally substituted. In some embodiments, the sugar is
[0102]
Chemical formula
[0103] is. In some embodiments, the structure of the sugar is
[0104]
Chemical formula
[0105] (wherein R 1s 、R 2s 、R 3s 、R 4s and R 5s are each independently -H, a suitable substituent or a suitable sugar modification (e.g., those described in U.S. Patent Nos. 9,394,333; 9,744,183; 9,605,019; 9,982,257; U.S. Patent Application Publication Nos. 2017 / 037399; 2018 / 216108; 2018 / 216107; U.S. Patent No. 9,598,458; International Publication Nos. 2017 / 062862; 2018 / 067973; 2017 / 160741; 2017 / 192679; 2017 / 210647; 2018 / 098264; 2018 / 022473; 2018 / 223056; 2018 / 223073; 2018 / 223081; 2018 / 237194; 2019 / 032607; 2019 / 032612; 2019 / 055951 and / or 2019 / 075357, substituents, sugar modifications, R 1s 、R 2s 、R 3s 、R 4s and R 5s are incorporated herein by reference), and each modified sugar is independently incorporated herein by reference). In some embodiments, R 1s 、R 2s 、R 3s 、R 4s and R 5s are each independently -F, -Cl, -Br, -I, -CN, -N3, -NO, -NO2, -L s -R’, -L s -OR’, -L s -SR’, -L s -N(R’)2, -O-L s -OR’, -O-L s -SR’ or -O-L s -N(R’)2, where each R’ is independently -H, or C 1-10 aliphatic, C 6-1Aryl, C having 1 to 5 heteroatoms 1-10 Optionally substituted group selected from heteroaliphatic, 5- to 10-membered heteroaryl having 1 to 5 heteroatoms, and 3- to 10-membered heterocyclyl having 1 to 4 heteroatoms, or two or more R' groups, together with their intervening atoms, form an optionally substituted 3- to 10-membered ring having 0 to 5 heteroatoms in addition to the intervening atoms, and independently as described in the specification, L s is a covalent bond or optionally substituted divalent C 1-6 Aliphatic or heteroaliphatic having 1 to 4 heteroatoms. In some embodiments, the sugar structure is
[0106]
Chemical formula
[0107] is. In some embodiments, R 4s is -H. In some embodiments, the sugar structure is
[0108]
Chemical formula
[0109] (wherein R 2s is -H, halogen or -OR, and R is optionally substituted C 1-6 Aliphatic). In some embodiments, R 2s is -H. In some embodiments, R 2s is -F. In some embodiments, R 2s is -OMe. In some embodiments, R 2s is -OCH2CH2OMe.
[0110] In some embodiments, the sugar structure is
[0111]
Chemical formula
[0112] (wherein R2s and R 4s together form -L s - to form L s is a covalent bond or a divalent C that may be substituted 1-6 is aliphatic or heteroaliphatic having 1 to 4 heteroatoms). In some embodiments, the heteroatoms are each independently selected from nitrogen, oxygen, or sulfur. In some embodiments, L s is optionally substituted C2-O-CH2-C4. In some embodiments, L s is C2-O-CH2-C4. In some embodiments, L s is C2-O-(R)-CH(CH2CH3)-C4. In some embodiments, L s is C2-O-(S)-CH(CH2CH3)-C4.
[0113] In some embodiments, the modified sugar has at least one substituent independently selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR', or -N(R')2 at the 2'-position (usually one substituent, often in the axial position or R 2s ), where each R' is independently as described in this disclosure and, in some embodiments, is optionally substituted C 1-10 aliphatic; -O-(C1-C 10 alkyl), -S-(C1-C 10 alkyl), -NH-(C1-C 10 alkyl) or -N(C1-C 10 alkyl)2; -O-(C2-C 10 alkenyl), -S-(C2-C 10 alkenyl), -NH-(C2-C 10 alkenyl) or -N(C2-C 10 alkenyl)2; -O-(C2-C 10 alkynyl), -S-(C2-C 10 alkynyl), -NH-(C2-C 10 alkynyl) or -N(C2-C 10 alkynyl)2; or, -O-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), -O-(C1-C10 (alkylene)-NH-(C1-C 10 (alkyl), -O-(C1-C 10 (alkylene)-NH(C1-C 10 (alkyl)2, -NH-(C1-C 10 (alkylene)-O-(C1-C 10 (alkyl) or -N(C1-C 10 (alkyl)-(C1-C 10 (alkylene)-O-(C1-C 10 (alkyl), and alkyl, alkylene, alkenyl and alkynyl are each independently optionally substituted. In some embodiments, the substituent is -O(CH2) n OCH3, -O(CH2) n NH2, MOE, DMAOE or DMAEOE, and n is from 1 to about 10.
[0114] In some embodiments, the modified sugar is a sugar of natural RNA in which the 2'-OH is substituted with a group selected from -F, -CF3, -CN, -N3, -NO, -NO2, -OR', -SR' or -N(R')2, where each R' is independently as described in this disclosure, -O-(C1-C 10 (alkyl), -S-(C1-C 10 (alkyl), -NH-(C1-C 10 (alkyl) or -N(C1-C 10 (alkyl)2; -O-(C2-C 10 (alkenyl), -S-(C2-C 10 (alkenyl), -NH-(C2-C 10 (alkenyl) or -N(C2-C 10 (alkenyl)2; -O-(C2-C 10 (alkynyl), -S-(C2-C 10 (alkynyl), -NH-(C2-C 10 (alkynyl) or -N(C2-C 10 (alkynyl)2; or, -O-(C1-C 10 (alkylene)-O-(C1-C 10 (alkyl), -O-(C1-C 10 (alkylene)-NH-(C1-C 10 (alkyl), -O-(C1-C10 (alkylene)-NH(C1-C 10 alkyl)2, -NH-(C1-C 10 alkylene)-O-(C1-C 10 alkyl) or -N(C1-C 10 alkyl)-(C1-C 10 alkylene)-O-(C1-C 10 alkyl), and alkyl, alkylene, alkenyl, and alkynyl are each independently optionally substituted. In some embodiments, the 2'-OH is replaced by -H (deoxyribose). In some embodiments, the 2'-OH is replaced by -F. In some embodiments, the 2'-OH is replaced by -OR'. In some embodiments, the 2'-OH is replaced by -OMe. In some embodiments, the 2'-OH is replaced by -OCH2CH2OMe.
[0115] In some embodiments, the modification of the sugar is a 2'-modification. In some embodiments, the 2'-modification is a 2'-OR s modification. In some embodiments, R s is optionally substituted C 1-4 aliphatic. In some embodiments, R s is optionally substituted C 1-6 alkyl. In some embodiments, the modification is 2'-OMe. In some embodiments, the modification is 2'-MOE. In some embodiments, the 2'-modification is S-cEt. In some embodiments, the modified sugar is an LNA sugar. In some embodiments, the 2'-modification is -F.
[0116] In some embodiments, due to the modification of the sugar, the sugar moiety is replaced by another cyclic or acyclic moiety. Examples of such moieties are, for example, morpholino, glycol nucleic acid, PNA, etc., which are widely known in the art and may be used in this disclosure.
[0117] In some embodiments, one or more of the sugars of the oligonucleotide are independently modified. In some embodiments, the sugar of the oligonucleotide or a portion thereof (e.g., a wing) is independently modified. In some embodiments, the modified sugar has a 2'-modification. In some embodiments, the modified sugars each independently have a 2'-modification. In some embodiments, the 2'-modification is 2'-OR s where R s is an optionally substituted C 1-6 aliphatic. In some embodiments, the 2'-modification is a 2'-OMe modification. In some embodiments, the 2'-modification is a 2'-MOE modification. In some embodiments, the 2'-modification is a modification of an LNA sugar. In some embodiments, the 2'-modification is 2'-F. In some embodiments, the modification of the sugar is independently a 2'-modification. In some embodiments, the modification of the sugar is independently a 2'-OR s modification. In some embodiments, the modification of the sugar is independently a 2'-OR s where R s is an optionally substituted C 1-6 alkyl. In some embodiments, the modification of each sugar is 2'-OMe. In some embodiments, the modification of each sugar is 2'-MOE. In some embodiments, the modification of the sugar is independently 2'-OMe or 2'-MOE. In some embodiments, the modification of the sugar is independently 2'-OMe, 2'-MOE, or an LNA sugar.
[0118] As will be appreciated by those skilled in the art, modifications such as to the sugar, nucleobase, internucleotide linkage, etc. can be used in combination and are often used in oligonucleotides. For example, refer to the various oligonucleotides in Table 1.
[0119] In some embodiments, the sugar is described in U.S. Patent Nos. 9,394,333; 9,744,183; 9,605,019; 9,598,458; 9,982,257; 10,160,969; 10,479,995; U.S. Patent Application Publication Nos. 2020 / 0056173; 2018 / 0216107; 2019 / 0127733; U.S. Patent No. 10,450,568; U.S. Patent Application Publication Nos. 2019 / 0077817; 2019 / 0249173; 2019 / 0375774; International Publication Nos. 2018 / 223056; 2018 / 223073; 2018 / 223081; 2018 / 237194; 2019 / 032607; 2019 / 055951; 2019 / 075357; 2019 / 200185; 2019 / 217784 and / or 2019 / 032612, each of which is incorporated herein by reference.
[0120] Various other sugars useful in the manufacture of oligonucleotides or analogs thereof are known in the art and may be utilized in this disclosure.
[0121] Inter-nucleotide linkage In some embodiments, the oligonucleotide includes modifications of the base, the sugar, and / or the inter-nucleotide linkage. In this disclosure, various inter-nucleotide linkages can be utilized for the linkage of units containing nucleobases (e.g., nucleosides). In some embodiments, it includes one or more modified inter-nucleotide linkages and one or more natural phosphate linkages. As is widely known to those skilled in the art, natural phosphate linkages are widely found in natural DNA and RNA molecules; these have the structure -OP(O)(OH)O-, which link the sugars in the nucleosides of DNA and RNA and can be in various salt forms. For example, at physiological pH (about 7.4), the natural phosphate linkage has an anion of -OP(O)(O -)It mainly exists in the form of a salt that is O-. A modified nucleotide - nucleotide bond or a phosphate bond not found in nature is a nucleotide - nucleotide bond that is not a natural phosphate bond or its salt form. Depending on its structure, a modified nucleotide - nucleotide bond may be in the form of a salt. For example, as understood by those skilled in the art, a phosphorothioate nucleotide - nucleotide bond with the structure -OP(O)(SH)O- may be in various salt forms where the anion is -OP(O)(O - )O-.
[0122] In some embodiments, the oligonucleotide comprises nucleotide - nucleotide bonds that are modified nucleotide - nucleotide bonds (e.g., phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, thiophosphate, 3'-thiophosphate or 5'-thiophosphate).
[0123] In some embodiments, the internucleotide linkage is described in U.S. Patent Nos. 9,394,333; 9,744,183; 9,605,019; 9,598,458; 9,982,257; 10,160,969; 10,479,995; U.S. Patent Application Publication Nos. 2020 / 0056173; 2018 / 0216107; 2019 / 0127733; U.S. Patent No. 10,450,568; U.S. Patent Application Publication Nos. 2019 / 0077817; 2019 / 0249173; 2019 / 0375774; International Publication Nos. 2018 / 223056; 2018 / 223073; 2018 / 223081; 2018 / 237194; 2019 / 032607; 2019 / 055951; 2019 / 075357; 2019 / 200185; 2019 / 217784; and / or 2019 / 032612, and each internucleotide linkage is incorporated herein by reference.In some embodiments, the inter-nucleotide linkage is described in U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,938; 5,405,939; 5,434,257; 5,453,496; 5,455,233; 5,466,677; 5,466,677; 5,470,967; 5,476,925; 5,489,677; 5,519,126; 5,536,821; 5,541,307; 5,541,316; 5,550,111; 5,561,225; 5,563,253; 5,571,799; 5,587,361; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,625,050; 5,633,360; 5,645,62; 5,663,312; 5,677,437; 5,677,439; 6,160,109; 6,239,265; 6,028,188; 6,124,445; 6,169,170; 6,172,209; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029 or Re. 39,464, and each inter-nucleotide linkage is incorporated herein by reference.
[0124] In some embodiments, the oligonucleotide comprises one or more modified internucleotide linkages. In some embodiments, each of the modified internucleotide linkages is independently a phosphorothioate internucleotide linkage. In some embodiments, one or more of all the internucleotide linkages in the oligonucleotide, for example, about 1-20, 1-15, 1-10, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or about 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more are independently phosphorothioate internucleotide linkages. In some embodiments, about 10% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 25% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 50% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 60% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 70% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 75% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 80% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 85% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 90% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, about 95% or more of all the internucleotide linkages are independently phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages that bind to the sugars of natural DNA are each independently phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages in the oligonucleotide are each independently phosphorothioate internucleotide linkages.
[0125] In some embodiments, the oligonucleotide comprises one or more native phosphate linkages. In some embodiments, each native phosphate linkage independently binds to at least one modified sugar. In some embodiments, the sugar that binds to the native phosphate linkage is independently a modified sugar. In some embodiments, the sugar that binds to the native phosphate linkage is independently 2'-OR s a modified sugar or a bicyclic sugar (e.g., the sugar of LNA). In some embodiments, the sugar that binds to the native phosphate linkage is independently 2'-OR s a modified sugar. In some embodiments, the sugar that binds to the native phosphate linkage is independently a 2'-MOE modified sugar.
[0126] Wings and core In some embodiments, the oligonucleotide comprises or consists of a 5'-wing-core-wing-3' structure.
[0127] The wings and the core can independently be of various suitable lengths. In some embodiments, the number of nucleobases in a wing or the core can independently be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more. In some embodiments, each nucleobase independently includes a ring having at least one nitrogen ring atom, which may be monocyclic, bicyclic or polycyclic and may be substituted; in some embodiments, each nucleobase independently is an optionally substituted A, T, C, G or U, or a tautomer of an optionally substituted A, T, C, G or U. In some embodiments, the number of nucleobases in a wing is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some embodiments, the number of nucleobases in a wing is 1. In some embodiments, the number of nucleobases in a wing is 2. In some embodiments, the number of nucleobases in a wing is 3. In some embodiments, the number of nucleobases in a wing is 4. In some embodiments, the number of nucleobases in a wing is 5. In some embodiments, the number of nucleobases in a wing is 6. In some embodiments, the number of nucleobases in a wing is 7. In some embodiments, the number of nucleobases in a wing is 8. In some embodiments, the number of nucleobases in a wing is 9. In some embodiments, the number of nucleobases in a wing is 10. In some embodiments, the lengths of the two wings in the wing-core-wing structure are the same. In some embodiments, the lengths of the two wings are different. In some embodiments, the number of nucleobases in the core is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more. In some embodiments, the number of nucleobases in the core is about 5-15, for example, about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. In some embodiments, the number of nucleobases in the core is 1. In some embodiments, the number of nucleobases in the core is 2. In some embodiments, the number of nucleobases in the core is 3. In some embodiments, the number of nucleobases in the core is 4. In some embodiments, the number of nucleobases in the core is 5. In some embodiments, the number of nucleobases in the core is 6. In some embodiments, the number of nucleobases in the core is 7. In some embodiments, the number of nucleobases in the core is 8. In some embodiments, the number of nucleobases in the core is 9.In some embodiments, the number of nucleobases in the core is 10. In some embodiments, the number of nucleobases in the core is 11. In some embodiments, the number of nucleobases in the core is 12. In some embodiments, the number of nucleobases in the core is 13. In some embodiments, the number of nucleobases in the core is 14. In some embodiments, the number of nucleobases in the core is 15.
