BRINP2-derived peptide compositions for the treatment of obesity and weight management
BRINP2-related peptides address the limitations of existing weight management interventions by reducing food intake and obesity through specific formulations, providing a therapeutic solution for obesity and related disorders.
Patent Information
- Application Number
- JP2025505735
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-08-02
- Filing Date
- 2023-07-05
- Publication Date
- 2025-08-07
AI Technical Summary
Current pharmacological and lifestyle interventions for weight management have limited success due to counterregulatory mechanisms, and there is a lack of understanding about endogenous peptides that control feeding behavior and obesity progression, hampering the development of effective therapeutic peptides for obesity and related disorders.
The use of BRINP2-related peptides (BRPs), proteolytically cleaved from the parent protein BRINP2, which are endogenously secreted and reduce food intake and obesity by administering them in various formulations, including modifications such as amidation, acylation, pegylation, and conjugation, to enhance their efficacy.
BRPs effectively reduce food intake and body weight in mammals, offering a therapeutic approach for managing obesity and related disorders like diabetes and metabolic syndrome without affecting insulin secretion, with potential for combination therapies.
Smart Images

Figure 2025525855000001_ABST
Abstract
Description
[Background technology]
[0001] Introduction Obesity is associated with a significant 5-10 year reduction in life expectancy and increased mortality from diabetes, cardiovascular disease, and other risk factors, independent of other risk factors. In humans, weight loss of as little as 5-10% is sufficient to improve hyperglycemia, triglyceridemia, and other comorbidities. Most of the genes involved in energy balance discovered so far act by controlling hunger, satiety, and food intake, demonstrating deeper genetic regulation and heritability than previously recognized. Therefore, it is not surprising that behavioral and lifestyle changes, the only weight-loss interventions, have had limited success in the general population. Lifestyle factors, exercise, and gastric bypass initially result in weight loss, but weight regain typically occurs due to counterregulatory mechanisms in increased appetite (estimated at 100 kcal / day) and decreased energy expenditure (25 kcal / day) per kg of weight lost. Based on these observations, weight loss through pharmacological approaches combined with lifestyle factors likely represents the most effective method for ameliorating the numerous complications associated with obesity.
[0002] Recently, modified GLP-1 peptide analogs such as liraglutide and semaglutide have had transformative efficacy in reducing body weight in humans. Peptide hormones represent a class of small (<100 amino acids), low-abundance bioactive peptides involved in the regulation of physiological processes such as food intake and body weight control, making them attractive targets for the modulation of energy metabolism.
[0003] Traditionally, novel bioactive peptide hormones have been identified by biochemical purification from endocrine organs, including insulin, glucagon, and oxyntomodulin from pancreatic or intestinal extracts, and neuropeptide Y (NPY) and gonadotropin-releasing hormone (GnRH) from brain extracts. More recently, extensive proteomics and peptidomics efforts have demonstrated the detection and quantification of peptide hormones and neuropeptides from complex biological tissues or blood. However, detection remains a significant challenge due to their low abundance. Furthermore, because many peptide hormones are synthesized as part of larger precursors that are further processed into active fragments by post-translational intracellular proteolytic cleavage, their dynamic regulation cannot be detected by RNA sequencing or conventional proteomic analysis. Therefore, little is known about other endogenous peptides that control feeding behavior and obesity progression, and the extent to which these uncharacterized peptides contribute to the regulation of energy balance is unclear.
[0004] Peptide hormones represent a class of small peptides that regulate a wide range of physiological functions. Systematic efforts to identify and characterize secreted bioactive polypeptides have traditionally been hampered by their low abundance, small size, and the difficulty of predicting their function. These peptide hormones are of great interest for clinical use and therapeutic development, including the treatment of obesity and related disorders. Summary of the Invention
[0005] Compositions and methods are provided for preventing or treating obesity and / or overweight, and for managing body weight. It is shown herein that peptides proteolytically cleaved from the parent protein BRINP2 are effective in reducing food intake and obesity in mammals. The peptides are referred to herein as BRINP2-related peptides (BRPs). The encoded human peptide has the sequence THRILRRLFNLC (SEQ ID NO: 1). BRP is endogenously secreted into human plasma and CSF and reduces food intake and body weight in vivo.
[0006] In some embodiments, a composition is provided comprising or consisting of a BRP peptide of the following formula (SEQ ID NO:2): TIFF2025525855000002.tif7145, X 9 can be any amino acid. In some embodiments, X 9 is other than F, and in some embodiments, X 9 is G, A, V, L, K, or I. 9 When is F, the peptide may contain a non-naturally occurring modification.
[0007] In some embodiments, one or more residues in SEQ ID NO:2 are amidated, and the C-terminal carboxyl group, C 12 In some embodiments, one or more residues may be acylated and may include a fatty acid. In some embodiments, the acyl moiety may be any of T1, H2, R7, X9, and L. 11 In some embodiments, the acyl moiety is a straight or branched C4-C 20 alkyl, C 10 ~C 18 Alkyl, especially C 16It may be alkyl, optionally substituted with halo, hydroxy, alkoxy, amino, alkylamino, dialkylamino, sulfate, or phosphate, and may be saturated or mono- or di-unsaturated. Fatty acids of interest for modification of peptides include, but are not limited to, palmitic acid, stearic acid, arachidic acid, lauric acid, myristic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, linoleic acid, α-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, docosahexaenoic acid, and the like, and in some embodiments, palmitic acid.
[0008] In some embodiments, the peptide of SEQ ID NO:2 is modified by pegylation, glycosylation, conjugation to a large protein such as albumin, conjugation to immunoglobulin Fc, or conjugation to a polymer. In some embodiments, the peptide of SEQ ID NO:2 includes amino acid modifications such as the use of D-amino acids or beta-amino acids to increase biological half-life. In some embodiments, the peptide of SEQ ID NO:2 is truncated at the carboxy- or amino-terminus. In some embodiments, the peptide of SEQ ID NO:2 is other than a naturally occurring peptide.
[0009] The present disclosure provides peptides of SEQ ID NO: 2, pharmaceutical formulations containing such peptides, and methods of using such peptides. The peptides may contain one or more of the modifications disclosed above. In particular, the present invention provides pharmaceutical formulations containing a therapeutically effective amount of a peptide of SEQ ID NO: 2, alone or in combination with a pharmaceutically acceptable carrier. The formulations may be provided in unit doses containing an effective dose of the peptide.
[0010] In some embodiments, a formulation is provided comprising an effective dose of a BRP peptide of SEQ ID NO: 2 and a pharmaceutically acceptable excipient, wherein the therapeutically effective amount of the BRP peptide is in the range of about 0.1 mg / kg to about 100 mg / kg. In some embodiments, the effective dose is at least about 0.1 mg / kg, at least about 0.5 mg / kg, at least about 1 mg / kg, at least about 5 mg / kg, at least about 10 mg / kg, at least about 20 mg / kg, at least about 50 mg / kg, or up to about 100 mg / kg, and in some embodiments, the effective dose is about 1 to 25 mg / kg. Administration can be daily, every other day, every third day, or more frequently, e.g., weekly, twice weekly, biweekly, monthly, etc. Administration can be parenteral, including sustained-release formulations. BRP and its analogs have the advantage of reducing food intake and obesity without affecting insulin secretion. Therefore, this drug may be applicable to a large number of patients.
[0011] Further provided is a method for weight management that may be associated with treating or delaying the progression or onset of diabetes and metabolic syndrome (particularly type II diabetes), including reducing complications of diabetes such as retinopathy, neuropathy, nephropathy, and delayed wound healing, and related diseases including insulin resistance (impaired glucose homeostasis), hyperglycemia, hyperinsulinemia, elevated blood levels of fatty acids or glycerol, hyperlipidemia including hypertriglyceridemia, syndrome X, atherosclerosis, and hypertension, wherein a therapeutically effective amount of the peptide of SEQ ID NO: 2 is administered to a mammal (e.g., a human, a patient in need of treatment).
[0012] In some embodiments, methods are provided for treating obesity and related disorders as defined herein, wherein a therapeutically effective amount of a combination of peptide compounds of SEQ ID NO: 2 is administered to a mammal (e.g., a human, a patient in need of treatment). In some such embodiments, the reduction in food intake observed with administration of BRP is associated with a weight loss, e.g., a 1%, 2.5%, 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, 30% or more reduction in body weight, depending on the subject's initial body weight.
[0013] These methods of treatment with the peptide of SEQ ID NO: 2 may be combined with one or more other types of therapeutic agents, such as antidiabetic, lipid-lowering, or antiobesity agents, for example, metformin, sulfonylureas (e.g., glyburide, glipizide, glimepiride), glinides (e.g., repaglinide and naglinide), thiazolidinediones (e.g., rosiglitazone, pioglitazone), DPP-4 inhibitors (e.g., sitagliptin, saxagliptin, linagliptin), GLP-1 receptor agonists (e.g., exenatide, liraglutide, semaglutide), SGLT2 inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin), and the like, and administered to a human patient in need of treatment. When used in combination with the compounds of the present invention, the other therapeutic agents may be used in amounts as indicated in the Physician's Desk Reference, for example, as in the patents listed above, or as otherwise determined by one of ordinary skill in the art.
[0014] The invention will be best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to scale. On the contrary, the dimensions of the various features have been arbitrarily increased or reduced for clarity. The drawings include the following figures: [Brief explanation of the drawings]
[0015] [Figure 1](Figures 1A-K) Sequence pattern recognition predicts small secreted human polypeptide hormones expressed across human tissues. (Figure 1A) Prohormone processing. (Figure 1B) Bioinformatics flow diagram. (Figure 1C) Number of prohormones versus cleavage interval. (Figure 1D) Number of prohormones versus number of cleavage sites. (Figure 1E) Cleavage site density for all human secreted proteins. (Figure 1F) Tissue distribution of prohormones. (Figure 1G) Tissue distribution of cleavage sites. (Figure 1H) Tissue distribution of cleavage sites. (Figure 1I) Tissue distribution of cleavage sites. (Figure 1J) Tissue distribution of cleavage sites. (Figure 1K) Tissue distribution of cleavage sites. [Figure 2](Figures 2A-G) The 12-mer BRINP2 peptide, BRP, induces cfos expression and acutely suppresses food intake in mice. (Figure 2A) Peptide library design and bioactivity assay. (Figure 2B) NS-1 and INS1 cells were treated for 1 hour with vehicle, GLP-1, and NGF (positive control), or 100 novel peptides at 100 μg / ml. N=3 biological replicates / group. Boxed areas represent hits with >5-fold upregulation across both cell lines. (Figure 2C) Validation of top hits with BRNP2_5 at 100 μg / ml versus scrambled BRNP2_5 peptide. Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by one-way ANOVA. (Fig. 2D) Food intake for up to 6 h in lean mice after intraperitoneal injection of 5 mg / kg peptide or 2 mg / kg GLP-1 (N=3 mice / group). Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (Fig. 2E) Food intake for up to 6 h in lean mice after intraperitoneal injection of 5 mg / kg peptide or 2 mg / kg GLP-1 (N=3 mice / group). Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (FIG. 2F) Food intake in DIO mice for up to 6 hours after intraperitoneal injection of 10 mg / kg BRNP2_5 peptide or 2 mg / kg GLP-1 (N=3 mice / group). Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (FIG. 2G) Fasting blood glucose levels in non-obese mice after intraperitoneal injection of 5 mg / kg peptide or 2 mg / kg GLP-1 (N=3 mice / group). Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. [Figure 3](Figures 3A-H) BRP, but not scrambled peptide, acutely suppresses food intake and food intake without affecting energy expenditure, locomotor activity, or anxiety-like behavior in mice. (Figure 3A) Metabolic cage analysis of food intake in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide. N = 4 mice / group. (Figure 3B) Metabolic cage analysis of food intake in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide. N = 4 mice / group. (Figure 3C) Metabolic cage analysis of food intake in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide. N = 4 mice / group. (Figure 3D) Metabolic cage analysis of food frequency in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide. N = 4 mice / group. (Figure 3E) Analysis of respiratory exchange ratio (RER) in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide using metabolic cages. N = 4 mice / group. (Figure 3F) Analysis of VO2 in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide using metabolic cages. N = 4 mice / group. (Figure 3G) Analysis of locomotor activity in mice after a single injection of vehicle, 5 mg / kg BRP, or 5 mg / kg BRP-scrambled peptide using metabolic cages. N = 4 mice / group. (Figure 3H) Distance traveled and time spent in the center in an open field assay in mice 30 minutes after a single injection of vehicle or 5 mg / kg BRP. [Figure 4](Figures 4A-F) BRP circulates endogenously in human cerebrospinal fluid and plasma. (Figure 4A) Expression of the BRNP2 prohormone across human organs (data from the Human Protein Atlas). (Figure 4B) LC-MS (MS1 spectrum) demonstrating detection of endogenous BRP in human plasma at 27 min. Black = synthetic BRP standard. Red = endogenous BRP peptide. The bottom graph is a zoomed-in version of the MS1 spectrum above. (Figure 4C) LC-MS (MS1 spectrum) demonstrating detection of endogenous BRP in human cerebrospinal fluid at 17 min. Black = synthetic BRP standard. Red = endogenous BRP peptide. The right graph is a zoomed-in version of the MS1 spectrum above. (Figure 4D) Phylogenetic tree of the BRNP2 parent protein across species. (Figure 4E) BRP sequences across species. (Figure 4F) NS-1 cells treated with vehicle, NGF (positive control), or BRP peptide (100 μg / ml) from different species for 1 hour. [Figure 5] (Figures 5A-C) Amino acid residues 3 and 8 are required for full BRP activity. (Figure 5A) Expression of cfos in NS1 cells in response to unmodified and amidated BRP. Neuron growth factor (NGF) was used as a positive control. Data are shown as SEM. N = 3 biological samples / group. (Figure 5B) Alanine substitution in the BRP sequence followed by measurement of cfos activation in NS-1 cells 1 hour after treatment (100 μg / kg). Data are shown as SEM. N = 3 biological samples / group. (Figure 5C) Alanine substitution in the BRP sequence followed by measurement of food intake in mice for up to 6 hours after intraperitoneal injection of 5 mg / kg of peptide (N = 3 mice / group). [Figure 6](Figures 6A-L) BRP reverses obesity, diabetes, and liver fat in diet-induced obese mice. (Figure 6A) Cumulative food intake in mice during and after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N = 10 mice / group. Data are shown as SEM. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by two-way ANOVA for multiple comparisons. (Figure 6B) Body weight change in mice during and after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N = 10 mice / group. Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (Figure 6C) Total body weight in mice during and after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (Figure 6D) Total body weight in mice during and after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. Data are shown as SEM. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 by two-way ANOVA for multiple comparisons. (Figure 6E) Glucose tolerance test (GTT) after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (Figure 6F) Insulin tolerance test (ITT) after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (Figure 6G) Fasting insulin levels after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (FIG. 6H) White adipose tissue weight after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group.(Figure 6I) Brown adipose tissue weight after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (Figure 6J) Liver weight after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (Figure 6K) Skeletal muscle weight after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. N=10 mice / group. (Figure 6L) Histological analysis of white adipose tissue, brown adipose tissue, and liver after 14 days of treatment with vehicle, 100 μg / kg liraglutide, or 5 mg / kg BRP. Representative photographs of N=10 mice / group. [Figure 7](Figures 7A-J) Sequence pattern recognition predicts small secreted human polypeptide hormones expressed across human tissues. (Figure 7A) Number of detected prohormones and cleavage sites per prohormone. No tissue annotation. Blue: known prohormones. Gray: unannotated functions. (Figure 7B) Number of detected prohormones and cleavage sites per prohormone. Widespread tissue expression. Blue: known prohormones. Gray: unannotated functions. (Figure 7C) Number of detected prohormones and cleavage sites per prohormone. Liver. Blue: known prohormones. Gray: unannotated functions. (Figure 7D) Number of detected prohormones and cleavage sites per prohormone. Blood. Blue: known prohormones. Gray: unannotated functions. (Figure 7E) Number of detected prohormones and cleavage sites per prohormone. Adipose tissue. Blue: known prohormones. Gray: unannotated functions. (Figure 7F) Number of detected prohormones and cleavage sites per prohormone. Parathyroid. Blue: known prohormones. Gray: unannotated functions. (Figure 7G) Number of prohormones detected and cleavage sites per prohormone. Salivary gland. Blue: known prohormones. Grey: unannotated functions. (Figure 7H) Number of prohormones detected and cleavage sites per prohormone. Kidney. Blue: known prohormones. Grey: unannotated functions. (Figure 7I) Number of prohormones detected and cleavage sites per prohormone. Thyroid gland. Blue: known prohormones. Grey: unannotated functions. (Figure 7J) Number of prohormones detected and cleavage sites per prohormone. Skeletal muscle. Blue: known prohormones. Grey: unannotated functions. [Figure 8](Figures 8A-F) Characterization of synthetic peptides by LC-MS and LC-MS / MS. (Figure 8A) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: BRNP2_5. (Figure 8B) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: EDIL3_4. (Figure 8C) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: FGF3_4. (Figure 8D) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: FGF5_5. (Figure 8E) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: FSTL4_3. (Figure 8F) LC-MS (left) and LC-MS / MS (right) graphs for six peptides tested in mice: SCG1_9. [Figure 9] (Figures 9A-F) GLP-1 acutely suppresses food intake and food intake without affecting energy expenditure or locomotor activity. (Figure 9A) Metabolic cage analysis of food intake in mice after a single injection of vehicle or 2 mg / kg GLP-1. N = 4 mice / group. (Figure 9B) Metabolic cage analysis of food intake in mice after a single injection of vehicle or 2 mg / kg GLP-1. N = 4 mice / group. (Figure 9C) Metabolic cage analysis of food frequency in mice after a single injection of vehicle or 2 mg / kg GLP-1. N = 4 mice / group. (Figure 9D) Metabolic cage analysis of respiratory exchange ratio (RER) in mice after a single injection of vehicle or 2 mg / kg GLP-1. N = 4 mice / group. (Figure 9E) Metabolic cage analysis of VO2 in mice after a single injection of vehicle or 2 mg / kg GLP-1. N=4 mice / group. (FIG. 9F) Analysis of locomotor activity in mice after a single injection of vehicle or 2 mg / kg GLP-1 using metabolic cages. N=4 mice / group. DETAILED DESCRIPTION OF THE INVENTION
[0016] Description of specific embodiments The present invention provides novel uses and analogs of BRNP2-related peptides (BRPs).
