Flow cell with patterned binding regions

Abstract

An exemplary flow cell includes a patterned substrate having an active area and a bonding area at least partially surrounding the active area. The active area includes a first recess defined in a layer of the patterned substrate, a surface chemical positioned in the first recess, and a first gap area surrounding the first recess. The bonding area includes a second recess defined in the layer and a second gap area surrounding the second recess. An adhesive is positioned over the second recess and over the second gap area. A cover is attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 373,617, filed August 26, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in XML format, and is incorporated herein by reference in its entirety. The XML copy, created on August 15, 2023, is named ILI242BPCT_IP-2339-PCT_SL.xml and is 15,796 bytes in size. [Background technology]

[0003] Flow cells are used in a variety of methods and applications, such as gene sequencing and genotyping. For nucleic acid analysis, the surface of the flow cell can be functionalized with specific surface chemistries, such as primers, polymerases, etc., depending on the reaction to be performed. The specified reaction can then be observed or detected, and subsequent analysis can help identify or reveal the properties of the chemicals involved in the reaction. In some instances, the controlled reaction changes charge, conductivity, or some other electrical property, and therefore electronic systems can be used for detection. In other instances, the controlled reaction produces fluorescence, and therefore optical systems can be used for detection. Summary of the Invention

[0004] Disclosed herein is a flow cell including at least one patterned substrate. The patterned substrate includes an active area and a bonding area. The bonding area of ​​the patterned substrate can be bonded to a lid, a second patterned substrate, or a second partially patterned substrate that includes a bonding area but not an active area. In the examples disclosed herein, the bonding area is patterned with features including recesses or posts separated by gap areas. These features introduce additional axes for adhesive bonding and also increase the surface area of ​​the substrate available for bonding. Therefore, the overall compressive and shear holding force in the bonding area is increased. The bonding area in the examples disclosed herein can help improve the bond integrity of the flow cell and prevent fluid leakage during use. [Brief explanation of the drawings]

[0005] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, if not identical, components. For purposes of brevity, reference numbers or features having functionality previously described may or may not be described in conjunction with other drawings in which they appear. [Figure 1] FIG. 1 is a top view of an example of a patterned substrate including active areas and bonding areas. [Figure 2A] 2A is a cross-sectional view taken along line 2A-2A of FIG. 1 illustrating an example of a flow cell including the example patterned substrate of FIG. 1. [Figure 2B] 2B is a cross-sectional view taken along line 2B-2B of FIG. 1 illustrating an example flow cell including another example patterned substrate of FIG. 1. [Figure 2C] 2C is a cross-sectional view taken along line 2C-2C of FIG. 1 illustrating one example of a flow cell including yet another example of the patterned substrate of FIG. 1. [Figure 2D] 2D-2D is a cross-sectional view taken along line 2D-2D of FIG. 1 illustrating an example of a flow cell including yet another example of the patterned substrate of FIG. 1. [Figure 3A]Each of Figures 3A-3B is a perspective view of a different recess formed in a layer of a patterned substrate. [Figure 3B] Each of Figures 3A-3B is a perspective view of a different recess formed in a layer of a patterned substrate. [Figure 4A] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4B] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4C] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4D] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4E] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4F] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 4G] Each of Figures 4A-4G is a cross-sectional view of a different shape of recesses in the bonding region of a patterned substrate. [Figure 5] FIG. 4B is a perspective view of the recessed portion shown in FIG. 4A. [Figure 6] FIG. 4C is a perspective view of the recessed portion shown in FIG. 4B. [Figure 7] FIG. 4D is a perspective view of the recessed shape shown in FIG. 4C. [Figure 8] 10A-10C are cross-sectional views of yet another shape of recesses in the bonding region of a patterned substrate. [Figure 9A] FIG. 1 is a top view of a bonding region including recesses and a feature suspended above each of the recesses. [Figure 9B] FIG. 9B is a cross-sectional view taken along line 9B-9B of FIG. 9A. [Figure 9C] FIG. 9C is a cross-sectional view taken along line 9C-9C of FIG. 9A. [Figure 10A] 1A-1C are perspective views of different posts formed on a patterned substrate layer. [Figure 10B] 1A-1C are perspective views of different posts formed on a patterned substrate layer. [Figure 11] FIG. 1 is a perspective view of an example of a post shape in a bonding region of a patterned substrate. [Figure 12] 10A and 10B are perspective views of other examples of post shapes in the bonding region of a patterned substrate. [Figure 13] 10A and 10B are perspective views of yet another example of post shapes in the bonding region of a patterned substrate. [Figure 14A] 14A and 14B are each perspective views of another example of post shapes in the bonding region of a patterned substrate. [Figure 14B] 14A and 14B are each perspective views of another example of post shapes in the bonding region of a patterned substrate. [Figure 15] FIG. 1 is a cross-sectional view of a complementary metal-oxide semiconductor (CMOS) integrated with an example flow cell disclosed herein. [Figure 16A] 16A and 16B are each a top view of a photoresist pattern used to form an example of a bonding region that includes a recess and a suspended feature above each of the recesses. [Figure 16B] 16A and 16B are each a top view of a photoresist pattern used to form an example of a bonding region that includes a recess and a suspended feature above each of the recesses. [Figure 17] 16A depicts a schematic flow diagram illustrating an exemplary method of using the photoresist pattern of either FIG. 16A or FIG. 16B. [Figure 18] 1 depicts a schematic flow diagram illustrating another exemplary method for creating recesses in bonding regions of a patterned substrate. [Figure 19A]1 is a graph depicting the results of a cyclic pressure test, where the percentage of flow cells that survived the pressure test is depicted on the Y-axis and the number of pressure cycles is depicted on the X-axis. [Figure 19B] 1 is a graph depicting the results of a cyclic pressure test, where the percentage of flow cells that survived the pressure test is depicted on the Y-axis and the number of pressure cycles is depicted on the X-axis. [Figure 19C] 1 is a graph depicting the results of a cyclic pressure test, where the percentage of flow cells that survived the pressure test is depicted on the Y-axis and the number of pressure cycles is depicted on the X-axis. DETAILED DESCRIPTION OF THE INVENTION

[0006] The flow cells disclosed herein include at least one patterned substrate including patterned active areas and patterned bonding areas. The patterned active areas include recesses or posts functionalized with surface chemistry that promotes a desired reaction. The patterned bonding areas are not functionalized with surface chemistry, but rather include recesses or posts that increase the surface available for bonding with an adhesive.

