Novel Signature for Lung Cancer Detection

Novel RNA molecules with specific sequences are used to diagnose and monitor lung cancer, addressing the lack of sensitive biomarkers in current diagnostic methods, improving diagnostic accuracy and efficiency.

JP2025523470APending Publication Date: 2025-07-23HUMMINGBIRD DIAGNOSTICS GMBH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024574739
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-06-28
Filing Date
2023-05-26
Publication Date
2025-07-23

AI Technical Summary

Technical Problem

Current diagnostic methods for lung cancer are not cost-effective, easy to use, and lack sensitive biomarkers, with no standard blood test proven to be useful for diagnosis.

Method used

Identifying novel RNA molecules significantly reduced in lung cancer patients, using RNA molecules with specific nucleotide sequences (SEQ ID NO: 1, 2, and 3) or their fragments with at least 80% sequence identity for diagnosing and monitoring lung cancer through blood samples.

Benefits of technology

Provides a sensitive and specific method for diagnosing and monitoring lung cancer using RNA biomarkers, enhancing diagnostic accuracy and efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025523470000001
    Figure 2025523470000001
  • Figure 2025523470000002
    Figure 2025523470000002
  • Figure 2025523470000003
    Figure 2025523470000003
Patent Text Reader

Abstract

The present invention relates to a method for diagnosing lung cancer in a patient. Further, the present invention relates to a method for observing lung cancer in a patient. Still further, the present invention relates to a kit for carrying out these methods.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for diagnosing lung cancer in a patient. Further, the present invention relates to a method for observing lung cancer in a patient. Further, the present invention relates to a kit for carrying out these methods.

Background Art

[0002] Cancer is the uncontrolled growth of abnormal cells in any part of the body. Abnormal cells are called cancer cells, malignant cells, or tumor cells. Cancer cells grow uncontrollably and form a mass of cancer cells. The most common types of cancer in men are lung cancer, prostate cancer, colorectal cancer, and gastric cancer. The most common in women are breast cancer, colorectal cancer, lung cancer, and cervical cancer.

[0003] Lung cancer or bronchogenic carcinoma refers to a tumor that occurs in the lung parenchyma or within the bronchus. Lung cancer is one of the leading causes of cancer-related death in Europe and the United States. Since 1987, lung cancer has accounted for more deaths in women than breast cancer. In the United States, it is estimated that 225,000 people are newly diagnosed with lung cancer each year, and approximately 160,000 people die from lung cancer. It is interesting that lung cancer was a relatively rare disease at the beginning of the 20th century. The dramatic increase in lung cancer over the next few decades is mainly due to the increase in smokers, both men and women.

[0004] Lung cancer is usually diagnosed by various imaging diagnostic techniques such as X-ray examination and computed tomography (CT), but it is clear that a more cost-effective, easier-to-use, and faster technique is needed. Through molecular biological research, several diagnostic markers for lung cancer have been identified. However, their diagnostic value for lung cancer is currently low. Therefore, more sensitive biomarkers are needed. Furthermore, there is currently no standard blood test or laboratory test that has been proven to be useful for the diagnosis of lung cancer.

[0005] The inventors have identified new RNA molecules whose regulation is significantly reduced in lung cancer patients compared to healthy control groups. The signatures of these new RNA molecules have been found to have a high diagnostic relevance for the determination of lung cancer. Therefore, these novel RNA molecules can be used as biomarkers for lung cancer diagnosis and also as biomarkers for lung cancer monitoring.

Summary of the Invention

[0006] In a first aspect, the present invention relates to a method for diagnosing lung cancer in a patient, (i) determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto; (ii) determining the level of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, or (iii) determining the level of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto.

[0007] In a second aspect, the present invention relates to a method for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, (i) determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, (ii) determining the level of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, or, (iii) determining the level of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto.

[0008] In a third aspect, the present invention is (i) at least one RNA molecule for diagnosing a patient's lung cancer or for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, (ii) At least two RNA molecules for diagnosing a patient's lung cancer, or for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, or (iii) Use of at least two RNA molecules for diagnosing a patient's lung cancer, or for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto.

[0009] In a fourth aspect, the present invention relates to the use of a kit for diagnosing a patient's lung cancer, or for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, the kit comprising (i) Means for determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto. (ii) means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule includes the nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, or, (iii) means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes the nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule includes the nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto.

[0010] The summary of the invention does not necessarily describe all features of the invention. Other embodiments will become apparent by considering the following detailed description.

Best Mode for Carrying Out the Invention

[0011] Definitions Before explaining the present invention in detail below, it should be understood that since the specific methodologies, protocols and reagents described herein may vary, the present invention is not limited thereto. It should also be understood that the terms used herein are for the purpose of describing only specific embodiments and are not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0012] Preferably, the terms used in this specification are defined as described in the "Multilingual Glossary of Biotechnology Terms: IUPAC Recommendations" (edited by Leuenberger, H.G.W, Nagel, B. and Kolbl, H., 1995, Helvetica Chimica Acta, Basel CH-4010, Switzerland).

[0013] Throughout the text of this specification, multiple documents are cited. Each document cited in this specification (including all patents, patent applications, academic papers, manufacturer's specifications, instructions, GenBank Accession Number sequence submission documents, etc.) is incorporated by reference in its entirety, regardless of whether it is above or below the text of this specification. The content of this specification should not be construed in any way as admitting that the invention has a right to precedence over the disclosure by a prior invention. In the event of a conflict between the definitions or teachings of such reference documents and the definitions or teachings described in this specification, the description in this specification shall prevail.

[0014] Variations such as "comprise", "comprises", or "comprising" mean, according to this specification, including a particular integer or group of integers and not excluding other integers or groups of integers. The term "consisting essentially of" in this specification means including a particular integer or group of integers and excluding modifications or other integers that have a substantial effect or change on that integer. Terms such as "consisting" or "consists of" in this specification mean including a particular integer or group of integers and excluding other integers or groups of integers. "A", "an", "the" and similar references used in this specification (especially in the claims) are to be construed as covering both the singular and the plural, unless otherwise specified in this specification or clearly inconsistent from the context.

[0015] As used herein, the term "about" indicates a certain variation from the quantitative value immediately preceding it. In particular, the term "about" allows for a variation of ±5% from the preceding quantitative value, unless otherwise indicated or inferred. The use of the term "about" includes the particular quantitative value itself, unless otherwise explicitly indicated. For example, the expression "about 80 °C" allows for a variation of ±4 °C and refers to the range of 76 °C to 84 °C.

[0016] As used herein, the term "sequence identity" refers to a measure of the similarity of nucleotide and amino acid sequences. The percentage of sequence identity can be determined by sequence alignment. Such alignment can be performed by several well-known algorithms, preferably the mathematical algorithms of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877), hmmalign (HMMER package) or the CLUSTAL algorithm (Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-80), or the CLUSTALW2 algorithm (Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948).

[0017] The degree of sequence identity (sequence match) can be calculated, for example, using BLAST, BLAT, or BlastZ (or BlastX). Similar algorithms are described in Altschul et al. (1990) J. Mol. Biol. 215:403-410. The BLAST protein search is performed, for example, using the BLASTP program available at the website: http: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastp&BLAST_PROGRAMS=blastp&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome.

[0018] The priority algorithm parameters used are the default parameters set at the specified website. Expect threshold = 10, word size = 3, maximum number of matches = 0, matrix = BLOSUM62, gap cost = existence: 11, extension: 1, composition adjustment = conditional composition score matrix adjustment with the non-redundant protein sequence database (nr).

[0019] To obtain a gap-alignment for comparison purposes, gapped BLAST is utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. When using the BLAST and gapped BLAST programs, the default parameters of each program are used. The sequence identity analysis can be supplemented by established homology mapping techniques such as Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1:I54-I62) or Markov random fields.

[0020] When the percentage of sequence identity is mentioned in the present application, these percentages can be calculated in relation to the full length of the indicated reference sequence, unless otherwise indicated. For example, the description "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated with respect to the full length of SEQ ID NO: XYZ. Specifically described here are variants of the nucleotide sequences from SEQ ID NO: 1 to SEQ ID NO: 71. These variants have at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequences from SEQ ID NO: 1 to SEQ ID NO: 71.

[0021] When the percentage of sequence identity between two sequences is calculated, unless otherwise indicated, these percentages can also be calculated in relation to the full length of the longer of the two sequences. For example, the description "a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to SEQ ID NO: XYZ" means that the percentage of sequence identity is calculated in relation to the longer of the two sequences.

[0022] As used herein, the term "RNA molecule" refers to a polymeric molecule that is essential for various biological roles in gene coding, decoding, regulation, and expression. Ribonucleic acid (RNA) and deoxyribonucleic acid (DNA) are nucleic acids. Nucleic acids, together with lipids, proteins, and carbohydrates, constitute one of the four major polymers essential for all known living organisms. Similar to DNA, RNA is composed of a chain of nucleotides, but unlike DNA, RNA exists in nature in a single-stranded folded state rather than a double-stranded one. Cellular organisms use messenger RNA (mRNA) to transmit genetic information (represented by the nitrogenous bases guanine, uracil, adenine, cytosine, G, U, A, C) that instructs the synthesis of specific proteins. Some RNA molecules play active roles, such as catalyzing biological reactions within cells, controlling gene expression, or sensing and transmitting responses to cell signals. One such active process is protein synthesis, which is a universal function where RNA molecules direct protein synthesis on ribosomes. In this process, transfer RNA (tRNA) molecules are used to carry amino acids to the ribosome, and ribosomal RNA (rRNA) binds the amino acids to form the encoded protein.

[0023] As used herein, the term "small RNA molecule" refers to a polymeric RNA molecule that is typically less than 200 ribonucleotides in length, preferably less than 50 ribonucleotides in length. Specifically, the small RNA molecule is less than 10 to 200 ribonucleotides in length. More specifically, the small RNA molecule is less than 10 to 50 ribonucleotides in length. RNA molecules having nucleotide sequences according to SEQ ID NOs: 1 to 79 are small RNA molecules.

[0024] As used herein, the term "non-coding small RNA molecule" refers to an RNA molecule that is not translated into a protein. In particular, non-coding small RNA molecules can be defined by their length. Non-coding small RNA molecules typically have a length of less than 200 ribonucleotides, preferably less than 50 ribonucleotides. Specifically, small non-coding RNA molecules have a length of less than 10 to 200 ribonucleotides. More specifically, small RNA molecules have a length of less than 10 to 50 ribonucleotides. Abundant and functionally important non-coding RNAs include transfer RNA (tRNA), ribosomal RNA (rRNA), microRNA (miRNA), small interfering RNA (siRNA), or piwi-interacting RNA (piRNA). RNA molecules having nucleotide sequences according to SEQ ID NOs: 1 to 79 are non-coding small RNA molecules. An RNA molecule consisting of the nucleotide sequence according to SEQ ID NO: 2 is, for example, a 28S ribosomal RNA (rRNA) fragment that is significantly upregulated in lung cancer patients compared to healthy subjects. Non-coding small RNA molecules include miRNAs and isomiRs.

[0025] As used herein, the term "miRNA" (which may also be referred to as "microRNA") refers to a single-stranded RNA molecule. A miRNA may be a molecule having a length of 10 to 50 nucleotides, for example, a molecule having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides and does not optionally include a label and / or an extension sequence (such as a biotin stretch).

[0026] miRNAs control gene expression and are encoded by genes transcribed from DNA, but miRNAs are not translated into proteins (i.e., miRNAs are non-coding RNAs). Genes encoding miRNAs are longer than the processed mature miRNA molecules. miRNAs are initially transcribed as long precursor molecules (longer than 1000 nucleotides in length) called primary miRNA transcripts (pri-miRNAs). Pri-miRNAs have a hairpin structure and are processed by the Drosha enzyme (as part of the microprocessor complex). The pri-miRNA after Drosha processing is only 60 - 100 nucleotides in length and is called precursor miRNA (pre-miRNA). At this point, the pre-miRNA is transported to the cytoplasm where it encounters the Dicer enzyme. Dicer cleaves the miRNA into two, creating a double-stranded miRNA. Traditionally, only one of these miRNA arms was thought to be important in gene regulation, and the arm is incorporated into the RNA-induced silencing complex (RISC) and is present at high concentrations within the cell. This is often called the "guide" strand and is named miR. The other strand is called the "minor miRNA" or "passenger miRNA" and is often miR * -called. The passenger miRNA was thought to be completely degraded, but deep sequencing studies have revealed that some minor miRNAs remain and actually play functional roles in gene regulation. These advances have led to a change in the naming rules. miR / miR *Instead of the previous nomenclature, the miR-5p / miR-3p nomenclature was adopted. In the new system, the 5´ arm of the miRNA is always named miR-5p and the 3´ arm is named miR-3p. The current nomenclature is as follows: after the prefix "miR", a dash and a number follow, and the latter often indicates the order of naming. For example, hsa-miR-16 was named before hsa-miR-342 and is likely to have been discovered earlier. The capital "miR-" refers to the mature form of the miRNA (e.g., hsa-miR-16-5p and hsa-miR-16-3p), the non-capital "mir-" refers to pre-miRNAs and pri-miRNAs (e.g., hsa-mir-16), and "MIR" refers to the genes encoding them. However, since this is a recent change, the original miR / miR * names are often used in the literature. After processing, the double-stranded miRNA is incorporated into Argonaute (AGO) proteins to form a precursor of the RNA-induced silencing complex (RISC). This complex unwinds the double strand, the passenger RNA strand is discarded, and a mature RISC with the mature single-stranded miRNA remains. The miRNA becomes part of the RISC to suppress the expression of target genes. This is the standard pathway of miRNA biosynthesis, but various other pathways have also been discovered. These include Drosha-independent pathways (such as the mirtron pathway, snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as the pathway that depends on AGO for cleavage and the pathway that depends on tRNaseZ).

[0027] As used herein, the term "miRBase" refers to an established repository of validated miRNAs. miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotations. Each entry in the miRBase sequence database represents the predicted hairpin portion of the miRNA transcript (designated as mir in the database), and includes information regarding the location and sequence of the mature miRNA sequence (designated as miR in the database). The hairpin and mature sequences are searchable and browsable, and entries can also be searched by name, keyword, reference, and annotation. All sequence and annotation data are also downloadable. In October 2018, miRbase version 22.1 was released. This is the current version [please confirm].

[0028] As used herein, the term "isomiR" (or "miRNA isoform") refers to miRNAs with slightly different sequences due to variations in the cleavage site during miRNA biogenesis. In particular, inaccurate cleavage by Drosha and Dicer, or miRNA turnover, can result in miRNAs with heterogeneous lengths and / or sequences. IsomiRs (miRNA isoforms) are mainly classified into three categories: 3´ isomiRs (one or more nucleotides are deleted or added at the 3´ position), 5´ isomiRs (one or more nucleotides are deleted or added at the 5´ position), and polymorphic isomiRs (some nucleotides within the sequence are different from the wild-type mature miRNA sequence). Increased expression of miRNA variants, or individual isomiRs, may lead to loss or attenuation of the function of the corresponding wild-type mature miRNA, or may result in the regulation of different transcriptomes. Recent studies have suggested that isomiRs may play important roles, perhaps, in various cancers, tissues, and cell types. Therefore, the detection of miRNAs and isomiRs is absolutely necessary to accurately reflect the biological situation and make correct diagnostic and therapeutic decisions.

[0029] RNA can be isolated from a sample using a variety of procedures well known in the art, such as, for example, the Applied Biosystems ABI Prism™ 6100 Nucleic Acid PrepStation (Life Technologies, Foster City, CA), and the ABI Prism™ 6700, an automated nucleic acid workstation (Life Technologies, Foster City, CA), Ambion™, mirVana™ RNA Isolation Kit (Life Technologies, Austin, TX), PAXgene Blood, RNA Kit (Qiagen, Hilden, Germany), and the like.

[0030] As used herein, the term "total RNA" refers to isolated RNA present in a blood sample (comprising small (non-coding) RNAs, particularly RNA molecules as described herein). Preferably, total RNA comprises small (non-coding) RNA fragments or small (non-coding) RNA-enriched fragments. For example, total RNA (comprising small (non-coding) RNA fragments or small (non-coding) RNA-enriched fractions) can be obtained by lysing blood cells in a blood cell preparation (e.g., Trizol), followed by RNA purification, for example, by phenol / chloroform extraction and / or separation-based techniques (e.g., glass fiber filter column, silica membrane column). Examples of kits for RNA isolation and purification include miRNeasy Kits (Qiagen), PAXgene Blood miRNA Kit (Qiagen), mirVana PARIS Kit (Life Technologies), PARIS Kit (Life Technologies), Tempus Spin RNA Isolation Kit (Life Technologies), and the like.

[0031] As used herein, the term "lung cancer" refers to a disease associated with uncontrolled cell growth in lung tissue. This growth may lead to invasion of adjacent tissues and metastasis, which is invasion outside the lung. Most primary lung cancers are squamous cell carcinomas of the lung, which originate from epithelial cells. Lung cancer is the most common cause of cancer-related death in both men and women. The most common symptoms are shortness of breath, cough (including hemoptysis), and weight loss.

[0032] Lung cancer is classified into four stages: stage I, II, III, and IV. Specifically, the stages of lung cancer are classified as follows. Stage I means that the cancer is small. It has not metastasized to lymph nodes or other distant organs. Stage I belongs to the early stage of lung cancer. Stage I is divided into stage IA and IB. Stage IA means that the cancer is 3 cm or less in size. Stage IB means that the cancer is 3 cm to 4 cm in size. It may also have invaded structures such as the main airway (main bronchus) of the lung or the membrane covering the lung (visceral pleura).