[0128] In some embodiments, the wing-core-wing is described as "X-Y-Z", where "X" represents the length of the 5' wing (number of nucleobases), "Y" represents the length of the core (number of nucleobases), and "Z" represents the length of the 3' wing (number of nucleobases). Examples of embodiments of X, Y, and Z are described as numerical values (e.g., as above) and include lengths exemplified by oligonucleotide species (e.g., Table 1). In some embodiments, the lengths of the two wings are the same or different, and / or the two wings have the same or different modifications or the same or different patterns of modifications. In some embodiments, Y is from 8 to 15. In some embodiments, X, Y, or Z can each independently be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more. In some embodiments, X, Y, and Z are each independently from 1 to 30. In some embodiments, X-Z-Z is 5-10-5, 5-10-4, 4-10-4, 4-10-3, 3-10-3, 2-10-2, 5-9-5, 5-9-4, 4-9-5, 5-8-5, 5-8-4, 4-8-5, 5-7-5, 4-7-5, 5-7-4 or 4-7-4.
[0129] In some embodiments, the wing contains one or more sugar modifications. In some embodiments, the sugars in the wing are each independently modified. In some embodiments, the sugars of the wing are each independently modified. In some embodiments, the modified sugars each independently include 2'-modifications (e.g., 2'-OR s modified sugars, sugars of LNA, etc.). In some embodiments, the sugars of the wing are each independently 2'-OR s modified sugars. In some embodiments, the modification of each sugar in the wing is the same. In some embodiments, the wing has different sugar modifications (e.g., different 2'-ORs includes a modification). In some embodiments, 2'-OR s is 2'-OMe. In some embodiments, 2'-OR s is 2'-MOE. In some embodiments, each sugar in the wing is a 2'-MOE modified sugar. In some embodiments, each sugar in the wing is a 2'-OMe modified sugar. In some embodiments, the wing includes one or more 2'-OMe modified sugars and one or more 2'-MOE modified sugars.
[0130] In some embodiments, the two wings of the wing-core-wing structure include different sugar modifications or patterns thereof.
[0131] In some embodiments, the modification of a particular sugar (e.g., 2'-MOE) is more stable than the modification of other sugars (e.g., 2'-OMe) or the sugar of natural DNA or RNA under certain conditions.
[0132] In some embodiments, the wing contains bicyclic sugars. In some embodiments, the bicyclic sugar is an LNA, cEt or BNA sugar.
[0133] In some embodiments, one or more of the internucleotide linkages that bind to the sugars of the 5'-wing are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages that bind to the sugars of the 5'-wing are each independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.
[0134] In some embodiments, one or more of the internucleotide linkages that bind to the sugars of the 3'-wing are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages that bind to the sugars of the 3'-wing are each independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.
[0135] In some embodiments, the core contains one or more, for example, about 1 to 20, 5 to 20, 6 to 20, 7 to 20, 8 to 20, 9 to 20, 10 to 20 or 5 to 15, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 natural DNA sugars. In some embodiments, the core contains two or more natural DNA sugars. In some embodiments, the core contains three or more natural DNA sugars. In some embodiments, the core contains four or more natural DNA sugars. In some embodiments, the core contains five or more natural DNA sugars. In some embodiments, the core contains six or more natural DNA sugars. In some embodiments, the core contains seven or more natural DNA sugars. In some embodiments, the core contains eight or more natural DNA sugars. In some embodiments, the core contains nine or more natural DNA sugars. In some embodiments, the core contains ten or more natural DNA sugars. In some embodiments, the core contains eleven or more natural DNA sugars. In some embodiments, the core contains twelve or more natural DNA sugars. In some embodiments, the core contains thirteen or more natural DNA sugars. In some embodiments, the core contains fourteen or more natural DNA sugars. In some embodiments, the core contains fifteen or more natural DNA sugars. In some embodiments, such DNA sugars are contiguous. In some embodiments, the sugars in the core are each independently natural DNA sugars.
[0136] In some embodiments, one or more of the internucleotide linkages that bind to the core sugar are each independently a modified internucleotide linkage. In some embodiments, they are each independently phosphorothioate internucleotide linkages. In some embodiments, the internucleotide linkages that bind to the core sugar are each independently a modified internucleotide linkage. In some embodiments, such internucleotide linkages are each independently phosphorothioate internucleotide linkages.
[0137] In some embodiments, the core hybridizes with the target mRNA to form a double-stranded structure recognizable by RNase H, enabling RNase H to cleave the mRNA.
[0138] Oligonucleotide In particular, this disclosure provides various oligonucleotides. As described herein, oligonucleotides may include various nucleic acid base modifications, sugar modifications, internucleotide linkages and their patterns. In some embodiments, this disclosure provides oligonucleotides as examples in Table 1.
[0139] [Table 1-1]
[0140] [Table 1-2]
[0141] [Table 1-3]
[0142] [Table 1-4]
[0143] [Table 1-5]
[0144] Note: Unless otherwise indicated, oligonucleotides are described in the 5' to 3' direction. As will be understood by those skilled in the art, the internucleotide linkage connects the 5' and 3' positions of the sugar. Unless otherwise indicated, (e.g., " * " represents a phosphorothioate internucleotide linkage) the internucleotide linkage is a natural phosphodiester bond. Unless otherwise indicated, each A, T, C, and G is deoxyadenosine, thymidine, deoxycytidine, and deoxyguanosine (as typically found in natural DNA). "2MOEr" indicates a 2'-MOE modification to the sugar; "5" indicates that the nucleoside has a 5'-OH group (when at the 5' terminus of the oligonucleotide); "3" indicates that the nucleoside has a 3'-OH group (when at the 3' terminus of the oligonucleotide); "i" indicates that the nucleoside is in the middle of the oligonucleotide and its 5' and 3' positions are linked by internucleotide linkages as described; "Me-dC" indicates 5-methyl-2'-deoxycytidine nucleoside. As will be understood by those skilled in the art, oligonucleotides can exist in various forms, including various salt forms.
[0145]
Chemical Structure
[0146]
Chemical Structure
[0147] In some embodiments, the provided oligonucleotide can hybridize to calpain 2 transcript. In some embodiments, the provided oligonucleotide can reduce the level of calpain 2 transcript or its product. In some embodiments, the provided oligonucleotide can reduce the level of calpain 2 mRNA. In some embodiments, the provided oligonucleotide can reduce the level of calpain 2 polypeptide. In some embodiments, the provided oligonucleotide can reduce the level of calpain 2 polypeptide activity observed in a system (e.g., sample, control, etc.). In some embodiments, the oligonucleotide is selected from Table 1. In some embodiments, the oligonucleotide is a pharmaceutically acceptable salt of the oligonucleotide selected from Table 1.
[0148] In some embodiments, this disclosure provides oligonucleotides that are particularly effective in reducing the level of calpain 2 transcript, polypeptide and / or activity.
[0149] In some embodiments, the structure of the oligonucleotide is / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * T * T * T * / iMe-dC / * T * G * T * A * G * G * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / or a salt thereof.
[0150] In some embodiments, the structure of the oligonucleotide is / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * A * / iMe-dC / * T * G * G * T * T * / iMe-dC / * A * G * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / or a salt thereof.
[0151] In some embodiments, the structure of the oligonucleotide is / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / * G * G * T * / iMe-dC / * A * G * G * / iMe-dC / * A * G * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / or a salt thereof.
[0152] In some embodiments, the structure of the oligonucleotide is / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / * T * T * T *T * T * G * / iMe-dC / * A * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / or a salt thereof.
[0153] In some embodiments, the structure of the oligonucleotide is / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * / iMe-dC / * T * G * T * G * / iMe-dC / * / iMe-dC / * T * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / or a salt thereof.
[0154] In some embodiments, this disclosure provides a composition comprising an oligonucleotide to be provided. In some embodiments, the oligonucleotide composition comprises the oligonucleotide to be provided or a salt thereof, as well as various diastereomers thereof and salts thereof. In some embodiments, the oligonucleotide composition comprises the oligonucleotide to be provided or a salt thereof, as well as various diastereomers and salts thereof for chiral linked phosphorus. In some embodiments, the oligonucleotide may exist in one or more forms. In some embodiments, the oligonucleotide in the composition exists in the form of a salt. In some embodiments, the oligonucleotide in the composition exists in one or more salt forms. In some embodiments, the salt form is a pharmaceutically acceptable salt form. In some embodiments, the salt form is a metal salt. In some embodiments, the salt form is an alkali metal salt. In some embodiments, the salt form is a sodium salt. In some embodiments, the salt form is a potassium salt. In some embodiments, the salt form is a calcium salt. In some embodiments, the salt form is an ammonium salt (e.g., N(R’)3 where R’ is as described herein; in some embodiments, each R’ is independently -H or optionally substituted C 1-6 alkyl). In some embodiments, the oligonucleotide composition is a liquid composition, where the oligonucleotide is dissolved in a solution. In some embodiments, the solution is a buffer. In some embodiments, the solution is buffered saline. In some embodiments, in the composition, acidic internucleotide linkages, (e.g., natural phosphate linkages), phosphorothioate internucleotide linkages independently exist in anionic form, and the composition contains one or more cations (e.g., Na + , K + , etc.)
[0155] Another chemical moiety In some embodiments, the oligonucleotide comprises one or more other chemical moieties. Various other chemical moieties (e.g., targeting moieties, carbohydrate moieties, lipid moieties, etc.) are known in the art and can be utilized in this disclosure to modulate the properties and / or activities of the oligonucleotide (e.g., stability, half-life, activity, delivery, pharmacodynamic properties, pharmacokinetic properties, etc.). In some embodiments, a particular other chemical moiety promotes delivery of the oligonucleotide to desirable cells, tissues, and / or organs including, but not limited to, cells of the central nervous system. In some embodiments, a particular other chemical moiety promotes internalization of the oligonucleotide. In some embodiments, a particular other chemical moiety increases the stability of the oligonucleotide. In some embodiments, this disclosure provides techniques for incorporating various other chemical moieties into oligonucleotides.
[0156] Particular other chemical moieties of interest are described in U.S. Pat. Nos. 9,394,333; 9,744,183; 9,605,019; 9,598,458; 9,982,257; 10,160,969; 10,479,995; U.S. Patent Application Publication Nos. 2020 / 0056173; 2018 / 0216107; 2019 / 0127733; U.S. Pat. No. 10,450,568; U.S. Patent Application Publication Nos. 2019 / 0077817; 2019 / 0249173; 2019 / 0375774; International Publication Nos. 2018 / 223056; 2018 / 223073; 2018 / 223081; 2018 / 237194; 2019 / 032607; 2019 / 055951; 2019 / 075357; 2019 / 200185; 2019 / 217784; and / or 2019 / 032612, each of which is incorporated herein by reference.
[0157] Manufacture In this technical field, oligonucleotides can be produced using various techniques and may be utilized in this disclosure. For example, in some embodiments, oligonucleotides are produced on a solid support using phosphoramidites. In some embodiments, oligonucleotides are produced in solution. In some embodiments, the production of oligonucleotides involves a number of cycles, and in each cycle, one or more (usually one) nucleoside units are added. In some embodiments, the cycles include coupling of phosphoramidites, protection of unreacted 5'-OH groups, modification (e.g., sulfurization) and / or deprotection of protected 5'-OH groups in the newly attached nucleosides. In some embodiments, after the oligonucleotide reaches a specific length, it can be modified at the end of the cycle.
[0158] The technologies for manufacturing oligonucleotides are described in U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,177,195; 5,023,243; 5,034,506; 5,166,315; 5,185,444; 5,188,897; 5,214,134; 5,216,141; 5,235,033; 5,264,423; 5,264,564; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,938; 5,405,939; 5,434,257; 5,453,496; 5,455,233; 5,466,677; 5,466,677; 5,470,967; 5,476,925; 5,489,677; 5,519,126; 5,536,821; 5,541,307; 5,541,316; 5,550,111; 5,561,225; 5,563,253; 5,571,799; 5,587,361; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,625,050; 5,633,360; 5,645,62; 5,663,312; 5,677,437; 5,677,439; 6,160,109; 6,239,265; 6,028,188; 6,124,445; 6,169,170; 6,172,209; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; RE39,464; 9,394,333; 9,744,183; 9,605,019; 9,598,458; 9,982,257; 10,160,969; 10,479,995; U.S. Patent Application Publication Nos. 2020 / 0056173; 2018 / 0216107; 2019 / 0127733; U.S. Patent No. 10,450,568; U.S. Patent Application Publication Nos. 2019 / 0077817; 2019 / 0249173;It is described in No. 2019 / 0375774, International Publication No. 2018 / 223056, No. 2018 / 223073, No. 2018 / 223081, No. 2018 / 237194, No. 2019 / 032607, No. 2019 / 055951, No. 2019 / 075357, No. 2019 / 200185, No. 2019 / 217784 or No. 2019 / 032612.,
[0159] In some embodiments, the oligonucleotide and / or composition is provided as a composition that is sterically random with respect to chiral linking phosphorus. For example, when using conventional phosphoramidites containing N,N - diisopropylamino groups and 2 - cyanoethyloxy groups in the synthesis of oligonucleotides, chiral linkages are formed without or with low stereoselectivity. In some embodiments, the oligonucleotide is provided as a mixture of various diastereomers and / or their salts. In some embodiments, the composition comprises an oligonucleotide and / or one or more or all of the diastereomers of its chiral linking phosphorus. In some embodiments, the oligonucleotide and / or its diastereomers are independently in one or more forms. In some embodiments, the oligonucleotide and / or its diastereomers are independently in the form of one or more salts (e.g., one or more pharmaceutically acceptable salts). In some embodiments, for each chiral linking phosphorus, both the Rp configuration and the Sp configuration are present in the composition. In some embodiments, for each chiral linking phosphorus, the ratio of both the Rp configuration and the Sp configuration is at least about 10%, 15%, 20%, 25%, 30%, 35%, 40% or 45%. In some embodiments, for chiral nucleotide linkages, the ratio of both the Rp configuration and the Sp configuration is about 50%. In some embodiments, for each chiral nucleotide linkage, the ratio of both the Rp configuration and the Sp configuration is about 50%. In some embodiments, for each chiral nucleotide linkage, the ratio of both the Rp configuration and the Sp configuration is about 20 - 80%. In some embodiments, for each chiral nucleotide linkage, the ratio of both the Rp configuration and the Sp configuration is about 30 - 70%. In some embodiments, for each chiral nucleotide linkage, the ratio of both the Rp configuration and the Sp configuration is about 40 - 60%. In some embodiments, for each chiral nucleotide linkage, the ratio of both the Rp configuration and the Sp configuration is about 45 - 55%. In some embodiments, for linking phosphorus, the Rp configuration is independently about 20 - 80%, 30 - 70%, 40 - 60% or 45 - 55%, or about 20%, 30%, 40%, 50%, 60%, 70% or 80%.