[0017] Before the present methods and compositions are described, it is to be understood that this invention is not limited to the particular methods or compositions described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0018] Where a range of values is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limit of that range is also specifically disclosed, to the tenth of the unit of the lower limit. Each smaller range between any stated value or intervening value within a stated range and any other stated value or intervening value within that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded, and each range where either, neither, or both limits are included in the smaller range is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where a stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are described below. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict, it should be understood that the present disclosure supersedes any disclosure of the incorporated publication.
[0020] It should be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a cell" includes a plurality of such cells, and a reference to "the peptide" includes a reference to one or more peptides and equivalents thereof, such as polypeptides, known to those skilled in the art.
[0021] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.
[0022] peptide The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms also apply to amino acid polymers in which one or more amino acid residues are artificial chemical mimetics of a corresponding naturally occurring amino acid, as well as to naturally occurring and non-naturally occurring amino acid polymers.
[0023] The term "sequence identity," as used herein in reference to polypeptide or DNA sequences, refers to subunit sequence identity between two molecules. If a subunit position in both molecules is occupied by the same monomeric subunit (e.g., the same amino acid residue or nucleotide), the molecules are identical at that position. The similarity between two amino acid or two nucleotide sequences is a linear function of the number of identical positions. Generally, sequences are aligned to obtain the highest order match. Where appropriate, identity can be calculated using published techniques and widely available computer programs such as the GCS program package (Devereux et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, and FASTA (Atschul et al., J. Molecular Biol. 215:403, 1990).
[0024] As used herein, the term "protein variant" or "variant protein" or "variant polypeptide" refers to a protein that differs from a wild-type protein by virtue of at least one amino acid modification. The parent polypeptide may be a naturally occurring or wild-type (WT) polypeptide, or may be a modified version of a WT polypeptide. A variant polypeptide may refer to the polypeptide itself, a composition comprising the polypeptide, or the amino acid sequence encoding it. Preferably, a variant polypeptide has at least one amino acid modification compared to the parent polypeptide, e.g., about 1 to about 10 amino acid modifications, preferably about 1 to about 5 amino acid modifications, compared to the parent.
[0025] As used herein, "parent polypeptide," "parent protein," "precursor polypeptide," or "precursor protein" refers to an unmodified polypeptide that is subsequently modified to generate a variant. A parent polypeptide can be a wild-type (or naturally occurring) polypeptide, or a variant or engineered version of a wild-type polypeptide. A parent polypeptide can refer to the polypeptide itself, a composition comprising the parent polypeptide, or the amino acid sequence that encodes it.
[0026] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that are later modified, such as hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine. An amino acid analog refers to a compound that has the same basic chemical structure as a naturally occurring amino acid (i.e., an alpha carbon bonded to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methylsulfonium). Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. An amino acid mimetic refers to a chemical compound that has a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
[0027] As used herein, the terms "peptide residue" and "peptide structure" are intended to include peptides consisting of naturally occurring L-amino acids and the corresponding D-amino acids, as well as peptide derivatives, peptide analogs, and peptidomimetics of the structures of naturally occurring L-amino acids. Approaches to designing peptide analogs, derivatives, and mimetics are known in the art. See, for example, Veber and Freidinger 1985 TINS p. 392; Evans, et al. 1987 J. Med. Chem. 30: 229. Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce equivalent or enhanced therapeutic or prophylactic effects by methods known in the art and further described in the following references: Spatola, AF 1983 in: Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267; Holladay, et al. 1983 Tetrahedron Lett. 24:4401-4404.
[0028] Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine for L-lysine) can be used to generate more stable peptides. In addition, constrained peptides containing consensus sequences or substantially identical consensus sequence variations can be generated by methods known in the art (Rizo, et al. 1992 Ann. Rev. Biochem. 61:387, incorporated herein by reference in its entirety). For example, peptides can be generated by adding internal cysteine residues capable of forming intramolecular disulfide bridges that cyclize the peptide, adding cyclic lactam bridges, or altering helix stability using flexible 6-aminohexanoic acid (Ahx), rigid aminoisobutyric acid (Aib), or D-amino acid residues.
[0029] As used herein, a "derivative" of a compound (e.g., a peptide or amino acid) refers to a form of the compound in which one or more reactive groups in the compound are derivatized with a substituent. Examples of peptide derivatives include peptides in which the amino acid side chain, the peptide backbone, or the amino or carboxy terminus are derivatized (e.g., peptide compounds having methylated amide bonds or hydroxylated amino acids or amino acid residues).
[0030] As used herein, the term "analog" of a compound refers to a compound that retains the chemical structure of a reference compound required for the functional activity of the compound, and also contains a specific chemical structure that differs from the reference compound. As used herein, the term "mimetic" of a compound refers to a compound in which the chemical structure of a reference compound required for the functional activity of the compound is replaced with another chemical structure that mimics the conformation of the reference compound. Examples of peptidomimetics include peptide compounds in which the peptide backbone is replaced with one or more benzodiazepine molecules, peptides in which all L-amino acids are replaced with the corresponding D-amino acids, and "retroinverso" peptides (see U.S. Pat. No. 4,522,752 by Sisto, James, Glet et al. 1993 Science 260:1937-1942, and Goodman et al. 1981 Perspectives in Peptide Chemistry pp.283-294). Other derivatives include C-terminal hydroxymethyl derivatives, O-modified derivatives (eg, C-terminal hydroxymethyl benzyl ether), and N-terminally modified derivatives, including substituted amides such as alkylamides and hydrazides.
[0031] As used herein, the term "amino acid structure" is intended to include amino acids, as well as analogs, derivatives, and mimetics of amino acids that maintain the functional activity of the compound. For example, the term "phenylalanine structure" is intended to include phenylalanine, as well as pyridylalanine and homophenylalanine. The term "leucine structure" is intended to include substitutions with leucine and other natural or unnatural amino acids having aliphatic side chains, such as valine, isoleucine, or norleucine.
[0032] The amino and / or carboxy termini of the peptide compounds disclosed herein may be standard amino and carboxy termini, as found in most proteins. Alternatively, the amino and / or carboxy termini of the peptide compounds may be chemically modified by the addition or replacement of a derivative group. Amino derivative groups that may be present at the N-terminus of the peptide compounds include acetyl, aryl, aralkyl, acyl, epoxysuccinyl, and cholesteryl groups. Carboxy derivative groups that may be present at the C-terminus of the peptide compounds include alcohols, aldehydes, epoxysuccinates, acid halides, carbonyls, halomethanes, diazomethane groups, and carboxamides.
[0033] As used herein, "modified" refers to a polypeptide that retains the overall structure of a reference polypeptide but differs from the reference polypeptide in at least one residue. As used herein, a "modified C-terminus" is a C-terminus of a polypeptide that has a chemical structure other than the standard peptide carboxy group; an example of such a modified C-terminus is a C-terminal carboxamide.
[0034] As used herein, "pharmaceutically acceptable carrier" refers to a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient and that is not toxic to the host or patient.
[0035] As used herein, the terms "peptide residue" and "peptide structure" are intended to include peptides consisting of naturally occurring L-amino acids and the corresponding D-amino acids, as well as peptide derivatives, peptide analogs, and peptidomimetics of naturally occurring L-amino acid structures. Approaches to designing peptide analogs, derivatives, and mimetics are known in the art (see Farmer, PSin: Drug Design EJ Ariens, ed. Academic Press, New York, 1980, vol. 10, pp. 119-143; Ball JB & Alewood, PF 1990 / . Mol. Recognition 3: 55; Luthman, et al. 1996 A Textbook of Drug Design and Development, 14: 386-406, 2nd Ed., Harwood Academic Publishers; Joachim Grante, Angew. 1994 Chem. Int. Ed. Engl. 33: 1699-1720). Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce equivalent or enhanced therapeutic or prophylactic effects by methods known in the art (see Spatola, AF. 1983 in: Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267; Spatola, AF 1983 Vega Data, Vol. 1, Issue 3, Peptide Backbone Modifications (general review); Jennings-White, et al. 1982 Tetrahedron Lett. 23:2533; Holladay, et al. 1983 Tetrahedron Lett. 24:4401-4404; and Hruby, 1982 Life Sci. 31:189-199).
[0036] In addition, constrained peptides can be generated by methods known in the art (Rizo, et al. 1992 Ann. Rev. Biochem. 61:387), for example, by adding internal cysteine residues that can form intramolecular bridges that cyclize the peptide, by adding cyclic lactam bridges, or by altering helix stability using flexible 6-aminohexanoic acid (Ahx), rigid aminoisobutyric acid (Aib), or D-amino acid residues.
[0037] Synthetic or non-naturally occurring amino acids refer to amino acids that do not naturally occur in vivo, but which can nevertheless be incorporated into the peptide structures described herein.
[0038] BRINP2 (BMP / retinoic acid-inducible neuron-specific protein 2) is a family of proteins widely expressed, primarily in both the central nervous system (CNS) and peripheral nervous system (PNS). These proteins are thought to inhibit neuronal proliferation by negatively regulating the cell cycle G1 / S transition, but do not have a well-characterized biological function. The reference sequence for human BRINP2 can be accessed at Genbank, NP_066988, and has the reference sequence (SEQ ID NO: 3). TIFF2025525855000003.tif69139
[0039] As demonstrated herein, peptides proteolytically cleaved from BRINP2 are effective in reducing food intake and obesity in mammals. The peptides are referred to herein as BRINP2-related peptides (BRPs). The encoded human peptide has the sequence THRILRRLFNLC (SEQ ID NO: 1). The BRP peptide is highly conserved across mammalian species, including humans (Homo sapiens) (SEQ ID NO: 1, THRILRRLFNLC), house mice (Mus musculus) (SEQ ID NO: 4, MHRIVRRLFNLC), roof rats (Rattus rattus) (SEQ ID NO: 5, IVHRIVRRLFNLC), wild boars (Sus scrofa) (SEQ ID NO: 6, THRIVRRLFNLC), rhesus monkeys (Macaca mulatta) (SEQ ID NO: 7, THRIVRRLFNLC), and Canis lupus (SEQ ID NO: 8, THRIVRRLFNLC).
[0040] Applicant has further made targeted amino acid changes in peptides set forth in, for example, SEQ ID NO: 9, AHRILRRLFNLC, SEQ ID NO: 10, TARILRRLFNLC, SEQ ID NO: 11, THAILRRLFNLC, SEQ ID NO: 12, THRALRRLFNLC, SEQ ID NO: 13, THRIARRLFNLC, SEQ ID NO: 14, THRILARLFNLC, SEQ ID NO: 15, THRILRALFNLC, SEQ ID NO: 16, THRILRRAFNLC, SEQ ID NO: 17, THRILRRLANLC, SEQ ID NO: 18, THRILRLFALC, SEQ ID NO: 19, THRILRRLFNAC, SEQ ID NO: 20, THRILRRLFNLA. In some embodiments, the peptides of the invention comprise or consist essentially of peptides of SEQ ID NOs: 9-20.
[0041] In some embodiments, a composition is provided comprising a BRP peptide of the following formula (SEQ ID NO:2): TIFF2025525855000004.tif7145, X 9 can be any amino acid. In some embodiments, X 9 is other than F, and in some embodiments, X9 is G, A, V, L, K, or I, e.g., SEQ ID NO: 17.
[0042] In some embodiments, one or more residues of SEQ ID NO:2 are amidated, and the C-terminal carboxyl group, C 12 In some embodiments, one or more residues may be acylated and may include a fatty acid. In some embodiments, the acyl moiety may be any of T1, H2, R7, X9, and L. 11 In some embodiments, the acyl moiety is a straight or branched C4-C 20 alkyl, C 10 ~C 18 Alkyl, especially C 16 It may be alkyl, optionally substituted with halo, hydroxy, alkoxy, amino, alkylamino, dialkylamino, sulfate, or phosphate, and may be saturated or mono- or di-unsaturated. Fatty acids of interest include, but are not limited to, palmitic acid, stearic acid, arachidic acid, lauric acid, myristic acid, myristoleic acid, palmitoleic acid, sapienic acid, oleic acid, linoleic acid, α-linolenic acid, arachidonic acid, eicosapentaenoic acid, erucic acid, docosahexaenoic acid, and the like, and may be palmitic acid.