[0033] Stage II still belongs to the early stage of lung cancer. Stage II is divided into stage IIA and IIB. Part of the affected lung may be ulcerated. Stage IIA means that the size of the cancer is 4 cm to 5 cm, but there are no cancer cells in the lymph nodes. Stage IIB means that the size of the cancer is 5 cm or less and there are cancer cells in the lymph nodes close to the affected lung. Or, it means that the size is 5 cm to 7 cm, but there are no cancer cells in the lymph nodes. Or, the cancer is not present in the lymph nodes, but has metastasized to one or more regions of the chest wall (ribs, muscles or skin), the nerve close to the lung (phrenic nerve), or the layers covering the heart (mediastinal pleura and parietal pericardium). Or, the cancer is less than 7 cm, but there are multiple tumors in the same lung lobe.

[0034] Stage III is divided into three stages: IIIA, IIIB, and IIIC. Stage III is sometimes called locally advanced lung cancer. In stage IIIA, the cancer is 5 cm or less in size and has spread to lymph nodes in the middle of the chest on the same side as the tumor. Or, the cancer is 5 cm to 7 cm in size and there are multiple tumors in the same lobe of the lung. Or, the cancer has spread to one or more of the following areas just outside the lung: the chest wall (ribs, muscles, or skin), a nerve near the lung (phrenic nerve), the layer covering the heart (mediastinal pleura and parietal pericardium), or lymph nodes within or near the lung. Or, the cancer is larger than 7 cm. It has not spread to lymph nodes but has spread to one or more of the following sites: the muscle under the lung (diaphragm), the middle of the chest (mediastinum), the heart, major blood vessels, the windpipe (trachea), the nerve leading to the vocal cords (larynx), the esophagus, the spinal column, or the point where the trachea divides (carina). Or, the cancer is present in multiple lobes of the same lung and there may also be cancer cells in lymph nodes near the affected lung.

[0035] Stage IIIB also has various meanings. The cancer is less than 5 cm in size and has spread to lymph nodes in the chest, neck, or above the collarbone on the side opposite the affected lung. Or, the cancer is 5 cm to 7 cm in size and has spread to lymph nodes in the middle of the chest. Or, regardless of the size of the cancer, it has spread to lymph nodes in the middle of the chest and has spread to one or more of the chest wall, the muscle under the lung (diaphragm), or the layer covering the heart (mediastinal pleura and parietal pericardium). Or, the cancer has spread to lymph nodes in the middle of the chest. The lung tumor is more than 7 cm or has spread to major structures in the chest such as the heart, windpipe (bronchi), esophagus (esophageal tube), or major blood vessels.

[0036] Stage IIIC means that the size of the cancer is between 5 cm and 7 cm, or it has spread to one or more of the nerves near the lungs (the vagus nerve) or the membrane covering the heart (the pericardium), and there is metastasis to the center of the chest on the side opposite to the affected lung, or to the upper part of the same or the opposite lung, or to the lymph nodes above the collarbone. Alternatively, there are multiple tumors in different lobes of the same lung. Alternatively, Stage IIIC means that the cancer is larger than 7 cm, or it has metastasized to any of the muscles under the lungs (the diaphragm), the center of the chest (the mediastinum), the heart, the major blood vessels, the trachea (the bronchus), the nerve leading to the vocal cords (the recurrent laryngeal nerve), the esophagus (the esophagus tube), the vertebrae or the part where the trachea divides (the carina), and there is metastasis to the center of the chest on the side opposite to the affected lung, or to the upper part of the same or the opposite lung, or to the lymph nodes above the collarbone. Alternatively, there are tumors in multiple lung lobes.

[0037] Stage IV means that the lung cancer has metastasized. It is also called advanced lung cancer. Stage IV is divided into Stage IVA and IVB. Stage IVA means that there is cancer in both lungs, the cancer is in the membrane of the lungs (the pleura) or the membrane of the heart (the pericardium), or there is body fluid containing cancer cells around the lungs or the heart. Alternatively, it may mean that there is a single area of cancer that has spread to the lymph nodes outside the chest or to organs such as the liver or bones.

[0038] Stage IVB means that the cancer has spread to multiple areas of one or more organs. In one embodiment, the lung cancer is non-small cell lung cancer (NSCLC) or small cell lung cancer (SCLC). In a preferred embodiment, the lung cancer is non-small cell lung cancer (NSCLC). In a more preferred embodiment, NSCLC is lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0039] As used herein, the term "small cell lung cancer (SCLC)" refers to a type of highly malignant cancer that occurs in the lungs. Small cell carcinoma of the lung usually appears in the center of the airway, infiltrates the submucosa, and narrows the bronchus. Common symptoms include cough, dyspnea, weight loss, and weakness. Compared with non-small cell carcinoma, small cell carcinoma has a short doubling time, a high growth rate, and early metastasis. SCLC accounts for approximately 15% of all lung cancers.

[0040] Small cell lung cancer is clinically and pathologically divided into two stages: limited stage (LS) and extensive stage (ES). Generally, this staging is determined by the presence or absence of metastasis, whether the tumor is confined to the chest, and whether the total amount of the tumor in the chest is within the target range of single radiotherapy. Generally, when the tumor is confined to one lung and the lymph nodes close to that lung, the cancer is said to be LS. If the cancer has spread further, it is said to be ES.

[0041] As used herein, the term "non-small cell lung cancer (NSCLC)" refers to any epithelial lung cancer other than small cell lung cancer (SCLC). NSCLC accounts for approximately 85% of all lung cancers. NSCLC has a relatively low reactivity to chemotherapy compared with small cell lung cancer. If possible, it is mainly treated by surgical resection for the purpose of radical cure, but chemotherapy is increasingly being used both preoperatively (neoadjuvant chemotherapy) and postoperatively (adjuvant chemotherapy). In one embodiment, NSCLC is squamous cell carcinoma, large cell carcinoma, or adenocarcinoma.

[0042] As used herein, the term "diagnosis of lung cancer" means determining whether a patient shows signs of lung cancer or has lung cancer. As used herein, the term "observation of a patient suspected of having lung cancer" means determining whether a patient suspected of having lung cancer develops lung cancer over time. As used herein, the term "observation of lung cancer patients" means determining the onset of lung cancer over time in a patient, for example, determining the progression of lung cancer in a patient, no progression / stability in a patient, or improvement over time.

[0043] As used herein, the term "(therapeutic) treatment / therapy" means any treatment / therapy that improves a patient's health condition and / or prolongs (increases) a patient's lifespan. Such treatment / therapy can eliminate a patient's disease, prevent, suppress, or delay the progression of a patient's disease, reduce the frequency or severity of a patient's symptoms, and / or reduce the recurrence of a patient who has had a disease currently or in the past.

[0044] As used herein, the term "lung cancer treatment" refers to protocols, methods, and / or agents that can be used for the prevention, management, treatment, and / or improvement of lung cancer. In particular, as used herein, the term "lung cancer treatment" means achieving one or more of (i) inhibition of tumor growth and / or tumor cell death, (ii) reduction of tumor markers, (iii) reduction of tumor lesions and metastases, (iv) reduction of tumor burden demonstrated by imaging diagnosis (e.g., computed tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction of tumor burden demonstrated by clinical evaluation or self-reporting by the patient.

[0045] Specifically, lung cancer treatment includes, but is not limited to, pharmacotherapy, supportive therapy, and / or other therapies useful for the prevention, management, treatment, and / or improvement of lung cancer known to those skilled in the art such as medical practitioners. More specifically, lung cancer treatment includes surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, hyperthermia therapy, and administration of drugs, or combinations thereof, such as a combination of chemotherapy and immunotherapy, but is not limited thereto.

[0046] As used herein, the term "patient" refers to an individual for whom it is desired to know whether that person has lung cancer. In particular, as used herein, the term "patient" refers to an individual suspected of having lung cancer. A patient may be diagnosed as having lung cancer, i.e., being ill, or may be diagnosed as not having lung cancer, i.e., being healthy. Also, a patient may be an individual who is observed to determine whether lung cancer has developed or further progressed in the patient over time. In particular, a patient may be observed in the form of longitudinal observation. Thus, the course of lung cancer in a patient (especially after or during treatment) may be observed over time. Also, a patient may be re-examined for lung cancer and diagnosed as to whether lung cancer has developed over time.

[0047] It should be noted that patients diagnosed as healthy, i.e., not having lung cancer, may have an undetected or unknown other disease or condition. A patient may be any mammal, including humans and other mammals such as rabbits, mice, rats, or monkeys. Human individuals are particularly preferred.

[0048] As used herein, the term "(control) subject" refers to a subject known not to have lung cancer (negative control), i.e., a healthy subject. The term "(control) subject" as used herein also refers to a subject known to have lung cancer (positive control), i.e., a subject with a disease.

[0049] It should be noted that (control) subjects known to be healthy, i.e., subjects not having cancer, may have an undetected / unknown other disease or condition. (Control) subjects may be any mammal, including both humans and other mammals, such as animals like rabbits, mice, rats, or monkeys. Healthy human individuals are particularly preferred.

[0050] As used herein, the term "blood sample" encompasses whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. More preferably, the blood cell fraction includes / comprises red blood cells, white blood cells, and / or platelets. Even more preferably, the blood cell fraction is a fraction of white blood cells or a mixture of red blood cells and white blood cells and platelets.

[0051] The volume of the blood sample is preferably between 0.01 and 20 ml, more preferably between 0.1 and 10 ml, even more preferably between 0.5 and 8 ml, and most preferably between 1 and 5 ml. The blood sample can be provided by collecting blood from a patient or a (control) subject, but can also be provided by using a previously separated sample. For example, the blood sample can be collected from a patient or a (control) subject by conventional blood collection techniques.

[0052] The blood sample can further be collected from a patient or a (control) subject before, during, and / or after the start of a treatment procedure. When the blood sample is obtained from at least one (control) subject, for example, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or 1,000 (control) subjects, it is designated as a "reference blood sample". Preferably, the reference blood sample is from the same source as the blood sample of the patient being tested, for example, both are whole blood samples or blood cell fractions. Even more preferably, both are of the same species, for example, derived from humans. Also, (alternatively or additionally) preferably, the measured values of the reference blood sample of the (control) subject and the blood sample of the patient being tested are the same, for example, both have the same volume. It is particularly preferred that the reference blood sample and the blood sample are from (control) subjects / patients of the same sex and of a similar age.

[0053] Whole blood samples can be collected using blood collection tubes. For example, they can be collected using PAXgene Blood RNA tubes, Tempus Blood RNA tubes, EDTA tubes, Na-citrate tubes, heparin tubes, or ACD tubes (Acid citrate dextrose). Alternatively, whole blood samples can be collected using blood collection tubes containing cell-free nucleic acid stabilizing chemical agents such as glutaraldehyde, formaldehyde, or the like (e.g., Streck cfRNA BCT tubes, Streck cfDNA BCT tubes), or cell aggregating agents such as polyethylene glycol (PEG) (e.g., Norgen cfDNA / cfRNA preservation tubes).

[0054] As used herein, "blood sample", particularly "whole blood sample", can also be collected by, for example, the dried blood spot technique using a Mitra Microsampling Device. In this technique, usually, in the case of humans, a small sample of 45 to 60 μl or less may be sufficient. For example, whole blood can be collected from a patient by fingertip puncture using a needle or lancet. Thus, the whole blood sample can take the form of a blood droplet. The blood droplet is then placed on an absorbent probe that can absorb whole blood, such as a hydrophilic polymer material like cellulose. After sampling is complete, before transporting or mailing to the laboratory for processing, the blood spot is dried in air. Since the blood is dried, it is not considered harmful. Therefore, no special precautions are required during handling or shipping. After arriving at the analysis site, the desired components, such as RNA molecules as described herein, are extracted from the dried blood spot into the supernatant and further analyzed. In this way, the level of RNA molecules is determined. This technique is suitable for the purpose of observing or screening lung cancer patients at home (in a home care / home sampling mode).

[0055] In the methods described herein, the level of one RNA molecule or the levels of multiple RNA molecules in a patient's blood sample are determined. As used herein, the term "level" refers to the amount of the RNA molecule (e.g., measured in grams, moles, or ion counts) or concentration (e.g., absolute or relative concentration, e.g., reads per million (RPM) or NGS count). The term "level" as used herein also includes scaled, normalized, or scaled and normalized amounts or values (e.g., RPM). In particular, the level of the RNA molecule is determined by sequencing, preferably next-generation sequencing (e.g., ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or beads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. Specifically, the level of the RNA molecule is the expression level of the RNA molecule.

[0056] One of ordinary skill in the art will understand that in many of the embodiments described herein, the determined RNA molecule level is compared to an appropriate RNA molecule "reference level". Specifically, the level of the RNA molecule is compared to the reference level of the RNA molecule. More specifically, the reference level of the RNA molecule is determined in a blood sample of a (control) subject. Even more specifically, the reference level is determined empirically by measuring a plurality of reference blood samples taken from subjects known to have lung cancer or a plurality of reference blood samples taken from subjects known not to have lung cancer. Typically, as will be understood by one of ordinary skill in the art, the reference level is determined under conditions similar to those utilized to determine or analyze the RNA molecule level in the patient's blood sample.

[0057] In the method described herein, the level of at least one RNA molecule is compared to a reference level of the at least one RNA molecule. The reference level is the level determined by measuring a reference blood sample. For example, if the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 is determined in a patient's blood sample, this level is compared to the reference level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 determined in the reference blood sample.

[0058] Alternatively, in the method described herein, the levels of at least two RNA molecules are compared to the reference levels of the at least two RNA molecules. The reference levels are the levels determined by measuring a reference blood sample. For example, if the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and the level of an RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 are determined in a patient's blood sample, both levels are compared to their respective reference levels. That is, the level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 is compared to the reference level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 1, and the level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 is compared to the reference level of the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 determined in the reference blood sample.

[0059] The reference level may be a cut-off level or a threshold level. Generally, the cut-off level or threshold level can be determined experimentally, empirically, or theoretically. The cut-off level or threshold level can also be arbitrarily selected based on existing experimental and / or clinical conditions, as will be recognized by those skilled in the art. The cut-off level or threshold level must be determined to obtain optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical outcomes of false positives and false negatives). The cut-off level or threshold level may be a cut-off or threshold score, or may be converted to a cut-off or threshold score.

[0060] Typically, the optimal sensitivity and specificity (and thus the cut-off or threshold level / score) can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data. For example, after determining the RNA molecule levels in a reference group, algorithm analysis can be used to perform statistical processing on the measured RNA molecule levels in the samples to be tested, and a significant classification criterion for sample classification can be obtained. The ROC curve is mainly used in clinical biomarker tests. The ROC curve is a comprehensive indicator that reflects two continuous variables: the true positive rate (sensitivity) and the false positive rate (1 - specificity). The ROC curve reveals the relationship between sensitivity and specificity using an image synthesis method. A series of different cut-off or threshold levels / scores are set as continuous variables, and a series of sensitivity and specificity values are calculated. Next, a curve is plotted with sensitivity on the vertical axis and specificity on the horizontal axis.

[0061] An important indicator is the area under the ROC curve value (AUC value). If this area is equal to 1.0, both sensitivity and specificity are 1.0, so there are no false positives or false negatives, and the test is 100% accurate (has 100% precision). For a non - discriminatory test, the AUC value is 0.5. The AUC value is usually between 0.5 and 1.0. However, according to information theory, if the results are interpreted inversely, an AUC value less than 0.5 is also equally good. Therefore, according to the present invention, an AUC value close to 1 (e.g., 0.95) is as good an indicator for clinical tests as an AUC value close to 0 (e.g., 0.05). In other words, when the AUC value is greater than 0.5, the diagnostic result becomes more accurate as the AUC value approaches 1. On the other hand, when the AUC value is less than 0.5, the diagnostic result becomes more accurate as the AUC value approaches 0.

[0062] As used herein, the term "classifier" refers to a predictive model that enables samples to be distinguished or characterized by classifying a given sample into a given class based on specific characteristics of the sample. For example, if a patient with an unknown diagnostic result belongs to one of two given classes, i.e., either the class of subjects with a disease or the class of healthy subjects, the classifier can make predictions with relatively high sensitivity and specificity. The output is given as a probability of belonging to any class between 0 and 1. Specifically, the classifier can distinguish between patients with lung cancer and patients without lung cancer, i.e., patients who are healthy with respect to lung cancer.

[0063] As used herein, the term "point-of-care testing (POCT)" refers to a medical diagnostic test that is performed at or near the point of care, which is the time and place of individual care. This is in contrast to the historical pattern where testing was almost entirely limited to medical laboratories, specimens had to be sent from the point of care, and it took hours to days to obtain results, during which care had to be continued without the necessary information. Point-of-care testing is a simple medical test that can be performed at the bedside. The main purpose of POCT is to provide a convenient and rapid test for the test subject. This enables the subject, physician, and medical team to receive test results more quickly and make immediate clinical management decisions. POCT is often performed using portable, transportable, and handheld devices and test kits. If handheld devices are not available, it is also possible to use small bench analyzers or stationary devices, with the aim of collecting specimens at or near the location of the patient and obtaining results in a very short time so that the treatment plan can be adjusted as needed before the patient is discharged.

[0064] In the context of the present invention, the term "parts kit (abbreviation: kit)" is understood to be any combination of at least some of the components specified herein, which coexist spatially and are combined into a functional unit and can include additional components.

[0065] Next, the present invention will be further described. In the following, different aspects of the invention will be defined in more detail. Each aspect thus defined can be combined with any one or more other aspects, unless the contrary is clearly indicated. In particular, any feature indicated as being preferred or advantageous can be combined with any feature indicated as being preferred or advantageous, unless the contrary is clearly indicated.

[0066] The inventors have identified novel RNA molecules that are significantly overexpressed in lung cancer patients compared to healthy controls. The signature of these novel RNA molecules has been found to be highly relevant for the diagnosis of lung cancer. Therefore, these novel RNA molecules can be used as biomarkers for lung cancer diagnosis and for monitoring lung cancer.

[0067] Accordingly, in a first aspect, the present invention is a (one) (in vitro) method for the diagnosis / detection / determination of lung cancer in a patient, comprising: (i) determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity, (ii) determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, and the second RNA molecule includes a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, or, (iii) determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, the second RNA molecule includes a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, and relates to a method comprising the step.