[0160] The amount, concentration, etc. of the oligonucleotides provided may be evaluated in this disclosure using various techniques such as UV (e.g., 260 nm), weight, etc. In some embodiments, the amount, concentration, etc. of all the oligonucleotides present in the composition are evaluated. In some embodiments, the amount, concentration, etc. include all forms including pharmaceutically acceptable salt forms, and all oligonucleotides sharing the same constitution (e.g., diastereomers for chiral bond phosphorus) are included.
[0161] Calpain 2 In some embodiments, calpain 2 (CAPN2) refers to genes or their gene products (e.g., nucleic acids (e.g., DNA, RNA, etc.), transcripts (e.g., calpain 2 mRNA), the proteins it encodes (e.g., calpain 2 polypeptide, etc.)) of species known as CAPN2, CANP2, CANPL2, mCANP, CANPml, calpain 2, calpain 2, m-calpain, millimolar-calpain, calpain M type, calpain 2 large subunit, calpain 2 (m / ll) large subunit, calpain large polypeptide L2, calpain 2 catalytic subunit, calcium-activated neural protease 2, CANP2, etc. Various CAPN2 sequences and their variants are readily available to those skilled in the art. Various techniques (e.g., assays, cells, model animals, etc.) have also been reported and can be used in this disclosure for the characterization and / or evaluation of the provided techniques (e.g., oligonucleotides, compositions, methods, etc.).
[0162] The CAPN2 gene has been reported to encode the calpain 2 protein, which, according to various reports, contains 622 or 700 amino acids depending on the isoform and is mainly localized in the cytoplasm and cell membrane of various tissues including the central nervous system (CNS). In some embodiments, human calpain 2, from the N-terminal region to the C-terminal region, comprises: (i) an α-helix; (ii) a CysPc domain containing a first protease core domain (PC1) and a second protease core domain (PC2); (iii) a calpain-type β-sandwich (CBSW) domain; and (iv) a penta-EF hand (PEF(L)) domain of the catalytic large subunit, and is reported to contain a plurality of domains. The calpain 2 proteins of other species (e.g., monkey, rat, and mouse) have been reported to contain various conserved domains similar to human calpain 2.
[0163] Calpain 2 belongs to the family of calcium-dependent proteases and has been reported to cleave a number of protein targets including, for example, actin, cytoplasmic polyadenylation element binding protein 3 (CPEB3), p35, phosphatase and tensin homolog deleted on chromosome 10 (PTEN), protein tyrosine phosphatase (PTPN13; also known as Fas-associated protein 1 (FAP1)), spectrin, TDP-43, neurofilament light chain (Wang et al., Expert Opin. Ther. Targets, 2018; Baudry, Curr. Neuropharmacol., 2019). Activation of calpain 2 requires a relatively high concentration of calcium ions (Ca 2+) has been reported to be involved, and the reported range is an amount close to millimolar, for example, 400 - 800 μM. Furthermore, several studies have suggested that calpain 2 may be activated by phosphorylation by epidermal growth factor (EGF) or brain-derived neurotrophic factor (BDNF) via extracellular signal-regulated kinase (ERK) (Glading et al., Mol. Cell Biol., 2004; Zadran et al., J. Neurosci., 2010). Calpain 2 is a regulator of synaptic plasticity and has been reported to perhaps limit such plasticity (Baudry and Bi, Trends Neurosci., 2017), and has been reported to be involved in excitotoxicity, and inhibition of calpain 2 reduces such toxicity (Wang et al., J. Neurosci., 2013).
[0164] Dysregulation of calpain 2 has been reported to be associated with various forms of neurodegeneration. Calpain 2 is involved in neurodegenerative conditions, disorders or diseases, including amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), etc. In another neurodegenerative disease, Wolfram syndrome (WS), it has been reported that excessive activation of calpain 2 and calpain 2-related cell death are involved (Lu et al., Proc. Natl. Acad. Sci., 2014). Inhibition of calpain 2 has been reported as a potential target for treating acute nerve injury in addition to progressive neurodegenerative diseases (Wang et al., Expert Opin. Ther. Targets, 2018). In several studies, it has been reported that in a mouse model of traumatic brain injury (TBI), deletion or inhibition of calpain 2 improves neuropathological features, indicating that calpain 2 is involved in TBI (Wang et al., Sci. Adv., 2020). As reported, inhibition of calpain 2 may improve the localization of TDP-43 in TBI; here, TDP-43 has been reported to form inclusions in certain neurodegenerations (Gao et al., J. Neurochem., 2018). Therefore, calpain 2 has the potential to be a therapeutic target for both progressive neurodegenerative diseases and acute nerve injury.
[0165] CAPN2-related conditions, disorders or diseases Various conditions, disorders or diseases have been reported to be associated with calpain 2 and may be preventable or treatable by this disclosure. Generally, a condition, disorder or disease is related to calpain 2 if the presence, level, activity and / or form of calpain 2 and / or its products (e.g., transcripts, encoded proteins, etc.) correlates with the incidence of the disease, disorder or condition, and / or the susceptibility to the disease, disorder or condition (e.g., in the relevant population as a whole). In some embodiments, conditions, disorders or diseases related to calpain 2 can be treated and / or prevented by reducing the expression, level and / or activity of calpain 2 transcripts and / or proteins.
[0166] In particular, this disclosure provides techniques for preventing and / or treating various conditions, disorders, or diseases. In some embodiments, the condition, disorder, or disease is a neurodegenerative disease. In some embodiments, the condition, disorder, or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder, or disease is traumatic brain injury (TBI). In some embodiments, the condition, disorder, or disease is Alzheimer's disease (AD). In some embodiments, the condition, disorder, or disease is Parkinson's disease (PD). In some embodiments, the condition, disorder, or disease is frontotemporal dementia (FTD). In some embodiments, the condition, disorder, or disease is progressive supranuclear palsy (PSP). In some embodiments, the condition, disorder, or disease is corticobasal degeneration (CBD). In some embodiments, the condition, disorder, or disease is Wolfram syndrome (WS). In some embodiments, the condition, disorder, or disease is Friedreich's ataxia (FRDA). In some embodiments, the condition, disorder, or disease is multiple system atrophy (MSA). In some embodiments, the condition, disorder, or disease is spinocerebellar ataxia (SCA). In some embodiments, the condition, disorder, or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder, or disease is Pick's disease (PD). In some embodiments, the condition, disorder, or disease is progressive muscular atrophy. In some embodiments, the condition, disorder, or disease is concussion. In some embodiments, the condition, disorder, or disease is spinal cord injury (SCI). In some embodiments, the condition, disorder, or disease is chronic traumatic encephalopathy (CTE). In some embodiments, the condition, disorder, or disease is epilepsy. In some embodiments, the condition, disorder, or disease is stroke. In some embodiments, the condition, disorder, or disease is intracerebral hemorrhage. In some embodiments, the condition, disorder, or disease is tauopathy. In some embodiments, the condition, disorder, or disease is related to Wallerian degeneration. In some embodiments, the condition, disorder, or disease is acute glaucoma. In some embodiments, the condition, disorder, or disease is cancer. In some embodiments, the condition, disorder, or disease is diabetes. In some embodiments, the condition, disorder, or disease is chemotherapy-induced peripheral neuropathy.
[0167] Characterization and Evaluation In some embodiments, the characteristics and / or activities of the provided oligonucleotides and their compositions can be characterized and / or evaluated using a variety of techniques available to those of skill in the art (e.g., biochemical assays (e.g., RNase H assays), cell-based assays, model animals, clinical trials, etc.). Useful techniques are described in the examples. Those of skill in the art upon exposure to this disclosure will readily appreciate that other techniques (e.g., in vitro models (e.g., cell lines) for various conditions, disorders or diseases, model animals for various conditions, disorders or diseases, clinical trials, etc.) may be designed and / or utilized to evaluate the techniques (e.g., oligonucleotides, compositions, methods, etc.) provided in this disclosure.
[0168] Biological Applications As will be appreciated by those of skill in the art, oligonucleotides are useful for a variety of purposes. In some embodiments, the techniques provided (e.g., oligonucleotides, compositions, methods, etc.) are useful for reducing the levels and / or activities of various calpain 2 transcripts (e.g., RNA) and / or the products (e.g., proteins) they encode. In some embodiments, the techniques provided reduce the levels and / or activities of calpain 2 RNA transcripts. In some embodiments, the provided oligonucleotides and compositions provide knockdown of calpain 2 mRNA. In some embodiments, the techniques provided result in a decrease in the level of calpain 2 polypeptide. In some embodiments, the techniques provided result in a decrease in the level of the activity (e.g., protease activity) of calpain 2.
[0169] In some aspects, this disclosure provides a method of reducing the level of calpain 2 mRNA in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some aspects, this disclosure provides a method of reducing the level of calpain 2 polypeptide in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some aspects, this disclosure provides a method of reducing the level of calpain 2 activity in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some aspects, this disclosure provides a method of reducing the level of calpain 2 protease activity in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition. In some aspects, the reduction in the level of calpain 2 mRNA and / or polypeptide increases the level of the mRNA and / or polypeptide of the target of calpain 2. In some aspects, the reduction in the level of calpain 2 mRNA and / or polypeptide increases the level of the mRNA and / or polypeptide of calpastatin. In some aspects, this disclosure provides a technique for increasing the level of calpastatin mRNA and / or polypeptide in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition that targets calpain 2. Calpain 2 has been reported to interact with various partners (e.g., TDP43, other ALS biomarkers). In some aspects, this disclosure provides a technique for modulating the interaction between calpain 2 and its partners. In some aspects, this disclosure provides a technique for modulating the interaction between calpain 2 and its partners in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or oligonucleotide composition that targets calpain 2.
[0170] In some aspects, the system comprises calpain 2 mRNA. In some aspects, the system expresses calpain 2 mRNA. In some aspects, the system expresses calpain 2 polypeptide.
[0171] In some embodiments, the system is an in vitro system. In some embodiments, the system is an in vivo system.
[0172] In some embodiments, the system includes cells. In some embodiments, the system is cells. In some embodiments, the system includes a population of cells. In some embodiments, the system is a population of cells. In some embodiments, the cells are neurons. In some embodiments, the cells are cells of the nervous system. In some embodiments, the cells are cells of the CNS. In some embodiments, the cells have one or more characteristics, properties, and / or activities of neurons.
[0173] In some embodiments, the system is tissue. In some embodiments, the system includes tissue. In some embodiments, the system is an organ. In some embodiments, the system includes an organ. In some embodiments, the system is the brain or a part thereof. In some embodiments, the system includes the brain or a part thereof. In some embodiments, the system is an organism. In some embodiments, the system includes an organism. In some embodiments, the system is a subject. In some embodiments, the system is a mammal, such as a mouse, rat, monkey, etc. In some embodiments, the system is a human.
[0174] In some embodiments, in the absence of the provided oligonucleotide or composition and / or as compared to the presence of a reference oligonucleotide or composition, the level is reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95%. In some embodiments, such reduction is achieved at a particular oligonucleotide concentration (e.g., 1 nM, 5 nM, 10 nM, 100 nM, 500 nM, 1 μM, 5 μM, etc.) or dose. In some embodiments, such reduction is achieved in a system such as various suitable assays (e.g., in vitro cell-based assays, assays described in the Examples, etc.). In some embodiments, the reference composition does not contain an oligonucleotide targeting calpain 2. In some embodiments, the reference oligonucleotide targets a nucleic acid different from calpain 2. In some embodiments, the level is the level of mRNA (e.g., calpain 2 mRNA). In some embodiments, the level is the level of a polypeptide (e.g., calpain 2 protein). In some embodiments, the level is reduced by at least about 10%. In some embodiments, the level is reduced by at least about 20%. In some embodiments, the level is reduced by at least about 30%. In some embodiments, the level is reduced by at least about 40%. In some embodiments, the level is reduced by at least about 50%. In some embodiments, the level is reduced by at least about 60%. In some embodiments, the level is reduced by at least about 70%. In some embodiments, the level is reduced by at least about 75%. In some embodiments, the level is reduced by at least about 80%. In some embodiments, the level is reduced by at least about 85%. In some embodiments, the level is reduced by at least about 90%. In some embodiments, the level is reduced by at least about 95%.In some embodiments, when evaluated using, for example, the assays of the examples, when the oligonucleotide is about 20 μM, the level of calpain 2 mRNA is reduced by about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% or more; in some embodiments, when the oligonucleotide is about 15 μM, it is reduced by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85% or 90% or more; in some embodiments, when the oligonucleotide is about 10 μM, it is reduced by about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% or more; in some embodiments, when the oligonucleotide is about 5 μM, it is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% or more; in some embodiments, when the oligonucleotide is about 2.5 μM, it is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60% or more; in some embodiments, when the oligonucleotide is about 1.25 μM, it is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% or 60% or more; in some embodiments, when the oligonucleotide is about 0.63 μM, it is reduced by about 10%, 15%, 20%, 25%, 30%, 35% or 40% or more; and, in some embodiments, when the oligonucleotide is about 0.32 μM, it is reduced by about 10%, 15%, 20%, 25% or 30% or more. In some embodiments, the reduction rate is about 50% or more. In some embodiments, the reduction rate is about 55% or more. In some embodiments, the reduction rate is about 60% or more. In some embodiments, the reduction rate is about 65% or more. In some embodiments, the reduction rate is about 70% or more. In some embodiments, the reduction rate is about 75% or more. In some embodiments, the reduction rate is about 80% or more. In some embodiments, the reduction rate is about 85% or more. In some embodiments, the reduction rate is about 90% or more. In some embodiments, the reduction rate is about 95% or more. In some embodiments, the reduction is evaluated about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days, or about 1, 2, 3 or 4 weeks or more after administration or delivery of the provided oligonucleotide or composition.In some embodiments, the reduction in the removal or washout of the provided oligonucleotide or composition is evaluated after about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks or more have elapsed. In some embodiments, the reduction is evaluated on day 0. In some embodiments, the reduction is evaluated on about day 3. In some embodiments, the reduction is evaluated on about day 10. In some embodiments, the reduction is evaluated on about day 14. In some embodiments, the reduction is evaluated on about day 21. In some embodiments, the rate of reduction in one or more evaluations, such as the calpain mRNA level, is independently about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more; in some embodiments, the rate of reduction is independently 75% or more; in some embodiments, the rate of reduction is about 80% or more. In some embodiments, the rate of reduction in one or more evaluations, such as the calpain 2 protein or activity, is independently about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% or more; in some embodiments, the rate of reduction is about 20% or more; in some embodiments, the rate of reduction is about 25% or more; in some embodiments, the rate of reduction is about 30% or more; in some embodiments, the rate of reduction is about 35% or more; in some embodiments, the rate of reduction is about 40% or more; in some embodiments, the rate of reduction is about 45% or more; in some embodiments, the rate of reduction is about 50% or more; in some embodiments, the rate of reduction is about 55% or more; in some embodiments, the rate of reduction is about 60% or more; in some embodiments, the rate of reduction is about 70% or more. In some embodiments, the reduction is compared to the case where the oligonucleotide is absent. In some embodiments, the reduction is compared to the case where a reference oligonucleotide or composition, such as an oligonucleotide targeting TUG1 described in the specification, is present. In some embodiments, the evaluation is performed according to that described in the examples, for example, in some embodiments, using iPSC-derived motor neurons with a gymnotic delivery of an oligonucleotide concentration of about 20 μM.