[0043] In some embodiments, the BRP peptides are modified by pegylation, glycosylation, conjugation to large proteins such as albumin, or conjugation to polymers, optionally in combination with amidation and / or amino acid modifications.
[0044] In some embodiments, the BRP peptides include amino acid modifications, such as the use of D-amino acids or beta-amino acids, to increase biological half-life.
[0045] In certain embodiments, the BRP peptide is truncated at the carboxy or amino terminus. In some embodiments, the peptide of SEQ ID NO: 2 is other than a naturally occurring peptide and may vary in amino acid sequence or in modifications such as acylation, amidation, etc.
[0046] Optionally, the peptide is modified by covalent attachment to a heterologous moiety, which may include a polymer, Fc, an FcRn binding ligand, an immunoglobulin, albumin, a collagen binding motif, or N-methylation. The covalently attached polymer may be selected from the group consisting of lipidation, polyethylene glycol (PEG) moieties, polypropylene glycol (PPG) moieties, PAS moieties, which are amino acid sequences containing primarily alanine and serine residues or primarily alanine, serine, and proline residues, amino acid sequences that form a random coil conformation under physiological conditions [US 2010 / 0292130 and WO2008 / 155134], and hydroxyethyl starch (HES) moieties [WO02 / 080979], Fc immunoglobulin sequences, FcRn-binding ligands, albumin and albumin-binding ligands, and XTEN moieties (see Schellenberger, et al., 2009, Nature Biotechnology 27(12):1186-1192).
[0047] An "Fc region" can be a naturally occurring or synthetic polypeptide homologous to the C-terminal domain of IgG produced by digestion of IgG with papain. The Fc of IgG has a molecular weight of approximately 50 kDa. The BRP protein can be fused to the entire Fc region or a smaller portion thereof that retains the ability to extend the circulating half-life of the chimeric polypeptide to which it belongs. In addition, full-length or fragmented Fc regions can be variants of the wild-type molecule; that is, they can contain mutations that may or may not affect the function of the polypeptide. As described further below, native activity may not be required or desired in all cases.
[0048] In other embodiments, the BRP protein can include a polypeptide that functions as an antigen tag, such as a FLAG sequence, which is recognized by a biotinylated, highly specific anti-FLAG antibody, as described herein (see Blanar et al., Science 256:1014, 1992; LeClair et al., Proc. Natl. Acad. Sci. USA 89:8145, 1992). In some embodiments, the chimeric polypeptide further includes a C-terminal c-myc epitope tag.
[0049] When the covalent bond is PEG, the molecular weight of the PEG can be about 1 kDa to about 100 kDa for ease of handling and manufacturing. For example, the PEG can have an average molecular weight of about 200, 500, 1000, 2000, 4000, 8000, 16,000, 32,000, 64,000, or 100,000 kDa. In some embodiments, the PEG can have a branched structure (see U.S. Pat. No. 5,643,575; Morpurgo et al. Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides Nucleotides 18:2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10:638-646 (1999)).
[0050] Optionally, modified peptide derivatives include replacing one or more disulfide bonds with lactam bridges to increase the metabolic stability of the peptide. Cystathion is resistant to thiol reduction. Therefore, replacing disulfides with thioethers, or selenosulfides, diselenides, and ditellurides can provide protection against reduction (Knerr et al., ACS Chem Biol, 6(7), 753-760, 2011; Muttenthaler et al. J Med Chem., 53(24), 8585-8596, 2010). Peptide disulfide bond mimetics based on diamino diacids can also be used to improve the stability of analogs (Cui et al., Angew Chem, 125, 9737-9741, 2013). Disulfide bridges can also be modified by inserting linkers or bridges of different natures.
[0051] Optionally, the peptide is modified by the addition of one or more alkane, cholesterol, or PEG-cholesterol moieties to increase the metabolic stability of the peptide. Stapled peptides can be synthesized using ring-closing metathesis to lock the peptide into a specific conformation and reduce conformational entropy through the introduction of synthetic braces (staples).
[0052] The sequence of a polypeptide can be altered in various ways known in the art to generate targeted changes in the sequence. Polypeptides are usually substantially similar to the sequences provided herein, i.e., differ by at least one amino acid, and may differ by at least two, but not more than about 10 amino acids. Sequence changes can be substitutions, insertions, or deletions (including truncations at the carboxy or amino termini). Scanning mutations that systematically introduce alanine or other residues can be used to determine key amino acids. Conservative amino acid substitutions typically include substitutions within the following groups: (glycine, alanine), (valine, isoleucine, leucine), (aspartic acid, glutamic acid), (asparagine, glutamine), (serine, threonine), (lysine, arginine), or (phenylalanine, tyrosine).
[0053] Modifications of interest that do not alter the primary sequence include chemical derivatization of the polypeptide, such as acetylation, amidation, acylation, or carboxylation. Also included are glycosylation modifications, made, for example, during polypeptide synthesis and processing or in further processing steps, by modifying the glycosylation pattern of the polypeptide, for example, by exposing the polypeptide to enzymes that affect glycosylation, such as mammalian glycosylation or deglycosylation enzymes. Also embraced are sequences having phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, or phosphothreonine.
[0054] The present invention also includes polypeptides that have been modified using conventional molecular biology techniques and synthetic chemistry to improve resistance to proteolysis, optimize solubility properties, or make them more suitable as therapeutic agents. For example, the peptide backbone can be cyclized to improve stability (see Friedler et al. (2000) J. Biol. Chem. 275:23783-23789). Analogs of such polypeptides include those containing residues other than naturally occurring L-amino acids, such as D-amino acids or non-naturally occurring synthetic amino acids.
[0055] Those skilled in the art of peptide chemistry will recognize that amino acid residues occur as both D and L isomers, and that the present invention contemplates the use of either isomer or mixture of isomers of the amino acid residues incorporated into the synthesis of the peptides described herein.
[0056] The present invention includes within its scope pharmaceutical compositions comprising, as an active ingredient, a therapeutically effective amount of at least one of the compounds of SEQ ID NO: 2, alone or in combination with a pharmaceutical carrier or diluent. Optionally, the compounds of the present invention can be used alone, in combination with other compounds of the present invention, or in combination with one or more other therapeutic agents (e.g., antidiabetic agents or other pharmaceutically active materials).
[0057] If desired, various groups may be introduced into the peptide during synthesis or expression, which allow for linkage to other molecules or surfaces. Thus, cysteine can be used to create a thioether, histidine for linkage to a metal ion complex, carboxyl group for forming an amide or ester, amino group for forming an amide, etc.
[0058] The peptides described herein can be prepared, for example, by using standard solid-phase techniques. (See Merrifield, 1963, Am. Chem. Soc. 85:2149; J.M. Stewart and J.D. Young, 1984, Solid Phase Peptide Syntheses, 2nd Ed., Pierce Chemical Company.) These procedures can also be used to synthesize peptides in which an amino acid other than the 20 naturally occurring genetically encoded amino acids is substituted at one, two, or more positions in any of the modified peptides disclosed herein. For example, naphthylalanine can be substituted for tryptophan to facilitate synthesis. Other synthetic amino acids that can be substituted into the peptides of this embodiment include L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, d-amino acids such as L-hydroxylysyl and D-methylalanyl, L-methylalanyl, β-amino acids, and isoquinolyl. D-amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides of the present embodiments (see Roberts, et al. 1983 Unusual Amino / Acids in Peptide Synthesis 5:341-449). In some embodiments, the naturally occurring side chains of the 20 genetically encoded amino acids, or any other side chain disclosed herein, can be transferred to the nitrogen of the amino acid instead of the α-carbon typically found in peptides.
[0059] Peptides can be synthesized in a stepwise fashion on an insoluble polymer support (also referred to as a "resin") starting from the C-terminus of the peptide. Synthesis begins by adding the C-terminal amino acid of the peptide to the resin via amide or ester bond formation. This allows the resulting peptide to be ultimately released as a C-terminal amide or carboxylic acid, respectively. Alternatively, if a C-terminal amino alcohol is present, the C-terminal residue can be coupled to the 2-methoxy-4-alkoxybenzyl alcohol resin (SASRIN™, Bachem Bioscience, Inc., King of Prussia, Pa.) described herein, and after completion of peptide sequence assembly, the resulting peptide alcohol is released with LiBH in THF (see J.M. Stewart and J.D. Young, supra, p. 92).
[0060] Synthesis of the peptides described herein can be performed using a peptide synthesizer such as an Advanced Chemtech Multiple Peptide Synthesizer (MPS396) or an Applied Biosystems Inc. Peptide Synthesizer (ABI 433A). When using the MPS396, up to 96 peptides were synthesized simultaneously. When using the ABI 433A synthesizer, individual peptides were synthesized sequentially. In both cases, stepwise solid-phase peptide synthesis was performed using an Fmoc / t-butyl protection strategy.
[0061] Peptides of the desired purity can be obtained by purification using preparative HPLC, for example, on a Waters Model 4000 or Shimadzu Model LC-8A liquid chromatograph. The crude peptide solution is injected onto a YMC S5 ODS column and eluted with a linear gradient of MeCN in water, both buffered with 0.1% TFA, using a flow rate of 14-20 mL / min, with monitoring of the effluent by UV absorbance at 220 nm. The structure of the purified peptide can be confirmed by electrospray MS analysis.
[0062] Polypeptides can also be isolated and purified according to conventional methods of recombinant synthesis. A lysate can be prepared from the expression host and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other purification techniques. In most cases, the composition used will be substantially pure, e.g., the peptide of interest will comprise at least 20% by weight of the desired product, more usually at least about 75% by weight, preferably at least about 95% by weight, and for therapeutic purposes usually at least about 99.5% by weight or more, with respect to contaminants related to the method of preparation and purification of the product. This percentage can be based on total protein.
[0063] Treatment methods Methods are provided for treating or delaying the progression or onset of diabetes and metabolic syndrome (particularly type II diabetes), including diabetic complications such as retinopathy, neuropathy, nephropathy, and delayed wound healing, and related disorders including insulin resistance (impaired glucose homeostasis), hyperglycemia, hyperinsulinemia, elevated blood levels of fatty acids or glycerol, hyperlipidemia including hypertriglyceridemia, syndrome X, atherosclerosis, and hypertension, wherein a therapeutically effective amount of the peptide of SEQ ID NO: 2 is administered to a mammal (e.g., a human, a patient in need of treatment) for a period sufficient to effect treatment.
[0064] Methods are provided for treating obesity and related disorders as defined herein, wherein a therapeutically effective amount of a peptide of SEQ ID NO: 2 is administered to a mammal (e.g., a human, a patient in need of treatment). In some such embodiments, the reduction in food intake observed with administration of BRP is associated with a weight loss, e.g., a 1%, 2.5%, 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, 30% or more reduction in body weight, depending on the subject's initial body weight.
[0065] "In combination with," "combination therapy," and "combination product" refer to simultaneous administration of the agents described herein to a patient. When administered as a combination, each component can be administered simultaneously or sequentially in any order at different times. Thus, each component can be administered separately but sufficiently close in time to provide the desired therapeutic effect.
[0066] "Co-administration" of active agents in the methods of the invention refers to administration of the agents at times such that the agents have a simultaneous therapeutic effect. Such co-administration may involve simultaneous (i.e., simultaneous), prior, or subsequent administration of the agents. One of ordinary skill in the art would have no difficulty determining the appropriate timing, sequence, and dosages of administration for particular drugs and compositions of the invention.
[0067] "In combination with," "combination therapy," and "combination product" refer, in certain embodiments, to the simultaneous administration of a peptide described herein to a patient in combination with an additional therapy. When administered in combination, each component can be administered simultaneously or sequentially in any order at different times. Thus, each component can be administered separately but sufficiently closely spaced in time to provide the desired therapeutic effect.
[0068] "Co-administration" refers to the administration of one or more components, such as engineered proteins and cells, known therapeutic agents, etc., at a time such that the combination has a therapeutic effect. Such co-administration may involve simultaneous (i.e., simultaneous), prior, or subsequent administration of the components. One of ordinary skill in the art would have no difficulty determining the appropriate timing, sequence, and dosages of administration.
[0069] The use of the term "in combination" does not restrict the order in which prophylactic and / or therapeutic agents are administered to a subject with a disorder. A first prophylactic or therapeutic agent can be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), simultaneously with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second prophylactic or therapeutic agent to a subject with a disorder.
[0070] These methods of treatment are optionally combined with one or more other types of therapeutic agents, such as antidiabetic agents, lipid-lowering agents, or antiobesity agents, e.g., metformin, sulfonylureas (e.g., glyburide, glipizide, glimepiride), glinides (e.g., repaglinide and naglinide), thiazolidinediones (e.g., rosiglitazone, pioglitazone), DPP-4 inhibitors (e.g., sitagliptin, saxagliptin, linagliptin), GLP-1 receptor agonists (e.g., exenatide, liraglutide, semaglutide), SGLT2 inhibitors (e.g., canagliflozin, dapagliflozin, empagliflozin), and the like, and administered to a human patient in need of treatment. When used in combination with the compounds of the invention, the other therapeutic agents may be used in amounts as indicated in the Physician's Desk Reference, for example, as in the patents listed above, or as otherwise determined by one of ordinary skill in the art.
[0071] The term "obesity-related condition" refers to any disease or condition caused by or associated with obesity or associated (e.g., by biochemical or molecular association) with weight gain and / or related biological processes that precede clinical obesity. Examples of obesity-related conditions include, but are not limited to, type 2 diabetes, metabolic syndrome, fatty liver disease such as NASH, hyperglycemia, hyperinsulinemia, impaired glucose tolerance, impaired fasting glucose, hyperlipidemia, hypertriglyceridemia, insulin resistance, hypercholesterolemia, atherosclerosis, coronary artery disease, peripheral vascular disease, and hypertension.
[0072] Associated obesity syndromes include, but are not limited to, 5p13 microduplication syndrome, 16p11.2 deletion, Albright hereditary osteodystrophy / PHP1a, Alström syndrome, Bardet-Biedl syndrome (BBS), Borjeson-Forssmann-Lehmann syndrome, Carpenter syndrome, CHOPS syndrome, Chudley-Lowry syndrome, Cohen syndrome, Kabuki syndrome / Niikawa-Kuroki syndrome, Kleefstra syndrome, MORM syndrome, Prader-Willi syndrome, Rubinstein-Taybi syndrome, Chassis X-linked mental retardation, Smith-Magenis syndrome, W These include AGRO syndrome, OBHD, ulno-mammaplasty syndrome, Bannayan-Riley-Ruvalcaba syndrome, Beckwith-Wiedemann syndrome, Klippel-Trenaunay-Weber syndrome, Parks-Weber syndrome, Proteus syndrome, Silver-Russell syndrome, Simpson-Golabi-Behmel syndrome, Sotos syndrome, Weaver syndrome, Camera-Margot-Cohen syndrome, Clark-Baraiste syndrome, MEHMO syndrome, MOMES syndrome, MOMO syndrome, Morgagni-Stewart-Morel syndrome, 1p36 deletion syndrome, and 2p25.3 deletion syndrome. See, e.g., Thaker (2017) Adolesc Med State Art Rev. 28(2):379-405 (specifically incorporated herein by reference).
[0073] Diabetes is a metabolic disease that occurs when the pancreas does not produce enough of the hormone insulin to regulate blood sugar ("type 1 diabetes"), or alternatively, when the body cannot effectively use the insulin it does produce ("type 2 diabetes").