[0068] Preferably, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, or the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3.

[0069] In particular, at least two RNA molecules are configured as a set. In other words, at least two RNA molecules represent a signature. This signature can cover, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, or 79 RNA molecules, in particular 2, 5, 6, 10, 18, 38, or 54 RNA molecules (RNA molecule signature).

[0070] In embodiment (i), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto is determined, or the level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto is determined.

[0071] Accordingly, the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, and the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising the nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, is determined in a blood sample from a patient, or the level of an RNA molecule comprising the nucleotide sequences from SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, is determined in a blood sample from a patient.

[0072] Specifically, the level of the RNA molecule is (i) the nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably between 1 and 12, more preferably between 1 and 8, most preferably between 1 and 5 or between 1 and 3, for example, a fragment that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides, shorter than the nucleotide sequence according to (i), or A nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence according to (iii)(i) or a fragment of the nucleotide sequence according to (ii). is determined in a blood sample.

[0073] In embodiment (ii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80% sequence identity thereto, or the level of an RNA molecule comprising a nucleotide sequence from SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and at least one additional RNA molecule selected from the group consisting of a sequence having at least 80% sequence identity thereto is determined.

[0074] Accordingly, the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity; and the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity; and the level of at least one additional RNA molecule selected from the group consisting of the RNA molecule comprising the nucleotide sequences from SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity; or determined in a blood sample from a patient; or the level of at least one additional RNA molecule selected from the group consisting of the RNA molecule comprising the nucleotide sequences from SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity is determined in a blood sample from a patient.

[0075] Specifically, (i) the nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) A nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example, a fragment that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides, or, (iii) A nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii), The level of the RNA molecule containing it is determined in the blood sample.

[0076] Preferably, (i) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule containing the nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (ii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule containing the nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iv) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule containing the nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (v) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (vi) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (vii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (viii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (ix) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or (x) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is determined.

[0077] More preferably, (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, (ix) SEQ ID NO: 1 to SEQ ID NO: 54, or (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, and SEQ ID NO: 71, The level of an RNA molecule comprising a nucleotide sequence according to is determined.

[0078] In embodiment (iii), the level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto is determined.

[0079] Accordingly, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, and the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, and at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, is determined in a blood sample from a patient.

[0080] Specifically, (i) nucleotide sequences from SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence of (i), preferably 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the nucleotide sequence according to (i), or A nucleotide sequence according to (iii)(i) or a nucleotide sequence fragment according to (ii) having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity. The level of the RNA molecule containing is determined in the blood sample.

[0081] Preferably, (i) The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or, (ii) The level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

[0082] More preferably, (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or, (ii) The level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75 is determined.

[0083] The above (six) signatures, which include RNA molecules comprising nucleotide sequences according to SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75, were obtained in blood samples collected using a Mitra Microsampling Device. RNA molecules were isolated from dried blood spots (DBS) and then used in molecular biological assays, particularly to determine the levels of these RNA molecules.

[0084] In a preferred embodiment (i), the level of at least one RNA molecule is compared to a reference. In particular, the level of at least one RNA molecule is compared to a reference level of that RNA molecule. From this comparison, it is possible to diagnose lung cancer in a patient, particularly a patient suspected of having lung cancer. The patient is diagnosed as having lung cancer, i.e., being diseased, or not having lung cancer, i.e., being healthy.

[0085] The reference, such as the reference level, can be anything as long as it can determine whether a patient has lung cancer or not. The reference level may be obtained from (control) subjects, i.e., subjects different from the patient being tested, such as healthy subjects and / or subjects known to have lung cancer, or it may be obtained from the same patient. In the latter case, the patient may be re-tested for lung cancer, for example, in the form of longitudinal observation. The patient may currently be determined to have lung cancer or still not have lung cancer.

[0086] More specifically, the reference level is the level of at least one RNA molecule empirically determined by measuring a plurality of reference blood samples taken from subjects known to be healthy (not having lung cancer) and / or subjects known to have lung cancer.

[0087] For example, The reference level is determined from at least two, at least ten, at least fifty, at least one hundred, at least two hundred, at least three hundred, at least four hundred, at least five hundred, at least one thousand, at least one thousand five hundred, at least two thousand, at least five thousand reference samples from healthy subjects, and / or the reference level is determined from at least two, at least ten, at least fifty, at least one hundred, at least two hundred, at least three hundred, at least four hundred, at least five hundred, at least one thousand, at least one thousand five hundred, at least two thousand, at least five thousand reference samples from subjects known to have lung cancer.

[0088] Specifically, the reference level is the average reference level. This is determined by measuring the reference levels of control subjects (e.g., healthy subjects or lung cancer patients / subjects known to have lung cancer) and calculating the "average" value (e.g., mean, median, or mode) thereof. The reference blood sample is preferably the same as the blood sample taken from the patient to be tested (e.g., blood cells, serum, or plasma). Further, the reference level is preferably obtained from control subjects (e.g., healthy subjects or lung cancer patients / subjects known to have lung cancer) of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be tested. In particular, the reference level represents the average value of RNA molecules in a population of healthy subjects, and / or the reference level represents the average value of RNA molecules in a population of lung cancer patients / subjects known to have lung cancer.

[0089] Preferably, the reference level is the level of at least one RNA molecule empirically determined by measuring a large number of reference blood samples taken from subjects known to be healthy (not having lung cancer), and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being above the reference level indicates that the patient has lung cancer, and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being below the reference level indicates that the patient has lung cancer.

[0090] Alternatively, or in addition, the reference level is the level of at least one RNA molecule empirically determined by measuring a number of reference blood samples taken from subjects known to have lung cancer, and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being below the reference level indicates that the patient is healthy (not suffering from lung cancer), and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being above the reference level indicates that the patient is healthy (not suffering from lung cancer).

[0091] Specifically, the level of the RNA molecule is above or below the reference level by at least 0.6-fold or 0.7-fold, more specifically at least 0.8-fold or 0.9-fold, even more specifically at least 1.2-fold or 1.5-fold, and even more specifically at least 2.0-fold or 3.0-fold. For example, the level of the RNA molecule is above or below the reference level by at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold.

[0092] In preferred embodiment (ii), the levels of at least two RNA molecules are compared to a reference. In particular, the levels of at least two RNA molecules are compared to the reference level of the RNA molecule.

[0093] By the above comparison, lung cancer in a patient, particularly a patient suspected of having lung cancer, can be diagnosed. The patient may be diagnosed as having lung cancer, i.e., being ill, or not having lung cancer, i.e., being healthy.

[0094] A criterion such as a reference level may be a criterion such as a reference level that enables determination of whether a patient has lung cancer. The reference level may be obtained from a (control) subject (i.e., a subject different from the patient being tested, e.g., a healthy subject and / or a subject known to have lung cancer), or from the same patient. In the latter case, the patient may be re-examined for lung cancer, for example, in the form of longitudinal observation. It is possible to determine whether the patient currently has lung cancer or still does not have lung cancer.

[0095] More specifically, the reference levels are the levels of at least two RNA molecules that are empirically determined by measuring a plurality of reference blood samples taken from subjects known to be healthy (not suffering from lung cancer) and / or subjects known to be suffering from lung cancer. For example, the reference levels are determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or the reference levels are determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects clearly diagnosed with lung cancer.

[0096] Specifically, the reference levels are average reference levels. These are determined by measuring the reference levels of control subjects (e.g., healthy subjects or subjects with lung cancer / known to have lung cancer) and calculating the "average" value (e.g., mean, median or mode). In particular, the reference levels represent the average value of RNA molecules in a healthy subject population and / or the reference levels represent the average value of RNA molecules in a subject population with lung cancer / known to have lung cancer. In this regard, it should be noted that for each RNA molecule, a level is determined and that level is compared to the respective reference levels of the same RNA molecule.

[0097] Preferably, the reference level is the level of at least two RNA molecules empirically determined by measuring a large number of reference blood samples taken from subjects known to be healthy (not having lung cancer), and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being above the reference level indicates that the patient has lung cancer, and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being below the reference level indicates that the patient has lung cancer.

[0098] Alternatively, or in addition, the reference level is the level of at least two RNA molecules empirically determined by measuring a plurality of reference blood samples taken from subjects known to have lung cancer, and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being below the reference level indicates that the patient is healthy (not suffering from lung cancer), and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being above the reference level indicates that the patient is healthy (not suffering from lung cancer).

[0099] Specifically, the level of the RNA molecule is above or below the reference level by at least 0.6-fold or 0.7-fold, more specifically at least 0.8-fold or 0.9-fold, even more specifically at least 1.2-fold or 1.5-fold, and even more specifically at least 2.0-fold or 3.0-fold. For example, the level of the RNA molecule is above or below the reference level by at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold.

[0100] In preferred embodiment (iii), the levels of at least two RNA molecules are compared to a standard. In particular, the levels of at least two RNA molecules are compared to the reference level of the RNA molecule.

[0101] By this comparison, the lung cancer of a patient, particularly a patient suspected of having lung cancer, can be diagnosed. The patient is diagnosed as having lung cancer, i.e., being ill, or not having lung cancer, i.e., being healthy.

[0102] A standard such as the reference level may be a standard such as the reference level that enables determination of whether a patient has lung cancer. The reference level may be obtained from a (control) subject (i.e., a subject different from the patient being tested, such as a healthy subject and / or a subject known to have lung cancer), or may be obtained from the same patient. In the latter case, the patient may be reexamined for lung cancer, for example, in the form of longitudinal observation. The patient may currently be determined to have lung cancer or still not have lung cancer.

[0103] More specifically, the reference level is the level of at least two RNA molecules empirically determined by measuring a plurality of reference blood samples taken from subjects known to be healthy (not suffering from lung cancer) and / or subjects known to be suffering from lung cancer.

[0104] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects and / or the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have been diagnosed with lung cancer.

[0105] Specifically, the reference level is the average reference level. These are determined by measuring the reference levels of control subjects (e.g., healthy subjects or subjects with lung cancer / known to have lung cancer) and calculating the "average" value (e.g., mean, median or mode) thereof. In particular, the reference level represents the average value of RNA molecules in a healthy subject population and / or the reference level represents the average value of RNA molecules in a subject population with lung cancer / known to have lung cancer. In this regard, it should be noted that for each RNA molecule, a level is determined and that level is compared to the respective reference levels of the same RNA molecule.

[0106] Preferably, the reference level is the level of at least two RNA molecules empirically determined by measuring a number of reference blood samples taken from subjects known to be healthy (not having lung cancer), and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being above the reference level indicates that the patient has lung cancer, and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being below the reference level indicates that the patient has lung cancer.

[0107] Alternatively or in addition, the reference level is the level of at least two RNA molecules empirically determined by measuring a plurality of reference blood samples taken from subjects known to have lung cancer, and the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 being below the reference level indicates that the patient is healthy (not suffering from lung cancer), and / or the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 being above the reference level indicates that the patient is healthy (not suffering from lung cancer).

[0108] Specifically, the level of the RNA molecule is above or below the reference level by at least 0.6-fold or 0.7-fold, more specifically at least 0.8-fold or 0.9-fold, even more specifically at least 1.2-fold or 1.5-fold, and even more specifically at least 2.0-fold or 3.0-fold. For example, the level of the RNA molecule is above / below the reference level by at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold.

[0109] In alternative or additional embodiments (i), the level of at least one RNA molecule is used in a mathematical calculation to obtain a numerical value (z). In particular, the level of at least one RNA molecule is used in a mathematical calculation to obtain a numerical value (z) by multiplying each level by a corresponding factor (weight), summing all the resulting products, and adding a constant (bias). This calculation result (x) is used as an input to the logistic function 1 / (1 + exp(-x)), and z is calculated. This mathematical calculation is called logistic regression, and the weights and bias are optimized based on the data (RNA levels) to predict the result (cancer or healthy).

[0110] Preferably, the numerical value (z) is compared with a cut-off score (y) (determined empirically). Based on the cut-off score (y), patients can be classified as lung cancer patients or non-lung cancer patients (healthy).

[0111] Regarding embodiment (i): More preferably, the numerical value (z) is calculated as follows for SEQ ID NO: 1: z = f(1.00 * x1 +- 5.24), f(x) = 1 / (1 + exp(-x)) Here, x1 is the normalized log2-RPM representation of array number 1, RPM means the number of reads per million, the cut-off score (y) is 0.5, and when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, when less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0112] In alternative or additional embodiments (ii) and / or (iii), the levels of at least two RNA molecules are used in a mathematical calculation to determine the numerical value (z). In particular, the levels of at least two RNA molecules are multiplied by corresponding factors (weights), all the resulting products are summed, and a constant (bias) is added, thereby being used in a mathematical calculation to determine the numerical value (z). The result of this calculation (x) is used as the input to the logistic function 1 / (1 + exp(-x)), and z is calculated. This mathematical calculation is called logistic regression, and the weights and bias are optimized based on the data (RNA levels) to predict the result (cancer or healthy).

[0113] Specifically, a numerical value is obtained by summing the weighted levels of at least two RNA molecules, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules (e.g., 71 or 79 RNA molecules). In this regard, the method further includes the step of determining a numerical value by summing the weighted levels of at least two RNA molecules, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules (e.g., 71 or 79 RNA molecules). By at least two RNA molecules, it means an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, or an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79.

[0114] Alternatively, by at least two RNA molecules, it means an RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 and SEQ ID NO: 3, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79.

[0115] At least two RNA molecules can also be designated as an RNA molecule signature. Preferably, the numerical value is compared to a cut-off score (y) (determined empirically). The cut-off score (y) allows the patient to be classified as a lung cancer patient or as a patient who is not a lung cancer patient (is healthy).

[0116] Regarding embodiment (ii): More preferably, the numerical value (z) is calculated as follows for the signatures of SEQ ID NO: 1 and SEQ ID NO: 2: z = f(0.95 * x1 + 0.71 * x2 + -5.71), where f(x) = 1 / (1 + exp(-x))). Here, x1 and x2 are the normalized log2-RPM representations of SEQ ID NO: 1 and SEQ ID NO: 2, RPM represents the number of reads per million, the cut-off score (y) is 0.5, and when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, less than 0.5, it indicates that the patient is healthy (does not have lung cancer).

[0117] Even more preferably, the numerical value (z) is calculated as follows for the signatures of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48. z = f(0.94 * x1 + 0.86 * x2 + -0.07 * x19 + -0.33 * x35 + -0.15 * x39 + -0.33 * x48 + -3.86), where f(x) = 1 / (1 + exp(-x)))

[0118] Here, x1, x2, x19, x35, x39, and x48 are for SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48 respectively, RPM means the number of reads per million times, the cut-off score (y) is 0.5, and when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, If it is less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0119] Alternatively, the numerical value (z) is calculated as follows for the signatures of Array No. 1, Array No. 2, Array No. 23, Array No. 39, and Array No. 48. y = f(0.44 * x1 + 0.83 * x2 + 0.45 * x23 + -0.07 * x39 + -0.25 * x48 + -4.34), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x23, x39, and x48 are the standardized log2 - RPM expressions of Array No. 1, Array No. 2, Array No. 23, Array No. 39, and Array No. 48 respectively, RPM means the number of reads per million, the cut - off score (y) is 0.5, and when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0120] Alternatively, the numerical value (z) is calculated as follows for the signatures of Array No. 1, Array No. 2, Array No. 6, Array No. 7, and Array No. 9. z = f(0.84 * x1 + 0.60 * x2 + 0.85 * x6 + 0.23 * x7 + 0.30 * x9 + -6.44), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x6, x7, and x9 are the standardized log2 - RPM expressions of Array No. 1, Array No. 2, Array No. 6, Array No. 7, and Array No. 9 respectively, RPM means the number of reads per million, the cut - off score (y) is 0.5, when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0121] Alternatively, the numerical value (z) is calculated as follows for the signatures of array number 1, array number 2, array number 6, array number 7, array number 11, and array number 18. y = f(0.19 * x1 + 0.62 * x2 + 0.87 * x6 + 0.32 * x7 + 0.40 * x11 + 0.65 * x18 + -6.12), f(x) = 1 / (1 + exp(-x))))

[0122] Here, x1, x2, x6, x7, x11, and x18 are for array number 1, array number 2, array number 6, array number 7, array number 11, and array number 18 respectively. RPM means the number of reads per million times, and the cut-off score (y) is 0.5. When the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer. When less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0123] More preferably, the numerical value (z) is calculated as follows for the signatures: array number 1, array number 2, array number 19, array number 35, array number 38, array number 39, array number 40, array number 43, array number 48, and array number 49. z = f(0.93 * x1 + 0.83 * x2 + -0.09 * x19 + -0.33 * x35 + -0.11 * x38 + -0.13 * x39 + -0.12 * x40 + 0.17 * x43 + -0.29 * x48 + 0.10 * x49 + -4.41), f(x) = 1 / (1 + exp(-x))))

[0124] Here, x1, x2, x19, x35, x38, x39, x40, x43, x48, and x49 are for array number 1, array number 2, array number 19, array number 35, array number 38, array number 39, array number 40, array number 43, array number 48, and array number 49 respectively. RPM means the number of reads per million times, and the cut-off score (y) is 0.5. When the numerical value (z) is If it is greater than 0.5, it indicates that the patient has lung cancer, If it is less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0125] Alternatively, the numerical value (z) is calculated for the signature. For array numbers 1, 2, 17, 23, 35, 39, 45, 48, 52, and 53, the numerical value (z) is calculated as follows. z = f(0.52 * x1 + 0.93 * x2 + -0.22 * x17 + 0.43 * x23 + -0.22 * x35 + -0.08 * x39 + -0.06 * x45 + -0.22 * x48 + -0.32 * x52 + 0.02 * x53 + -1.32), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x17, x23, x35, x39, x45, x48, x52, and x53 are for each of array numbers 1, 2, 17, 23, 35, 39, 45, 48, 52, and 53. RPM means the number of reads per million times, and the cut-off score (y) is 0.5, When the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0126] Alternatively, the numerical value (z) is calculated as follows for the signature: array numbers 1, 2, 6, 7, 9, 19, 25, 29, 30, and 38. z = f(0.83 * x1 + 0.77 * x2 + 0.69 * x6 + 0.31 * x7 + 0.34 * x9 + -0.03 * x19 + -0.58 * x25 + -0.33 * x29 + -0.28 * x30 + -0.19 * x38 + 3.17), f(x) = 1 / (1 + exp(-x))))