[0175] In some embodiments, the activity of the provided oligonucleotide or oligonucleotide composition may be evaluated by, for example, an IC50 at a concentration that reduces the levels, such as calpain 2 mRNA, polypeptide, activity, etc., by 50% under appropriate conditions, such as cell-based in vitro assays, the assays described in the examples. In some embodiments, the IC50 of the provided oligonucleotide or composition is about 0.001, 0.01, 0.1, 0.5, 1, 2, 5, 10, 50, 100, 200, 500, 1000, 2000, 5000, or 10000 nM or less. In some embodiments, the IC50 of the oligonucleotide is about 10000 nM or less. In some embodiments, the IC50 of the oligonucleotide is about 5000 nM or less. In some embodiments, the IC50 of the oligonucleotide is about 2000 nM or less. In some embodiments, the IC50 of the oligonucleotide is about 1000 nM or less. In some embodiments, the IC50 is about 500 nM or less. In some embodiments, the IC50 is about 200 nM or less. In some embodiments, the IC50 is about 100 nM or less. In some embodiments, the IC50 is about 50 nM or less. In some embodiments, the IC50 is about 20 nM or less. In some embodiments, the IC50 is about 10 nM or less. In some embodiments, the IC50 is about 5 nM or less. In some embodiments, the IC50 is about 2 nM or less. In some embodiments, the IC50 is about 1 nM or less.
[0176] In some embodiments, the provided oligonucleotide and composition are useful for treating various conditions, disorders, or diseases by reducing the levels and / or activity of calpain 2 transcripts and / or the products they encode that are associated with the condition, disorder, or disease.
[0177] In some embodiments, this disclosure provides a method of preventing a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the oligonucleotide or composition of this disclosure to a susceptible subject. In some embodiments, this disclosure provides a method of treating a condition, disorder, or disease, the method comprising administering or delivering an effective amount of the oligonucleotide or composition of this disclosure to a subject suffering therefrom.
[0178] Various conditions, disorders or diseases associated with calpain 2 may be preventable or treatable with the technology provided. In some embodiments, the subject benefits from a decrease in the level of calpain 2 transcript, polypeptide and / or activity in certain cells, tissues and / or organs.
[0179] In some embodiments, the condition, disorder or disease is a neurodegenerative condition, disorder or disease. In some embodiments, the condition, disorder or disease is Wallerian degeneration or includes Wallerian degeneration. In some embodiments, Wallerian degeneration is associated with injury. In some embodiments, Wallerian degeneration is associated with stress. In some embodiments, the condition, disorder or disease is associated with Wallerian degeneration. In some embodiments, the condition, disorder or disease is amyotrophic lateral sclerosis (ALS). In some embodiments, the condition, disorder or disease is a neuropathy. In some embodiments, the condition, disorder or disease is a peripheral neuropathy. In some embodiments, the condition, disorder or disease is chemotherapy-induced peripheral neuropathy. In some embodiments, the condition, disorder or disease is Parkinson's disease. In some embodiments, the condition, disorder or disease is Huntington's disease. In some embodiments, the condition, disorder or disease is Alzheimer's disease. In some embodiments, the condition, disorder or disease is frontotemporal dementia. In some embodiments, the condition, disorder or disease is a brain injury. In some embodiments, the condition, disorder or disease is a traumatic brain injury. In some embodiments, the condition, disorder or disease is progressive supranuclear palsy. In some embodiments, the condition, disorder or disease is corticobasal degeneration. In some embodiments, the condition, disorder or disease is Wolfram syndrome. In some embodiments, the condition, disorder or disease is Friedreich's ataxia. In some embodiments, the condition, disorder or disease is multiple system atrophy. In some embodiments, the condition, disorder or disease is spinocerebellar ataxia. In some embodiments, the condition, disorder or disease is spinal muscular atrophy (SMA). In some embodiments, the condition, disorder or disease is Pick's disease. In some embodiments, the condition, disorder or disease is progressive muscular atrophy. In some embodiments, the condition, disorder or disease is associated with nerve injury. In some embodiments, the condition, disorder or disease is associated with nerve cell injury. In some embodiments, the condition, disorder or disease is associated with nerve cell death. In some embodiments, the condition, disorder or disease is axonal degeneration. In some embodiments, axonal degeneration is ALS.
[0180] Various techniques can be utilized for the administration or delivery of the provided oligonucleotide or composition. In some embodiments, the oligonucleotide or composition is administered or delivered orally. In some embodiments, the oligonucleotide or composition is administered or delivered via a parenteral route. In some embodiments, parenteral routes include intravenous, intraarterial, intramuscular, intradermal, subcutaneous, intranasal, and intraperitoneal routes. In some embodiments, the oligonucleotide or composition is administered or delivered via an intravitreal, intraorbital, subconjunctival, intravitreal, subretinal, transscleral, or intratympanic route. In some embodiments, the oligonucleotide or composition is administered or delivered parenterally. In some embodiments, the oligonucleotide or composition is administered or delivered intrathecally. In some embodiments, the oligonucleotide or composition is administered or delivered intravenously. In some embodiments, the oligonucleotide is administered or delivered as a liquid composition. In some embodiments, the oligonucleotide is dissolved in a liquid (e.g., buffered saline such as aCSF) for administration or delivery.
[0181] In some embodiments, the oligonucleotide or composition may be utilized in combination with another therapy (e.g., another therapeutic agent).
[0182] In some embodiments, the provided techniques (e.g., oligonucleotides, compositions, methods, etc.) delay or prevent the onset of one or more symptoms and / or characteristics of a condition, disorder, or disease. In some embodiments, the provided techniques delay, retard, or prevent the progression of a condition, disorder, or disease with respect to its onset. In some embodiments, the provided techniques reduce, improve, alleviate, arrest, prevent, delay the onset of, reduce the severity of, and / or decrease the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition. In some embodiments, the provided techniques improve the performance of a subject in one or more assessments. In some embodiments, the provided techniques improve the performance of a subject in one or more clinical assessments. In some embodiments, the provided techniques independently improve the results of one or more clinical assessments of a subject.
[0183] Pharmaceutical composition In some embodiments, this disclosure provides a pharmaceutical composition comprising a provided compound (e.g., an oligonucleotide) or a pharmaceutically acceptable salt thereof, and a pharmaceutical carrier. In some embodiments, for example, for therapeutic and clinical purposes, the oligonucleotides of this disclosure are provided as a pharmaceutical composition.
[0184] As will be appreciated by those skilled in the art, oligonucleotides can be provided in a variety of forms. In some embodiments, the oligonucleotide can be in acid form, for example, in the form of -OP(O)(OH)O- for natural phosphate linkages; in the form of -OP(O)(SH)O- for phosphorothioate nucleotide linkages; etc. In some embodiments, the provided oligonucleotide can be in salt form, for example, in the form of the sodium salt of -OP(O)(ONa)O- for natural phosphate linkages; in the form of the sodium salt of -OP(O)(SNa)O- for phosphorothioate nucleotide linkages; etc. Unless otherwise specifically noted, the oligonucleotides of this disclosure can exist in acid, base, and / or salt forms. In some embodiments, the composition comprises one or more forms of the oligonucleotide. In some embodiments, the composition comprises one or more salt forms of the oligonucleotide. In some embodiments, the composition comprises one or more pharmaceutically acceptable salt forms of the oligonucleotide.
[0185] When used as a therapeutic agent, the provided oligonucleotide or composition is typically administered as a pharmaceutical composition. In some embodiments, the pharmaceutical composition is suitable for administering or delivering the oligonucleotide to a body region or portion affected by a condition, disorder, or disease. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the provided oligonucleotide or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of oligonucleotides that are diastereomers of each other, and the oligonucleotides exist in one or more forms. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of oligonucleotides that are diastereomers of each other with respect to chiral linked phosphorus, and the oligonucleotides exist in one or more forms.
[0186] In some embodiments, the pharmaceutically acceptable carrier is a buffer solution. In some embodiments, the pharmaceutically acceptable carrier is buffered saline. In some embodiments, the pharmaceutically acceptable carrier is artificial cerebrospinal fluid. In some embodiments, the composition is a liquid composition comprising a dissolved oligonucleotide.
[0187] In some embodiments, the pharmaceutical composition is formulated for intravenous injection, oral administration, buccal administration, inhalation, nasal administration, topical administration, administration to the eye or administration to the ear. In some embodiments, the pharmaceutical composition is a tablet, pill, capsule, liquid, inhalant, nasal spray solution, suppository, suspension, gel, colloid, dispersion, suspension, solution, emulsion, ointment, lotion, eye drop or ear drop. In some embodiments, the pharmaceutical composition is formulated for intrathecal administration.
[0188] As will be appreciated by those skilled in the art, oligonucleotides can exist as various salts. In some embodiments, the salt is a pharmaceutically acceptable salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (in salt form if desired) and a sodium salt. In some embodiments, the pharmaceutical composition comprises an oligonucleotide (in salt form if desired) and sodium chloride. In some embodiments, each hydrogen ion of the oligonucleotide that may be donated to a base (e.g., under conditions such as in an aqueous solution, a pharmaceutical composition, etc.) is replaced with a cation other than H+. For example, in some embodiments, the pharmaceutically acceptable salts of the oligonucleotide are all metal ions, and each hydrogen ion (e.g., -OH, -SH, etc.) of each internucleotide bond (e.g., natural phosphate bond, phosphorothioate internucleotide bond, etc.) is replaced with a metal ion. Various metal salts suitable for pharmaceutical compositions are well known in the art and can be utilized in this disclosure. In some embodiments, the pharmaceutically acceptable salt is a sodium salt. In some embodiments, the pharmaceutically acceptable salt is a magnesium salt. In some embodiments, the pharmaceutically acceptable salt is a calcium salt. In some embodiments, the pharmaceutically acceptable salt is a potassium salt. In some embodiments, the pharmaceutically acceptable salt is an ammonium salt (cation N(R’)4 +) is. In some embodiments, the pharmaceutically acceptable salt contains one cation. In some embodiments, the pharmaceutically acceptable salt contains two or more cations. In some embodiments, the cation is Li + , Na + , K + , Mg 2+ or Ca 2+ . In some embodiments, the pharmaceutically acceptable salts are all sodium salts. In some embodiments, the pharmaceutically acceptable salts are all sodium salts, and each internucleotide bond that is a native phosphate bond (acid form -O-P(O)(OH)-O-) is, if present, present in the form of its sodium salt (-O-P(O)(ONa)-O-), and each internucleotide bond that is a phosphorothioate internucleotide bond (acid form -O-P(O)(SH)-O-) is, if present, present in the form of its sodium salt (-O-P(O)(SNa)-O-).
[0189] In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is provided as a solid. In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is lyophilized.
[0190] In some embodiments, the oligonucleotide or composition (e.g., pharmaceutical composition) is stored at a temperature lower than room temperature, such as about -78, -20, 0, 4 or 10 °C or lower.
[0191] Various techniques for delivering nucleic acids and / or oligonucleotides are known in the art and can be utilized in this disclosure. For example, various supramolecular nanocarriers can be used to deliver nucleic acids. Examples of nanocarriers include liposomes, cationic polymer complexes, and various polymeric compounds. Complex formation between nucleic acids and various polycations is another method for delivery into cells and includes the use of PEGylated polycations, polyethyleneimine (PEI) complexes, cationic block copolymers, and dendrimers. Some cationic nanocarriers, including PEI and polyamidoamine dendrimers, may assist in the release of the contents from endosomes. Other methods may include the use of polymeric nanoparticles, microspheres, liposomes, dendrimers, biodegradable polymers, complexes, prodrugs, inorganic colloids such as sulfur and iron, antibodies, implants, biodegradable implants, biodegradable microspheres, osmotic control implants, lipid nanoparticles, emulsions, oily solutions, aqueous solutions, biodegradable polymers, poly(lactic-co-glycolic acid), poly(lactic acid), liquid depot, polymeric micelles, quantum dots, and lipoplexes. In some embodiments, the oligonucleotide binds to other molecules.
[0192] In some embodiments, the oligonucleotide is administered or delivered by dimnosis uptake.
[0193] In some embodiments, the oligonucleotide or composition is formulated for various methods of administration, including systemic, topical, or localized administration. Techniques and formulations are generally described in Remington, The Science and Practice of Pharmacy (20th ed. 2000).
[0194] In certain embodiments, the oligonucleotide or composition is delivered to the CNS. In certain embodiments, the oligonucleotide and composition are delivered to the cerebrospinal fluid. In certain embodiments, the oligonucleotide and composition are delivered to the brain parenchyma. In certain embodiments, the oligonucleotide and composition are delivered to an animal / subject by intrathecal or intracerebroventricular administration. A broad distribution of the oligonucleotide and composition may be achieved by administration methods described in the specification and / or known in the art.
[0195] In certain embodiments, parenteral administration is by injection, for example, using a syringe, pump, etc. In certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is performed directly into a tissue or site such as the cerebrospinal fluid, striatum, caudate nucleus, cortex, hippocampus, and / or cerebellum.
[0196] The oligonucleotides and their compositions provided are effective at a wide range of doses. In some embodiments, the dose is about 0.01 to about 1000 mg, about 0.5 to about 100 mg, about 1 to about 50 mg, or about 5 to about 100 mg. The exact dose may depend on the route of administration, the form of the oligonucleotide, the subject (e.g., weight, age, body surface area, etc.), the condition, disorder or disease, and / or the preference and experience of the physician. In some embodiments, a fixed dose is administered. In some embodiments, the oligonucleotide or composition provided is administered or delivered, for example, by injection or infusion, once a week, once every two weeks, monthly, every two months, every 90 days, every three months, every six months, every nine months, or once a year. In some embodiments, two or more doses are substantially the same. In some embodiments, one or more doses are independently higher than one or more other doses. For example, in some embodiments, one or more high-dose loading doses, each independently, are administered before one or more low-dose maintenance doses, each independently. In some embodiments, two or more or all of the loading doses are substantially the same. In some embodiments, a loading dose is higher than another loading dose. In some embodiments, two or more or all of the maintenance doses are substantially the same. In some embodiments, a maintenance dose is higher than another maintenance dose.