[0074] According to recent estimates by the World Health Organization, over 200 million people worldwide have diabetes, with 90% suffering from type 2 diabetes. Typical long-term complications include neuropathy, retinopathy, nephropathy, systemic degenerative changes in large and small blood vessels, and increased susceptibility to infection. Because individuals with type 2 diabetes still have residual insulin available, as opposed to individuals with type 1 diabetes who completely lack insulin production, type 2 diabetes only gradually surfaces and is often diagnosed years after onset, once complications have already occurred.
[0075] Insulin resistance occurs in 25% of apparently healthy, non-diabetic, non-obese individuals and predisposes to both diabetes and coronary artery disease. Hyperglycemia in type 2 diabetes is the result of both resistance to insulin in muscle and other major insulin target tissues and reduced insulin secretion by beta cells. Longitudinal studies of individuals with a strong family history of diabetes show that insulin resistance precedes secretory abnormalities. Prior to developing diabetes, these individuals compensate for insulin resistance by secreting excess insulin. When compensatory hyperinsulinemia fails, diabetes develops. Subsequently, secretory defects in pancreatic beta cells play a major role in the severity of diabetes.
[0076] Type II diabetes is diagnosed according to the criteria set forth in the Report of the Expert Committee on the Diagnosis and Classification of Diabetes, whereby a fasting plasma glucose level of 126 milligrams per deciliter or greater is present, and is a latent autoimmune form of diabetes in adults. It is characterized by insulin resistance and hyperglycemia, which can subsequently lead to retinopathy, nephropathy, neuropathy, or other pathological conditions. In addition, diabetes is a known risk factor for atherosclerotic cardiovascular disease. Metabolic syndrome refers to a group of factors that increase the risk of developing heart disease, diabetes, or other health problems, including hypertension, obesity, hyperlipidemia, and insulin resistance (manifesting as overt diabetes or impaired fasting blood glucose or glucose tolerance) (Grundy et al., Circulation. 2004;109:433-438).
[0077] The progression from a normal metabolic state to a state of impaired fasting glucose (IFG: fasting glucose levels greater than 100 mg / dL) or impaired glucose tolerance (IGT: 2-hour glucose levels of 140-199 mg / dL after a 75-gram oral glucose challenge) is well characterized. Both IFG and IGT are considered prediabetic states, and more than 50% of subjects with IFG progress to overt type 2 diabetes within an average of 3 years (Nichols, Diabetes Care 2007.(2):228-233).
[0078] The term "metabolic syndrome" refers to metabolic disorders (particularly glucose and lipid dysregulation) that include insulin resistance and defective insulin secretion by pancreatic beta cells, and may further include conditions and states such as abdominal obesity, dyslipidemia, hypertension, glucose intolerance, or a prothrombotic state, and may further lead to disorders such as hyperlipidemia, obesity, diabetes, insulin resistance, glucose intolerance, hyperglycemia, and hypertension.
[0079] The term "obesity" means a state of excess body fat (adipose tissue), including by way of example in accordance with the Federal Obesity Clinical Guidelines for Adults of the National Institutes of Health, whereby a body mass index ("BMI"), calculated by weight in kilograms divided by height in meters squared, is 25 or greater.
[0080] Compounds, e.g., peptides of SEQ ID NO: 2, are effective in treating patients with a baseline mean BMI of >27 kg / m 2 A drug is effective to induce at least a "minimal weight loss" if it induces a statistically significant, placebo-adjusted reduction in mean body weight of at least about 2.5% but less than about 5.0% over a 12-52 week period in a cohort of subjects.
[0081] The pharmaceutical composition is administered to patients with a baseline mean BMI of >27 kg / m 2 A compound is effective in "treating obesity" or "inducing weight loss" if it induces a statistically significant, placebo-adjusted reduction of at least about 5.0% of body weight over a 12-52 week period in a cohort of subjects.
[0082] It will be understood that there are medically accepted definitions of obesity and overweight. Patients can be identified, for example, by measuring their body mass index (BMI), calculated by dividing weight in kilograms by height in meters squared, and comparing the results to the definitions. The recommended classification of BMI in humans, adopted by an expert panel on the identification, evaluation, and treatment of overweight and obesity in adults and endorsed by leading organizations of the medical profession, is as follows: underweight <18.5 kg / m 2 , normal weight 18.5-24.9kg / m 2 , overweight 25-29.9kg / m 2 , Obesity (Class 1) 30-34.9 kg / m 2 , Obesity (Class 2) 35-39.9 kg / m 2 , Severe obesity (Class 3) >40 kg / m 2(Practical Guide to the Identification, Evaluation, and Treatment of Overweight and Obesity in Adults, The North American Association for the Study of Obesity (NAASO) and the National Heart, Lung, and Blood Institute (NHLBI) 2000.) Modifications of this classification may be used for specific ethnic groups.
[0083] Another alternative for assessing overweight and obesity is by measuring waist circumference. There are several proposed classifications and different cutoffs based on ethnic groups. For example, according to the International Diabetes Federation classification, men with a waist circumference greater than 94 cm and women with a waist circumference greater than 80 cm are at higher risk of diabetes, dyslipidemia, hypertension, and cardiovascular disease due to excess abdominal fat. Another classification is based on recommendations from the Adult Treatment Panel III, with a recommended cutoff of 102 cm for men and 88 cm for women. However, the methods, combinations, and compositions of the present invention can also be used to reduce self-diagnosed overweight and the risk of becoming obese due to lifestyle, genetic considerations, heredity, and / or other factors.
[0084] Dosage and frequency of administration may vary depending on the half-life of the drug in the patient. Those skilled in the art will understand that such guidelines will be adjusted depending on the molecular weight of the active agent, clearance from the blood, mode of administration, and other pharmacokinetic parameters. Dosage may vary depending on local administration, e.g., intranasal, inhalation, etc., or systemic administration, e.g., intramuscular, intraperitoneal, intravenous, oral, etc.
[0085] The active agent may be administered by any suitable means, including topical, oral, parenteral, intrapulmonary, and intranasal. Parenteral infusions include intramuscular, intravenous (bolus or slow drip), intraarterial, intraperitoneal, intrathecal, or subcutaneous administration. The agent may be administered in any medically acceptable manner. This may include parenteral routes, such as intravenous, intravascular, intraarterial, subcutaneous, intramuscular, intratumoral, intraperitoneal, intraventricular, epidural, or other, as well as oral, nasal, ophthalmic, rectal, or topical injection. Sustained-release administration is also specifically included in the present disclosure, such as by depot injection or erodible implant.
[0086] As mentioned above, the agent may be formulated with a pharmaceutically acceptable carrier (one or more organic or inorganic components, natural or synthetic, with which the agent of interest is combined to facilitate its application). Suitable carriers include sterile saline, although other aqueous and non-aqueous isotonic sterile solutions and suspensions known to be pharmaceutically acceptable are known to those skilled in the art. An "effective amount" refers to an amount capable of ameliorating or slowing the progression of a diseased, degenerative, or damaged condition. The effective amount can be determined on an individual basis and is determined, in part, based on consideration of the condition being treated and the desired results. The effective amount can be determined by those skilled in the art using such factors and only routine experimentation.
[0087] The agent can be administered as a pharmaceutical composition containing a pharmaceutically acceptable excipient. The preferred form depends on the intended mode of administration and therapeutic use. Depending on the desired formulation, the composition can contain a pharmaceutically acceptable non-toxic carrier or diluent, defined as a vehicle commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solution, dextrose solution, and Hank's solution. In addition, the pharmaceutical composition or formulation can also contain other carriers, adjuvants, or non-toxic, non-therapeutic, non-immunogenic stabilizers.
[0088] As used herein, "commercially available" compounds include those available from Acros Organics (Pittsburgh PA), Aldrich Chemical (Milwaukee WI, including Sigma Chemical and Fluka), Apin Chemicals Ltd. (Milton Park UK), Avocado Research (Lancashire UK), BDH Inc. (Toronto, Canada), Bionet (Cornwall, UK), Chemservice Inc. (West Chester PA), Crescent Chemical Co. (Hauppauge NY), Eastman Organic Chemicals, Eastman Kodak Company (Rochester NY), Fisher Scientific Co. (Pittsburgh PA), Fisons Chemicals (Leicestershire UK), Frontier Scientific (Logan UT), ICN Biomedicals, Inc. (Costa Mesa CA), Key Organics (Cornwall UK), Lancaster Synthesis (Windham NH), Maybridge Chemical Co. Ltd. (Cornwall UK), Parish Chemical Co. (Orem UT), Pfaltz & Bauer, Inc. (Waterbury CN), Polyorganix (Houston TX), Pierce Chemical Co. (Rockford IL), Riedel de Haen AG (Hannover, Germany), Spectrum Quality Products, Inc. (New Brunswick, NJ), TCI America (Portland OR), Trans World Chemicals, Inc. (Rockville MD), Wako Chemicals USA, Inc. (Richmond VA), Novabiochem, and Argonaut Technology.
[0089] Compounds useful for co-administration with the active agents of the present invention can also be made by methods known to those skilled in the art. As used herein, "methods known to those skilled in the art" can be identified through various reference books and databases. Suitable reference books and treatises that detail the synthesis of reactants useful in preparing the compounds of the invention or provide references to articles describing the preparation include, for example, "Synthetic Organic Chemistry," John Wiley & Sons, Inc., New York; S.R. Sandler et al., "Organic Functional Group Preparations," 2nd Ed., Academic Press, New York, 1983; H.O. House, "Modern Synthetic Reactions," 2nd Ed., W.A. Benjamin, Inc., Menlo Park, Calif., 1972; T.L.G. Gilchrist, "Heterocyclic Chemistry," 2nd Ed., John Wiley & Sons, New York, 1992; and J. March, "Advanced Organic Chemistry: Reactions, Mechanisms and Structure," 4th Ed., Wiley-Interscience, New York, 1992. Specific reactants and similar reactants can also be identified through the index of known chemicals produced by the Chemical Abstracts Service of the American Chemical Society, available in most public and university libraries, as well as online databases (for more information, the American Chemical Society, Washington, DC, can be contacted). Chemicals that are known in catalogs but not commercially available can be prepared by custom chemical synthesis companies, and many of the standard chemical supply companies (e.g., those listed above) offer custom synthesis services.
[0090] The active agents of the present invention and / or compounds administered therewith are incorporated into various formulations for therapeutic administration. In one embodiment, the agents can be formulated into pharmaceutical compositions by combining with a suitable pharmaceutically acceptable carrier or diluent, and are formulated into preparations in solid, semi-solid, liquid, or gaseous form, such as tablets, capsules, powders, granules, ointments, liquids, suppositories, injections, inhalants, gels, microspheres, and aerosols. Thus, administration of the active agents and / or other compounds can be achieved in a variety of ways, usually by oral administration. The active agents and / or other compounds may be systemic after administration or may be localized by formulation or by the use of an implant that acts to retain the active dose at the implantation site.
[0091] In pharmaceutical dosage forms, the active agents and / or other compounds may be administered in the form of their pharmaceutically acceptable salts, or they may be used alone or in suitable combinations, as well as in combination with other pharmaceutically active compounds. As mentioned above, drugs can be combined to provide an active cocktail. The following methods and excipients are exemplary and should not be construed as limiting the present invention.
[0092] The formulations are typically provided in unit dosage forms. Here, the term "unit dosage form" refers to a physically discrete unit suitable as a unitary dosage for a human subject, each unit containing a predetermined amount of an active agent in an amount calculated to produce an effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular conjugate used and the effect to be achieved, as well as the pharmacodynamics associated with each conjugate in the host.
[0093] The term "sustained release" is intended to include forms of active ingredients or formulations for active ingredients that have an extended in vivo half-life or duration of action, such as sustained release forms, sustained release compositions, or sustained release formulations. Sustained release forms can result from modifications of the active ingredient, such as modifications that increase circulation residence time, decrease degradation rate, decrease clearance rate, etc., or from formulations or compositions that provide sustained release of the active ingredient (e.g., the use of various liposomes, emulsions, micelles, matrices, etc.). Sustained release forms or formulations are a type of controlled release form or formulation.
[0094] In some embodiments, the unit dose is at least about 0.1 mg / kg, at least about 0.5 mg / kg, at least about 1 mg / kg, at least about 5 mg / kg, at least about 10 mg / kg, at least about 20 mg / kg, at least about 50 mg / kg, or at least about 100 mg / kg, and in some embodiments, an effective dose is about 1-50 mg / kg. Administration can be daily, every two days, every three days, or more frequently, e.g., weekly, twice weekly, biweekly, monthly, etc. Administration can be parenteral, including sustained-release formulations. Administration can be sustained over an extended period (e.g., months or years) to maintain desired glucose and fatty acid levels.
[0095] Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers, or diluents, are commercially available. Additionally, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, and wetting agents, are commercially available. Any compound useful in the methods and compositions of the present invention can be provided as a pharmaceutically acceptable base addition salt. "Pharmaceutically acceptable base addition salt" refers to a salt that retains the biological effectiveness and properties of the free acid and is not biologically or otherwise undesirable. These salts are prepared from the addition of an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Preferred inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, tris(hydroxymethyl)aminomethane (Tris), ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, and polyamine resins. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.
[0096] For oral preparations, the agent may be used alone or in combination with suitable additives to form tablets, powders, granules, or capsules, for example, with conventional additives such as lactose, mannitol, corn starch, or potato starch; with binders such as crystalline cellulose, cellulose derivatives, acacia, corn starch, or gelatin; with disintegrating agents such as corn starch, potato starch, or sodium carboxymethylcellulose; with lubricants such as talc or magnesium stearate; and, if desired, with diluents, buffers, wetting agents, preservatives, and flavoring agents.
[0097] In some embodiments, pharmaceutical compositions can also include large, slowly metabolized macromolecules such as proteins, polysaccharides such as chitosan, polylactic acids, polyglycolic acids and copolymers (such as latex-functionalized Sepharose™, agarose, cellulose), polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes).
[0098] Carriers can carry drugs in a variety of ways, including covalent bonding directly or via a linker group, and non-covalent bonding. Suitable covalently bonded carriers include proteins such as albumin, peptides, and polysaccharides such as aminodextran, each of which has multiple sites for binding moieties. The nature of the carrier can be soluble or insoluble for the purposes of the present invention.
[0099] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl, or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol); low molecular weight (less than about 10 residues) polypeptides; serum, albumin, and the like. The preferred compositions include proteins such as amine, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterion metal complexes such as sodium (e.g., zinc-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG). Formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
[0100] These active ingredients may also be encapsulated in microcapsules prepared, for example, by droplet formation techniques or interfacial polymerization, e.g., hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules, respectively, colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules), or macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).
[0101] The compositions are prepared as injectables, either as liquid solutions or suspensions, although solid forms suitable for solution or suspension in liquid vehicles prior to injection can also be prepared. These preparations can also be emulsified or encapsulated in liposomes or microparticles, such as polylactides, polyglycolides, or copolymers, for enhanced adjuvant effect, as discussed above. Langer, Science 249:1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28:97-119, 1997. The agents of the present invention can be administered in the form of depot injections or implant preparations, which can be formulated in a manner that allows sustained or pulsatile release of the active ingredient. Pharmaceutical compositions are generally sterile, substantially isotonic, and formulated in full compliance with all US Food and Drug Administration Good Manufacturing Practice (GMP) regulations.