[0127] Here, x1, x2, x6, x7, x9, x19, x25, x29, x30, and x38 are for each of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38 respectively, RPM means the number of reads per million times, the cut-off score (y) is 0.5, when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, when less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0128] Alternatively, for the signature: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28, the numerical value (z) is calculated as follows. z = f(0.24*x1 + 0.74*x2 + 0.19*x3 + 0.68*x6 + 0.36*x7 + 0.26*x11 + 0.26*x12 + -0.42*x14 + 0.66*x18 + -0.94*x28 + 4.76), f(x) = 1 / (1 + exp(-x))))

[0129] Here, x1, x2, x3, x6, x7, x11, x12, x14, x18, and x28 are for each of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28 respectively, RPM means the number of reads per million times, the cut-off score (y) is 0.5, when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, when less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0130] Most preferably, for the signature (54), for SEQ ID NO:1 to SEQ ID NO:54, the numerical value (z) is calculated as follows. z = f(0.45 * x1 + 0.83 * x2 + 0.74 * x3 + 0.50 * x4 + -0.48 * x5 + 0.74 * x6 + 0.48 * x7 + 0.55 * x8 + 0.64 * x9 + -0.72 * x10 + 0.39 * x11 + 0.25 * x12 + 0.35 * x13 + -0.34 * x14 + -0.43 * x15 + -0.40 * x16 + -0.34 * x17 + 0.14 * x18 + -0.32 * x19 + -0.52 * x20 + -0.28 * x21 + -0.32 * x22 + -0.28 * x23 + 0.20 * x24 + -0.33 * x25 + -0.24 * x26 + 0.26 * x27 + 0.44 * x28 + -0.11 * x29 + -0.12 * x30 + -0.10 * x31 + 0.25 * x32 + -0.26 * x33 + 0.16 * x34 + -0.15 * x35 + -0.24 * x36 + 0.10 * x37 + -0.11 * x38 + -0.08 * x39 + 0.08 * x40 + 0.05 * x41 + -0.10 * x42 + 0.06 * x43 + 0.06 * x44 + 0.12 * x45 + -0.06 * x46 + 0.10 * x47 + -0.02 * x48 + 0.01 * x49 + -0.04 * x50 + 0.02 * x51 + 0.01 * x52 + 0.04 * x53 + 0.05 * x54 + 0.21), f(x) = 1 / (1 + exp(-x))))

[0131] Here, x1 to x54 are the standardized log2-RPM expressions of array numbers 1 to 54 respectively, RPM means the number of reads per million times, and the cut-off score (y) is 0.5, When the numerical value (z) is, greater than 0.5, it indicates that the patient has lung cancer, less than 0.5, it indicates that the patient is healthy (not having lung cancer).

[0132] Alternatively, the numerical value (z) is calculated as follows for (38) signatures: array number 1, array number 2, array number 3, array number 6, array number 7, array number 8, array number 10, array number 11, array number 12, array number 14, array number 16, array number 17, array number 18, array number 21, array number 22, array number 24, array number 26, array number 28, array number 29, array number 31, array number 34, array number 55, array number 56, array number 57, array number 58, array number 59, array number 60, array number 61, array number 62, array number 63, array number 64, array number 65, array number 66, array number 67, array number 68, array number 69, array number 70 and array number 71. z = f(0.05 * x1 + 0.83 * x2 + 0.27 * x3 + 0.89 * x6 + 0.35 * x7 + 0.29 * x8 + -0.56 * x10 + 0.14 * x11 + 0.13 * x12 + -0.16 * x14 + -0.21 * x16 + -0.29 * x17 + 0.37 * x18 + -0.21 * x21 + -0.26 * x22 + -0.15 * x24 + -0.26 * x26 + -0.74 * x28 + -0.17 * x29 + -0.17 * x31 + 00.17 * x34 + 0.16 * x55 + 0.18 * x56 + 0.19 * x57 + 0.08 * x58 + 0.27 * x59 + 0.39 * x60 + 0.50 * x61 + 0.24 * x62 + -0.10 * x63 + -0.19 * x64 + -0.12 * x65 + -0.54 * x66 + -0.07 * x67 + -0.20 * x68 + -0.25 * x69 + 0.81 * x70 + -0.19 * x71 + 0.33), where f(x) = 1 / (1 + exp(-x)))

[0133] Here, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are the standardized log2-RPM expressions of array numbers 1, 2, 3, 6, 7, 8, 10, 11, 12, 14, 16, 17, 18, 21, 22, 24, 26, 28, 29, 31, 34, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, and 71 respectively. RPM means the number of reads per million, the cut-off score (y) is 0.5, when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, when it is less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0134] Regarding embodiment (iii): More preferably, the numerical value (z) is calculated as follows for array numbers 2 and 3 which are (two) signatures: z = f(0.800 * x2 + 1.342 * x3 + -8.733), f(x) = 1 / (1 + exp(-x))))

[0135] Here, x2 and x3 are the log2-RPM expressions of array numbers 2 and 3 respectively. RPM represents the number of reads per million, the cut-off score (y) is 0.5, when the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer, when it is less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0136] More preferably, the numerical value (z) is calculated as follows for the (18) signatures: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79. z = f(0.792*x2 + 0.54*x3 + 0.521*x7 + 0.26*x11 + -0.284*x14 + -0.306*x17 + 0.399*x18 + -0.429*x21 + -0.693*x28 + 0.295*x56 + 0.452*x72 + 0.38*x73 + -0.3*x74 + -0.297*x75 + -0.219*x76 + 0.157*x77 + 0.0658*x78 + -0.0421*x79 + 5.203), where f(x) = 1 / (1 + exp(-x)))

[0137] Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the standardized log2-RPM representations of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79 respectively, RPM represents the number of reads per million, and the cut-off score (y) is 0.5. When the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer. When it is less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0138] More preferably, the numerical value (z) is calculated as follows for the (6) signatures (Mitra samples): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75: z = f(19.621 * x2 + 0.638 * x3 + 1.171 * x7 + -0.492 * x17 + -2.400 * x18 + 1.049 * x75 + 3.185), where f(x) = 1 / (1 + exp(-x)))

[0139] Here, x2, x3, x7, x17, x18, x75 are the log2 - RPM expressions for array numbers 2, 3, 7, 17, 18, 75 respectively, where RPM represents the number of reads per million, and the cut - off score (y) is 0.5. When the numerical value (z) is greater than 0.5, it indicates that the patient has lung cancer. When less than 0.5, it indicates that the patient is healthy (not suffering from lung cancer).

[0140] In a second aspect, the present invention is an (in vitro) method for observing a patient suspected of having lung cancer or a patient having lung cancer, comprising: (i) determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto; (ii) determining the level of at least two RNA molecules in the patient's blood sample, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule. The first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, step, or, (iii) determining the levels of at least two RNA molecules in a blood sample of a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, The first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 3, or has a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, step, comprising.

[0141] Preferably, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, or the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3.

[0142] In particular, at least two RNA molecules are configured as a set. In other words, at least two RNA molecules represent a signature. This signature can include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, particularly 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA molecule signature).

[0143] In embodiment (i), the level of at least one further RNA molecule selected from the group consisting of RNA molecules comprising / having a nucleotide sequence according to SEQ ID NOs: 2 to 71, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto is determined, or RNA molecules comprising or having nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and at least 1 additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, are determined.

[0144] Accordingly, the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, the level of an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and at least 1 additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, is determined in a blood sample from a patient, or, The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising the nucleotide sequence from SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, is determined in a blood sample from a patient.

[0145] Specifically, (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a fragment that is shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii) The level of an RNA molecule comprising is determined in a blood sample.

[0146] In embodiment (ii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising the nucleotide sequence from SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising / having a nucleotide sequence from SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

[0147] Accordingly, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, and the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto is determined in a blood sample from a patient, or, The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, is determined in a blood sample from a patient.

[0148] Specifically, (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a fragment of 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides that is shorter than the nucleotide sequence according to (i), or (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii) is determined in the blood sample.

[0149] Preferably, (i) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (ii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (iii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (iv) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (v) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (vi) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (vii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (viii) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. (ix) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or (x) The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

[0150] More preferably, (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52, and SEQ ID NO:53, (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38, (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28, (ix) SEQ ID NOs: 1 to 54, or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71 The level of an RNA molecule comprising a nucleotide sequence according to is determined.

[0151] In embodiment (iii), the level of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO:1 and SEQ ID NOs:4 to 79, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is determined.

[0152] Accordingly, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the level of at least one additional RNA molecule selected from the group consisting of the nucleotide sequence according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, is determined in a blood sample from a patient.

[0153] Specifically, (i) a nucleotide sequence according to SEQ ID NOs: 1 to 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence of (i), preferably a fragment that is shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, such as a fragment of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides, or A nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (iii)(i) or the nucleotide sequence fragment according to (ii) is determined in a blood sample.

[0154] Preferably, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

[0155] More preferably, (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or, (ii) the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75 is determined.

[0156] In preferred embodiment (i), the level of at least one RNA molecule is compared to a reference. In particular, the level of at least one RNA molecule is compared to a reference level of the RNA molecule.

[0157] From the above comparison, the progression of lung cancer in a patient with lung cancer can be observed / determined. It can be determined whether the lung cancer in the patient is worsening, whether the lung cancer in the patient is not worsening / stable, or whether the lung cancer in the patient is improving. From the above comparison, it can also be observed / determined whether the lung cancer in the patient is progressing.

[0158] A criterion such as a reference level can be any criterion such as a reference level that can observe or detect the patient's lung cancer. It may be obtained from a (control) subject (i.e., a subject different from the patient to be examined, such as a subject known to have lung cancer / a subject having lung cancer or a healthy subject).

[0159] More specifically, the reference level is the level of at least one RNA molecule empirically determined by measuring a large number of reference blood samples taken from subjects known to be healthy (not having lung cancer) and / or subjects known to have lung cancer.

[0160] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects, and / or the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have been diagnosed with lung cancer.

[0161] Specifically, the reference level is the average reference level. This is determined by measuring the reference levels of control subjects (e.g., healthy subjects or subjects known to have lung cancer / lung cancer patients), and calculating the "average" value thereof (e.g., average value, median value or mode). The reference blood sample is preferably the same as the blood sample taken from the patient to be examined (e.g., blood cells, serum or plasma). Further, the reference level is preferably obtained from control subjects of the same gender (e.g., female or male) and / or similar age / life stage (e.g., adult or elderly) as the patient to be examined (e.g., healthy subjects or subjects known to have lung cancer / lung cancer patients). In particular, the reference level represents the average value of RNA molecules in a population of healthy subjects, and / or the reference level represents the average value of RNA molecules in a population of lung cancer patients / subjects known to be lung cancer patients.

[0162] In preferred embodiments (ii) and / or (iii), the levels of at least two RNA molecules are compared to a reference. In particular, the levels of at least two RNA molecules are compared to the reference level of the RNA molecule.

[0163] Based on the above comparison, lung cancer in a patient, particularly a patient suspected of having lung cancer, can be diagnosed. The patient is diagnosed as having lung cancer, i.e., being ill, or not having lung cancer, i.e., being healthy.

[0164] A reference such as the reference level may be a reference such as the reference level that enables determination of whether a patient has lung cancer. The reference level may be obtained from a (control) subject (i.e., a subject different from the patient to be examined such as a healthy subject and / or a subject known to have lung cancer), or may be obtained from the same patient. In the latter case, the patient may be re-examined for lung cancer, for example, in the form of longitudinal observation. It may be determined whether the patient currently has lung cancer or still does not have lung cancer.

[0165] More specifically, the reference level is at least two RNA molecules empirically determined by measuring a number of reference blood samples taken from subjects known to be healthy (not having lung cancer) and / or subjects known to have lung cancer.

[0166] For example, the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from healthy subjects and / or the reference level is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000, at least 5000 reference samples from subjects known to have lung cancer.

[0167] Specifically, the reference level is the average reference level. These are determined by measuring the reference levels of control subjects (e.g., healthy subjects or subjects with lung cancer / known to have lung cancer) and calculating the "average" value (e.g., mean, median or mode). In particular, the reference level represents the average value of the RNA molecule in the healthy subject population and / or the reference level represents the average value of the RNA molecule in the lung cancer patient / known lung cancer subject population. In this regard, it should be noted that for each RNA molecule, the level is determined and that level is compared to the respective reference levels of the same RNA molecule.

[0168] Regarding the diagnosis / detection / determination of lung cancer in a patient and each reference level of the respective (control) subjects known not to have lung cancer (i.e., healthy) and / or known to have lung cancer (control), refer to the first aspect of the present invention.

[0169] As already described above, the reference level may be any level at which the patient's lung cancer can be observed or detected. It may be obtained from a (control) subject, i.e., a subject different from the patient being tested, such as a subject known to have lung cancer or a healthy subject. It may also be obtained from the same individual. Alternatively, the reference level may be a level at which the patient's lung cancer can be observed or detected. They may be obtained from a (control) subject, i.e., a subject different from the patient being tested, such as a subject known to have lung cancer or a healthy subject. It may also be obtained from the same individual.

[0170] Thus, in alternative or additional embodiments (i), the observation comprises determining the level of at least one RNA molecule in a blood sample obtained from the patient at a first time point and in at least one additional blood sample obtained from the (same) patient at a later time point, and comparing these levels determined at different time points.

[0171] This procedure enables the observation of lung cancer in a patient (healthy or suffering from lung cancer) over a long period of time, such as several months or years, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 months, or 1, 2, 3, 4 or 5 years.

[0172] The period from the first time point onwards is preferably at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, an individual may be examined periodically, for example once or twice a year. The patient may be (re)examined 2, 3, 4, 5, 6, 7, 8, 9 or 10 times (at the first time point and subsequent time points).

[0173] In alternative or additional embodiments (ii) and / or (iii), the observation comprises determining the levels of at least two RNA molecules in a blood sample obtained from the patient at the first time point and in at least one further blood sample obtained from the (same) patient at a subsequent time point, and comparing the levels determined at different time points.

[0174] In this regard, it should be noted that for each RNA molecule, the levels at the first and subsequent time points are determined and then further compared to each other. This procedure enables the observation of lung cancer in a patient (healthy or with lung cancer) over a long period of several months or years, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 months, or 1, 2, 3, 4 or 5 years.

[0175] The period from the first time point onwards is at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days (1 week), at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 12 months (1 year), at least 24 months (2 years), at least 3 years, at least 4 years, at least 5 years, at least 6 years, at least 7 years, at least 8 years, at least 9 years or at least 10 years. For example, an individual may be examined regularly, e.g., once or twice a year. A patient may be (re)examined at 2, 3, 4, 5, 6, 7, 8, 9, or 10 time points (the first time point and additional time points).

[0176] In preferred embodiments (i), (ii) and / or (iii), the level of an RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 is (i) If it increases over time, it indicates that the patient has developed lung cancer or that the patient's lung cancer has worsened, (ii) If it does not change over time, it indicates that the patient is stable or that the patient's lung cancer is not progressing, or (iii) If it decreases over time, it indicates that the patient's lung cancer is improving.

[0177] Specifically, (i) At the first time point, the patient is healthy, and the level increasing over time indicates that the patient has developed lung cancer. (ii) At the first time point, the patient has lung cancer, and the level increasing over time indicates that the patient's lung cancer is worsening. (iii) At the first time point, the patient has lung cancer, and the level that does not change over time indicates that there is no progression of lung cancer, or (iv) At the first time point, the patient has lung cancer, and the level decreasing over time indicates an improvement in lung cancer.

[0178] More specifically, the patient has received, is receiving, or has received a therapeutic treatment for lung cancer. Even more specifically, the therapeutic treatment for lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, hyperthermia therapy, and administration of drugs, or a combination thereof.

[0179] In preferred embodiments (i), (ii), and / or (iii), the level of an RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, and / or SEQ ID NO: 79 (i) When decreasing over time, indicates that the patient has developed lung cancer or that the patient's lung cancer is worsening. (ii) When not changing over time, indicates that the patient is stable or that the patient's lung cancer is not progressing, or (iii) When increasing over time, indicates that the patient's lung cancer is improving.

[0180] Specifically, (i) At the first time point, the patient is healthy, and the level that decreases over time indicates that the patient has developed lung cancer. (ii) At the first time point, the patient has lung cancer, and the level that decreases over time indicates that the patient's lung cancer is worsening. (iii) At the first time point, the patient has lung cancer, and the level that does not change over time indicates that the patient's lung cancer is not progressing, or (iv) At the first time point, the patient has lung cancer, and the level that increases over time indicates that the patient's lung cancer is improving.

[0181] More specifically, the patient has received, is receiving, or has received therapeutic treatment for lung cancer. Even more specifically, the therapeutic treatment for lung cancer is selected from the group consisting of surgery, chemotherapy, targeted therapy, immunotherapy, oncolytic virus therapy, vaccine therapy, radiation therapy, laser therapy, hyperthermia, and administration of drugs, or a combination thereof.

[0182] In alternative or additional preferred embodiments (i), (ii), and / or (iii), the level of at least one RNA molecule is specifically used in a mathematical calculation to obtain numerical values at different time points (i.e., the first time point and subsequent time points), and then those numerical values are compared to each other, or the levels of at least two RNA molecules are specifically used in a mathematical calculation to obtain numerical values at different time points (i.e., the first time point and subsequent time points), and then those numerical values are compared to each other. The mathematical calculation is performed as described above.