[0197] Exemplary embodiments In particular, this disclosure provides the following exemplary embodiments. 1. An oligonucleotide, wherein the base sequence contains 10 or more consecutive nucleic acid bases of ATCAGTTTCTGTAGGCTTCC (wherein T is independently replaced by U as necessary), and contains a modified nucleic acid base, a modified sugar, or a modified nucleotide linkage, oligonucleotide. 2. The oligonucleotide according to embodiment 1, wherein the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC. 3. An oligonucleotide, wherein the base sequence contains 10 or more consecutive nucleic acid bases of GGCATACTGGTTCAGTTGAT (wherein T is independently replaced by U as necessary), and contains a modified nucleic acid base, a modified sugar, or a modified nucleotide linkage, oligonucleotide. 4. The oligonucleotide according to embodiment 3, wherein the base sequence of the oligonucleotide is GGCATACTGGTTCAGTTGAT. 5. An oligonucleotide, wherein the base sequence contains 10 or more consecutive nucleic acid bases of GCTCAGGTCAGGCAGTGGTT (wherein T is independently replaced by U as necessary), and contains a modified nucleic acid base, a modified sugar, or a modified nucleotide linkage, oligonucleotide. 6. The oligonucleotide according to embodiment 5, wherein the base sequence of the oligonucleotide is GCTCAGGTCAGGCAGTGGTT. 7. An oligonucleotide, wherein the base sequence contains 10 or more consecutive nucleic acid bases of GAGAGCCTTTTTGCAGAGCT (wherein T is independently replaced by U as necessary), and contains a modified nucleic acid base, a modified sugar, or a modified nucleotide linkage, oligonucleotide. 8. The oligonucleotide according to aspect 7, wherein the base sequence of the oligonucleotide is GAGAGCCTTTTTGCAGAGCT. 9. An oligonucleotide, the base sequence of which contains 10 or more consecutive nucleobases of TCCAGCTCTGTGCCTCTAGT (wherein T is independently replaced by U as necessary), and contains a modified nucleobase, a modified sugar or a modified internucleotide linkage. Oligonucleotide. 10. The oligonucleotide according to aspect 9, wherein the base sequence of the oligonucleotide is TCCAGCTCTGTGCCTCTAGT. 11. An oligonucleotide, the base sequence of which contains 10 or more consecutive nucleobases of GTTCCAGCTTGGGCAGTTGT (wherein T is independently replaced by U as necessary), and contains a modified nucleobase, a modified sugar or a modified internucleotide linkage. Oligonucleotide. 12. The oligonucleotide according to aspect 11, wherein the base sequence of the oligonucleotide is GTTCCAGCTTGGGCAGTTGT. 13. An oligonucleotide, the base sequence of which contains 10 or more consecutive nucleobases of GGAAGCTTAGTCCTTGGCTG (wherein T is independently replaced by U as necessary), and contains a modified nucleobase, a modified sugar or a modified internucleotide linkage. Oligonucleotide. 14. The oligonucleotide according to aspect 13, wherein the base sequence of the oligonucleotide is GGAAGCTTAGTCCTTGGCTG. 15. The oligonucleotide according to any one of the preceding aspects, wherein the oligonucleotide contains a 5'-wing-gap-wing-3' structure. 16. The oligonucleotide according to any one of the preceding aspects, wherein the number of nucleosides in the 5'-wing is about 3 to 10. 17. The oligonucleotide according to any one of the preceding aspects, wherein the number of nucleosides in the 5'-wing is 5. 18. The oligonucleotide according to any one of the preceding aspects, wherein the sugars in the 5'-wing are each independently a modified sugar. 19. The sugar in the 5'-wing is 2'-OR s a modified sugar, and R s is C 1-6 is aliphatic. The oligonucleotide according to any one of the preceding aspects. 20. The oligonucleotide according to any one of the preceding aspects, wherein the sugar in the 5'-wing is a 2'-MOE modified sugar. 21. The oligonucleotide according to any one of the preceding aspects, wherein the sugar in the 5'-wing is a 2'-OMe modified sugar. 22. The oligonucleotide according to any one of the preceding aspects, wherein the 5'-wing is a bicyclic sugar. 23. The oligonucleotide according to aspect 22, wherein the bicyclic sugar is the sugar of LNA. 24. The oligonucleotide according to aspect 22, wherein the bicyclic sugar is the sugar of cEt. 25. The sugars in the 5'-wing are each independently 2'-OR s modified sugars, and R s is C 1-6 is aliphatic. The oligonucleotide according to any one of aspects 1 to 19. 26. The sugars in the 5'-wing are each independently 2'-MOE modified sugars. The oligonucleotide according to any one of aspects 1 to 19. 27. The oligonucleotide according to any one of the preceding aspects, wherein the number of nucleosides in the gap is about 8 to 15. 28. The oligonucleotide according to any one of the preceding aspects, wherein the number of nucleosides in the gap is 10. 29. The oligonucleotide according to any one of the preceding aspects, wherein the sugars in the gap are each independently the sugar of natural DNA. 30. The gap is an oligonucleotide according to any one of the preceding aspects and does not contain cysteine. 31. The gap is an oligonucleotide according to any one of the preceding aspects and contains one or more 5-methylcytosines. 32. The number of nucleosides in the 3'-wing is about 3 to 10 for the oligonucleotide according to any one of the preceding aspects. 33. The number of nucleosides in the 3'-wing is 5 for the oligonucleotide according to any one of the preceding aspects. 34. The sugars in the 3'-wing are each independently modified sugars for the oligonucleotide according to any one of the preceding aspects. 35. The sugars in the 3'-wing are 2'-OR s modified sugars, where R s is C 1-6 aliphatic for the oligonucleotide according to any one of the preceding aspects. 36. The sugars in the 3'-wing are 2'-MOE modified sugars for the oligonucleotide according to any one of the preceding aspects. 37. The sugars in the 3'-wing are 2'-OMe modified sugars for the oligonucleotide according to any one of the preceding aspects. 38. The sugars in the 3'-wing are bicyclic sugars for the oligonucleotide according to any one of the preceding aspects. 39. The bicyclic sugar is the sugar of LNA for the oligonucleotide according to aspect 38. 40. The bicyclic sugar is the sugar of cEt for the oligonucleotide according to aspect 38. 41. The sugars in the 3'-wing are each independently 2'-OR s modified sugars, where R s is C 1-6 aliphatic for the oligonucleotide according to any one of aspects 1 to 35. 42. The sugars in the 3'-wing are each independently 2'-MOE modified sugars for the oligonucleotide according to any one of aspects 1 to 35. 43. The oligonucleotide is the oligonucleotide according to any one of the preceding aspects, which contains a modified nucleotide internucleoside linkage. 44. The oligonucleotide according to aspect 43, wherein the modified nucleotide internucleoside linkage is a phosphorothioate nucleotide internucleoside linkage. 45. The oligonucleotide according to any one of the preceding aspects, wherein the internucleoside linkages are each independently a modified nucleotide internucleoside linkage. 46. The oligonucleotide according to any one of the preceding aspects, wherein the internucleoside linkages are each independently a phosphorothioate nucleotide internucleoside linkage.
[0198] 47. Structure: / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * T * T * T * / iMe-dC / * T * G * T * A * G * G * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / (wherein,
Chemical formula
Chemical formula
[0199] 48. Structure: / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * A * / iMe-dC / * T * G * G * T * T * / iMe-dC / * A * G * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / (wherein,
Chem.
Chem.
[0200] 49. Structure: / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / * G * G * T * / iMe-dC / * A * G * G * / iMe-dC / * A * G * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / (wherein, [Chemical formula] Each A, T, and G is deoxyadenosine, thymidine, and deoxyguanosine, respectively; [Chemical formula] An oligonucleotide having or a salt thereof.
[0201] 50. Structure: / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / * T * T * T * T * T * G * / iMe-dC / * A * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / (In the formula, [Chemical formula] Each A, T, and G is deoxyadenosine, thymidine, and deoxyguanosine, respectively; [Chemical formula] An oligonucleotide having or a salt thereof.
[0202] 51. Structure: / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * / iMe-dC / * T * G * T * G * / iMe-dC / * / iMe-dC / * T * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / (wherein,
Chem.
Chem.
[0203] 52. Structure: / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / * A * G * / iMe-dC / * T * T * G * G * G * / iMe-dC / * A * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / (wherein,
Chem.
[0204] 53. Structure: / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * T * A * G * T * / iMe-dC / * / iMe-dC / * T * T * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / (wherein, [Chemical formula] Each A, T, and G is deoxyadenosine, thymidine, and deoxyguanosine, respectively; [Chemical formula] or an oligonucleotide having a salt thereof.
[0205] 54. The oligonucleotide is an oligonucleotide according to any one of the preceding aspects, which is a pharmaceutically acceptable salt. 55. The oligonucleotide is an oligonucleotide according to any one of the preceding aspects, which is a sodium salt. A composition comprising the oligonucleotide according to any one of the preceding embodiments and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide.
[0206] 57. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomers, wherein the composition contains the oligonucleotide is / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * T * T * T * / iMe-dC / * T * G * T * A * G * G * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / (wherein
Chemical formula
Chemical formula
[0207] 58. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomers, wherein the composition contains The oligonucleotide is / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * A * / iMe-dC / * T * G * G * T * T * / iMe-dC / * A * G * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / (wherein
Chemical formula
Chemical formula
[0208] 59. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral bonding phosphorus of the oligonucleotide or one or more salts of the diastereomers, a composition containing the same, wherein the oligonucleotide is / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / * G * G * T * / iMe-dC / * A * G * G * / iMe-dC / * A * G * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / (wherein,
Chem.
Chem.
[0209] 60. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomers, is a composition containing the oligonucleotide is / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * / iMe-dC / * T * G * T * G * / iMe-dC / * / iMe-dC / * T * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / (wherein,
Chem.
Chemical formula
[0210] 61. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomers, A composition containing the same, wherein the oligonucleotide is / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / * A * G * / iMe-dC / * T * T * G * G * G * / iMe-dC / * A * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / (wherein
Chemical formula
Chemical formula
[0211] 62. An oligonucleotide or a salt thereof, and One or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomer, A composition comprising, The oligonucleotide is / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * T * A * G * T * / iMe-dC / * / iMe-dC / * T * T * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / (wherein,
Chemical formula
Chemical formula
[0212] 63. An oligonucleotide or a salt thereof, and One or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomer, A composition comprising, The oligonucleotide is / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / * T * T * T * T * T * G * / iMe-dC / * A * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / (wherein,
Chem.
Chem.
[0213] 64. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 20% to 80%, the composition according to any one of aspects 56 to 63. 65. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 30% to 70%, the composition according to any one of aspects 56 to 63. 66. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 40% to 60%, the composition according to any one of aspects 56 to 63. 67. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 45% to 55%, the composition according to any one of aspects 56 to 63. 68. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 50%, the composition according to any one of aspects 56 to 63. 69. The composition contains a salt of the oligonucleotide and one or more salts of one or more diastereomers, the composition according to any one of aspects 56 to 68. 70. The composition according to any one of aspects 56 to 69, which is a pharmaceutical composition and further contains a pharmaceutically acceptable carrier. 71. The composition according to any one of aspects 56 to 70, which contains a pharmaceutically acceptable salt of the oligonucleotide, a pharmaceutically acceptable salt of one or more diastereomers, and a pharmaceutically acceptable carrier. 72. A pharmaceutical composition containing the oligonucleotide according to any one of the preceding aspects and a pharmaceutically acceptable carrier. 73. The composition according to aspect 72, which contains a pharmaceutically acceptable salt of one or more oligonucleotides. 74. The composition according to any one of aspects 56 to 73, which is a liquid composition. 75. The composition according to any one of aspects 70 to 74, wherein the pharmaceutically acceptable carrier is a buffer solution. 76. The composition according to any one of aspects 70 to 74, wherein the pharmaceutically acceptable carrier is buffered physiological saline. 77. The composition according to any one of aspects 70 to 74, wherein the pharmaceutically acceptable carrier is artificial cerebrospinal fluid. 78. A method for reducing the level of calpain 2 mRNA in a system, which includes administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding aspects to the system. 79. A method for reducing the level of calpain 2 polypeptide in a system, which includes administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding aspects to the system. 80. A method for reducing the level of calpain 2 activity in a system, which includes administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding aspects to the system. 81. The method according to any one of aspects 78 to 80, wherein the system expresses calpain 2 mRNA. 82. The method according to any one of aspects 78 to 81, wherein the system is a cell or includes cells. 83. The system is a tissue or includes a tissue, and is the method according to any one of Aspects 78 to 81. 84. The system is an organ or includes an organ, and is the method according to any one of Aspects 78 to 81. 85. The system is the brain or a part thereof or includes the brain or a part thereof, and is the method according to any one of Aspects 78 to 81. 86. The system is an organism or includes an organism, and is the method according to any one of Aspects 78 to 81. 87. The system is a subject, and is the method according to any one of Aspects 78 to 81. 88. The system is a human, and is the method according to any one of Aspects 78 to 81. 89. The level of calpain 2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 90. The level of calpain 2 mRNA in the system is reduced by about or at least about 50% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 91. The level of calpain 2 mRNA in the system is reduced by about or at least about 60% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 92. The level of calpain 2 mRNA in the system is reduced by about or at least about 65% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 93. The level of calpain 2 mRNA in the system is reduced by about or at least about 70% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 94. The level of calpain 2 mRNA in the system is reduced by about or at least about 75% as compared to the case where the oligonucleotide or composition is absent, and is the method according to any one of Aspects 78 to 88. 95. The method according to any one of aspects 78 to 88, wherein the level of calpain 2 mRNA in the system is reduced by about or at least about 80% as compared to the case where the oligonucleotide or composition is absent. 96. The method according to any one of aspects 78 to 88, wherein the level of calpain 2 mRNA in the system is reduced by about or at least about 85% as compared to the case where the oligonucleotide or composition is absent. 97. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% as compared to the case where the oligonucleotide or composition is absent. 98. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 20% as compared to the case where the oligonucleotide or composition is absent. 99. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 30% as compared to the case where the oligonucleotide or composition is absent. 100. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 40% as compared to the case where the oligonucleotide or composition is absent.