[0102] Toxicity of an active agent can be determined by standard pharmaceutical procedures in cell culture or experimental animals, for example, to determine the LD50 (the dose lethal to 50% of the population) or the LD100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index. Data obtained from these cell culture assays and animal studies can be used to further optimize and / or define therapeutic and / or subtherapeutic ranges (e.g., for use in humans). The exact formulation, route of administration, and dosage can be chosen by the individual physician in view of the patient's condition.
[0103] The terms "subject," "individual," and "patient" are used interchangeably herein to refer to a mammal being evaluated for therapy and / or treated. In some embodiments, the mammal is a human. The terms "subject," "individual," and "patient" include, without limitation, individuals with a disease. A subject can be a human, but also includes other mammals, particularly mammals useful as laboratory models for human disease, e.g., mice, rats, and the like.
[0104] The term "sample" with respect to a patient encompasses blood and other liquid samples of biological origin, solid tissue samples such as biopsy specimens or tissue cultures or cells derived therefrom, and their progeny. The term also encompasses samples that have been manipulated in any way after procurement, such as by treatment with reagents, washing, or enrichment for certain cell populations, such as diseased cells. The definition also includes samples enriched for specific types of molecules (e.g., nucleic acids, polypeptides, etc.). The term "biological sample" encompasses clinical samples, including tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, etc. "Biological sample" includes samples obtained from diseased cells of a patient, e.g., samples containing polynucleotides and / or polypeptides obtained from diseased cells of a patient (e.g., cell lysates or other cell extracts containing polynucleotides and / or polypeptides), as well as samples containing diseased cells from a patient. A biological sample containing diseased cells from a patient may also include non-diseased cells.
[0105] The term "diagnosis" is used herein to refer to the identification of a molecular or pathological state, disease or condition in a subject, individual or patient.
[0106] The term "prognosis" is used herein to refer to the prediction of the likelihood of death or disease progression, including recurrence, spread, and drug resistance, in a subject, individual, or patient. The term "prediction" is used herein to refer to the act of foretelling or estimating the likelihood of a subject, individual, or patient experiencing a particular event or clinical outcome based on observation, experience, or scientific reasoning. In one example, a physician may attempt to predict the likelihood that a patient will survive.
[0107] As used herein, the terms "treatment," "treating," and the like refer to administering an agent or performing a procedure to or in a subject, individual, or patient for the purpose of obtaining an effect. The effect may be prophylactic, in that it completely or partially prevents the disease or its symptoms, and / or therapeutic, in that it results in a partial or complete cure for the disease and / or symptoms of the disease. As used herein, "treatment" includes treatment of fatty liver disease in mammals (particularly humans), and includes (a) inhibiting the disease, i.e., preventing its onset, and (b) alleviating the disease or its symptoms, i.e., causing regression of the disease or its symptoms.
[0108] Treating can refer to any indication of successful treatment or amelioration or prevention of a disease, including any objective or subjective parameter, such as reduction, remission, or diminishment of symptoms, or making the disease state more tolerable to the patient, slowing the rate of degeneration or decline, or making the end point of degeneration less debilitating. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of an examination by a physician. Thus, the term "treating" includes administering engineered cells to prevent or delay the onset, alleviate, or arrest or inhibit the onset of a disease or other disease-related symptoms or conditions. The term "therapeutic effect" refers to the reduction, elimination, or prevention of a disease, a symptom of a disease, or a side effect of a disease in a subject.
[0109] As used herein, a "therapeutically effective amount" refers to that amount of a therapeutic agent sufficient to treat or manage a disease or disorder. A therapeutically effective amount may refer to the amount of a therapeutic agent sufficient to delay or minimize the onset of a disease. A therapeutically effective amount may also refer to the amount of a therapeutic agent that provides a therapeutic benefit in the treatment or management of a disease. Furthermore, a therapeutically effective amount with respect to a therapeutic agent of the present invention means the amount of a therapeutic agent alone, or in combination with other therapies, that provides a therapeutic benefit in the treatment or management of a disease.
[0110] As used herein, the term "dosing regimen" refers to a series of unit doses (typically two or more) administered to a subject individually, typically separated by a period of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may include one or more doses. In some embodiments, a dosing regimen includes multiple doses, each separated from the other by a period of equal length; in some embodiments, a dosing regimen includes multiple doses, each separated from the other by at least two different periods of time. In some embodiments, all doses within a dosing regimen are the same unit dose amount. In some embodiments, different doses within a dosing regimen are different amounts. In some embodiments, a dosing regimen includes a first dose of a first dosage amount, followed by one or more additional doses of a second dosage amount that is different from the first dosage amount. In some embodiments, a dosing regimen includes a first dose of a first dosage amount, followed by one or more additional doses of a second dosage amount that is the same as the first dosage amount. In some embodiments, the dosing regimen correlates with a desired or beneficial outcome when administered across a relevant population (ie, is a therapeutic dosing regimen).
[0111] The effectiveness of a treatment for obesity can be readily determined by weight loss, for example, the reduction in food intake observed with administration of BRP is associated with a weight loss, e.g., a 1%, 2.5%, 5%, 7.5%, 10%, 12.5%, 15%, 17.5%, 20%, 22.5%, 25%, 27.5%, 30% or more reduction in body weight, depending on the subject's initial weight.
[0112] Although weight loss may improve insulin sensitivity, BRP itself does not appear to directly alter insulin secretion. Insulin sensitivity can be monitored by various methods known in the art to determine improvement in insulin sensitivity (or reduction in insulin resistance), and improvement can be, for example, 5%, 20%, 15%, 20%, 25%, 30%, 40%, 50%, or more. The hyperinsulinemic-euglycemic clamp (HEC) is known to be the "gold standard" for measuring insulin sensitivity. However, simplified assays can be used to quantify insulin sensitivity. There are two main groups of insulin sensitivity indices: (1) indices calculated using fasting plasma concentrations of insulin, glucose, and triglycerides; and (2) indices calculated using plasma concentrations of insulin and glucose obtained over 120 minutes of a standard (75 g glucose) OGTT. The former group includes the Homeostasis Model Assessment-Insulin Resistance (HOMA-IR), the QUIKI index, and the McAuley index, while the latter group includes the Matsuda, Belfiore, Cederholm, Avignon, and Stumvoll indexes. For clinical use, HOMA-IR, QUIKI, and Matsuda are suitable, while HES, McAuley, Belfiore, Cederholm, Avignon, and Stumvoll are preferred for epidemiological / research purposes.
[0113] HEC-derived insulin sensitivity index (ISI HEC , ml / kg / min / μIU ml) obtained during the steady-state period of HEC. ISI HEC =MCR / I 平均 . In the formula, I 平均 is the mean steady-state plasma insulin response (μIU / ml), MCR: metabolic clearance rate of glucose (ml / kg / min). MCR=M 平均 / (G 平均 ×0.18). In the formula, M 平均 : Metabolized glucose is expressed as the mean steady-state glucose infusion rate per kg body weight (mg / kg / min). G平均 :Average steady-state blood glucose concentration (mmol / l) x 0.18 is the conversion factor to convert blood glucose concentration from mmol / l to mg / ml.
[0114] HOMA is a model of the relationship between glucose and insulin dynamics that predicts fasting steady-state glucose and insulin concentrations for a wide range of possible combinations of insulin resistance and beta-cell function. The HOMA model has proven to be a robust clinical and epidemiological tool for assessing insulin resistance. Here, IR HOMA =(I0×G0) / 22.5(mathematically: e -Inx =1 / x).
[0115] The Quantitative Insulin Sensitivity Testing Index (QUICKI) is an empirically derived mathematical transformation of fasting blood glucose and plasma insulin concentrations that provides a consistent and accurate ISI with better positive predictive power. It is a variation of the HOMA equation, transforming the data by taking both the logarithm and the inverse of the glucose-insulin product, thus slightly distorting the distribution of fasting insulin values. Similar to the HOMA calculation, it employs the use of fasting values of insulin and glucose. QUICKI is virtually identical in all respects to the simple equation form of the HOMA model, except that a logarithmic transformation of the insulin-glucose product is used to calculate QUICKI. QUICKI can be determined from fasting plasma glucose concentrations (mg / dL) and insulin concentrations (μIU / ml).
[0116] The McAuley index is used to predict insulin resistance in normoglycemic individuals. Regression analysis was used to estimate the cutoff point for insulin resistance and the significance of various data (fasting concentrations of insulin, triglycerides, aspartate aminotransferase, basal metabolic rate (BMI), and waist circumference). A bootstrap procedure was used to find the index most strongly correlated with the insulin sensitivity index, corrected for lean body mass obtained by HEC (Mffm / I).
[0117] The Matsuda index derives the ISI from the OGTT. These methods use the ratio of plasma glucose and insulin concentrations during the OGTT. The OGTT ISI (composite) is calculated using both the data from the entire 3-hour OGTT and the data from the first 2 hours of the test. The composite whole-body insulin sensitivity index (WBISI) is based on the microunits per milliliter (μU / mL) and glucose values (milligrams per deciliter (mg / L)) obtained from the OGTT and the corresponding fasting values.
[0118] Examples of suitable antidiabetic agents for use in combination with the compounds of the invention include biguanides (e.g., metformin or phenformin), glucosidase inhibitors (e.g., acarbose or miglitol), insulins (including insulin secretagogues or insulin sensitizers), meglitinides (e.g., repaglinide), sulfonylureas (e.g., glimepiride, glyburide, gliclazide, chlorpropamide, and glipizide), biguanide / glyburide combinations (e.g., Glucovance®), thiazolidinediones (e.g., troglitazone, rosiglitazone, and pioglitazone), PPAR-alpha agonists, PPAR-gamma agonists, PPAR alpha / gamma dual agonists, glycogen phosphorylase inhibitors, fatty acid binding protein (aP2) inhibitors, DPP-IV inhibitors, and SGLT2 inhibitors.
[0119] Thiazolidinediones include Mitsubishi's MCC-555 (disclosed in U.S. Pat. No. 5,594,016), Glaxo-Welcome's GL-262570, englitazone (CP-68722, Pfizer) or darglitazone (CP-86325, Pfizer), isaglitazone (MIT / J&J), JTT-501 (JPNT / P&U), L-895645 (Merck), R-119702 (Sankyo / WL), NN-2344 (Dr. Reddy / NN), or YM-440 (Yamanouchi).
[0120] Suitable PPAR alpha / gamma dual agonists include AR-HO39242 (Astra / Zeneca), GW-409544 (Glaxo-Wellcome), KRP297 (Kyorin Merck), as well as those described in Murakami et al., "A Novel Insulin Sensitizer Acts As a Coligand for Peroxisome Proliferation--Activated Receptor Alpha (PPAR alpha) and PPAR gamma. Effect on PPAR alpha Activation on Abnormal Lipid Metabolism in Liver of Zucker Fatty Rats," Diabetes 47, 1841-1847 (1998), and U.S. application Ser. No. 09 / 644,598, filed Sep. 18, 2000 (using dosages set forth therein, the compounds designated as preferred are preferred for use herein).
[0121] Suitable aP2 inhibitors include those disclosed in U.S. Application No. 09 / 391,053, filed September 7, 1999, and U.S. Application No. 09 / 519,079, filed March 6, 2000 (using the dosages set forth therein).
[0122] Suitable DPP4 inhibitors which may be used in combination with the compounds of the invention include those disclosed in WO99 / 38501, WO99 / 46272, WO99 / 67279 (PROBIODRUG), WO99 / 67278 (PROBIODRUG), WO99 / 61431 (PROBIODRUG), NVP-DPP728A (1-[[[2-[(5-cyanopyridin-2-yl)amino]ethyl]amino]acetyl]-2-cyano-(S)-pyrrolidine) (Novartis) (disclosed in Hughes et al., Biochemistry, 38(36), 11597-11603, 1999), TSL-225 (tryptophyl-1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Yamada et al. al, Bioorg. & Med. Chem. Lett. 8 (1998) 1537-1540, 2-cyanopyrrolidone, and 4-cyanopyrrolidone (disclosed by Ashworth et al, Bioorg. & Med. Chem. Lett., Vol. 6, No. 22, pp 1163-1166 and 2745-2748 (1996)) (using dosages set forth in the above references).
[0123] Suitable meglitinides include nateglinide (Novartis) or KAD1229 (PF / Kissei).
[0124] Examples of other suitable glucagon-like peptide-1 (GLP-1) compounds that may be used in combination with the GLP-1 mimetics of the present invention include GLP-1(1-36)amide, GLP-1(7-36)amide, GLP-1(7-37) (disclosed in U.S. Pat. No. 5,614,492 to Habener), as well as AC2993 (Amylin), LY-315902 (Lilly), and NN-2211 (NovoNordisk).
[0125] Examples of suitable hypolipidemic / lipid-lowering agents for use in combination with the compounds of the invention include one or more MTP inhibitors, HMG CoA reductase inhibitors, squalene synthetase inhibitors, fibric acid derivatives, ACAT inhibitors, lipoxygenase inhibitors, cholesterol absorption inhibitors, ileal Na.sup.+ / bile acid cotransporter inhibitors, upregulators of LDL receptor activity, bile acid sequestrants, cholesterol ester transfer protein inhibitors (e.g., CP-529414 (Pfizer)), and / or nicotinic acid and its derivatives.
[0126] MTP inhibitors that may be used as described above include those disclosed in U.S. Patent Nos. 5,595,872, 5,739,135, 5,712,279, 5,760,246, 5,827,875, 5,885,983, and 5,962,440.
[0127] HMG CoA reductase inhibitors that may be used in combination with one or more compounds of SEQ ID NO:2 include mevastatin and related compounds disclosed in U.S. Pat. No. 3,983,140, lovastatin (mevinolin) and related compounds disclosed in U.S. Pat. No. 4,231,938, pravastatin and related compounds disclosed in U.S. Pat. No. 4,346,227, and simvastatin and related compounds disclosed in U.S. Pat. Nos. 4,448,784 and 4,450,171.Other HMG CoA reductase inhibitors that may be used herein include fluvastatin, disclosed in U.S. Pat. No. 5,354,772; cerivastatin, disclosed in U.S. Pat. Nos. 5,006,530 and 5,177,080; atorvastatin, disclosed in U.S. Pat. Nos. 4,681,893; 5,273,995; 5,385,929; and 5,686,104; atavastatin, disclosed in U.S. Pat. No. 5,011,930 (Nissan / Sankyo); simvastatin (NK-104), visastatin (Shionogi-Astra / Zeneca (ZD-4522)) disclosed in U.S. Pat. No. 5,260,440 and related statin compounds disclosed in U.S. Pat. No. 5,753,675, pyrazole analogs of mevalonolactone derivatives disclosed in U.S. Pat. No. 4,613,610, indene analogs of mevalonolactone derivatives disclosed in PCT application WO 86 / 03488, U.S. Pat. 647,576, 6-[2-(substituted pyrrol-1-yl)-alkyl)pyran-2-ones and derivatives thereof disclosed in Searle's SC-45355 (3-substituted pentanedioic acid derivatives) dichloroacetic acid, imidazole analogues of mevalonolactone disclosed in PCT application WO 86 / 07054, 3-carboxy-2-hydroxy-propane-phosphonic acid derivatives disclosed in French patent no. 2,596,393, 3-carboxy-2-hydroxy-propane-phosphonic acid derivatives disclosed in European patent application no. 0221025, These include 2,3-disubstituted pyrrole, furan, and thiophene derivatives disclosed in U.S. Pat. No. 4,686,237, naphthyl analogs of mevalonolactone disclosed in U.S. Pat. No. 4,499,289, octahydronaphthalenes disclosed in U.S. Pat. No. 4,499,289, keto analogs of mevinolin (lovastatin) disclosed in European Patent Application No. 0142146A2, and quinoline and pyridine derivatives disclosed in U.S. Pat. Nos. 5,506,219 and 5,691,322.