[0183] Specifically, at least two RNA molecules, for example, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, or 79 RNA molecules (e.g., 71 or 79 RNA molecules). A numerical value is obtained by summing the weight levels.

[0184] At least two RNA molecules are an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, or an RNA molecule having a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NO: 2, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79 mean.

[0185] Alternatively, at least two RNA molecules mean an RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 and SEQ ID NO: 3, and optionally at least one RNA molecule having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79. At least two RNA molecules can also be designated as an RNA molecule signature. Preferably, the numerical value is compared with an empirically determined cut-off score.

[0186] Regarding embodiment (i): More preferably, the numerical value (z) is calculated as follows for SEQ ID NO: 1. z = f(1.00 * x1 + -5.24), f(x) = 1 / (1 + exp(-x)))) Here, x1 is the normalized log2-RPM representation of array number 1, RPM represents the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or, if the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0187] Regarding embodiment (ii): More preferably, the numerical value (z) is calculated as follows for signatures: array number 1 and array number 2: z = f(0.95 * x1 + 0.71 * x2 + -5.71), f(x) = 1 / (1 + exp(-x)))) Here, x1 and x2 are the normalized log2-RPM representations of array number 1 and array number 2, RPM represents the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or, if the numerical value (z) is greater than 0.5 and does not increase over time, it indicates that the patient's lung cancer is stable.

[0188] Even more preferably, the numerical value (z) is calculated as follows for signatures: array number 1, array number 2, array number 19, array number 35, array number 39, and array number 48: z = f(0.94 * x1 + 0.86 * x2 + -0.07 * x19 + -0.33 * x35 + -0.15 * x39 + -0.33 * x48 + -3.86), f(x) = 1 / (1 + exp(-x))))

[0189] Here, x1, x2, x19, x35, x39, and x48 are, respectively, for each of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:39, and SEQ ID NO:48. RPM represents the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or if the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0190] Alternatively, the numerical value (z) is calculated as follows for signatures: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48. y = f(0.44*x1 + 0.83*x2 + 0.45*x23 + -0.07*x39 + -0.25*x48 + -4.34), f(x) = 1 / (1 + exp(-x))))

[0191] Here, x1, x2, x23, x39, and x48 are the standardized log2-RPM representations of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48, respectively. RPM represents the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or if the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0192] Alternatively, the numerical value (z) is calculated as follows for signatures: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9. z = f(0.84*x1 + 0.60*x2 + 0.85*x6 + 0.23*x7 + 0.30*x9 + -6.44), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x6, x7, and x9 are the normalized log2-RPM expressions of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9, respectively. RPM means the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or if the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0193] Alternatively, the numerical value (z) is calculated as follows for the signatures: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:11, SEQ ID NO:18. y = f(0.19 * x1 + 0.62 * x2 + 0.87 * x6 + 0.32 * x7 + 0.40 * x11 + 0.65 * x18 + -6.12), f(x) = 1 / (1 + exp(-x))) Here, x1, x2, x6, x7, x11, and x18 are the normalized log2-RPM expressions of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO:18, respectively. RPM means the number of reads per million, the cut-off score (y) is 0.5, if the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or if the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0194] More preferably, the numerical value (z) is calculated as follows for the signatures: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48, and SEQ ID NO:49: z = f(0.93 * x1 + 0.83 * x2 + -0.09 * x19 + -0.33 * x35 + -0.11 * x38 + -0.13 * x39 + -0.12 * x40 + 0.17 * x43 + -0.29 * x48 + 0.10 * x49 + -4.41), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x19, x35, x38, x39, x40, x43, x48, and x49 are the standardized log2-RPM expressions of array numbers 1, 2, 19, 35, 38, 39, 40, 43, 48, and 49, respectively, RPM represents the number of reads per million times, and the cutoff score (y) is 0.5, When the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or, When the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0195] Alternatively, the numerical value (z) is calculated as follows for signatures: array numbers 1, 2, 17, 23, 35, 39, 45, 48, 52, and 53. z = f(0.52 * x1 + 0.93 * x2 + -0.22 * x17 + 0.43 * x23 + -0.22 * x35 + -0.08 * x39 + -0.06 * x45 + -0.22 * x48 + -0.32 * x52 + 0.02 * x53 + -1.32), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x17, x23, x35, x39, x45, x48, x52, and x53 are the standardized log2-RPM expressions of array numbers 1, 2, 17, 23, 35, 39, 45, 48, 52, and 53, respectively, RPM means the number of reads per million times, and the cutoff score (y) is 0.5, If the numerical value (z) is greater than 0.5 and further increasing over time, it indicates that the patient's lung cancer is deteriorating, or, If the numerical value (z) is greater than 0.5 and not further increasing over time, it indicates that the patient's lung cancer is stable.

[0196] Alternatively, for the signature: Array No. 1, Array No. 2, Array No. 6, Array No. 7, Array No. 9, Array No. 19, Array No. 25, Array No. 29, Array No. 30 and Array No. 38, the numerical value (z) is calculated as follows. z = f(0.83 * x1 + 0.77 * x2 + 0.69 * x6 + 0.31 * x7 + 0.34 * x9 + -0.03 * x19 + -0.58 * x25 + -0.33 * x29 + -0.28 * x30 + -0.19 * x38 + 3.17), f(x) = 1 / (1 + exp(-x))))

[0197] Here, x1, x2, x6, x7, x9, x19, x25, x29, x30 and x38 are the standardized log2-RPM representations of Array No. 1, Array No. 2, Array No. 6, Array No. 7, Array No. 9, Array No. 19, Array No. 25, Array No. 29, Array No. 30 and Array No. 38 respectively, RPM means the number of reads per million, and the cut-off score (y) is 0.5, If the numerical value (z) is greater than 0.5 and further increasing over time, it indicates that the patient's lung cancer is deteriorating, or, If the numerical value (z) is greater than 0.5 and not further increasing over time, it indicates that the patient's lung cancer is stable.

[0198] Alternatively, for the signature: Array No. 1, Array No. 2, Array No. 3, Array No. 6, Array No. 7, Array No. 11, Array No. 12, Array No. 14, Array No. 18 and Array No. 28, it is calculated as follows. z = f(0.24 * x1 + 0.74 * x2 + 0.19 * x3 + 0.68 * x6 + 0.36 * x7 + 0.26 * x11 + 0.26 * x12 + -0.42 * x14 + 0.66 * x18 + -0.94 * x28 + 4.76), where f(x) = 1 / (1 + exp(-x)))

[0199] Here, x1, x2, x3, x6, x7, x11, x12, x14, x18, and x28 are the standardized log2-RPM expressions of array numbers 1, 2, 3, 6, 7, 11, 12, 14, 18, and 28 respectively. RPM means the number of reads per million, and the cut-off score (y) is 0.5. If the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or If the numerical value (z) is greater than 0.5 and does not further increase over time, this indicates that the patient's lung cancer is stable.

[0200] Most preferably, the numerical value (z) is calculated as follows for the (54) signatures from array number 1 to array number 54. z = f(0.45 * x1 + 0.83 * x2 + 0.74 * x3 + 0.50 * x4 + -0.48 * x5 + 0.74 * x6 + 0.48 * x7 + 0.55 * x8 + 0.64 * x9 + -0.72 * x10 + 0.39 * x11 + 0.25 * x12 + 0.35 * x13 + -0.34 * x14 + -0.43 * x15 + -0.40 * x16 + -0.34 * x17 + 0.14 * x18 + -0.32 * x19 + -0.52 * x20 + -0.28 * x21 + -0.32 * x22 + -0.28 * x23 + 0.20 * x24 + -0.33 * x25 + -0.24 * x26 + 0.26 * x27 + 0.44 * x28 + -0.11 * x29 + -0.12 * x30 + -0.10 * x31 + 0.25 * x32 + -0.26 * x33 + 0.16 * x34 + -0.15 * x35 + -0.24 * x36 + 0.10 * x37 + -0.11 * x38 + -0.08 * x39 + 0.08 * x40 + 0.05 * x41 + -0.10 * x42 + 0.06 * x43 + 0.06 * x44 + 0.12 * x45 + -0.06 * x46 + 0.10 * x47 + -0.02 * x48 + 0.01 * x49 + -0.04 * x50 + 0.02 * x51 + 0.01 * x52 + 0.04 * x53 + 0.05 * x54 + 0.21), f(x) = 1 / (1 + exp(-x)))

[0201] Here, x1 to x54 are the standardized log2 - RPM expressions of array numbers 1 to 54 respectively, RPM means the number of reads per million times, and the cut - off score (y) is 0.5. When the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or When the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0202] Alternatively, the numerical value (z) is calculated as follows for the (38) signatures: Sequence number 1, Sequence number 2, Sequence number 3, Sequence number 6, Sequence number 7, Sequence number 8, Sequence number 10, Sequence number 11, Sequence number 12, Sequence number 14, Sequence number 16, Sequence number 17, Sequence number 18, Sequence number 21, Sequence number 22, Sequence number 24, Sequence number 26, Sequence number 28, Sequence number 29, Sequence number 31, Sequence number 34, Sequence number 55, Sequence number 56, Sequence number 57, Sequence number 58, Sequence number 59, Sequence number 60, Sequence number 61, Sequence number 62, Sequence number 63, Sequence number 64, Sequence number 65, Sequence number 66, Sequence number 67, Sequence number 68, Sequence number 69, Sequence number 70 and Sequence number 71. z = f(0.05 * x1 + 0.83 * x2 + 0.27 * x3 + 0.89 * x6 + 0.35 * x7 + 0.29 * x8 + -0.56 * x10 + 0.14 * x11 + 0.13 * x12 + -0.16 * x14 + -0.21 * x16 + -0.29 * x17 + 0.37 * x18 + -0.21 * x21 + -0.26 * x22 + -0.15 * x24 + -0.26 * x26 + -0.74 * x28 + -0.17 * x29 + -0.17 * x31 + 0.17 * x34 + 0.16 * x55 + 0.18 * x56 + 0.19 * x57 + 0.08 * x58 + 0.27 * x59 + 0.39 * x60 + 0.50 * x61 + 0.24 * x62 + -0.10 * x63 + -0.19 * x64 + -0.12 * x65 + -0.54 * x66 + -0.07 * x67 + -0.20 * x68 + -0.25 * x69 + 0.81 * x70 + -0.19 * x71 + 0.33), where f(x) = 1 / (1 + exp(-x)))

[0203] Here, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are the standardized log2-RPM expressions of array numbers 1, 2, 3, 6, 7, 8, 10, 11, 12, 14, 16, 17, 18, 21, 22, 24, 26, 28, 29, 31, 34, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, and 71, respectively. RPM means the number of reads per million, and the cut-off score (y) is 0.5. If the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or If the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0204] Regarding embodiment (iii): More preferably, the numerical value (z) is calculated as follows for the (two) signatures: array numbers 2 and 3. z = f(0.800 * x2 + 1.342 * x3 + -8.733), f(x) = 1 / (1 + exp(-x))) Here, x2 and x3 are the log2-RPM expressions of array numbers 2 and 3, respectively. RPM represents the number of reads per million, and the cut-off score (y) is 0.5. If the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or If the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0205] More preferably, the numerical value (z) is calculated as follows for the (18) signatures: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79. z = f(0.792 * x2 + 0.54 * x3 + 0.521 * x7 + 0.26 * x11 + -0.284 * x14 + -0.306 * x17 + 0.399 * x18 + -0.429 * x21 + -0.693 * x28 + 0.295 * x56 + 0.452 * x72 + 0.38 * x73 + -0.3 * x74 + -0.297 * x75 + -0.219 * x76 + 0.157 * x77 + 0.0658 * x78 + -0.0421 * x79 + 5.203), where f(x) = 1 / (1 + exp(-x)))

[0206] Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the standardized log2 - RPM expressions of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79 respectively, RPM means the number of reads per million, and the cut - off score (y) is 0.5. When the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or When the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0207] More preferably, the numerical value (z) is calculated as follows for the (six) signatures (Mitra samples): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75. More preferably, the numerical value (z) is calculated as follows for the (six) signatures (Mitra samples): SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75. z = f(19.621 * x2 + 0.638 * x3 + 1.171 * x7 + -0.492 * x17 + -2.400 * x18 + 1.049 * x75 + 3.185), where f(x) = 1 / (1 + exp(-x))) Here, x2, x3, x7, x17, x18, x75 are the log2-RPM representations of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75, respectively, RPM means the number of reads per million, the cut-off score (y) is 0.5, When the numerical value (z) is greater than 0.5 and further increases over time, it indicates that the patient's lung cancer is deteriorating, or When the numerical value (z) is greater than 0.5 and does not further increase over time, it indicates that the patient's lung cancer is stable.

[0208] The patient may receive a therapeutic treatment during the complete observation process (e.g., administration of a drug), or before, at, or after that first time point (e.g., administration of a drug), and may be re-examined at a later time point. In particular, the first time point is before the start of the therapeutic treatment, and the later time point may be during and / or after the therapeutic treatment. If the therapeutic treatment includes administration of a drug and the patient responds to the treatment, the administration of the drug may be continued, the dose of the drug may be reduced, or the administration of the drug may be discontinued. If the therapeutic treatment includes administration of a drug and the patient does not respond to the treatment, the dose of the drug may be increased, the drug may be changed, or the treatment modality may be changed, for example, from drug administration to surgery, laser treatment, or hyperthermia.

[0209] By therapeutic treatment, an increased level of an RNA molecule can be decreased and / or a decreased level of an RNA molecule can be increased. Alternatively, by therapeutic treatment, an increased numerical value of an RNA molecule can be decreased and / or a decreased numerical value of an RNA molecule can be increased. In this way, the (overall) condition of a patient having lung cancer can be improved.

[0210] In the method of the first aspect, it is preferred that the lung cancer is stage I or II (i.e., early stage lung cancer). Diagnostic tests in this regard can significantly reduce the mortality rate because lung cancer can be detected very early. More preferably, the lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), for example, stage I or II small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0211] In the method of the second aspect, the lung cancer is preferably small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), more preferably lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0212] In the method of the first or second aspect, the patient is preferably a mammal, more preferably a human or a rodent, and even more preferably a human. In the method of the first or second aspect, the blood sample is preferably whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. Even more preferably, the blood cell fraction is a fraction / component of red blood cells, white blood cells, and / or platelets.

[0213] In the method of the first or second aspect, the level of the RNA molecule is preferably determined by sequencing, specifically next-generation sequencing (e.g., ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g., microarray or beads), nucleic acid amplification (e.g., PCR, RT-PCR, qRT-PCR, or high-throughput RT-PCR), polymerase extension, mass spectrometry, flow cytometry (e.g., LUMINEX), or any combination thereof. In the method of the first or second aspect, the level of the RNA molecule is the expression level of the RNA molecule.

[0214] In the third aspect, the present invention is (in vitro), (i) At least one RNA molecule for the diagnosis of lung cancer in a patient, or for the observation of a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto, (ii) At least two RNA molecules for the diagnosis of lung cancer in a patient, or for the observation of a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto, the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto, or, (iii) At least two RNA molecules for the diagnosis of lung cancer in a patient, or for observing a patient suspected of having lung cancer or a patient suffering from lung cancer, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, The first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or has a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or has a sequence having at least 80% sequence identity thereto.

[0215] Preferably, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, or the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3.

[0216] In particular, at least two RNA molecules are constituted as a set. In other words, at least two RNA molecules represent a signature. This signature can include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, particularly 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA signature).

[0217] In embodiment (i), an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient, or, An RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient.

[0218] Accordingly, an RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, is used for the diagnosis or observation of lung cancer in a patient, or, An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, is used for the diagnosis or observation of lung cancer in a patient.

[0219] Specifically, the RNA molecule is, (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a fragment of the nucleotide sequence according to (i), which is shorter than the nucleotide sequence according to (i), preferably 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example a nucleotide sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or, (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (i) or the fragment of the nucleotide sequence according to (ii) is an RNA molecule comprising

[0220] In embodiment (ii): an RNA molecule comprising or having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or monitoring of lung cancer in a patient, or an RNA molecule comprising or having a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or monitoring of lung cancer in a patient.

[0221] Thus, an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 71, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient, or, the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient.

[0222] Specifically, the RNA molecule is (i) A nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) A nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a fragment that is shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example, a fragment of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or (iii) A nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii) is an RNA molecule comprising.

[0223] Preferably, (i) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of a patient's lung cancer), (ii) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of a patient's lung cancer), (iii) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of a patient's lung cancer), (iv) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of lung cancer in a patient), (v) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of lung cancer in a patient), (vi) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of lung cancer in a patient), (vii) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of lung cancer in a patient), (viii) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of lung cancer in a patient), (ix) At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, fragments thereof, and sequences having at least 80% sequence identity thereto is used (for the diagnosis or observation of a patient's lung cancer), or, (x) Nucleotide sequences according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto are used (for the diagnosis or observation of a patient's lung cancer).

[0224] More preferably, (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28, (ix) SEQ ID NOs: 1 to 54, or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71 An RNA molecule comprising a nucleotide sequence according to (is used for the diagnosis or observation of lung cancer in a patient).

[0225] In embodiment (iii): At least one additional RNA molecule selected from the group consisting of SEQ ID NO:1, SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, is used for the diagnosis or observation of lung cancer in a patient.

[0226] Accordingly, the nucleotide sequences according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the nucleotide sequences according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, RNA molecules comprising, and nucleotide sequences according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, the level of at least one additional RNA molecule selected from the group consisting of is used for the diagnosis or observation of lung cancer in a patient.

[0227] Specifically, the RNA molecule is (i) a nucleotide sequence according to SEQ ID NOs: 1 to 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably shorter than the nucleotide sequence according to (i), a fragment that is 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or A nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (iii)(i) or a nucleotide sequence fragment according to (ii) is an RNA molecule comprising

[0228] Preferably (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient, or (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in a patient.

[0229] More preferably (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or (ii) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75 an RNA comprising a nucleotide sequence according to is used for the diagnosis or observation of lung cancer in a patient.