[0214] 101. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 50% as compared to the case where the oligonucleotide or composition is absent. 102. The method according to any one of aspects 78 to 96, wherein the level of calpain 2 polypeptide in the system is reduced by about or at least about 60% as compared to the case where the oligonucleotide or composition is absent. 103. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% as compared to the case where the oligonucleotide or composition is absent. 104. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 20% as compared to the case where the oligonucleotide or composition is absent. 105. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 30% as compared to the case where the oligonucleotide or composition is absent. 106. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 40% as compared to the case where the oligonucleotide or composition is absent. 107. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 50% as compared to the case where the oligonucleotide or composition is absent. 108. The method according to any one of aspects 78 to 102, wherein the level of calpain 2 activity in the system is reduced by about or at least about 60% as compared to the case where the oligonucleotide or composition is absent. 109. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in the system is reduced by about or at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 110. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in the system is reduced by about or at least about 50% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 111. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 60% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 112. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 65% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 113. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 70% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 114. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 75% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 115. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 80% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 116. The method according to any one of aspects 78 to 108, wherein the level of calpain 2 mRNA in said system is reduced by about or at least about 85% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 117. The method according to any one of aspects 78 to 116, wherein the level of calpain 2 polypeptide in said system is reduced by about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 118. The method according to any one of aspects 78 to 116, wherein the level of calpain 2 polypeptide in said system is reduced by about or at least about 20% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 119. The method according to any one of aspects 78 to 116, which reduces the level of the calpain 2 polypeptide in the system by about or at least about 30% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 120. The method according to any one of aspects 78 to 116, which reduces the level of the calpain 2 polypeptide in the system by about or at least about 40% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 121. The method according to any one of aspects 78 to 116, which reduces the level of the calpain 2 polypeptide in the system by about or at least about 50% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 122. The method according to any one of aspects 78 to 116, which reduces the level of the calpain 2 polypeptide in the system by about or at least about 60% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 123. The method according to any one of aspects 78 to 122, which reduces the level of the activity of calpain 2 in the system by about or at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 124. The method according to any one of aspects 78 to 122, which reduces the level of the activity of calpain 2 in the system by about or at least about 20% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 125. The method according to any one of aspects 78 to 122, which reduces the level of the activity of calpain 2 in the system by about or at least about 30% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 126. The method according to any one of aspects 78 to 122, which reduces the level of the activity of calpain 2 in the system by about or at least about 40% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 127. The method according to any one of aspects 78 - 122, wherein the level of the activity of calpain 2 in the system is reduced by about or at least about 50% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 128. The method according to any one of aspects 78 - 122, wherein the level of the activity of calpain 2 in the system is reduced by about or at least about 60% as compared to the case where a reference oligonucleotide or composition is administered or delivered. 129. The method according to any one of aspects 109 - 128, wherein the reference oligonucleotide does not target calpain 2, or the reference composition does not contain an oligonucleotide that targets calpain 2. 130. The method according to any one of aspects 109 - 128, wherein the reference oligonucleotide targets TUG1, or the reference composition contains an oligonucleotide that targets TUG1. 131. The method according to any one of aspects 89 - 130, wherein the reduction is evaluated about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 days, or about 1, 2, 3, or 4 weeks, or more than these periods after the administration or delivery of the oligonucleotide or composition. 132. The method according to any one of aspects 89 - 131, wherein the reduction is evaluated about D3 after the administration or delivery of the oligonucleotide or composition. 133. The method according to any one of aspects 89 - 132, wherein the reduction is evaluated about D7 after the administration or delivery of the oligonucleotide or composition. 134. The method according to any one of aspects 89 - 133, wherein the reduction is evaluated about D10 after the administration or delivery of the oligonucleotide or composition. 135. The method according to any one of aspects 89 - 134, wherein the reduction is evaluated about D14 after the administration or delivery of the oligonucleotide or composition. 136. The method according to any one of aspects 89 - 135, wherein the reduction is evaluated about D21 after the administration or delivery of the oligonucleotide or composition. 137. The method according to any one of aspects 89 to 136, wherein the decrease is evaluated after about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days, or about 1, 2, 3 or 4 weeks, or more than these periods, after the removal or washout of the oligonucleotide or composition. 138. The method according to any one of aspects 89 to 137, wherein the decrease is evaluated after about D3 after the removal or washout of the oligonucleotide or composition. 139. The method according to any one of aspects 89 to 138, wherein the decrease is evaluated after about D7 after the removal or washout of the oligonucleotide or composition. 140. The method according to any one of aspects 89 to 139, wherein the decrease is evaluated after about D10 after the removal or washout of the oligonucleotide or composition. 141. The method according to any one of aspects 89 to 140, wherein the decrease is evaluated after about D14 after the removal or washout of the oligonucleotide or composition. 142. The method according to any one of aspects 89 to 141, wherein the decrease is evaluated after about D21 after the removal or washout of the oligonucleotide or composition. 143. The method according to any one of aspects 89 to 142, wherein the decrease is evaluated in iPSC-derived motor neurons with gymnotic delivery of about 20 μM oligonucleotide. 144. A method for preventing or treating a condition, disorder or disease, comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of aspects 1 to 77 to a susceptible subject. 145. The method according to aspect 144, wherein the onset of the symptom, disorder or disease is delayed. 146. The method according to aspect 144, wherein the onset of the symptom, disorder or disease is prevented. 147. A method for treating a condition, disorder or disease, comprising administering or delivering to a subject suffering therefrom an effective amount of the oligonucleotide or composition according to any one of aspects 1 to 77. 148. The method according to aspect 147, which reduces the severity of the symptoms of the condition, disorder or disease. 149. The method according to aspect 147 or 148, wherein one or more results of the clinical evaluation in the subject are independently improved. 150. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is related to Wallerian degeneration.
[0215] 151. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is a neurodegenerative condition, disorder or disease. 152. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is amyotrophic lateral sclerosis. 153. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is peripheral neuropathy. 154. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is chemotherapy-induced peripheral neuropathy. 155. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is Parkinson's disease. 156. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is Huntington's disease. 157. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is Alzheimer's disease. 158. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is frontotemporal dementia. 159. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is traumatic brain injury. 160. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is progressive supranuclear palsy. 161. The method according to any one of aspects 144 to 149, wherein the condition, disorder or disease is corticobasal degeneration. 162. The state, disorder or disease is Wolfram syndrome, and the method according to any one of aspects 144 to 149. 163. The state, disorder or disease is Friedreich's ataxia, and the method according to any one of aspects 144 to 149. 164. The state, disorder or disease is multiple system atrophy, and the method according to any one of aspects 144 to 149. 165. The state, disorder or disease is spinocerebellar degeneration, and the method according to any one of aspects 144 to 149. 166. The state, disorder or disease is spinal muscular atrophy, and the method according to any one of aspects 144 to 149. 167. The state, disorder or disease is Pick's disease, and the method according to any one of aspects 144 to 149. 168. The state, disorder or disease is progressive muscular atrophy, and the method according to any one of aspects 144 to 149. 169. The state, disorder or disease is stroke, and the method according to any one of aspects 144 to 149. 170. The state, disorder or disease is concussion, and the method according to any one of aspects 144 to 149. 171. The state, disorder or disease is intracerebral hemorrhage, and the method according to any one of aspects 144 to 149. 172. The state, disorder or disease is acute glaucoma, and the method according to any one of aspects 144 to 149. 173. The state, disorder or disease is epilepsy, and the method according to any one of aspects 144 to 149. 174. The state, disorder or disease is spinal cord injury, and the method according to any one of aspects 144 to 149. 175. The method according to any one of aspects 78 to 174 for reducing the excretion of NF-L. 176. A method for reducing the excretion of NF-L, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of aspects 1 to 77 to a subject. 177. The method according to any one of the preceding aspects for reducing the degeneration of neurites. A method for reducing the degeneration of neurites, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of Aspects 1 to 77 to a subject. 179. The method according to any one of Aspects 175 to 178, wherein the excretion of NF-L and / or the degeneration of neurites are induced by toxicity. 180. The method according to any one of Aspects 144 to 179, wherein the oligonucleotide or composition is administered or delivered intrathecally. 181. The method according to any one of Aspects 144 to 179, wherein the oligonucleotide or composition is administered or delivered intravenously.
Examples
[0216] Some examples of the provided technologies (such as compounds (oligonucleotides, reagents, etc.), compositions, methods (preparation methods, usage methods, evaluation methods, etc.)) are presented in the specification. Those skilled in the art will understand from this disclosure that a number of techniques are available for preparing and / or evaluating the characteristics and / or activities of the provided technologies.
[0217] Example 1 Various oligonucleotides and compositions can reduce the expression of calpain 2 The oligonucleotides and compositions described in the specification can provide in vitro knockdown of calpain 2 (CAPN2) transcripts. In the evaluation, bit.bio ioGlutamatergic Neurons (catalog number io1001) derived from human induced pluripotent stem cells (iPSCs) were seeded at 20,000 cells / well in a 96-well plate. After culturing the cells for 4 days, various oligonucleotide compositions were added to the cells at a concentration of 5 μM in 5% TE buffer. The cells were incubated with the oligonucleotides for 48 hours to enable Gymnosis uptake and knockdown of CAPN2 expression. After incubation, the cells were lysed and RNA was collected (Thermo Fisher, catalog number A25603). The RNA was used in real-time RT-qPCR to quantify the fold change in CAPN2 expression. In some embodiments, as shown in Figure 1, various oligonucleotides provided substantial in vitro knockdown of CAPN2 expression compared to the reference condition. The negative control was / 52MOErC / * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErT / * A * G * G * A * / iMe-dC / * T * A * T * / iMe-dC / * / iMe-dC / * / i2MOErA / * / i2MOErG / * / i2MOErG / * / i2MOErA / * / 32MOErA / . See also the data in Figure 2 (the positive control is <T * G * C * A * A * >G * T * C * T * G* A * C * G * C * C * <C * A * T * C * is <C * C * C * A * G * >T * G * C * A * T * T * C * A * T * T * <C * G * A * G * >T; the nucleosides are all DNA nucleosides except those within <> modified with 2’-MOE, * which represents phosphorothioate nucleotide linkages).
[0218] Example 2 Various oligonucleotides and compositions do not exhibit obvious cytotoxicity In particular, this disclosure provides oligonucleotides and compositions with low or no cytotoxicity. In the evaluation, human iPSC-derived glutamatergic neurons (bit.bio ioGlutamatergic Neurons, catalog number io1001) were seeded at 20,000 cells / well in a 96-well plate. After culturing the cells for 4 days, various oligonucleotides were added to the cells at a concentration of 5 μM in 5% TE buffer. The cells were incubated with the oligonucleotides for 48 hours. After incubation, the cells were stained with Hoechst (5 μg / mL). The number of live cells, dead cells, and total (live + dead) cells was counted, and the percentage of live cells was calculated. As shown in Figure 3, no significant change in the percentage of live cells was observed in the treatment with various oligonucleotides compared to the vehicle treatment (TE buffer). The positive control is <T * G* C * A * A * >G * T * C * T * G * A * C * G * C * C * <C * A * T * C * T> (targeting NEAT1), and the negative control was <A * C * C * A * G * >T * G * C * A * T * T * C * A * T * T * <C * G * A * G * T>. The nucleosides are all DNA nucleosides except those within <> modified with 2'-MOE, * represents phosphorothioate nucleotide internucleotide linkages. Staurosporine was utilized to induce toxicity in another well.
[0219] Example 3 Various oligonucleotides and compositions can dose-dependently reduce the expression of calpain 2 In particular, this disclosure shows that the various oligonucleotides and compositions provided can dose-dependently reduce the level of calpain 2 mRNA. The results of the evaluation are shown below as an example.
[0220] Cells: Human Bit.bio ioGlutamatergic neurons seeded in a 96-well plate at 20,000 cells / well. Thawing, seeding, and culturing were performed according to the supplier's instructions (coating: 0.01% PLO and 26 ng / cm2 laminin).
[0221] Oligonucleotide treatment: Oligonucleotide compositions 14, 15, 36, 39, 71, 77, and TUG1 (negative control). Concentrations: 20 μM, 15 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, 0.63 μM, 0.31 μM. Positive control (targeting NEAT1): Oligonucleotide targeting NEAT1 (5 μM). Negative control: TUG1 (5 μM). Vehicle: 20% TE buffer without oligonucleotides (same TE buffer content under all conditions). Four days after seeding, oligonucleotides were added to the cells (48-hour incubation by gymnosis uptake). Except for the negative control TUG1 oligonucleotide, two replicate experiments were performed on separate plates. Positive control: <T * G * C * A * A * >G * T * C * T * G * A * C * G * C * C * <C * A * T * C * T> (targeting NEAT1); Negative control: <A * C * C * A * G * >T * G * C * A * T * T * C * A * T * T * <C * G * A * G * T>; Nucleosides are all DNA nucleosides except those within <> modified with 2'-MOE, * represents phosphorothioate nucleotide internucleotide linkages.
[0222] Recovery: According to the supplier's instructions, Cells-to-Ct 1-Step TaqMan Kit (Life technologies) (cell lysis without additional RNA purification and 1-step reverse transcription + real-time PCR (real-time RT-PCR). 30 μL / well lysis buffer. Two days after treatment.
[0223] RT-qPCR: 10% of the Cells-to-Ct lysate samples (or water for no-template control; NTC). Singleplex reactions in 384-well plates in replicate experiments. TaqMan gene expression assay using the LightCycler 480 instrument. (NEAT1 Taqman assay for control oligonucleotide samples only, CAPN2 and RPLP0 Taqman assays for control and test oligonucleotide samples).
[0224]
Table 2
[0225] Data analysis: Cp values were determined by the second derivative method (Lightcycler software). Fold changes in gene expression were determined by the ΔΔCp method (normalized to TUG1 at 5 μM of negative control oligonucleotide). NEAT1 expression: ΔCp = Cp NEAT1 - Cp RPLP0 ; ΔΔCp = ΔCp NEAT1 - ΔCp TUG1 ; Fold change in NEAT1 expression = 2 -ΔΔCp 。CAPN2 expression: ΔCp = Cp CAPN2 - Cp RPLP0 ; ΔΔCp = ΔCp CAPN2 - ΔCp TUG1 ; Fold change in CAPN2 expression = 2 -ΔΔCp 。
[0226] Strong separation of positive and negative control oligonucleotides was observed. There was no significant variation within or between plates between the positive and negative controls. No plate position effect was observed with respect to control sample performance (vehicle, positive and negative controls), and no obvious plate drift was observed between the plates on which the tests were performed. No effect of the control treatment on the expression of calpain 2 and / or RPLP0 was observed compared to the vehicle treatment (fold change and / or Cp value). Agreement was observed during the biological replicate experiments.
[0227] As shown in the following table, a concentration-dependent increase in calpain 2 knockdown was observed with the various oligonucleotide compositions provided. No effect on the expression of RPLP0 was observed. The negative control targeting TUG1 did not show a concentration-dependent effect on calpain 2 expression. No obvious cytotoxicity was observed at the highest oligonucleotide concentration examined (20 μM) or at relatively low concentrations.
[0228]
Table 3
[0229] Example 4 Various oligonucleotides and compositions can dose-dependently reduce calpain 2 mRNA In particular, this disclosure shows that the various oligonucleotides and compositions provided can dose-dependently reduce the level of calpain 2 mRNA. The results of the evaluation are shown below as an example.