[0128] Lipid-lowering agents include pravastatin, lovastatin, simvastatin, atorvastatin, fluvastatin, cerivastatin, atavastatin, and ZD-4522. Additionally, phosphinic acid compounds useful for inhibiting HMG CoA reductase, such as those disclosed in GB 2205837, are suitable for use in combination with the compounds of the present invention.
[0129] Squalene synthetase inhibitors suitable for use herein include, but are not limited to, the α-phosphono-sulfonates disclosed in U.S. Pat. No. 5,712,396, those disclosed in Biller et al., J. Med. Chem., 1988, Vol. 31, No. 10, pp. 1869-1871 (including isoprenoid (phosphinylmethyl) phosphonates), and other known squalene synthetase inhibitors (e.g., those disclosed in U.S. Pat. Nos. 4,871,721 and 4,924,024, and Biller, SA, Neuenschwander, K., Ponpipom, MM, and Poulter, CD, Current Pharmaceutical Design, 2, 1-40 (1996)). Other squalene synthetase inhibitors suitable for use herein include the terpenoid pyrophosphates disclosed by P. Ortiz de Montellano et al., J. Med. Chem., 1977, 20, 243-249, the farnesyl diphosphate analog A and presqualene pyrophosphate (PSQ-PP) analogs disclosed by Corey and Volante, J. Am. Chem. Soc., 1976, 98, 1291-1293, the phosphinyl phosphonates disclosed by McClard, RW et al., JACS, 1987, 109, 5544, and cyclopropanes.
[0130] Fibric acid derivatives that may be used in combination with one or more compounds of SEQ ID NO: 2 include fenofibrate, gemfibrozil, clofibrate, bezafibrate, ciprofibrate, clinofibrate, etc., probucol and related compounds disclosed in U.S. Pat. No. 3,674,836 (probucol and gemfibrozil are preferred), bile acid sequestrants (e.g., cholestyramine, colestipol, and DEAE-Sephadex (Secholex®, Policexide®)), as well as lipostabilisers (Rhone-Poulenc), Eisai's E-5050 (an N-substituted ethanolamine derivative), imanixyl (HOE-402), tetrahydrolipstatin (THL), istigmastanil phosphorylcholine (SPC, Roche), aminocyclodextrin (Tanabe Seiyoku), Ajinomoto Co., Inc., and the like. Included are AJ-814 (azulene derivative), melinamide (Sumitomo), Sandoz 58-035, American Cyanamid CL-277,082 and CL-283,546 (disubstituted urea derivatives), nicotinic acid, acipimox, acifuran, neomycin, p-aminosalicylic acid, aspirin, poly(diallylmethylamine) derivatives disclosed in U.S. Pat. No. 4,759,923, quaternary amine poly(diallyldimethylammonium chloride) and ionenes disclosed in U.S. Pat. No. 4,027,009, and other known serum cholesterol-lowering agents.
[0131] ACAT inhibitors that may be used in combination with one or more compounds of SEQ ID NO: 2 include those disclosed in: Drugs of the Future 24, 9-15 (1999) (Avasimibe); "The ACAT inhibitor, Cl-1011, is effective in the prevention and regression of aortic fatty streak area in hamsters", Nicolosi et al, Atherosclerosis (Shannon, Ireland), (1998), 137(1), 77-85; "The pharmacological profile of FCE 27677: a novel ACAT inhibitor with potent hypolipidemic activity mediated by the selective suppression of the hepatic secretion of ApoB100-containing lipoprotein", Ghiselli, Giancarlo, Cardiovasc. Drug Rev. (1998), 16(1), 16-30; "RP 73163: a bioavailable alkylsulfinyl-diphenylimidazole ACAT Smith, C., et al, Bioorg.Med.Chem. Lett. (1996), 6(1), 47-50, “ACAT inhibitors: physiologic mechanisms for hypolipidemic and anti-atherosclerotic activities in experimental animals”, Krause et al, Editor(s): Ruffolo, Robert R. Jr., Hollinger, Mannfred A., Inflammation: Mediators Pathways (1995), 173-98, Publisher: CRC, Boca Raton, Fla.,”ACAT inhibitors:potential anti-atherosclerotic agents”,Sliskovic et al,Curr.Med.Chem.(1994),1(3),204-25,”Inhibitors of acyl-CoA:cholesterol O-acyl transferase(ACAT) as hypocholesterolemic agents.6.The first water-soluble ACAT inhibitor with lipid-regulating activity.Inhibitors of acyl-CoA:cholesterol acyltransferase(ACAT).7.Development of a series of substituted N-phenyl-N'-[(1-phenylcyclopentyl)methyl]ureas with enhanced hypocholesterolemic activity”, Stout et al,Chemtracts:Org.Chem.(1995),8(6),359-62, or TS-962(Taisho Pharmaceutical Co.Ltd). .
[0132] The lipid-lowering agent may be an upregulator of LD2 receptor activity, such as MD-700 (Taisho Pharmaceutical Co. Ltd.) and LY295427 (Eli Lilly). Examples of suitable cholesterol absorption inhibitors for use in combination with the compounds of the present invention include SCH48461 (Schering-Plough) and those disclosed in Atherosclerosis 115, 45-63 (1995) and J. Med. Chem. 41, 973 (1998).
[0133] Suitable ileal NaCl solutions for use in combination with the compounds of the present invention + Examples of bile acid cotransporter inhibitors include the compounds disclosed in Drugs of the Future, 24, 425-430 (1999).
[0134] Lipoxygenase inhibitors that may be used in combination with one or more compounds of SEQ ID NO:2 include 15-lipoxygenase (15-LO) inhibitors (e.g., the benzimidazole derivatives disclosed in WO 97 / 12615), the 15-LO inhibitors disclosed in WO 97 / 12613, the isothiazolones disclosed in WO 96 / 38144, and the 15-LO inhibitors disclosed in Sendobry et al., "Attenuation of diet-induced atherosclerosis in rabbits with a highly selective 15-lipoxygenase inhibitor lacking significant antioxidant properties," Brit. J. Pharmacology (1997) 120, 1199-1206 and Cornicelli et al., "15-Lipoxygenase and its Inhibition: A Novel Therapeutic Target for Vascular Disease," Current Pharmaceutical Design, 1999, 5, 11-20.
[0135] Examples of suitable antihypertensive agents for use in combination with the compounds of the invention include beta-adrenergic blockers, calcium channel blockers (L-type and T-type; e.g., diltiazem, verapamil, nifedipine, amlodipine, and mibefradil), diuretics (e.g., chlorothiazide, hydrochlorothiazide, flumethiazide, hydroflumethiazide, bendroflumethiazide, methylchlorothiazide, trichloromethiazide, polythiazide, benzthiazide, triclinafen ethacrynate, chlorthalidone, furosemide, musolimine, bumetanide, triamterene, amiloride, spironolactone), renin inhibitors, ACE inhibitors (e.g., captopril, zofenopril, fossil fuels, and the like), and / or steroids (e.g., thiazide ... No. 5,612,359 and U.S. Pat. No. 6,043,265), dual ET / AII antagonists (e.g., compounds disclosed in WO 00 / 01389), neutral endopeptidase (NEP) inhibitors, vasopepsidase inhibitors (dual NEP-ACE inhibitors) (e.g., omapatrilat and gemopatrilat), and nitrates.
[0136] Examples of suitable anti-obesity agents for use in combination with the compounds of the invention include NPY receptor antagonists, MCH antagonists, GHSR antagonists, CRH antagonists, beta 3 adrenergic agonists, lipase inhibitors, serotonin (and dopamine) reuptake inhibitors, thyroid receptor beta agents, and / or appetite suppressants.
[0137] Beta 3 adrenergic agonists that may optionally be used in combination with the compounds of the invention include AJ9677 (Takeda / Dainippon), L750355 (Merck), or CP331648 (Pfizer), or other known beta 3 agonists disclosed in U.S. Patent Nos. 5,541,204, 5,770,615, 5,491,134, 5,776,983, and 5,488,064, with AJ9677, L750,355, and CP331648 being preferred.
[0138] Examples of lipase inhibitors that may optionally be used in combination with the compounds of the present invention include orlistat or ATL-962 (Alizyme), with orlistat being preferred. [Example]
[0139] experiment The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should be accounted for. Unless otherwise specified, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.
[0140] Example 1 Tissue-based human prohormone prediction identifies anti-obesity BRNP2-derived peptides. Using a computational reverse endocrine discovery approach, we predicted the existence of 2,683 novel secreted and proteolytically cleaved peptides. Using these predictions, we generated and functionally tested a human hormone peptide library of small peptides to explore novel biology. This led to the discovery of a secreted, highly evolutionarily conserved 12-mer human brain peptide (BRP) derived from BRINP2 that circulates in human plasma and cerebrospinal fluid. BRP acts to acutely suppress food intake and feeding without affecting energy expenditure, motor activity, or anxiety-like behavior. Furthermore, chronic administration of BRP reverses obesity and diabetes in diet-induced obese mice, highlighting its potential as a novel anti-obesity and anti-diabetic agent.
[0141] Sequence pattern recognition predicts small secreted human peptide hormones and their expression across human tissues. Functional identification and characterization of small proteolytically cleaved peptides has traditionally been challenging due to their low abundance and the need to distinguish bioactive fragments from inactive fragments or degradation products. Therefore, we exploited the fact that peptide hormones, like GLP-1, are often synthesized as part of larger prohormones that are processed into peptides by post-translational intracellular proteolytic cleavage. This process occurs at specific dibasic amino acid residues, KR / RR / RK / KK, followed by non-basic, non-aliphatic amino acids (KRH is an exception) (Figure 1a). Proteolytic cleavage is mediated by enzymes present in the secretory pathway, including the subtilisin-like proprotein convertase furin, prohormone convertase 2 (PC2), and prohormone convertase 1 / 3 (PC1 / PC3). Using these conserved sites as a reference, we generated code for sequence pattern recognition using regular expressions (RegEx) to match text patterns in protein sequences. Using this method, we were able to annotate all amino acid sequences containing signal peptides with any combination of more than four KR / RR / RK / KK cleavage sites (2,082 proteins) in the tissue of origin (26) (Figure 1b). The spacing between cleavage sites was set to 3 to generate peptides >4 aa in length and exclude tripeptides (Figure 1c). Based on the number of cleavage sites, the minimum number of cleavage sites per protein was set to 4 to generate at least five peptides after cleavage (Figure 1d). In addition, the next criterion was that proteins must be less than 2,000 amino acids in length to exclude very long peptide sequences and enrich for prohormones with a high cleavage site density, such as preproglucagon (Figure 1e). In total, we identified 373 prohormones predicted to generate 2,683 novel peptides among the 2,082 secreted proteins, the majority of which were completely unknown (Figure 1b).
[0142] To analyze the tissue distribution of the identified prohormones, we classified them according to distinct or common tissue expression (Fig. 1f and Fig. 7). The largest group of identified peptides, 601 peptides, has widespread expression (Fig. 7b), while the second largest number, 366 peptides, belong to the brain (Fig. 1f). Interestingly, the brain prohormones prediction accurately predicts nine known prohormones and their truncated neuropeptides, as well as an additional 50 brain-abundant proteins with unknown functions (Fig. 1g). For example, peptides derived from proenkephalin-A, pituitary adenylate cyclase-activating polypeptide (PACAP), secretogranin II, and thyrotropin-releasing hormone (TRH) are identified (Fig. 1g). Furthermore, many known peptides are identified. These include vasoactive intestinal peptide in the intestine (Figure 1h) and neuropeptide precursors in the pituitary gland, including secretogranin-I in the adrenal gland, proopiomelanocortin (POMC) (Figure 1i), and proenkephalin-A (Figure 1j). Finally, we found that proglucagon is abundant in the pancreas, validating that our computational approach can predict true peptide hormones (Figure 1k). In conclusion, the brain (Figure 1g) and liver (Figure 7c) primarily contribute to the release of small secretory peptides, most of which have no previously annotated function.
[0143] The 12-mer BRINP2 peptide, BRP, induces CFOS expression and acutely suppresses food intake in mice. To functionally test the biological activity of some of the identified peptides, we generated a peptide library of sequences ranging in size from 5 to 25 amino acids (Figure 2a). Proteins annotated as enzymes, non-extracellular matrix proteins, or proteins with transmembrane domains were excluded from this library. Novel peptides were analyzed by Protein BLAST (NCBI) and showed no homology to proteins other than the original parent protein. A custom peptide library was generated by chemical peptide synthesis (see Methods).
[0144] A characteristic of many known biologically active peptide hormones is the presence of an amidated C-terminus, which may be important for the peptide's bioactivity, as in the case of the gastrin-releasing peptide neuromedin B, or for its increased stability, as in the case of GLP-1. Therefore, a peptide library was constructed with an amide (NH) group at the C-terminus as the only modification for comparative studies between peptides (Figure 2a). In total, a library of 100 peptides was generated for functional biological screening. Peptide solubility was estimated according to their overall charge and reconstituted according to optimal solubility. Quality control by mass spectrometry was performed for all peptides to verify the purity of the peptides synthesized for primary screening according to their theoretical molecular weights (Figure 8). Next, the efficacy of the 100 peptides in activating cfos expression, a marker of cellular activity, was functionally investigated after 1 hour of peptide treatment across two cell lines: Neuroscreen-1 (NS-1) (rat neuronal origin) and INS1 cells (rat pancreatic origin) (Figure 2b). INS1 cells express glucagon-like peptide 1 (GLP-1), a 30-mer peptide ligand for the glucagon receptor family of G protein-coupled receptors in pancreatic B cells. 7-37 ) was used as a positive control at 30 μM. For NS-1 cells, NGF (nerve growth factor) was used as a positive control at 2 nM. As expected, GLP-1 7-37 We found that FGF induces a 4-fold increase in CfOS expression in INS1 cells, and NGF induces a 10-fold increase in CfOS expression in NS-1 cells (Figure 2b). Across the 100 peptides tested, six peptides, FGF3_4, EDIL3_4, BRNP2_5, SCG1_9, FSTL4_3, and FGF5_5, induced >5-fold CfOS expression across both cell lines compared to vehicle.
[0145] Interestingly, a novel BRNP2-derived 12-mer secreted peptide derived from the parent protein BRNP2 induced CFOS expression by >10-fold across both cell lines (Figure 2b). Importantly, a scrambled version of BRNP2_5 used at the same concentration and time point was ineffective (Figure 2c). The scrambled peptide was analyzed by protein BLAST (NCBI) and did not match any known proteins. These data indicate that the function of the BRNP2_5 peptide is specific and determined only by the exact sequence of amino acids, eliminating the possibility of other contaminants in the peptide solution.