[0230] Diagnosis or observation is carried out, in particular, on a blood sample from a patient. For this purpose, in a blood sample from a patient, the level of RNA molecules is specifically determined / analyzed. Preferably, the blood sample is whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. Even more preferably, the blood cell fraction is / is included a fraction of red blood cells, white blood cells, and / or platelets.

[0231] The lung cancer is preferably in stage I or II (i.e., early-stage lung cancer). Furthermore, the lung cancer is preferably small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), for example, stage I or II small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), in particular lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0232] For other preferred embodiments, reference is made to the first or second aspect of the present invention. In a fourth aspect, the present invention relates to a kit (for (in vitro) use) for diagnosing lung cancer in a patient, or observing a patient suspected of having lung cancer or a patient suffering from lung cancer, the kit comprising (i) means for determining the level of at least one RNA molecule in a blood sample from a patient, wherein the at least one RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, is a fragment thereof, or has a sequence having at least 80% sequence identity thereto, (ii) means for determining the level of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, A means in which the first RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises / has a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, or, (iii) A means for determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, A means comprising a first RNA molecule that comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and a second RNA molecule that comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto.

[0233] Preferably, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, or, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3.

[0234] In particular, at least two RNA molecules are configured as a set. In other words, at least two RNA molecules represent a signature. This signature can include, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78 or 79 RNA molecules, particularly 2, 5, 6, 10, 18, 38 or 54 RNA molecules (RNA signature).

[0235] In embodiment (i): The kit comprises means for determining the level of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, or The kit comprises means for determining the level of an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0236] Accordingly, the kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, or, comprises means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising or having a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0237] Specifically, the RNA molecule is (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71 or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) A nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 18, most preferably 1 to 5 or 1 to 3, for example, a fragment of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or, (iii) A nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99% nucleotide sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii), for example, having at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity is an RNA molecule comprising.

[0238] In embodiment (ii): The kit includes means for determining the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising / having the nucleotide sequences according to SEQ ID NOs: 3 to 71, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, or, The kit includes means for determining the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising / having the nucleotide sequences according to SEQ ID NOs: 3 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0239] Therefore, this kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto, and, means for determining the level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 71, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, or, means for determining the level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto and comprises.

[0240] Specifically, the RNA molecule is (i) a nucleotide sequence according to SEQ ID NO: 1 to SEQ ID NO: 71, or SEQ ID NO: 1 to SEQ ID NO: 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably shorter than the nucleotide sequence according to (i), 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example, a fragment of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or (iii) a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example, at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity to the nucleotide sequence according to (i) or the nucleotide sequence fragment according to (ii) and is an RNA molecule containing the same.

[0241] Preferably, the kit is (i) at least one additional RNA molecule selected from the group consisting of an RNA molecule consisting of a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and a sequence having at least 80% sequence identity thereto, (ii) at least one additional RNA molecule selected from the group consisting of an RNA molecule containing a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and a sequence having at least 80% sequence identity thereto, (iii) at least one additional RNA molecule selected from the group consisting of an RNA molecule containing a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and a sequence having at least 80% sequence identity thereto, (iv) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, or SEQ ID NO: 18, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (v) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, or SEQ ID NO: 49, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (vi) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, or SEQ ID NO: 53, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (vii) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 38, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (viii) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, or SEQ ID NO: 28, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (ix) An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, or, (x) At least one additional RNA molecule selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto Comprising means for determining the level of

[0242] More preferably, the kit (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, (ix) SEQ ID NO: 1 to SEQ ID NO: 54, or (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71 comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to

[0243] In embodiment (iii), the kit comprises means for determining the level of an RNA molecule comprising or having a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, fragments thereof, and at least one further RNA molecule selected from the group consisting of sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% sequence identity thereto.

[0244] Accordingly, the kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto; means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto; and means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0245] Specifically, the RNA molecule is (i) a nucleotide sequence according to SEQ ID NOs: 1 to 79, (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a fragment that is shorter than the nucleotide sequence according to (i) and is 1 to 12, more preferably 1 to 8, most preferably 1 to 5 or 1 to 3, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 nucleotides, or A nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99% sequence identity, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity, to the nucleotide sequence according to (iii)(i) or the nucleotide sequence fragment according to (ii) is an RNA molecule comprising

[0246] Preferably, the kit comprises at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto, or (ii) an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto and means for determining the level of

[0247] More preferably, the kit comprises means for determining the level of an RNA molecule comprising a nucleotide sequence according to (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or (ii) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75

[0248] ​Preferably, the blood sample is whole blood or a blood fraction. More preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. Even more preferably, the blood cell fraction is a fraction / component of red blood cells, white blood cells, and / or platelets.

[0249] The lung cancer is preferably in stage I or II (i.e., early-stage lung cancer). Further, the lung cancer is preferably small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC), for example, stage I or II small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), particularly lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

[0250] For other preferred embodiments, reference is made to the first to third aspects of the present invention. More specifically, the kit comprises means for performing next-generation sequencing (NGS), one or more polynucleotides (probes) for detecting RNA molecules, one or more primers (e.g., primer pairs) for binding to RNA molecules, and / or, one or more antibodies capable of binding to the hybrid of the above polynucleotide (probe) and the above RNA molecule.

[0251] The one or more polynucleotides (probes) may be part of a microarray / biochip or attached to beads for a bead-based multiplex system. The one or more polynucleotides (primers, primer pairs) may be part of an RT-PCR system, a PCR system, or a next-generation sequencing system.

[0252] The above means may further comprise a microarray, an RT-PCR system, a PCR system, a flow cytometer, a Luminex system, and / or a next-generation sequencing system.

[0253] In a preferred embodiment, the kit is useful for carrying out the method of the first or second aspect of the invention. In another preferred embodiment, the kit further comprises instructions for the method of carrying out the method of the first or second aspect of the invention.

[0254] The kit may further comprise a container and / or a data carrier. The data carrier may be a non-electronic data carrier, such as a graphical data carrier like an information pamphlet, an information sheet, a barcode, an access code, etc., or an electronic data carrier such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip, or other semiconductor-based electronic data carriers. The access code may enable access to, for example, an Internet database, a centralized database, or a distributed database. The access code may enable access to application software that causes a computer to perform tasks for a computer user, or to a mobile application that is software designed to operate on a smartphone or other mobile device.

[0255] The data carrier may further include at least one reference, such as one or more reference levels of one or more RNA molecules determined herein and / or one or more cut-off scores. If the data carrier includes an access code that enables access to a database, the at least one reference, such as one or more reference levels of one or more RNA molecules determined herein and / or one or more cut-off scores, may be stored in this database.

[0256] Also, the data carrier may include information or instructions regarding the method of carrying out the method of the first or second aspect of the invention. Also, the kit may include materials desirable from a commercial and user perspective, such as buffers, reagents, and / or diluents for determining the above levels.

[0257] In yet another aspect, the present invention relates to a method for determining / distinguishing / differentiating whether a patient is healthy or suffering from a subtype of lung cancer, particularly whether suffering from small cell lung cancer (SCLC), lung adenocarcinoma (LUAD), or lung squamous cell carcinoma (LUSC), comprising the step of determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the second RNA molecule includes a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0258] In a preferred embodiment, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, The level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and, The level of at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, e.g., at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is determined in a blood sample of a patient.

[0259] Preferably, the level of the RNA molecule determined above is used / considered in a mathematical calculation to obtain a numerical value (z) (thereafter). More preferably, the numerical value is obtained by summing the weighted levels of at least two RNA molecules.

[0260] Even more preferably, the numerical value (z) is compared (thereafter) to an empirically determined cut-off score for a healthy state or a subtype of lung cancer, in particular lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and / or small cell lung cancer (SCLC)). This comparison can determine whether the patient is healthy or suffering from a subtype of lung cancer, in particular LUAD, LUSC or SCLC.

[0261] In another preferred embodiment, (i) The levels of RNA molecules comprising nucleotide sequences according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79 are determined in a blood sample of a patient, (ii) the levels of the RNA molecules determined in step (i) are used / considered in a mathematical calculation to obtain a numerical value (z), (iii) the numerical value (z) is compared with empirically determined cut-off scores for health, adenocarcinoma (LUAD), squamous cell carcinoma (LUSC) and / or small cell lung cancer (SCLC), A numerical value (z) below the cut-off score for LUAD indicates that the patient is healthy (not having lung cancer), A numerical value (z) above the cut-off score for health and below the cut-off score for LUSC indicates that the patient has LUAD, A numerical value (z) below the cut-off score for SCLC and above the cut-off score for LUAD indicates that the patient has LUSC, or, A numerical value (z) above the cut-off score for LUSC indicates that the patient has SCLC.

[0262] Preferably, the numerical value is obtained by summing the weighted levels of at least two RNA molecules. As described above, in yet another aspect, the present invention is a method for determining / distinguishing / identifying whether a patient is healthy or has a subtype of lung cancer, particularly small cell lung cancer (SCLC), lung adenocarcinoma (LUAD), or lung squamous cell carcinoma (LUSC), Determining the levels of at least two RNA molecules in a blood sample from a patient, wherein the at least two RNA molecules include a first RNA molecule and a second RNA molecule, the first RNA molecule includes a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and the second RNA molecule includes a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto.

[0263] In one preferred embodiment, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, such as at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto, and The level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1 and SEQ ID NOs: 4 to 79, fragments thereof, and sequences having at least 80%, preferably at least 85%, more preferably at least 90%, most preferably at least 95% or 99%, for example at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% sequence identity thereto is determined in a blood sample of a patient.

[0264] In a more preferred alternative embodiment, (i) the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79 is determined in a blood sample of a patient and, (ii) the level of the RNA molecule is used / considered in a mathematical calculation to determine numerical values z1 to z4 according to the following formula. z1 = f(-0.639 * x2 + -0.479 * x3 + -0.243 * x7 + -0.264 * x11 + 0.094 * x14 + 0.252 * x17 + -0.271 * x18 + 0.391 * x21 + 0.530 * x28 + -0.215 * x56 + -0.189 * x72 + -0.313 * x73 + 0.000 * x74 + 0.196 * x75 + 0.181 * x76 + -0.075 * x77 + -0.071 * x78 + 0.000 * x79 + -1.823), f(x) = 1 / (1 + exp(-x)))) Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expressions of array numbers 2, 3, 7, 11, 14, 17, 18, 21, 28, 56, 72, 73, 74, 75, 76, 77, 78, 79 respectively, and RPM represents the number of reads per million times, z2 = f(0.142 * x2 + 0.272 * x3 + -0.207 * x7 + 0.000 * x11 + -0.143 * x14 + -0.134 * x17 + 0.008 * x18 + -0.075 * x21 + 0.124 * x28 + -0.023 * x56 + 0.287 * x72 + 0.085 * x73 + -0.448 * x74 + 0.000 * x75 + -0.000 * x76 + 0.076 * x77 + -0.126 * x78 + -0.017 * x79 + -0.712), f(x) = 1 / (1 + exp(-x)))) Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expressions of array numbers 2, 3, 7, 11, 14, 17, 18, 21, 28, 56, 72, 73, 74, 75, 76, 77, 78, 79 respectively, and RPM represents the number of reads per million times, z3 = f(-0.306 * x2 + -0.088 * x3 + 1.368 * x7 + 0.095 * x11 + -0.294 * x14 + 0.140 * x17 + 0.182 * x18 + 0.002 * x21 + -0.099 * x28 + 0.085 * x56 + 0.229 * x72 + -0.216 * x73 + 0.064 * x74 + -0.527 * x75 + 0.066 * x76 + 0.038 * x77 + 0.002 * x78 + -0.053 * x79 + 1.186), f(x) = 1 / (1 + exp(-x)))) Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expressions of array numbers 2, 3, 7, 11, 14, 17, 18, 21, 28, 56, 72, 73, 74, 75, 76, 77, 78, 79 respectively, and RPM represents the number of reads per million, and z4 = f(0.803 * x2 + 0.287 * x3 + -0.587 * x7 + 0.029 * x11 + 0.344 * x14 + -0.257 * x17 + 0.000 * x18 + -0.287 * x21 + -0.553 * x28 + 0.154 * x56 + -0.327 * x72 + 0.442 * x73 + 0.059 * x74 + 0.009 * x75 + -0.257 * x76 + -0.045 * x77 + 0.457 * x78 + 0.131 * x79 + 1.350), f(x) = 1 / (1 + exp(-x)))) Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are the log2-RPM expressions of array numbers 2, 3, 7, 11, 14, 17, 18, 21, 28, 56, 72, 73, 74, 75, 76, 77, 78, 79 respectively, and RPM represents the number of reads per million, Here, z1 > z2 and z1 > z3 and z1 > z4 indicate that the patient is healthy (not suffering from any type of lung cancer, especially lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), or small cell lung cancer (SCLC)), z2 > z1 and z2 > z3 and z2 > z4 indicate that the patient is suffering from lung adenocarcinoma (LUAD), z3 > z1 and z3 > z2 and z3 > z4 indicate that the patient has lung squamous cell carcinoma (LUSC), z4 > z1 and z4 > z2 and z4 > z3 indicate that the patient has small cell lung cancer (SCLC).

[0265] If two of the values of z1, z2, z3, and z4 are exactly equal, the test will not reach a conclusion. For other embodiments, reference is made to the first aspect of the present invention. Those skilled in the art will be able to understand various modifications and variations of the present invention without departing from the scope of the invention. Although the present invention has been described in connection with specific preferred embodiments, it should be understood that the invention described in the claims should not be unduly limited to such specific embodiments. In fact, all various modifications of the described embodiments for implementing the present invention that are obvious to those skilled in the relevant art are intended to be covered by the present invention.

Brief Description of the Drawings

[0266] The following figures are merely illustrative of the present invention and should not be construed as limiting the scope of the present invention in any way as shown by the appended claims.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13A

Figure 13B

Figure 14A

Figure 14B

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

[0267] The examples given below are for illustrative purposes only and do not limit the invention described above. Example 1: Materials: Obtained from three Hammingbird-sponsored studies (Boston (NCT03452514), Grosshansdorf Lung Hospital (DRKS00018784), Ruhrlandklinik Essen (DRKS00020137)) involving patients with lung cancer (all types of lung cancer) or patients without lung cancer. Briefly, blood was collected into PAXgene Blood RNA tubes according to the manufacturer's instructions, inverted 10 times, stored at -20°C, and then stored long-term at -80°C.

[0268] Methods: To extract RNA from PAXgene samples, the QIAsymphony PAXgene Blood RNA Kit was used on a QIAsymphony SP liquid handling station. The eluted RNA was aliquoted and stored at -80°C. 100 ng of total RNA was used for small RNA library preparation. The PCR library products after 18 cycles of amplification were evaluated for size and uniformity, and the concentration of the PCR products was measured. The NGS library was measured on an Illumina NextSeq 200 instrument. Small non-coding RNAs were measured from next-generation sequencing data measuring the relative abundance (expression) of a large number of RNAs. A small subset of RNAs that can be used for the detection of lung cancer was identified.

[0269] FastQ files from Illumina NextSeq 2000 obtained from repeated measurements of the same multiplexed pool (batch of samples sequenced simultaneously using dual indices) were first aggregated into a single FastQ file per pool. These were then UMI-corrected (to remove PCR artifacts), converted into a raw read count matrix, and the UMI-corrected read counts of small RNAs were summed. Finally, RNA expression was provided as Yij = log2(1+(cXij / Mj)) where cXij / Mj is the reads per million (RPM) with the library size Mj normalized, log2-transformed, and 1-shifted, and c = 1e6 for all RNAi and patient samples j.

[0270] ROC curves were used to quantify the ability of a logistic regression model (optimized L1 regularization) to distinguish cancer patients from non-cancer patients (controls) based on RNA expression.

[0271] Figures 1 through 12 show the combined plot of 100 ROC curves obtained by separately splitting patient samples into training and test sets. Individual logistic regression models were trained on each training set, and ROC statistics were obtained on the test set. The combined AUC metrics are shown for each plot to identify the expected AUC and its variability over 100 iterations.

[0272] All features were normalized by subtracting the mean value of the training samples and dividing by the standard deviation. An RNA molecule having the nucleotide sequence according to SEQ ID NO: 1 has a median AUC value of 0.77 and thus has high diagnostic relevance in the detection of lung cancer in patients. The ROC curve of this RNA molecule is shown in Figure 1.

[0273] Furthermore, the following RNA molecule signature with high diagnostic relevance was calculated. (i) SEQ ID NO: 1 and SEQ ID NO: 2, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39, and SEQ ID NO: 48, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 9, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, and SEQ ID NO: 18, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, and SEQ ID NO: 49, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, and SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, and SEQ ID NO: 53, (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 38, (ix) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, and SEQ ID NO: 28, (x) SEQ ID NO: 1 to SEQ ID NO: 54, and (xi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, and SEQ ID NO: 71.

[0274] The ROC curves of the above RNA molecule signatures are shown in FIGS. 2 to 12. The achievement of an AUC value > 0.8 was due to combinations of RNA molecules (RNA signatures). The results of comparing the signatures of 54 RNA molecules between patients known to have lung cancer and healthy (control) subjects, including the average model weights obtained from 100 training iterations, log2 fold changes (DESeq2), and adjusted p-values (DESeq2) for individual RNA molecules, are shown in FIGS. 13A, 13B.

[0275] The comparison results of the signatures of 38 RNA molecules in healthy (control) subjects and patients known to have lung cancer, including the average model weights from 100 training iterations, log2 fold changes (DESeq2), and adjusted p-values (DESeq2) for individual RNA molecules, are shown in FIG. 14.

[0276] All subsets of the largest signature, including the smallest signature, are expected to have performance intermediate between the smallest and largest signatures, i.e., that all of these subsets can also be used for the detection of lung cancer.