[0230] Cells: iCell motor neurons seeded at 32,000 cells / well in a 96-well plate. The thawing, seeding, and culturing procedures can be carried out according to the supplier's instructions (e.g., coating: 0.07% PEI + 10 μg / ml Cultrex 3D mouse laminin; medium: complete maintenance medium containing 20 mM DAPT from day 0 to day 6, and complete maintenance medium without DAPT from day 7 to day 10). Cell viability was examined on day 10 by staining with Hoechst (5 μg / ml) and imaging for counting nuclei.
[0231] Oligonucleotide treatment: Oligonucleotide compositions 14, 39, and TUG1 (negative control). Concentrations: 20 μM, 6.329 μM, 2.003 μM, 0.634 μM, 0.201 μM, 0.063 μM, 0.020 μM, 0.006 μM. Positive control (targeting NEAT1): Oligonucleotide targeting NEAT1 (20 μM). Vehicle: 2% (v / v) TE buffer without oligonucleotide. Oligonucleotides were added to the cells on day 7 after seeding and renewed on day 9 (total 72-hour incubation by DAPI uptake). Six replicate experiments were performed per plate for the positive control NEAT1 oligonucleotide and vehicle, and three replicate experiments were performed on a separate plate for the others except the positive control NEAT1 oligonucleotide and vehicle. Positive control: <T * G * C * A * A * >G * T * C * T * G * A * C * G * C * C * <C * A * T * C * T> (targeting NEAT1); negative control: <A * C * C * A * G * >T * G * C * A *T * T * C * A * T * T * <C * G * A * G * T>; The nucleosides are all DNA nucleosides except those within the <> modified with 2'-MOE, * represents phosphorothioate nucleotide internucleotide linkages.
[0232] Recovery: Cells can be recovered using the Cells-to-Ct 1-Step TaqMan Kit (Life Technologies) according to the supplier's instructions (cell lysis without additional RNA purification and 1-step reverse transcription + real-time PCR (real-time RT-PCR)). 25 μL / well lysis buffer. 3 days after treatment.
[0233] RT-qPCR: 15% of the Cells-to-Ct lysate samples (or water for the no-template control; NTC). Singleplex reactions in a 384-well plate in replicate experiments. TaqMan gene expression assay using a LightCycler 480 instrument. (NEAT1 Taqman assay for control oligonucleotide samples only, CAPN2 and RPLP0 Taqman assays for control and test oligonucleotide samples).
[0234]
Table 4
[0235] Data analysis: Cp values were determined using the second derivative method (Lightcycler software). The knockdown rate of gene expression was determined by the Pfaffl method to account for primer efficiency mismatches: RQ=(E 標的 ) ΔCt(標的) / (E 参照 ) ΔCt(参照) (Negative control: normalized to TUG1) (wherein, ΔCt (target) is Ct (target gene of the calibrator) - Ct (target gene for which the test was performed), and ΔCt (reference) is Ct (reference gene of the calibrator) - Ct (reference gene for which the test was performed)).
[0236] Treatment with the positive control oligonucleotide targeting NEAT1 specifically knocked down NEAT1, and treatment with the negative control oligonucleotide targeting TUG1 slightly decreased the Cp value of NEAT1 compared to the vehicle. Treatment with the positive control oligonucleotide targeting NEAT1 or the negative control oligonucleotide targeting TUG1 did not significantly affect the Cp values of RPLP0 or CAPN2 compared to vehicle treatment. No significant variation between plates was observed. By bright-field imaging, significant variation in cell viability was observed throughout the experiment, so the sample input for RT-qPCR varied and some data were excluded. The variation among multiple replicate experiments was small. No amplification was seen in the NTC, indicating no contamination. No significant variation in the total cell number was observed between plates. No obvious oligonucleotide-specific cytotoxicity was observed at any concentration.
[0237] As shown in Figure 4 and the following table, a concentration-dependent increase in CAPN2 knockdown was observed. Oligonucleotide 14 at 20 μM could knock down CAPN2 by approximately 96% in 72 hours. No significant effect on the expression of RPLP0 was observed. The negative control oligonucleotide targeting TUG1 did not show a concentration-dependent effect on the level of CAPN2 mRNA. Nonlinear regression (variable Hill slope) was used to convert the EC50 value to the pEC50 value.
[0238] [Table 5]
[0239] Example 5 Various oligonucleotides and compositions can provide a neuroprotective effect In particular, this disclosure shows that the various oligonucleotides and compositions provided are capable of a neuroprotective effect, e.g., reducing neurofilament-L (NF-L) excretion after exposure to a toxicity inducer. The results of the evaluation are shown below as an example.
[0240] Cells: iCell motor neurons seeded in 96-well plates at 32,000 cells / well. The thawing, seeding, and culturing steps can be carried out according to the supplier's instructions (e.g., coating: 0.07% PEI + 10 μg / ml Cultrex 3D mouse laminin; medium: complete maintenance medium containing 20 mM DAPT from day 0 to day 6, and complete maintenance medium without DAPT from day 7 to day 10).
[0241] Oligonucleotide treatment: Oligonucleotide compositions 14 and TUG1 (negative control). Concentration: 20 μM. Vehicle: 2% (v / v) TE buffer without oligonucleotides (same TE buffer content in all conditions). The oligonucleotides were added to the cells on day 7 after seeding and renewed on day 9 (total incubation of 72 hours by dithionite uptake). The treatment was repeated (in some embodiments, N = 4 for each oligonucleotide treatment for the toxicity inducer). Negative control: <A * C * C * A * G * >T * G * C * A * T * T * C * A * T * T * <C * G * A * G * T> (where TUG1 is the target); the nucleosides are all DNA nucleosides except those within <> modified with 2'-MOE, * represents phosphorothioate nucleotide internucleotide linkages.
[0242] Toxicity Inducers: Various toxicity inducers were added on the 9th day. The toxicity inducers used included vincristine (1.5 nM, 3 nM, 6 nM), rotenone (5 μM, 10 μM, 15 μM), and colchicine (10 nM, 100 nM, 1000 nM).
[0243] Neurofilament-L Assay: The cell supernatant was collected on the 10th day, 24 hours after the addition of the toxicity inducer. The concentration of neurofilament-L (NF-L) was determined using an R-PLEX Human Neurofilament-L Assay Kit (Meso Scale Discovery) according to the supplier's instructions.
[0244] As shown in Figure 5, pretreatment with oligonucleotide composition 14 reduced the NF-L efflux induced by the toxicity inducer compared to the vehicle. In the pretreatment with oligonucleotide composition 14, a significant reduction in NF-L efflux was observed after exposure to vincristine (1.5 nM, 3 nM, or 6 nM; Figure 5(A)), rotenone (5 μM, 10 μM, or 15 μM; Figure 5(B)), and colchicine (100 nM; Figure 5(C)) compared to the vehicle. A negative control oligonucleotide composition (targeting TUG1) also reduced the NF-L efflux induced by the toxicity inducer compared to the vehicle. Without intending to be limited by any theory, the reduction observed with the oligonucleotide composition targeting TUG1 may be due to a calpain-independent effect. Furthermore, in various cases, a significant reduction in NF-L efflux was observed with oligonucleotide composition 14 compared to the oligonucleotide composition targeting TUG1. In some embodiments, the MSD-based NF-L analysis showed an observable assay window for oligonucleotide composition 14 beyond TUG1.
[0245] When evaluated in a neurite degeneration assay, it was revealed that the oligonucleotide composition 14 partially prevented neurite degeneration induced by an inducer, for example, as measured by the tubulin immunoreactive area after exposure to a toxicity inducer. In some embodiments, certain effects were also observed for the oligonucleotide composition targeting TUG1.
[0246] Example 6 The technology provided can reduce calpain 2 mRNA and protein In particular, this disclosure shows that the various oligonucleotides and compositions provided can, in some instances, reduce the levels of calpain 2 mRNA and protein for several days, weeks, or longer. Some of the evaluation results are shown below as an example. Those skilled in the art will understand that other techniques can also be used to evaluate the technology provided in this disclosure for the purpose of confirming the technical effects, benefits, advantages, etc. of the provided technology.
[0247] Cells: iCell motoneurons seeded in a 96-well plate at 32,000 cells / well. The thawing, seeding, and culturing steps can be performed according to the supplier's instructions.
[0248] Oligonucleotide treatment: Oligonucleotide compositions 14, 39, and TUG1 (negative control). Concentrations: 20 μM for oligonucleotide composition 14, 18.9 μM for oligonucleotide composition 39, and 20 μM for the negative control oligonucleotide targeting TUG1. Vehicle: 2% (v / v) TE buffer without oligonucleotide. The oligonucleotides were added to the cells on the 7th day after seeding (by gymnosis uptake) and removed by medium replacement on the 9th day (total incubation of 48 hours). Cells were collected and lysed on the 7th day after seeding (baseline) and on the 3rd, 7th, 10th, 14th, and 21st days after removal of the oligonucleotide compositions. For mRNA collection, three replicate experiments were performed for each condition using a separate plate at each collection time point. For protein collection, three replicate experiments were performed for each condition using a separate plate at each collection time point.
[0249] Negative control: <A * C * C * A * G * >T * G * C * A * T * T * C * A * T * T * <C * G * A * G * T>; The nucleosides are all DNA nucleosides except those within <> modified with 2'-MOE, * represents phosphorothioate nucleotide internucleotide linkages.
[0250] mRNA recovery: On day 7 (baseline) after seeding and on days 3, 7, 10, 14, and 21 after removal of the oligonucleotide composition, cells were recovered using the Cells-to-Ct 1-Step TaqMan kit (Thermo Fisher) according to the supplier's instructions (25 μL / well lysis buffer).
[0251] RT-PCR: 15% of the Cells-to-Ct lysate samples as singleplex reactions in 384-well plates in replicate experiments and the primer / probe sets in the table below. TaqMan gene expression assay using a LightCycler 480 instrument (Roche). (CAPN2 and RPLP0 Taqman assays for control and test oligonucleotide samples).
[0252]
Table 6
[0253] mRNA data analysis: Determination of Cp values by the second derivative method (Lightcycler software). The knockdown rate of gene expression was determined by the Pfaffl method to account for primer efficiency mismatches: RQ=(E 標的 ) ΔCt(標的) / (E 参照 ) ΔCt(参照) (Normalized to negative control: TUG1) (where ΔCt (target) = Ct (target gene of calibrator) - Ct (target gene tested), and ΔCt (reference) = Ct (reference gene of calibrator) - Ct (reference gene tested)).
[0254] Treatment of cells with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1 resulted in only minor changes in the Cp values of the housekeeping (RPLP0) and target (CAPN2) genes. Perhaps due to variation between wells in cell viability, minor variations in Cp values were observed in replicate samples of CAPN2 and RPLP0 during treatment with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1. Cell viability was evaluated by Hoechst staining (which enables counting of cell nuclei) and brightfield imaging. No significant cytotoxicity was observed. Although some variation in cell viability was observed between individual wells, the average number of nuclei was not significantly different during treatment with oligonucleotides targeting CAPN2 compared to treatment with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1. Additionally, as shown in Figure 8, no significant effect on cell morphology was observed during treatment with vehicle (TE buffer), negative control oligonucleotides targeting TUG1, or oligonucleotides targeting CAPN2. Furthermore, cell morphology did not differ significantly between treatment conditions until at least day 21 after removal of the oligonucleotides. Formation of cell aggregates was observed on day 21 with oligonucleotides targeting CAPN2, and cell aggregate formation was also observed under control conditions. Neural network formation was observed under all treatment conditions.
[0255] As shown in FIG. 6 and the following table, calpain 2 (CAPN2) mRNA knockdown was confirmed. Oligonucleotide 14 can provide approximately 94% knockdown of calpain 2 mRNA at 20 μM on day 0 after oligonucleotide removal and approximately 77% knockdown of calpain 2 mRNA at 20 μM on day 21 after oligonucleotide removal. Oligonucleotide 39 can provide approximately 87% knockdown of calpain 2 mRNA at 18.9 μM on day 0 after oligonucleotide removal and approximately 82% knockdown of calpain 2 mRNA at 18.9 μM on day 21 after oligonucleotide removal. Oligonucleotide 14 and oligonucleotide 39 showed persistent knockdown of calpain 2 mRNA from day 0 to at least day 21 after oligonucleotide removal. The negative control oligonucleotide targeting TUG1 did not show knockdown of calpain 2 mRNA levels. In particular, the data of this example confirm that the provided technique can provide persistent knockdown of calpain 2 mRNA, for example, after removal or washout of the oligonucleotide or composition.
[0256] Protein recovery: Cell lysates were prepared using RIPA lysis buffer (30 μL / well) containing Halt protease inhibitor cocktail (Thermo Fisher). To ensure sufficient amounts of protein for detection, 3 wells were pooled per experiment. For each condition and time point, samples were collected in 3 replicate experiments. Protein yields were evaluated by BCA assay.
[0257] Protein detection: Calpain 2 protein was detected using Western blot with a Jess device (Lightcycler software) according to the supplier's instructions. For each condition and time point, 2 replicate experiments were performed. Calpain 2 antibody (EPR5977 / ab126600; Abcam) was used at a 1:6 dilution.
[0258] Protein data analysis: Detection based on chemiluminescence of target immunoreactivity. Signal analysis regarding area under the curve (AUC), detected molecule (MW), and signal-to-noise ratio using Compass software. Quantification of the rate of target protein knockdown normalized to total protein.
[0259] Calpain 2 protein levels were not affected by vehicle (TE buffer) or negative control treatment compared to untreated cells at 48 hours after treatment. During repeated experiments, some variation in calpain 2 protein levels was observed at some time points for some conditions, which, for example, in some cases, with negative controls for oligonucleotide 39, had a large protein loading amount and insufficient substrate, resulting in a slight burnout of the calpain 2 protein signal and potential underestimation of protein knockdown in samples on days 10, 14, and 21. Cell viability was evaluated by Hoechst staining (enabling counting of cell nuclei) and bright-field imaging. No significant cytotoxicity was observed. Some variation in cell viability was observed between each well, but the average number of nuclei was not significantly different upon treatment with oligonucleotides targeting CAPN2 compared to treatment with vehicle (TE buffer) or negative control oligonucleotides targeting TUG1. Additionally, as shown in Figure 8, no significant effect on cell morphology was observed upon treatment with vehicle (TE buffer), negative control oligonucleotides targeting TUG1, or oligonucleotides targeting CAPN2. Furthermore, cell morphology did not differ significantly between treatment conditions until at least day 21 after removal of the oligonucleotides. Cell clump formation was observed on day 21 with oligonucleotides targeting CAPN2, and cell clump formation was also observed under control conditions. Neural network formation was observed under all treatment conditions.