[0146] We next conducted in vivo studies to determine whether any of these peptides affected food intake or blood glucose levels, two biological outcomes of CFS activation. In acute food intake studies, non-obese 8-week-old C57BL / 6 mice (N = 3 / group) were fasted for 16 h and then administered vehicle (saline), 2 mg / kg GLP-1, or 5 mg / kg FGF3_4, EDIL3_4, BRNP2_5, SCG1_9, FSTL4_3, and FGF5_5 peptides. Food intake was then monitored over a 6-h period. Notably, we found that BRNP2_5 potently regulated acute food intake in non-obese mice, starting at 30 min and lasting for up to 3 h (Figure 2d-e). Notably, the appetite-suppressing effect was comparable to that of GLP-1, with the greatest difference in food intake observed 1.5 h after injection (Figure 2d-e). In diet-induced obese (DIO) mice, BRNP2_5 was found to have a stronger suppression of food intake compared to vehicle- and GLP-1-treated mice (Figure 2f). Next, to determine whether any of the peptides acutely lowered blood glucose as an indicator of increased insulin secretion, a similar experiment was performed in non-obese 8-week-old C57BL / 6 mice (N = 3 / group) in the absence of food. Upon peptide administration, only GLP-1 lowered blood glucose, but no significant difference was observed compared to any of the other peptides (Figure 2g). These results suggest that the BRNP2_5 peptide reduces food intake without acutely lowering blood glucose through either an insulin-dependent or insulin-independent mechanism. Based on these results, this peptide was designated BRP, for BRNP2-related peptide.
[0147] BRP acutely suppresses food intake and meal size without affecting energy expenditure, locomotor activity, or anxiety-like behavior. To study the metabolic effects in more detail, we next performed experiments using metabolic cages in a Columbus comprehensive laboratory animal monitoring system. C57BL6 / J mice were acclimated to cages, randomized into two groups, and then intraperitoneally injected with either vehicle (saline) or 5 mg / kg BRP (N = 4 / group). Again, BRP dramatically reduced food intake (Fig. 3a), an effect that was not observed when scrambled BRP peptide was administered (Fig. 3b). Interestingly, we found that BRP, but not scrambled BRP peptide, reduced meal size (Fig. 3c) without affecting meal frequency (Fig. 3d). BRP also acutely decreased the respiratory exchange ratio (Fig. 3e). This is consistent with increased fat, but not carbohydrate, oxidation during small meal intake. On the other hand, acute BRP treatment did not alter oxygen consumption (VO2) (Fig. 3f) or ambulatory activity (Fig. 3g). Additionally, we demonstrate that BRP does not affect anxiety-like behavior in BRP-treated mice by performing an open-field assay (Fig. 3h). Overall, these results establish BRP as a potent food intake suppressant (Figs. 3 and 9) and strongly support that BRP reduces appetite by reducing food intake rather than by inducing anxiety, fatigue, or toxicity.
[0148] Unmodified BRP peptides circulate in human cerebrospinal fluid and plasma. The parent BRNP2 protein is highly expressed in the human brain (Figure 4a), and its fetal deletion has been reported to be involved in neurodevelopmental disorders. Having predicted truncated BRP peptides using computational methods, we next sought to establish whether BRP is endogenously secreted and detectable in humans. Using targeted liquid chromatography-tandem mass spectrometry (LS-MS) with synthetic BRP as an internal standard, we quantified the m / z intensity of the endogenous peptide relative to a spiked peptide of known concentration. Notably, we found that intact BRP peptides are present in human plasma (Figure 4b) and human cerebrospinal fluid (Figure 4c). These data indicate that BRP is endogenously secreted, demonstrating its biological relevance in humans. To further explore the potential applications of BRP, we performed sequence and phylogenetic analyses of the parent BRNP2 protein. This indicates that BRNP2 is highly conserved and secreted in all species (Figure 4d-e). Furthermore, human, monkey, and pig BRNP2 are more similar to each other than to rat, mouse, and dog sequences (Figure 4d), and the cleavage site that generates the small secreted BRP peptide is conserved across all six species (Figure 4e). In addition, human and pig BRP differ by only one amino acid residue (Leu (L) at position 5) and exhibited similar activity to human BRP (Figure 4f). These results indicate that human BRP is a true secreted hormone with potential therapeutic applications.
[0149] Arg 3 and Leu 8is required for full BRP bioactivity. Endogenous BRP is a 12-mer peptide with the sequence THRILRRLFNLC, SEQ ID NO: 1. A common feature of most known active peptide hormones is the presence of an amidated (NH2) C-terminus. This C-terminal amidation has been shown to be particularly important for peptide bioactivity, such as neuromedin-B, a gastrin-releasing peptide, or for increasing peptide stability, such as GLP-1. Our preliminary data confirm that C-terminal amidation of BRP is important for bioactivity, as nonamidated BRP is inactive in cells (Figure 5a). Furthermore, by synthesizing peptides with Ala substitutions at positions 1–12 to determine which amino acid residues are required for bioactivity, we identified that amino acid residues 3, 8, 10, and 12 were important for maintaining full activity, while other Ala substitutions did not impair activity (Figure 5b). In these experiments, a minimum activity of >15-fold compared to vehicle was used as the cutoff for being considered fully active. Interestingly, it is found that in mice, Ala substitution at residue 7 improves the appetite suppressant effect of BRP, whereas Ala substitutions at residues 3, 4, 5, 6, 8, and 12 show reduced efficacy in reducing food intake (FIG. 5c).
[0150] Chronic administration of amidated BRP reverses obesity and diabetes in diet-induced obese mice. Given that a 20-50% reduction in food intake is expected to dramatically reduce body weight, we next conducted a chronic administration experiment in mice that had developed obesity and diabetes. Eight-week-old C57BL6 / J mice on a 6-week HFD were randomized into three groups and subsequently administered a mock intraperitoneal injection for 4 days, followed by treatment with either vehicle (saline), 100 μg / kg liraglutide, or 5 mg / kg BRP (N = 10 / group). After 14 days of daily injections, mice treated with BRP and liraglutide had significantly lower cumulative food intake compared to vehicle controls, demonstrating the absence of desensitization over the course of the experiment (Figure 6a). Furthermore, both the BRP- and liraglutide-treated groups achieved significant and visible weight gains of an average of 4 grams with BRP and liraglutide compared with vehicle (Figures 6b-d). End-point glucose and insulin tolerance tests showed that BRP mice had improved glucose tolerance (Figure 6e) and insulin tolerance (Figure 6f). This effect was accompanied by lower fasting glucose levels (Figures 6e-f) and fasting insulin levels (Figure 6g). In conclusion, chronic BRAP treatment reduces obesity and improves glucose homeostasis in mice. We next assessed whether the weight loss was associated with a decrease in fat mass and / or lean body mass. After 14 days, the BRP-treated group had significantly lower subcutaneous (inguinal) white adipose tissue mass (Figure 6h), brown adipose tissue mass (Figure 6i), and liver mass (Figure 6j), comparable to the effects of liraglutide. There was no difference in skeletal muscle mass with either treatment (Fig. 6k). These data were consistent with histological analysis of adipose and liver tissue, which demonstrated that BRP reduced adipocyte size and ectopic lipid accumulation in the liver (Fig. 6l). In conclusion, our robust and reproducible preliminary data demonstrate that a novel, previously unidentified BRP peptide has dramatic effects in reducing food intake, reversing obesity, and reversing diabetes in mice, without any apparent adverse behavioral effects.
[0151] Metabolic diseases such as obesity have become a major public health concern. In 2020, the prevalence of obesity in the United States was >40%. Obesity significantly increases the risk of type 2 diabetes, fatty liver disease, cardiovascular and pulmonary diseases, and musculoskeletal disorders. While lifestyle interventions are known to provide modest efficacy due to complex and persistent hormonal, metabolic, and neurochemical adaptations, pharmacological therapies for treating obesity generally involve several side effects. The challenge is to find drugs that sustainably correct excess weight while reducing comorbidities and adverse effects. Peptides have attracted significant attention over the past decade and are now part of a major strategy for developing new drugs. The field of peptide drug discovery has revolutionized medicine, with over 60 peptide drugs approved in the United States. To date, several peptides, including leptin-, ghrelin-, and glucagon-derived peptides, have been identified as regulators of food intake and obesity. While peptide hormones have traditionally been identified through biochemical purification, our computational analysis unlocks the exciting possibility of targeting selective aspects of metabolism through mechanisms distinct from current drugs.
[0152] Here, we found that the predicted peptide, BRP, is endogenously secreted into human plasma and CSF and reduces food intake and body weight in vivo. Because BRP is a circulating ligand, identifying its receptor is of great interest for understanding its mechanism of action and its intracellular signaling in the brain. Hormonal signaling through protein phosphorylation is one of the most important post-translational modifications, enabling rapid changes in cellular metabolic state, including feeding control. Many important physiological processes are regulated by G protein-coupled receptors (GPCRs), including GLP-1, but whether BRP binds to GPCRs remains unknown. The fact that BRP induces cfos expression in vitro strongly suggests that BRP binds to cell surface receptors and induces intracellular signaling cascades associated with the suppression of food intake. Given the beneficial effects of BRP on food intake and body weight, our study highlights the unique opportunity for peptide engineering of BRP for therapeutic purposes, which may offer certain advantages over current therapies.
[0153] Materials and Methods Sample preparation for LC-MS analysis. Pooled human plasma (IPLALIH10ML) and human cerebrospinal fluid (CSF, IRHUCSF5ML) were purchased from Innovative Research. Eight aliquots of 250 μL of plasma or CSF (total of 2 mL per preparation) were mixed with 750 μL of 100 mM Tris-HCl (pH 8.2) and boiled at 95°C for 10 min. 1 mM DTT was added, and the samples were vortexed and incubated at 60°C for 50 min. Iodoacetamide was added to a final concentration of 5 mM and incubated at room temperature in the dark for 1 h. Formic acid was added to a final concentration of 0.2%. The samples were centrifuged at 15,000 rpm for 20 min. The supernatant was desalted and concentrated on a C8 column (Waters, WAT054965) and eluted with 100 μL of 80% ACN. The samples were centrifuged at 15,000 rpm for 10 minutes, and the supernatant was transferred to an LC-MS vial.
[0154] Targeted Measurement of BRP by LC-MS. Targeted metabolomics measurements were performed using an Agilent Q-TOF LC-MS instrument. MS analysis was performed using electrospray ionization (ESI) in positive mode. Dual ESI source parameters were set as follows: gas temperature was set at 325 °C, drying gas flow rate was 13 l min-1, and nebulizer pressure was 30 psi. The capillary voltage was set at 4000 V, and the fragmentor voltage was set at 185 V. In the MSMS spectrum, the +3 ion at 533.64 was fragmented at 25 CE. The mobile phases were as follows: Buffer A (100% HO + 0.1% formic acid) and Buffer B (90% ACN / 10% HO + 0.1% formic acid). A 60-minute LC gradient from 95% A / 5% B to 60% A / 40% B was used.
[0155] Bioinformatics. A FASTA file of all screened secreted human genes (as well as secreted.fasta) obtained from the UniProtKB API was used to generate a program for sequence pattern recognition, which uses regular expressions (RegEx) to match text patterns in protein sequences. The code for Prohormone Predictor can be found at https: / / github.com / Svensson-Lab / pro-hormone-predictor. This program predicts whether a secreted gene has prohormone activity based on the number of cleavage sites it contains. For tissue distribution, prohormones were classified according to distinct or common tissue expression based on tissue expression data from the Human Protein Atlas. All predicted prohormones and their subsequent peptides were annotated using the following criteria: >4 KR / RR / RK / KK cleavage sites in any combination, >3 cleavage sites per protein, >4 cleavage sites per protein, and prohormone size <2,000 amino acids.
[0156] Mouse studies. Animal experiments were performed according to procedures approved by the Institutional Animal Care and Use Committee of the Stanford Animal Care and Use Committee (APLAC) protocol number #32982. C57BL / 6J male mice were purchased from the Jackson Laboratory (#000664) and used after one week of acclimatization following transfer to the facility. Unless otherwise stated, all mice were in good health and were housed in a temperature-controlled (20-22°C) room with a 12-hour light / dark cycle and provided with food and water ad libitum.
[0157] For acute experiments, after a 16-hour overnight fast, 8-week-old C57BL / 6 mice were weighed and injected intraperitoneally with either saline, 2 mg / kg GLP-1, or 5 mg / kg peptide (N=3 mice per group).Fasting blood glucose and food intake were then monitored for 6 hours.
[0158] Pharmacological studies using BRP peptide were conducted in mice with established diet-induced obesity. Male C57BL / 6J mice purchased from Jax were fed a high-fat diet (#D12492, Research Diets) for 6 weeks. To prevent stress-induced weight loss, mice were injected with saline for 4 days before peptide injection. Mice were intraperitoneally injected daily for 14 days with vehicle (saline) or the indicated doses of liraglutide or BRP diluted in saline. Food intake and body weight were monitored daily. At the end of the experiment, mouse and tissue weights were recorded. Tissues and plasma were collected and frozen for further analysis.
[0159] Cell culture. NS-1 rat neuronal cell line was cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS and 1% L-glutamine. INS-1 832 / 13 rat insulinoma cell line (#SCC207) was cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS, 1% L-glutamine, 10 mM HEPES, 1 mM Na-pyruvate, and 50 μM β-mercaptoethanol. For peptide activity assays, 3 × 10 5 NS-1 and INS1 cells were plated in 12-well plates. The next day, cells were washed twice with warm PBS and starved overnight in serum-free RPMI. The indicated concentrations of NGF (2 nM), GLP-1 (30 μM), or peptides (100 μg / ml) were added and incubated for 1 hour at 37°C. Cells were washed with PBS, and RNA was isolated for cfos expression analysis.
[0160] Peptide synthesis. Custom peptide libraries were generated by chemical peptide synthesis at Genscript USA Inc. The libraries were generated as >70% pure peptides in 1-4 mg quantities, with C-terminal amidation as the only modification for comparative studies between peptides. Peptide purity was analyzed by mass spectrometry (theoretical MW). Lyophilized peptides were dissolved in water or DMSO.
[0161] RNA expression analysis. Total RNA was isolated using TRIzol (Thermo Fischer Scientific) and the Rneasy Mini Kit (QIAGEN). RNA was reverse transcribed using the ABI High-Capacity cDNA Synthesis Kit. qRT-PCR analysis was performed using cDNA, primers, and SYBR Green fluorescent dye (ABI). Relative mRNA expression was determined by normalizing to ribosomal protein S18 (Rsp18) levels using the ΔΔCt method. The primer sequences used were CATGCAGAACCCACGACAGTA and CCTCACGCAGCTTGTTGTCTA for Rsp18 and TCTCCTGAAGAGGAAGAGAAACGG and TCTGCAACGCAGACTTCTCG for cfos.
[0162] Food intake, energy expenditure, and body composition measurements. Cumulative food intake and VO2 measurements were performed using a comprehensive laboratory animal monitoring system (Oxymax, Columbus Instruments) at room temperature (20-22 °C) as previously described. Singly housed mice were allowed to acclimate in metabolic cages for at least 24 h before the start of the experiment to minimize stress.
[0163] Glucose tolerance test and insulin tolerance test. For the glucose tolerance test, mice were fasted for 6 hours and then intraperitoneally injected with 1.5 g / kg body weight of glucose. Blood glucose levels were measured at 0, 15, 30, 45, 60, 90, and 120 minutes. For the insulin tolerance test, mice were fasted for 2 hours and then intraperitoneally injected with 0.8 U / kg of insulin. Blood glucose levels were measured at 0, 15, 30, 45, 60, 90, and 120 minutes.