[0277] For different signatures, the following equations were calculated (using adjusted median weights) to enable classification of patients as either lung cancer patients or non-lung cancer, i.e., healthy patients. (i) SEQ ID NO: 1 and SEQ ID NO: 2: z = f(0.95 * x1 + 0.71 * x2 + -5.71), f(x) = 1 / (1 + exp(-x))), where x1 and x2 are the normalized log2-RPM representations of SEQ ID NO: 1 and SEQ ID NO: 2, RPM represents reads per million, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, and SEQ ID NO: 48: z = f(0.94 * x1 + 0.86 * x2 + -0.07 * x19 + -0.33 * x35 + -0.15 * x39 + -0.33 * x48 + -3.86), f(x) = 1 / (1 + exp(-x)))) where x1, x2, x19, x35, x39, and x48 are the normalized log2-RPM representations of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:39, and SEQ ID NO:48, respectively, where RPM represents the number of reads per million, (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48: z = f(0.44*x1 + 0.83*x2 + 0.45*x23 + -0.07*x39 + -0.25*x48 + -4.34), f(x) = 1 / (1 + exp(-x)))) where x1, x2, x23, x39, and x48 are the normalized log2-RPM representations of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48, respectively, where RPM represents the number of reads per million, (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9: z = f(0.84*x1 + 0.60*x2 + 0.85*x6 + 0.23*x7 + 0.30*x9 + -6.44), f(x) = 1 / (1 + exp(-x)))) where x1, x2, x6, x7, and x9 are the normalized log2-RPM representations of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9, respectively, where RPM represents the number of reads per million, (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:11 and SEQ ID NO:18: z = f(0.19*x1 + 0.62*x2 + 0.87*x6 + 0.32*x7 + 0.40*x11 + 0.65*x18 + -6.12), f(x) = 1 / (1 + exp(-x)))) where x1, x2, x6, x7, x11, and x18 are the normalized log2-RPM representations of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO:18, respectively, where RPM represents the number of reads per million, (vi) Array No. 1, Array No. 2, Array No. 19, Array No. 35, Array No. 38, Array No. 39, Array No. 40, Array No. 43, Array No. 48 and Array No. 49: z = f(0.93 * x1 + 0.83 * x2 + -0.09 * x19 + -0.33 * x35 + -0.11 * x38 + -0.13 * x39 + -0.12 * x40 + 0.17 * x43 + -0.29 * x48 + 0.10 * x49 + -4.41), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x19, x35, x38, x39, x40, x43, x48 and x49 are, respectively, the standardized log2-RPM representations of Array No. 1, Array No. 2, Array No. 19, Array No. 35, Array No. 38, Array No. 39, Array No. 40, Array No. 43, Array No. 48 and Array No. 49, RPM represents the number of reads per million, (vii) Array No. 1, Array No. 2, Array No. 17, Array No. 23, Array No. 35, Array No. 39, Array No. 45, Array No. 48, Array No. 52 and Array No. 53: z = f(0.52 * x1 + 0.93 * x2 + -0.22 * x17 + 0.43 * x23 + -0.22 * x35 + -0.08 * x39 + -0.06 * x45 + -0.22 * x48 + -0.32 * x52 + 0.02 * x53 + -1.32), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x17, x23, x35, x39, x45, x48, x52 and x53 are, respectively, the standardized log2-RPM representations of Array No. 1, Array No. 2, Array No. 17, Array No. 23, Array No. 35, Array No. 39, Array No. 45, Array No. 48, Array No. 52 and Array No. 53, RPM represents the number of reads per million, (viii) Array No. 1, Array No. 2, Array No. 6, Array No. 7, Array No. 9, Array No. 19, Array No. 25, Array No. 29, Array No. 30 and Array No. 38: z = f(0.83 * x1 + 0.77 * x2 + 0.69 * x6 + 0.31 * x7 + 0.34 * x9 + -0.03 * x19 + -0.58 * x25 + -0.33 * x29 + -0.28 * x30 + -0.19 * x38 + 3.17), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x6, x7, x9, x19, x25, x29, x30, and x38 are, respectively, the normalized log2-RPM expressions of array numbers 1, 2, 6, 7, 9, 19, 25, 29, 30, and 38, where RPM represents the number of reads per million, (ix) Array numbers 1, 2, 3, 6, 7, 11, 12, 14, 18, and 28: z = f(0.24 * x1 + 0.74 * x2 + 0.19 * x3 + 0.68 * x6 + 0.36 * x7 + 0.26 * x11 + 0.26 * x12 + -0.42 * x14 + 0.66 * x18 + -0.94 * x28 + 4.76), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x3, x6, x7, x11, x12, x14, x18, and x28 are, respectively, the normalized log2-RPM expressions of array numbers 1, 2, 3, 6, 7, 11, 12, 14, 18, and 28, where RPM represents the number of reads per million, (x) Array numbers 1 to 54: z = f(0.45 * x1 + 0.83 * x2 + 0.74 * x3 + 0.50 * x4 + -0.48 * x5 + 0.74 * x6 + 0.48 * x7 + 0.55 * x8 + 0.64 * x9 + -0.72 * x10 + 0.39 * x11 + 0.25 * x12 + 0.35 * x13 + -0.34 * x14 + -0.43 * x15 + -0.40 * x16 + -0.34 * x17 + 0.14 * x18 + -0.32 * x19 + -0.52 * x20 + -0.28 * x21 + -0.32 * x22 + -0.28 * x23 + 0.20 * x24 + -0.33 * x25 + -0.24 * x26 + 0.26 * x27 + 0.44 * x28 + -0.11 * x29 + -0.12 * x30 + -0.10 * x31 + 0.25 * x32 + -0.26 * x33 + 0.16 * x34 + -0.15 * x35 + -0.24 * x36 + 0.10 * x37 + -0.11 * x38 + -0.08 * x39 + 0.08 * x40 + 0.05 * x41 + -0.10 * x42 + 0.06 * x43 + 0.06 * x44 + 0.12 * x45 + -0.06 * x46 + 0.10 * x47 + -0.02 * x48 + 0.01 * x49 + -0.04 * x50 + 0.02 * x51 + 0.01 * x52 + 0.04 * x53 + 0.05 * x54 + 0.21), f(x) = 1 / (1 + exp(-x)))) Here, x1 to x54 are the standardized log2 - RPM expressions of array numbers 1 to 54 respectively, where RPM represents the number of reads per million, (xi) array numbers 1, 2, 3, 6, 7, 8, 10, 11, 12, 14, 16, 17, 18, 21, 22, 24, 26, 28, 29, 31, 34, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70 and 71: z = f(0.05 * x1 + 0.83 * x2 + 0.27 * x3 + 0.89 * x6 + 0.35 * x7 + 0.29 * x8 + -0.56 * x10 + 0.14 * x11 + 0.13 * x12 + -0.16 * x14 + -0.21 * x16 + -0.29 * x17 + 0.37 * x18 + -0.21 * x21 + -0.26 * x22 + -0.15 * x24 + -0.26 * x26 + -0.74 * x28 + -0.17 * x29 + -0.17 * x31 + 0.17 * x34 + 0.16 * x55 + 0.18 * x56 + 0.19 * x57 + 0.08 * x58 + 0.27 * x59 + 0.39 * x60 + 0.50 * x61 + 0.24 * x62 + -0.10 * x63 + -0.19 * x64 + -0.12 * x65 + -0.54 * x66 + -0.07 * x67 + -0.20 * x68 + -0.25 * x69 + 0.81 * x70 + -0.19 * x71 + 0.33), f(x) = 1 / (1 + exp(-x)))) Here, x1, x2, x3, x6, x7, x8, x10, x11, x12, x14, x16, x17, x18, x21, x22, x24, x26, x28, x29, x31, x34, x55 to x71 are, respectively, the standardized log2-RPM expressions of array number 1, array number 2, array number 3, array number 6, array number 7, array number 8, array number 10, array number 11, array number 12, array number 14, array number 16, array number 17, array number 18, array number 21, array number 22, array number 24, array number 26, array number 28, array number 29, array number 31, array number 34, array number 55, array number 56, array number 57, array number 58, array number 59, array number 60, array number 61, array number 62, array number 63, array number 64, array number 65, array number 66, array number 67, array number 68, array number 69, array number 70, and array number 71, and RPM represents the number of reads per million.

[0278] In all of the above cases, the cutoff score (y) is calculated as 0.5, and if z > 0.5 is obtained for a patient, it indicates that the patient has lung cancer, and if z < 0.5 is obtained for a patient, it indicates that the patient is healthy (not suffering from lung cancer).

[0279] Example 2: Materials: Patients with lung cancer (all types of lung cancer) and patients without lung cancer were obtained from three Hamming Bird-sponsored studies (Boston (NCT03452514), Grosshansdorf Lung Hospital (DRKS00018784), Ruhrlandklinik Essen (DRKS00020137)). Additionally, samples were collected from Kempten, Konstanz, and Heidelberg. Briefly, blood was collected into PAXgene Blood RNA tubes according to the manufacturer's instructions, inverted 10 times, stored at -20°C, and then stored long-term at -80°C.

[0280] Methods: RNA was extracted from PAXgene samples and sequenced by the method described above. The discovery cohort consisted of 498 control patients (cancer-free) and 445 lung cancer patients obtained from facilities in Boston, Essen, and Grosshansdorf. The validation cohort consisted of 155 control subjects and 286 lung cancer patients obtained from facilities in Boston, Kempten, Konstanz, and Heidelberg.

[0281] To predict whether a patient has lung cancer or not, in the discovery cohort, a logistic regression model composed of the above RNA molecules was trained. The input data was the log2-RPM expression of these small RNA molecules.

[0282] The effect size was shown as Cohen's d as an alternative to DEseq2 fold change to indicate the difference and direction of expression between control and cancer, and a positive d indicates an increase in cancer. The following (two) RNA molecule signatures with high diagnostic relevance were calculated. SEQ ID NO: 2 and SEQ ID NO: 3: Regarding the data, see Figure 15. The ROC curve of this signature is shown in Figure 17. An AUC value > 0.75, i.e., 0.774, was achieved.

[0283] In order to be able to classify patients into those with lung cancer and those without lung cancer, i.e., healthy patients, the following equations were calculated for this (two) signature (using adjusted median weights). z = f(0.800 * x2 + 1.342 * x3 + -8.733), f(x) = 1 / (1 + exp(-x)))) Here, x2 and x3 are the log2 - RPM expressions of array number 2 and array number 3 respectively, and RPM represents the number of reads per million.

[0284] Furthermore, the following (eighteen) RNA molecule signatures with high diagnostic relevance were calculated. Array number 2, array number 3, array number 7, array number 11, array number 14, array number 17, array number 18, array number 21, array number 28, array number 56, array number 72, array number 73, array number 74, array number 75, array number 76, array number 77, array number 78 and array number 79.

[0285] Regarding this data, refer to Figure 15. The ROC curve of this signature is shown in Figure 18. An AUC value > 0.8, i.e., 0.832, could be achieved.

[0286] In order to be able to classify patients into those with lung cancer and those without lung cancer, i.e., healthy patients, the following equation was calculated for this (eighteen) signature (using adjusted median weights). Array number 2, array number 3, array number 7, array number 11, array number 14, array number 17, array number 18, array number 21, array number 28, array number 56, array number 72, array number 73, array number 74, array number 75, array number 76, array number 77, array number 78 and array number 79. z = f(0.792 * x2 + 0.54 * x3 + 0.521 * x7 + 0.26 * x11 + -0.284 * x14 + -0.306 * x17 + 0.399 * x18 + -0.429 * x21 + -0.693 * x28 + 0.295 * x56 + 0.452 * x72 + 0.38 * x73 + -0.3 * x74 + -0.297 * x75 + -0.219 * x76 + 0.157 * x77 + 0.0658 * x78 + -0.0421 * x79 + 5.203), f(x) = 1 / (1 + exp(-x)))) Here, x2, x3, x7, x11, x14, x17, x18, x21, x28, x56, x72, x73, x74, x75, x76, x77, x78, x79 are, respectively, the array numbers 2, 3, 7, 11, 14, 17, 18, 21, 28, 56, 72, 73, 74, 75, 76, 77, 78, 79 log2 - RPM expressions, and RPM represents the number of reads per million times.

[0287] Example 3: Materials and methods: A clean and disinfected finger was punctured with a lancet. Blood was squeezed out from the finger by massage. The first blood drop was discarded. Without touching the skin, the 2x Microsampler was applied directly to the blood drop and dropped until each drop reached 10 μl. Then the cap was closed and the Mitra Microsamplers were stored at room temperature. For RNA extraction, the Mitra cellulose was transferred to a 2 ml eppendorf tube and 1 ml of QIAzol (QIAgen, Venlo, The Netherlands) was added. The sample was incubated at room temperature for 15 minutes while shaking at 1000 rpm. Next, the sample was centrifuged at 12000 xg for 5 minutes at room temperature to remove the cellulose. 200 μl of chloroform was added and the sample was pulsed vortexed for 15 seconds. After incubation at room temperature for 2 minutes, the sample was centrifuged at 12,000 xg for 15 minutes at 4°C. The supernatant containing RNA was mixed with 1.5 volumes of 100% ethanol, and further, according to the manufacturer's instructions, the miRNeasy Serum and Plasma Kit (QIAgen) and MinElute spin columns (QIAgen) were used in combination. RNA was eluted with 28 μl of nuclease-free water and stored at -80°C. 5 - 50 ng of total RNA was used to prepare a small RNA library as described by Rajakumar et al. (2022) and sequenced on an Illumina NextSeq2000 system.

[0288] DBS data analysis: Based on the log2-RPM expression of NGS measurements of small RNAs in 21 control subjects and 19 cancer patients, 100 logistic regression models were trained. Each model was trained with a different random 30 samples, and the ROC curve and AUC performance were calculated with the remaining 10 samples. The representative model with the median AUC was selected.

[0289] The following (6) RNA molecule signatures with high diagnostic relevance were calculated. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75. Regarding this data, refer to Figure 16. The ROC curve of this signature is shown in Figure 19. An AUC value > 0.7, that is, 0.735, was achieved.

[0290] In order to be able to classify patients into those with lung cancer or those without lung cancer, i.e., healthy patients, the following formula was calculated for this (6 - signature) using (adjusted median weights). SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75. z = f(19.621 * x2 + 0.638 * x3 + 1.171 * x7 + -0.492 * x17 + -2.400 * x18 + 1.049 * x75 + 3.185), f(x) = 1 / (1 + exp(-x)))) Here x2, x3, x7, x17, x18, x75 are the log2 - RPM expressions of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75 respectively, and RPM represents the number of reads per million.

[0291] Unofficial array list: RNA molecules having the following arrays were identified as biomarkers suitable for the diagnosis and observation of lung cancer in patients. 1. UUCACAGUGGCUAAGUUCUGC (SEQ ID NO: 1) 2. GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2) 3. AUUGCACGGUAUCCAUCUG (SEQ ID NO: 3) 4. CUCCCACUGCUUCACUUGACUAGCC (SEQ ID NO: 4) 5. UUCUCACUACUGCACUUGACUAGUC (SEQ ID NO: 5) 6. UCCUUCAUUCCACCGGAGU (SEQ ID NO: 6) 7. UCCUUCAUUCCACCGGAGUCU (SEQ ID NO: 7) 8. CAGUGCAAUGUUAAAAGGGC (SEQ ID NO: 8) 9. CUAUCUGAGAGAUGGUGAUGACA (SEQ ID NO: 9) 10. UGUAAACAUCCCCGACUGGAAGCA (SEQ ID NO: 10) 11. UACAGUAGUCUGCACAUUGGUU (SEQ ID NO: 11) 12. UCUUGCGACCCGGGUUCGUUUCCCGGGCGGCGCACCA (SEQ ID NO: 12) 13. UGAUUAAGUCCCUGCCCUUUGUACACACCGCC (SEQ ID NO: 13) 14. CGGGCCGCCGGUGAAAUACCACUA (SEQ ID NO: 14) 15. UAGCACCAUCUGAAAUCGGU (SEQ ID NO: 15) 16. UCGAAACCGGGCAGAAGCACCA (SEQ ID NO: 16) 17. UGGAGUGUGACAAUGGUGUUUGA (SEQ ID NO: 17) 18. CAGUGCAAUGUUAAAAGGG (SEQ ID NO: 18) 19. UAGCAGCGGGAACAGUUCUG (SEQ ID NO: 19) 20. ACUGCAGUGAAGGCACUUGUA (SEQ ID NO: 20) 21. GGUCAAUGAUGUGUUGGCA (SEQ ID NO: 21) 22. UACUUCCAGGAACGGUGCACC (SEQ ID NO: 22) 23. ACAGUAGUCUGCACAUUGGUUA (SEQ ID NO: 23) 24. UGGCUCAGUUCAGCAGGAACAGUA (SEQ ID NO: 24) 25. UCCCCCAGGUGUGAUUCUGAUU (SEQ ID NO: 25) 26. AUUGGGGAGUGAGAGGGAGAGAACGCGGUCUGAGUGGU (SEQ ID NO: 26) 27. AAGAACUGCUAACUCAUGCCCCCAUGUA (SEQ ID NO: 27) 28. UGUAAACAUCCCCGACUGGAAG (SEQ ID NO: 28) 29. ACGCCCUUCCCCCCCUUCU (SEQ ID NO: 29) 30. UCGAUUCCCGGCCCAUGCACCA (SEQ ID NO: 30) 31. GAUAUAUACGCCAGUACCGCC (SEQ ID NO: 31) 32. GUCCAUAACAAAGCGGAGG (SEQ ID NO: 32) 33. GCCGGGUACUUUCGUAUUU (SEQ ID NO: 33) 34. AGAAGGUUGCGUGUUCAGGUCACGUCGGGGUCACCA (SEQ ID NO: 34) 35. UCUCCAAUGGAGGCGUGGGUUU (SEQ ID NO: 35) 36. CAUAAAGUAGAAAGCACUACUA (SEQ ID NO: 36) 37. GAGACCGCCUGGGAAUACCGGGUG (SEQ ID NO: 37) 38. UUUCGAUGGUAGUCGCCGUGCC (SEQ ID NO: 38) 39. CAGCCCUCGACACAAGGGUUUG (SEQ ID NO: 39) 40. UGCGCGUCCCCCGAAGAGG (SEQ ID NO: 40) 41. UGGGUUUACCUUGGGAGAACU (SEQ ID NO: 41) 42. CAUUCUGAAAGAACGUGUGGAAAACUAAUGACUGAGCA (SEQ ID NO: 42) 43. CACCCGGCUGUGUGCACAUGUGC (SEQ ID NO: 43) 44. GUUUCCGUAGUGUAGUGGUUAUCACGUUCGC (SEQ ID NO: 44) 45. AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 45) 46. GGAGGUAGUAGUAGUUAUAGUU (SEQ ID NO: 46) 47. AAAAGCUGGGUUGAGAGGGCGAG (SEQ ID NO: 47) 48. GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 48) 49. UCGAAUCCGAGUCACGGCA (SEQ ID NO: 49) 50. CUUCUCACUACUGCACUUGACUAGUCUUA (SEQ ID NO: 50) 51. UGGAGUGUGACAAUGGUGUUU (SEQ ID NO: 51) 52. GAUUCCCGGCCAAUGCACC (SEQ ID NO: 52) 53. GGGAGAGAAAGGCAGUUCCUG (SEQ ID NO: 53) 54. UUUGGCAAUGGUAGAACUC (SEQ ID NO: 54) 55. CAGCAGCACACUGUGGUUUGUA (SEQ ID NO: 55) 56. AAAUAAGCUAUCGGGCCCAUACCCCG (SEQ ID NO: 56) 57. AUUGGUCGUGGUUGUAGUCCGUGCGAGAAUACCA (SEQ ID NO: 57) 58. CAAUCCUAAGCCAAAAGAACAA (SEQ ID NO: 58) 59. UGAGCAUGUAGACAAAGGUAACACUGAAG (SEQ ID NO: 59) 60. UGGCUCAGUUCAGCAGGAAC (SEQ ID NO: 60) 61. GUCCAAUAAAACAAAGCGGAGG (SEQ ID NO: 61) 62. UCCGCCCCCCGGCCCCGCGUCCUC (SEQ ID NO: 62) 63. UCUCACACGGAAAUCGCACCCGU (SEQ ID NO: 63) 64. UAAUGCCCCUAAAAAUCCUU (SEQ ID NO: 64) 65. UAAUCCUUGCUACCUGGGUGAGAG (SEQ ID NO: 65) 66. GUUCUACAGUCCGACAAU (SEQ ID NO: 66) 67. CGGUGCGCCGCGACCGGCUCCGGGACGGCUG (SEQ ID NO: 67) 68. UCUCACACAGAAAUCGCACCCGU (SEQ ID NO: 68) 69. UAGCAGCGGGAACAGUUCUGAA (SEQ ID NO: 69) 70. UGUAAACAUCCCCGACUGGAAGCU (SEQ ID NO: 70) 71. AGGGGCAGAGAGCGAGACUUU (SEQ ID NO: 71) 72. GUUCACUGAUGAGAGCAUUGUUCUGAGCCA (SEQ ID NO: 72) 73. UCAUUGGUCGUGGUUGUAGUCCGUGCGAGAAUACCA (SEQ ID NO: 73) 74. AUGCACCUGGGCAAGGAUUCUG (SEQ ID NO: 74) 75. AUCCCACUCCUGACACCUUU (SEQ ID NO: 75) 76. GGCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 76) 77. GUCAGUUUGUCAAAUACCC (SEQ ID NO: 77) 78. UAGCACCAUUUGAAAUCG (SEQ ID NO: 78) 79. UUCAAAUCCCGGACGAGCCCA (SEQ ID NO: 79)