[0260] As shown in FIG. 7 and the following table, calpain 2 protein knockdown was confirmed. As shown in FIG. 7A, oligonucleotide 14 can provide approximately 51% knockdown of calpain 2 protein at 20 μM on the 14th day after oligonucleotide removal. As shown in FIG. 7B, oligonucleotide 39 can provide approximately 60% knockdown of calpain 2 protein at 18.9 μM on the 14th day after oligonucleotide removal. Oligonucleotide 14 and oligonucleotide 39 showed persistent calpain 2 protein knockdown from the 7th day after oligonucleotide removal and maintained persistent calpain 2 protein knockdown until at least the 21st day. The negative control oligonucleotide targeting TUG1 did not show knockdown of calpain 2 protein levels. In particular, the data of this example confirm that the provided technology can provide persistent knockdown of calpain 2 protein, for example, after removal or washout of the oligonucleotide or composition.
[0261]
Table 7
[0262] Various other techniques can be used to evaluate the characteristics and / or activities of the technology provided according to this disclosure. For example, a decrease in the level of calpain 2 polypeptide can be evaluated by Western blot or immunostaining. In some embodiments, the provided oligonucleotides and compositions are evaluated for a decrease in calpain 2 activation. In some embodiments, the provided oligonucleotides and compositions are evaluated for a decrease in the activity of calpain 2 protease. In some embodiments, the provided oligonucleotides and compositions are evaluated for a decrease in neurodegeneration, for example, using one or more cell models. In some embodiments, the provided oligonucleotides and compositions are evaluated for promoting recovery from axonal injury.
[0263] Although various aspects have been described and illustrated in this specification, those skilled in the art will readily conceive of various other means and / or structures for performing the functions described in this disclosure and / or obtaining the results and / or one or more advantages, and each such variation and / or modification is to be considered as included therein. More generally, those skilled in the art will readily understand that all parameters, ranges, materials, and configurations described in the specification are intended as examples, and that the actual parameters, ranges, materials, and / or configurations may depend on the particular application to which the teachings of this disclosure are applied. Those skilled in the art can recognize or confirm many equivalents to the aspects of this disclosure with only routine experimentation. Accordingly, the aspects described heretofore have been presented for purposes of illustration only, and it is to be understood that the technology recited in the claims is specifically described within the scope of the claims and their equivalents and may be practiced otherwise than specifically described apart from the claims. Further, combinations of two or more features, systems, articles, materials, kits, and / or methods are included within the scope of this disclosure so long as such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.
Claims
1. An oligonucleotide, whose base sequence is ATCAGTTTCTGTAGGCTTCC, GGATACTGGTTCTGTTGAT, GCTCTGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCCTCTAGT, GTTCCAGCTTGGGCAATGT or GGAAGCTTAGTCCTTGGCTG (wherein T is optionally and independently replaced by U), containing 10 or more consecutive nucleobases of and containing modified nucleobases, modified sugars or modified internucleotide linkages, oligonucleotide.
2. The oligonucleotide according to claim 1, wherein the base sequence of the oligonucleotide is ATCAGTTTCTGTAGGCTTCC, GGATACTGGTTCTGTTGAT, GCTCTGGTCAGGCAGTGGTT, GAGAGCCTTTTTGCAGAGCT, TCCAGCTCTGTGCCCTCTAGT, GTTCCAGCTTGGGCAATGT or GGAAGCTTAGTCCTTGGCTG.
3. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide contains a 5'-wing-gap-wing-3' structure.
4. The oligonucleotide according to any one of the preceding claims, wherein the number of nucleosides in the 5'-wing is about 3 to 10, and optionally, the number of nucleosides in the 5'-wing is 5.
5. The oligonucleotide according to any one of the preceding claims, wherein the sugars in the 5'-wing are each independently modified sugars.
6. The sugar in the 5'-wing is 2'-OR s a modified sugar, where R s is C 1-6 is aliphatic; The sugar in the 5'-wing is a 2'-MOE modified sugar; The sugar in the 5'-wing is a 2'-OMe modified sugar; and / or, The sugar in the 5'-wing is a bicyclic sugar, optionally, the bicyclic sugar is an LNA sugar or a cEt sugar, the oligonucleotide according to any one of the preceding claims.
7. The sugars in the 5'-wing are each independently a 2'-OR s modified sugar, R s is C 1-6 aliphatic, or, The sugars in the 5'-wing are each independently a 2'-MOE modified sugar, the oligonucleotide according to any one of claims 1 to 6.
8. The number of nucleosides in the gap is about 8 to 15, optionally, the number of nucleosides in the gap is 10, the oligonucleotide according to any one of the preceding claims.
9. The sugars in the gap are each independently sugars of natural DNA, the oligonucleotide according to any one of the preceding claims.
10. The gap does not contain cysteine, and / or, the gap contains one or more 5-methylcytosines, the oligonucleotide according to any one of the preceding claims.
11. The number of nucleosides in the 3'-wing is about 3 to 10, optionally, the number of nucleosides in the 3'-wing is 5, the oligonucleotide according to any one of the preceding claims.
12. The sugars in the 3'-wing are each independently modified sugars, the oligonucleotide according to any one of the preceding claims.
13. The sugars in the 3'-wing are 2'-OR s modified sugars, R s is C 1-6 ; The sugar in the 3'-wing is a 2'-MOE-modified sugar; The sugar in the 3'-wing is a 2'-OMe-modified sugar; and / or, The sugar in the 3'-wing is a bicyclic sugar, and optionally, the bicyclic sugar is an LNA sugar or a cEt sugar, the oligonucleotide according to any one of the preceding claims.
14. The sugars in the 3'-wing are each independently a 2'-OR s modified sugar where R s is C 1-6 is aliphatic, or, The sugars in the 3'-wing are each independently a 2'-MOE-modified sugar, the oligonucleotide according to any one of claims 1 to 13.
15. The oligonucleotide contains modified internucleotide linkages, and optionally, the modified internucleotide linkages are phosphorothioate internucleotide linkages, the oligonucleotide according to any one of the preceding claims.
16. The internucleotide linkages are each independently modified internucleotide linkages, and / or, The internucleotide linkages are each independently phosphorothioate internucleotide linkages, the oligonucleotide according to any one of the preceding claims.
17. Structure: / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * T * T * T * / iMe-dC / * T * G * T * A * G * G * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * A * / iMe-dC / * T * G * G * T * T * / iMe-dC / * A * G * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / * G * G * T * / iMe-dC / * A * G * G * / iMe-dC / * A * G * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / * T * T * T *T * T * G * / iMe-dC / * A * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / , / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * / iMe-dC / * T * G * T * G * / iMe-dC / * / iMe-dC / * T * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / , / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / * A * G * / iMe-dC / * T * T * G * G * G * / iMe-dC / * A * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / , or, / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * T * A * G * T * / iMe-dC / * / iMe-dC / * T * T * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / (wherein, 【Chemical Formula 1】 each A, T, and G is deoxyadenosine, thymidine, and deoxyguanosine, respectively; 【Chemical Formula 2】 or an oligonucleotide having a salt thereof.
18. The oligonucleotide according to any one of the preceding claims, wherein the oligonucleotide is a pharmaceutically acceptable salt, and optionally, the oligonucleotide is a sodium salt.
19. A composition containing the oligonucleotide according to any one of the preceding claims and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide.
20. An oligonucleotide or a salt thereof, and one or more diastereomers of the chiral linking phosphorus of the oligonucleotide or one or more salts of the diastereomers, A composition containing the same, wherein the oligonucleotide is / 52MOErA / * / i2MOErT / * / i2MOErC / * / i2MOErA / * / i2MOErG / * T * T * T * / iMe-dC / * T * G * T * A * G * G * / i2MOErC / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / 32MOErC / , / 52MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErA / * / i2MOErT / * A * / iMe-dC / * T * G * G * T * T * / iMe-dC / * A * G * / i2MOErT / * / i2MOErT / * / i2MOErG / * / i2MOErA / * / 32MOErT / , / 52MOErG / * / i2MOErC / * / i2MOErT / * / i2MOErC / * / i2MOErA / * G * G * T * / iMe-dC / * A * G * G * / iMe-dC / * A * G * / i2MOErT / * / i2MOErG / * / i2MOErG / * / i2MOErT / * / 32MOErT / 、 / 52MOErT / * / i2MOErC / * / i2MOErC / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * / iMe-dC / * T * G * T * G * / iMe-dC / * / iMe-dC / * T * / i2MOErC / * / i2MOErT / * / i2MOErA / * / i2MOErG / * / 32MOErT / 、 / 52MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErC / * / i2MOErC / * A * G * / iMe-dC / * T * T * G * G * G * / iMe-dC / * A * / i2MOErG / * / i2MOErT / * / i2MOErT / * / i2MOErG / * / 32MOErT / 、 / 52MOErG / * / i2MOErG / * / i2MOErA / * / i2MOErA / * / i2MOErG / * / iMe-dC / * T * T * A * G * T * / iMe-dC / * / iMe-dC / * T * T * / i2MOErG / * / i2MOErG / * / i2MOErC / * / i2MOErT / * / 32MOErG / , or / 52MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErA / * / i2MOErG / * / iMe-dC / * / iMe-dC / * T * T * T * T * T * G * / iMe-dC / * A * / i2MOErG / * / i2MOErA / * / i2MOErG / * / i2MOErC / * / 32MOErT / (wherein, 【Chemical Formula 3】 Each A, T, and G is deoxyadenosine, thymidine, and deoxyguanosine, respectively; 【Chemical Formula 4】 is a composition.
21. For each chiral linking phosphorus, the proportion of the Rp configuration is independently about 20% to 80%, about 30% to 70%, about 40% to 60%, about 45% to 55%, or about 50%, the composition according to claim 19 or 20.
22. The composition contains a salt of the oligonucleotide and a salt of one or more diastereomers, the composition according to any one of claims 19 to 21.
23. The composition according to any one of claims 19 to 22, wherein the composition is a pharmaceutical composition and further contains a pharmaceutically acceptable carrier.
24. The composition according to any one of claims 19 to 23, wherein the composition contains a pharmaceutically acceptable salt of the oligonucleotide, a pharmaceutically acceptable salt of one or more diastereomers, and a pharmaceutically acceptable carrier.
25. A pharmaceutical composition containing the oligonucleotide according to any one of the preceding claims and a pharmaceutically acceptable carrier.
26. The composition according to claim 25, wherein the composition contains a pharmaceutically acceptable salt of one or more oligonucleotides.
27. The composition according to any one of claims 19 to 26, wherein the composition is a liquid composition.
28. The composition according to any one of claims 23 to 27, wherein the pharmaceutically acceptable carrier is a buffer solution, buffered saline, or artificial cerebrospinal fluid.
29. A method for reducing the level of calpain 2 mRNA in a system, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding claims to the system.
30. A method for reducing the level of calpain 2 polypeptide in a system, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding claims to the system.
31. A method for reducing the level of calpain 2 activity in a system, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of the preceding claims to the system.
32. The method according to any one of claims 29 to 31, wherein the system expresses calpain 2 mRNA.
33. The system is a cell, tissue, organ, brain or a part thereof, organism, subject or human, or a method according to any one of claims 29 to 32, including a cell, tissue, period, brain or a part thereof, organism, subject or human.
34. The level of calpain 2 mRNA in the system is reduced by about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more compared to the case where the oligonucleotide or composition is absent, according to any one of claims 29 to 33.
35. The level of calpain 2 polypeptide in the system is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% or more compared to the case where the oligonucleotide or composition is absent, according to any one of claims 29 to 33.
36. The level of calpain 2 activity in the system is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% or more compared to the case where the oligonucleotide or composition is absent, according to any one of claims 29 to 33.
37. The level of calpain 2 mRNA in the system is reduced by about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more compared to the case where a reference oligonucleotide or composition is administered or delivered, according to any one of claims 29 to 33.
38. The level of calpain 2 polypeptide in the system is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% or more compared to the case where a reference oligonucleotide or composition is administered or delivered, according to any one of claims 29 to 33.
39. The method according to any one of claims 29 to 33, wherein the level of the activity of calpain 2 in the system is reduced by about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or 80% or more as compared with the case where a reference oligonucleotide or composition is administered or delivered.
40. The method according to any one of claims 37 to 39, wherein the reference oligonucleotide does not target calpain 2, or the reference composition does not contain an oligonucleotide that targets calpain 2.
41. The method according to any one of claims 37 to 39, wherein the reference oligonucleotide targets TUG1, or the reference composition contains an oligonucleotide that targets TUG1.
42. The method according to any one of claims 34 to 41, wherein the reduction is evaluated about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days, or about 1, 2, 3 or 4 weeks or more after the administration or delivery of the oligonucleotide or composition.
43. The method according to any one of claims 34 to 42, wherein the reduction is evaluated about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 days, or about 1, 2, 3 or 4 weeks or more after the removal or washout of the oligonucleotide or composition.
44. The method according to any one of claims 34 to 43, wherein the reduction is evaluated in iPSC-derived motor neurons that have received gymnotic delivery of about 20 μM of the oligonucleotide.
45. A method for preventing or treating a condition, disorder or disease, comprising administering or delivering to a susceptible subject an effective amount of the oligonucleotide or composition according to any one of claims 1 to 28.
46. The method according to claim 45, which delays or prevents the onset of said symptom, disorder or disease.
47. A method for treating a condition, disorder or disease, comprising administering or delivering to a subject suffering therefrom an effective amount of the oligonucleotide or composition according to any one of claims 1 to 28.
48. The method according to claim 47, which reduces the severity of the symptoms of said condition, disorder or disease.
49. The method according to claim 47 or 48, wherein one or more results of the clinical evaluation in said subject are independently improved.
50. The condition, disorder or disease is a neurodegenerative condition, disorder or disease, amyotrophic lateral sclerosis, peripheral neuropathy, chemotherapy-induced peripheral neuropathy, Parkinson's disease, Huntington's disease, Alzheimer's disease, frontotemporal dementia, traumatic brain injury, progressive supranuclear palsy, corticobasal degeneration, Wolfram syndrome, Friedreich's ataxia, multiple system atrophy, spinocerebellar degeneration, spinal muscular atrophy, Pick's disease, progressive muscular atrophy, stroke, concussion, intracerebral hemorrhage, acute glaucoma, epilepsy, spinal cord injury, and / or a condition, disorder or disease associated with Wallerian degeneration, according to any one of claims 45 to 49.
51. The method according to any one of claims 29 to 50, which reduces the excretion of NF-L.
52. A method for reducing the excretion of NF-L, comprising administering or delivering to a subject an effective amount of the oligonucleotide or composition according to any one of claims 1 to 28.
53. The method according to any one of the preceding claims, which reduces the degeneration of neurites.
54. A method for reducing the degeneration of neurites, the method comprising administering or delivering an effective amount of the oligonucleotide or composition according to any one of claims 1 to 28 to a subject.
55. The method according to any one of claims 51 to 54, wherein the efflux of NF-L and / or the degeneration of neurites is induced by toxicity.
56. The method according to any one of claims 45 to 55, wherein the oligonucleotide or composition is administered or delivered intrathecally and / or intravenously.
57. An oligonucleotide, composition or method according to any one of exemplary embodiments 1 to 181.