[0164] Immunohistochemistry. For hematoxylin and eosin (H&E) staining, iWAT, BAT, and liver were formalin-fixed, paraffin-embedded, and sectioned at 6 μm. Sections were deparaffinized and dehydrated with xylene and ethanol. Briefly, slides were stained with hematoxylin, washed with water and 95% ethanol, and stained with eosin for 30 minutes. Sections were then incubated with ethanol and xylene and mounted with mounting medium. Immunohistochemical staining was observed under a Nikon 80i upright light microscope using a 40x objective. Digital images were captured with a Nikon Digital Sight DS-Fi1 color camera and NIS-Elements acquisition software.
[0165] Open field assay. Eight-week-old C57BL / 6 mice were transferred to an open field facility and housed for 7 days for acclimatization before testing. Mice were weighed and then intraperitoneally injected with either saline or 5 mg / kg BRP peptide (N = 15 mice per group; 10 mg / ml stock solution diluted in saline; total injection volume 100 μl per mouse). Thirty minutes after injection, the open field test was performed in a three-sided infrared detector-equipped open field activity arena (Med Associates Inc., St. Albans, VT. Model ENV-515) within a specially designed sound-attenuating chamber (Med Associates Inc., St. Albans, VT. MED-017M-027). The arena measured 43 cm (length) × 43 cm (width) × 30 cm (height), and the sound-attenuating chamber measured 74 cm (length) × 60 cm (width) × 60 cm (height). Each mouse was placed in a corner of the testing arena and allowed to explore the arena for 10 minutes while being tracked by an automated tracking system. Data were analyzed using Activity Monitor version 7.8. Analyzed parameters included distance traveled and time spent on the perimeter and in the center of the arena. The perimeter was defined as a zone 5 cm from the arena wall.
[0166] Statistical analysis. Replicates are listed in the figure legends. All values in the graphs are expressed as mean ± standard error. The n value represents biological replicates for cell experiments or individual animals for in vivo experiments. For animal experiments, n corresponds to the number of animals per condition. Specific details of the n value are provided in the legends of each figure. Mice were randomly assigned to treatment groups for in vivo studies. Each animal experiment was repeated using at least two mouse cohorts. Student's t-test was used for single comparisons. Significant differences between two groups (*p<0.05, **p<0.01, ***p<0.001) were assessed using a two-tailed unpaired Student's t-test, as the sample groups showed normal distribution and equal variances. Two-way ANOVA with repeated measures was used for food intake, body weight, GTT, and ITT.
[0167] A. Berrington de Gonzalez et al.,Body-mass index and mortality among 1.46 million white adults. The New England journal of medicine.363, 2211-2219(2010).
[0168] J.L.Kuk,C.I.Ardern,T.S.Church,A.M.Sharma,R.Padwal,X.Sui,S.N.Blair,Edmonton Obesity Staging System:association with weight history and mortality risk.Applied physiology,nutrition,and metabolism=Physiologie appliquee,nutrition et metabolisme.36,570-576(2011).
[0169] R.R.Wing,W.Lang,T.A.Wadden,M.Safford,W.C.Knowler,A.G.Bertoni,J.O.Hill,F.L.Brancati,A.Peters,L.Wagenknecht,Benefits of modest weight loss in improving cardiovascular risk factors in overweight and obese individuals with type 2 diabetes. Diabetes care.34,1481-1486(2011).
[0170] S.O’Rahilly,I.S.Farooqi,Human obesity as a heritable disorder of the central control of energy balance.International journal of obesity(2005).32 Suppl 7,S55-61(2008).
[0171] D.Polidori,A.Sanghvi,R.J.Seeley,K.D.Hall,How Strongly Does Appetite Counter Weight Loss? Quantification of the Feedback Control of Human Energy Intake. Obesity(Silver Spring,Md.).24,2289-2295(2016).
[0172] D.O.Magro,B.Geloneze,R.Delfini,B.C.Pareja,F.Callejas,J.C.Pareja,Long-term weight regain after gastric bypass:a 5-year prospective study.Obesity surgery.18,648-651(2008).
[0173] C.H.Lin,L.Shao,Y.M.Zhang,Y.J.Tu,Y.Zhang,B.Tomlinson,P.Chan,Z.Liu,An evaluation of liraglutide including its efficacy and safety for the treatment of obesity.Expert opinion on pharmacotherapy.21,275-285(2020).
[0174] J.P.H.Wilding,R.L.Batterham,S.Calanna,M.Davies,L.F.Van Gaal,I.Lingvay,B.M.McGowan,J.Rosenstock,M.T.D.Tran,T.A.Wadden,S.Wharton,K.Yokote,N.Zeuthen,R.F.Kushner,Once-Weekly Semaglutide in Adults with Overweight or Obesity.The New England journal of medicine.384,989-1002(2021).
[0175] C.Sobrino Crespo,A.Perianes Cachero,L.Puebla Jimenez,V.Barrios,E.Arilla Ferreiro,Peptides and food intake.Frontiers in endocrinology.5,58(2014).
[0176] J.E.Campbell,D.J.Drucker,Pharmacology,physiology,and mechanisms of incretin hormone action.Cell metabolism.17,819-837(2013).
[0177] M.Muttenthaler,G.F.King,D.J.Adams,P.F.Alewood,Trends in peptide drug discovery.Nature Reviews Drug Discovery.20,309-325(2021).
[0178] H.G.Pollock,J.W.Hamilton,J.B.Rouse,K.E.Ebner,A.B.Rawitch,Isolation of peptide hormones from the pancreas of the bullfrog(Rana catesbeiana).Amino acid sequences of pancreatic polypeptide,oxyntomodulin,and two glucagon-like peptides.The Journal of biological chemistry.263,9746-9751(1988).
[0179] I.Vecchio,C.Tornali,N.L.Bragazzi,M.Martini,The discovery of insulin:An important milestone in the history of medicine. Frontiers in Endocrinology.9(2018),p.613.
[0180] K.Tatemoto,Neuropeptide Y:complete amino acid sequence of the brain peptide.Proceedings of the National Academy of Sciences of the United States of America.79,5485-5489(1982).
[0181] D.A.Lovejoy,W.H.Fischer,S.Ngamvongchon,A. G.Craig,C.S.Nahorniak,R.E.Peter,J.E.Rivier,N.M.Sherwood,Distinct sequence of gonadotropin-releasing hormone(GnRH)in dogfish brain provides insight into GnRH evolution.Proceedings of the National Academy of Sciences of the United States of America.89,6373-6377(1992).
[0182] K.L.Lee,M.J.Middleditch,G.M.Williams,M.A.Brimble,G.J.S.Cooper,Using Mass Spectrometry to Detect,Differentiate,and Semiquantitate Closely Related Peptide Hormones in Complex Milieu:Measurement of IGF-II and Vesiculin.Endocrinology.156,1194-1199(2015).
[0183] J.E.Lee,Neuropeptidomics:Mass Spectrometry-Based Identification and Quantitation of Neuropeptides.Genomics & informatics.14,12-19(2016).
[0184] L.D.Fricker,J.Lim,H.Pan,F.-Y.Che,Peptidomics:Identification and quantification of endogenous peptides in neuroendocrine tissues.Mass Spectrometry Reviews.25,327-344(2006).
[0185] B.Muthusamy,et al.,Plasma Proteome Database as a resource for proteomics research.Proteomics.5,3531-3536(2005).
[0186] J.M.Schwenk,G.S.Omenn,Z.Sun,D.S.Campbell,M.S.Baker,C.M.Overall,R.Aebersold,R.L.Moritz,E.W.Deutsch,The Human Plasma Proteome Draft of 2017:Building on the Human Plasma PeptideAtlas from Mass Spectrometry and Complementary Assays.Journal of proteome research.16,4299-4310(2017).
[0187] B.R.Southey,A.Amare,T.A.Zimmerman,S.L.Rodriguez-Zas,J.V Sweedler,NeuroPred:a tool to predict cleavage sites in neuropeptide precursors and provide the masses of the resulting peptides. Nucleic acids research.34,W267-72(2006).
[0188] B.R.Southey,J.V Sweedler,S.L.Rodriguez-Zas,A python analytical pipeline to identify prohormone precursors and predict prohormone cleavage sites.Frontiers in neuroinformatics.2,7(2008).
[0189] D.F.Steiner,The proprotein convertases.Current opinion in chemical biology.2,31-39(1998).
[0190] M.Zheng,R.D.Streck,R.E.Scott,N.G.Seidah,J.E.Pintar,The developmental expression in rat of proteases furin, PC1,PC2,and carboxypeptidase E:implications for early maturation of proteolytic processing capacity.The Journal of neuroscience:the official journal of the Society for Neuroscience.14,4656-4673(1994).
[0191] J.R.Peinado,H.Li,K.Johanning,I.Lindberg,Cleavage of recombinant proenkephalin and blockade mutants by prohormone convertases 1 and 2:an in vitro specificity study.Journal of neurochemistry.87,868-878(2003).
[0192] M.Uhlen,et al.,Tissue-based map of the human proteome.Science.347,1260419(2015).
[0193] R.Petryszak,et al.,Expression Atlas update-An integrated database of gene and protein expression in humans,animals and plants.Nucleic Acids Research.44,D746-D752(2016).
[0194] B.A.Eipper,D.A.Stoffers,R.E.Mains,The biosynthesis of neuropeptides:peptide alpha-amidation.Annual review of neuroscience.15,57-85(1992).
[0195] K.-H.Kim,B.L.Seong,Peptide amidation:Production of peptide hormonesin vivo andin vitro.Biotechnology and Bioprocess Engineering.6,244-251(2001).
[0196] H.Mukai,K.Kawai,Y.Suzuki,K.Yamashita,E.Munekata,Stimulation of dog gastropancreatic hormone release by neuromedin B and its analogues.The American journal of physiology.252,E765-71(1987).
[0197] A.Wettergren,L.Pridal,M.Wjdemann,J.J.Holst,Amidated and non-amidated glucagon-like peptide-1(GLP-1):non-pancreatic effects(cephalic phase acid secretion)and stability in plasma in humans.Regulatory peptides.77,83-87(1998).
[0198] J.Milbrandt,Nerve growth factor rapidly induces c-fos mRNA in PC12 rat pheochromocytoma cells.Proceedings of the National Academy of Sciences of the United States of America.83,4789-4793(1986).
[0199] N.Gabellini,M.C.Minozzi,A.Leon,R.Dal Toso,Nerve growth factor transcriptional control of c-fos promoter transfected in cultured spinal sensory neurons.The Journal of cell biology.118,131-138(1992).
[0200] D.J.Drucker,Mechanisms of Action and Therapeutic Application of Glucagon-like Peptide-1.Cell Metabolism.27,740-756(2018).
[0201] S.R.Berkowicz,T.J.Featherby,J.C.Whisstock,P.I.Bird,Mice Lacking Brinp2 or Brinp3, or Both,Exhibit Behaviors Consistent with Neurodevelopmental Disorders.Frontiers in behavioral neuroscience.10,196(2016).
[0202] J.T.Kim,S.M.Terrell,V.L.Li,W.Wei,C.R.Fischer,J.Z.Long,Cooperative enzymatic control of N-acyl amino acids by PM20D1 and FAAH.eLife.9(2020),doi:10.7554 / eLife.55211.
[0203] J.T.Kim,V.L.Li,S.M.Terrell,C.R.Fischer,J.Z.Long,Family-wide Annotation of Enzymatic Pathways by Parallel In Vivo Metabolomics.Cell chemical biology.26,1623-1629.e3(2019).
[0204] P.Cohen,et al.,Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch.Cell.156,304-316(2014).
[0205] J.Z.Long,et al.,Ablation of PM20D1 reveals N-acyl amino acid control of metabolism and nociception.Proceedings of the National Academy of Sciences of the United States of America.115,E6937-E6945(2018).
[0206] KJSvensson,JZLong,MPJedrychowski,P.Cohen,JCLo,S.Serag,S.Kir,K.Shinoda,JATartaglia,RRRao,A.Chedotal,S.Kajimura,SPGygi,BMSpiegelman,A secreted slit2 fragment regulates adipose tissue thermogenesis and metabolic function.Cell Metabolism.23,454-466(2016).
[0207] is an adipokine that promotes glucose uptake and improves glucose tolerance and hepatic steatosis.Cell metabolism(2021),doi:10.1016 / j.cmet.2021.07.010.
[0208] All publications and patent applications cited in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0209] The present invention has been described with reference to specific embodiments discovered or proposed by the inventors to include preferred modes for carrying out the invention. Those skilled in the art will recognize, in light of this disclosure, that many modifications and variations can be made in the specific embodiments exemplified without departing from the intended scope of the invention. Furthermore, considerations of biological functional equivalence allow for some changes to be made in the structure of the protein without affecting the type or amount of biological action. All such modifications are intended to be included within the scope of the appended claims.
Claims
1. Amino acid sequence of SEQ ID NO:2:
1. An isolated peptide comprising or consisting essentially of: In the formula, X 9 is any amino acid, provided that X 9 is F, the peptide comprises a non-naturally occurring modification. The peptide.
2. The peptide of claim 1 , comprising at least one amidated amino acid.
3. The amidated amino acid has a C-terminal carboxyl group, 12 Thiol, R 3 , R 6 , and R 7 The peptide of claim 2, wherein the peptide is located at one or more of:
4. A peptide according to any one of claims 1 to 3, comprising at least one acylated residue.
5. C 4 ~C 20 5. The peptide of claim 4, comprising an alkyl fatty acid.
6. 6. The peptide of claim 5, wherein the fatty acid is palmitate.
7. The peptide of any one of claims 1 to 6, which is modified by pegylation, glycosylation, conjugation to albumin, or conjugation to immunoglobulin Fc.
8. An isolated peptide comprising a sequence according to any of SEQ ID NOs: 9-20.
9. For use in a method of providing therapeutic weight loss in a subject or managing the weight of a subject, Amino acid sequence of SEQ ID NO:2:
1. An isolated peptide comprising or consisting essentially of: In the formula, X 9 is any amino acid, The peptide.
10. A pharmaceutical formulation comprising the isolated peptide of any one of claims 1 to 9 and a pharmaceutically acceptable excipient.
11. 11. A unit dose pharmaceutical formulation according to claim 10.
12. 1. A method for managing weight in a subject, comprising: The method comprising administering to a subject in need thereof an effective dose of the pharmaceutical formulation of any one of claims 1 to 10.
13. 13. The method of claim 12, wherein the effective dose ranges from about 0.1 mg / kg to about 100 mg / kg.
14. 14. The method of claim 12 or 13, wherein the administration is parenteral.
15. The method of any one of claims 12 to 14, wherein the subject is overweight or obese.
16. The method of any one of claims 12 to 15, wherein the subject has been diagnosed with metabolic syndrome or type II diabetes.
17. 17. The method of any one of claims 12 to 16, wherein the subject reduces food intake compared to an untreated subject.
18. 18. The method of any one of claims 12-17, wherein the subject is concurrently treated with a therapeutic agent selected from the group consisting of an antidiabetic agent, an antiobesity agent, an antihypertensive agent, an antiatherosclerotic agent, and a lipid-lowering agent.