Claims

1. A method for diagnosing lung cancer in a patient, comprising: (i) determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto; (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto; or (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto. A method comprising the above.

2. Comprising the step of (i) above, the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising the nucleotide sequences from SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined; or the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising the nucleotide sequences from SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined. The method according to Claim 1.

3. Comprising the step of Claim 1(ii), The method according to claim 1, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

4. comprising the step of claim 1 (ii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or The method according to claim 1 or claim 3, wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

5. (i) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (ii) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iii) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iv) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (v) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (vi)the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (vii)the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (viii)the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (ix)the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or (x)the method according to claim 4, wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

6. (i)SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48, (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9, (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO:18, (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48, and SEQ ID NO:49, (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52, and SEQ ID NO:53, (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38, (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28, (ix) SEQ ID NOs: 1 to 54, or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71, The method according to claim 4 or 5, wherein the level of the RNA molecule comprising the nucleotide sequence according to any one of (i) to (x) is determined.

7. The method according to claim 1, comprising the step of (iii) of claim 1, wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO:2, and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO:

3.

8. The method according to claim 1, comprising the step of (iii) of claim 1, The method according to claim 1 or claim 7, wherein the level of at least one additional RNA molecule is determined, which is selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto.

9. (i) The level of at least one additional RNA molecule is determined, which is selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto, or (ii) The method according to claim 8, wherein the level of at least one additional RNA molecule is determined, which is selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and a sequence having at least 80% sequence identity thereto.

10. (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or (ii) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75, The method according to claim 8 or claim 9, wherein the level of an RNA molecule comprising a nucleotide sequence according to is determined.

11. comparing the level of the at least one RNA molecule with a reference level of the RNA molecule, or comparing the levels of the at least two RNA molecules with a reference level of the RNA molecules, The method according to any one of claims 1 to 10.

12. The reference level is the level of the at least one RNA molecule empirically determined by measuring a number of reference blood samples from subjects known to be healthy (not suffering from lung cancer), or The method according to claim 11, wherein the reference level is the level of the at least two RNA molecules empirically determined by measuring a large number of reference blood samples from subjects known to be healthy (not suffering from lung cancer).

13. That the level of the RNA molecule selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 49, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 69, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 77 and / or SEQ ID NO: 78 exceeds the reference level indicates that the patient has lung cancer, and / or The method according to claim 12, wherein that the level of the RNA molecule selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76 and / or SEQ ID NO: 79 is below the reference level indicates that the patient has lung cancer.

14. The reference level is the level of the at least one RNA molecule empirically determined by measuring a large number of reference blood samples taken from subjects known to have lung cancer, or The method according to any one of claims 11 to 13, wherein the reference level is the level of the at least two RNA molecules empirically determined by measuring a large number of reference blood samples taken from subjects known to have lung cancer.

15. The level of said RNA molecule selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:15, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:36, SEQ ID NO:38, SEQ ID NO:41, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:49, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:62, SEQ ID NO:69, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:77 and / or SEQ ID NO:78 being below said reference level indicates that said patient is healthy (not suffering from lung cancer) and / or, The method according to claim 14, wherein the level of said RNA molecule selected from the group consisting of SEQ ID NO:4, SEQ ID NO:10, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:42, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:52, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76 and / or SEQ ID NO:79 being above said reference level indicates that said patient is healthy (not suffering from lung cancer).

16. The level of said at least one RNA molecule is used in a mathematical calculation to obtain a numerical value, or, The method according to any one of claims 1 to 15, wherein the levels of said at least two RNA molecules are used in a mathematical calculation to obtain a numerical value.

17. The method according to claim 16, wherein said numerical value is obtained by summing the weighted levels of said at least two RNA molecules.

18. The method according to claim 16 or claim 17, wherein said numerical value is compared with an empirically determined cut-off score.

19. The method according to claim 18, wherein said cut-off score enables classification of whether said patient is suffering from lung cancer or is healthy (not suffering from lung cancer).

20. A method for observing a patient suspected of having lung cancer or the patient suffering from lung cancer, comprising: (i) determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or sequences having at least 80% sequence identity thereto; (ii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or sequences having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80% sequence identity thereto; or (iii) determining the levels of at least two RNA molecules in a blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or sequences having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or sequences having at least 80% sequence identity thereto; A method comprising the above steps.

21. The method according to claim 20, comprising the step of claim 20(i), wherein the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NOs: 2 to 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined; or wherein the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NOs: 2 to 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

22. The method according to claim 20, comprising the step of claim 20(ii), The method according to claim 20, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

23. comprising the step of claim 20(ii), the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, or The method according to claim 20 or claim 22, wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is determined.

24. (i) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (ii) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iii) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (iv) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 18, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (v) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, fragments thereof, and sequences having at least 80% sequence identity thereto is determined, (vi)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, is determined, (vii)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, is determined, (viii)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, is determined, (ix)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, is determined, or, (x)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, a fragment thereof, and at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, is determined, the method according to claim 23.

25. (i)SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:23, SEQ ID NO:39, and SEQ ID NO:48, (iii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:9, (iv) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, and SEQ ID NO:18, (v) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:19, SEQ ID NO:35, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:43, SEQ ID NO:48, and SEQ ID NO:49, (vi) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:17, SEQ ID NO:23, SEQ ID NO:35, SEQ ID NO:39, SEQ ID NO:45, SEQ ID NO:48, SEQ ID NO:52, and SEQ ID NO:53, (vii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:19, SEQ ID NO:25, SEQ ID NO:29, SEQ ID NO:30, and SEQ ID NO:38, (viii) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:18, and SEQ ID NO:28, (ix) SEQ ID NOs: 1 to 54, or (x) SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:31, SEQ ID NO:34, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71, The method according to claim 23 or claim 24, wherein the level of the RNA molecule consisting of the nucleotide sequence according to any one of (i) to (x) is determined.

26. The method according to claim 20, comprising the step of claim 20(iii), wherein the first RNA molecule comprises the nucleotide sequence according to SEQ ID NO:2 and the second RNA molecule comprises the nucleotide sequence according to SEQ ID NO:

3.

27. The method according to claim 20, comprising the step of claim 20(iii), The method according to claim 20 or claim 26, wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto is determined.

28. (i) the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto is determined, or (ii) the method according to claim 27, wherein the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and a sequence having at least 80% sequence identity thereto is determined.

29. (i) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, or (ii) SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18 and SEQ ID NO: 75, The method according to claim 27 or claim 28, wherein the level of an RNA molecule comprising a nucleotide sequence according to is determined.

30. comparing the level of the at least one RNA molecule with a reference level of the RNA molecule, or The method according to any one of claims 20 to 29, wherein the levels of the at least two RNA molecules are compared with a reference level of the RNA molecules.

31. the reference level is the level of the RNA molecule empirically determined by measuring a number of reference blood samples taken from a subject known to be healthy or a subject known to have lung cancer, or The method according to claim 30, wherein the reference level is the level of the at least two RNA molecules empirically determined by measuring a plurality of reference blood samples taken from a subject known to be healthy or a subject known to have lung cancer.

32. The observation includes determining the level of the at least one RNA molecule in a blood sample obtained from the patient at a first time point and in at least one further blood sample (the same) obtained from the patient at a later time point, and comparing the levels determined at different time points, or The method according to any one of claims 20 to 31, wherein the observation includes determining the level of the at least two RNA molecules in the blood sample obtained from the patient at the first time point and in at least one further blood sample (the same) obtained from the patient at a later time point, and comparing the levels determined at different time points.

33. The method according to any one of claims 1 to 32, wherein the lung cancer is small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC), preferably lung adenocarcinoma (LUAD) or lung squamous cell carcinoma (LUSC).

34. The method according to any one of claims 1 to 33, wherein the blood sample is whole blood or a blood fraction.

35. The method according to claim 34, wherein the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum.

36. The method according to claim 35, wherein the blood cell fraction is a fraction of red blood cells, white blood cells, and / or platelets.

37. The method according to any one of claims 1 to 36, wherein the level is determined by sequencing, preferably next-generation sequencing, nucleic acid hybridization, nucleic acid amplification, polymerase extension, mass spectrometry, or any combination thereof.

38. The method according to any one of claims 1 to 37, wherein the patient is a mammal, preferably a human.

39. (i)At least one RNA molecule for the diagnosis of lung cancer in a patient, or for the observation of said patient suspected of having lung cancer or suffering from lung cancer, wherein said at least one RNA molecule has a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, an RNA molecule, (ii)At least two RNA molecules for the diagnosis of lung cancer in said patient, or for the observation of said patient suspected of having lung cancer or suffering from lung cancer, wherein said at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, said first RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and said second RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, an RNA molecule, or, (iii)At least two RNA molecules for the diagnosis of lung cancer in said patient, or for the observation of said patient suspected of having lung cancer or suffering from lung cancer, wherein said at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, said first RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and said second RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto, an RNA molecule, use of.

40. At least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, or, The use according to claim 39, wherein at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient.

41. The use according to claim 39, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

42. At least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 71, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, or The use according to claim 39 or claim 41, wherein at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 3 to 79, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient.

43. (i) At least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 19, 35, 39, 48, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (ii) At least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 23, 39, 48, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (iii) At least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 6, 7, 9, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (iv) At least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NOs: 6, 7, 11, 18, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient. (v)An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, SEQ ID NO: 49, a fragment thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (vi)An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 53, a fragment thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (vii)An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 38, a fragment thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (viii)An RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, SEQ ID NO: 28, a fragment thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, (ix)An RNA molecule comprising a nucleotide sequence from SEQ ID NO: 3 to SEQ ID NO: 54, a fragment thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient, or, The use according to claim 42, wherein said at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in said patient.

44. (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, (ix) SEQ ID NO: 1 to SEQ ID NO: 54, or, The use according to claim 42 or claim 43, wherein an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71 is used for the diagnosis or observation of lung cancer in the patient.

45. The use according to claim 39, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

46. The use according to claim 39 or claim 45, wherein at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in the patient.

47. (i) at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in the patient, or (ii) the use according to claim 46, wherein at least one further RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and sequences having at least 80% sequence identity thereto is used for the diagnosis or observation of lung cancer in the patient.

48. (i)SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, and SEQ ID NO: 79, or, (ii)SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, and SEQ ID NO: 75 The use according to claim 46 or claim 47, wherein an RNA molecule consisting of a nucleotide sequence according to (i) or (ii) is used for the diagnosis or observation of lung cancer in the patient.

49. A kit for diagnosing lung cancer in a patient or for observing the patient suspected of having lung cancer or suffering from lung cancer, comprising: (i)means for determining the level of at least one RNA molecule in a blood sample from the patient, wherein the at least one RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto; (ii)means for determining the levels of at least two RNA molecules in the blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto; or, (iii)means for determining the levels of at least two RNA molecules in the blood sample from the patient, wherein the at least two RNA molecules comprise a first RNA molecule and a second RNA molecule, the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2, fragments thereof, or a sequence having at least 80% sequence identity thereto, and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 3, fragments thereof, or a sequence having at least 80% sequence identity thereto. A kit comprising the same.

50. Means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80% sequence identity thereto, or, Means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 2 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto, The kit according to claim 49, comprising the same.

51. The kit according to claim 49, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 1 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

2.

52. Comprising means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 71, fragments thereof, and a sequence having at least 80% sequence identity thereto, or, Comprising means for determining the level of at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 79, fragments thereof, and a sequence having at least 80% sequence identity thereto, The kit according to claim 49 or claim 51, which is used for the diagnosis or observation of lung cancer in the patient.

53. (i) The at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and a sequence having at least 80% sequence identity thereto, (ii) The at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 23, SEQ ID NO: 39, SEQ ID NO: 48, fragments thereof, and a sequence having at least 80% sequence identity thereto, (iii) The at least one additional RNA molecule selected from the group consisting of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, fragments thereof, and a sequence having at least 80% sequence identity thereto, (iv)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, or SEQ ID NO: 18, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (v)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48, or SEQ ID NO: 49, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (vi)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52, or SEQ ID NO: 53, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (vii)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30, or SEQ ID NO: 38, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (viii)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18, or SEQ ID NO: 28, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, (ix)an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3 to SEQ ID NO: 54, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, or, Means for determining the level of an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, a fragment thereof, and said at least one further RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, the kit according to claim 52.

54. (i) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 39 and SEQ ID NO: 48, (ii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 39 and SEQ ID NO: 48, (iii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 9, (iv) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11 and SEQ ID NO: 18, (v) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 19, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 43, SEQ ID NO: 48 and SEQ ID NO: 49, (vi) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 48, SEQ ID NO: 52 and SEQ ID NO: 53, (vii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 38, (viii) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 18 and SEQ ID NO: 28, (ix) SEQ ID NO: 1 to SEQ ID NO: 54, or, Means for determining the level of an RNA molecule comprising a nucleotide sequence according to (x) SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 34, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71, The kit according to claim 52 or claim 53, comprising means for determining the level of an RNA molecule comprising a nucleotide sequence according to the above.

55. The kit according to claim 49, wherein the first RNA molecule comprises a nucleotide sequence according to SEQ ID NO: 2 and the second RNA molecule comprises a nucleotide sequence according to SEQ ID NO:

3.

56. The kit according to claim 49 or claim 55, comprising means for determining the level of at least one additional RNA molecule selected from the group consisting of RNA molecules comprising nucleotide sequences according to SEQ ID NO: 1, SEQ ID NO: 4 to SEQ ID NO: 79, fragments thereof, and sequences having at least 80% sequence identity thereto.

57. (i) an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 28, SEQ ID NO: 56, SEQ ID NO: 72 to SEQ ID NO: 79, fragments thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, or, (ii) an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 7, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 75, fragments thereof, and said at least one additional RNA molecule selected from the group consisting of sequences having at least 80% sequence identity thereto, The kit according to claim 56, comprising means for determining the level of the above.

58. (i) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:21, SEQ ID NO:28, SEQ ID NO:56, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78 and SEQ ID NO:79, or, (ii) SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:7, SEQ ID NO:17, SEQ ID NO:18 and SEQ ID NO:75, The kit according to claim 56 or claim 57, comprising means for determining the level of an RNA molecule comprising a nucleotide sequence according to

59. The kit according to any one of claims 49 to 58, which is useful for carrying out the method according to any one of claims 1 to 38.

60. The kit according to any one of claims 49 to 58, further comprising instructions on how to carry out the method according to any one of claims 1 to 38.