[0007] In some examples, the patterned substrate is incorporated into a flow cell suitable for optical detection of the reaction. In other examples, the patterned substrate is incorporated into a flow cell integrated onto a solid-state imager, such as a complementary metal-oxide semiconductor (CMOS) imager. In these examples, the flow cell is suitable for optical detection of the reaction.

[0008] definition Terms used herein should be understood to have their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are described below.

[0009] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0010] The terms comprising, including, containing, and the various forms of these terms are synonymous and intended to be equally broad.

[0011] Terms such as top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and / or various components of the flow cell. It should be understood that these directional terms are not meant to indicate a specific orientation, but are used to designate the relative orientation between components. The use of directional terms should not be construed to limit the examples disclosed herein to any specific orientation.

[0012] The terms first, second, etc. are also not meant to indicate a particular orientation or order, but rather are used to distinguish one component from another.

[0013] Ranges provided herein should be understood to include the stated range and any value or subrange within that stated range, as if such value or subrange were explicitly recited. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and subranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. Furthermore, when "about" and / or "substantially" are used to describe values, these are meant to encompass small variations (up to ±10%) of the stated value.

[0014] The term "active area" refers to an area of ​​a patterned substrate that contains features (i.e., recesses or posts) that support surface chemistry that promotes a desired reaction that is detected when a flow cell containing the patterned substrate is in operation.

[0015] As used herein, the term "attached" refers to the state in which two things are bonded, fastened, adhered, connected, or bound to one another, either directly or indirectly. By way of example, the bond that forms can be a covalent bond or a non-covalent bond. A covalent bond is characterized by the sharing of electron pairs between atoms. A non-covalent bond is a physical bond that does not involve the sharing of electron pairs, and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0016] As used herein, a "bonding region" refers to an area of ​​a patterned substrate that is bonded to another material, which may be, by way of example, a lid, another patterned substrate, or a partially patterned substrate. In the examples disclosed herein, the bond formed in the bonding region is a chemical bond.

[0017] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and which, in some cases, results in the modification of surface properties. Generally, deposition may be carried out using evaporation techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0018] As used herein, the term "recess" refers to a discrete, concave feature of a substrate, the recess having a surface opening at least partially surrounded by a clearance area of ​​the substrate. The recesses can have any of a variety of shapes at their opening in the surface, including, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices), etc. The cross-section of the recess taken perpendicular to the substrate surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. Several exemplary recesses are described herein.

[0019] The term "each," when used in reference to a collection of items, is intended to identify each individual item in the set, but does not necessarily refer to every item in the set. Exceptions may occur where express disclosure or context clearly dictates otherwise.

[0020] As used herein, the term "flow cell" is intended to mean a vessel having a flow channel in which a reaction may occur, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell allows for detection of a reaction occurring within the chamber. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0021] As used herein, a "flow channel" or "channel" can be an area defined between two bonded components that can selectively receive a liquid sample. In some examples, a flow channel can be defined between a patterned substrate and a lid and thus be in fluid communication with one or more recesses or ports defined in or on the patterned substrate. A flow channel can also be defined between two patterned substrates that are bonded together, or between a patterned substrate and a partially patterned substrate.

[0022] As used herein, the term "interstitial region" refers to, for example, an area of ​​a substrate that separates features, e.g., recesses or posts, defined in or on the substrate. For example, an interstitial region can separate one recess or post of an array from another recess or post of the array. Two recesses or posts that are separated from one another can be distinct, i.e., lack physical contact with one another. In the examples disclosed herein, the interstitial region is continuous, but the recesses or posts are discrete, as in, for example, multiple recesses defined in an otherwise continuous surface or multiple posts formed on an otherwise continuous surface.

[0023] As used herein, "negative photoresist" refers to a photosensitive material in which portions exposed to light of a specific wavelength become insoluble in a developer. In these examples, an insoluble negative photoresist has a solubility of less than 5% in the developer. In a negative photoresist, light exposure changes the chemical structure of the exposed portions of the material so that they are less soluble in the developer (than the unexposed portions). An insoluble negative photoresist is not soluble in the developer, but may be at least 99% soluble in a remover different from the developer. The remover may be, for example, a solvent or solvent mixture used in a lift-off process.

[0024] In contrast to insoluble negative photoresists, any portion of a negative photoresist that is not exposed to light is at least 95% soluble in a developer. This portion may be referred to as a "soluble negative photoresist." In some examples, the soluble negative photoresist is at least 98%, for example, 99%, 99.5%, or 100% soluble in a developer.

[0025] As used herein, a "nucleotide" comprises a nitrogen-containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are the monomeric units of nucleic acid sequences. In ribonucleic acid (RNA), the sugar is ribose, and in deoxyribonucleic acid (DNA), the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group at the 2' position of the ribose. The nitrogen-containing heterocyclic base (i.e., nucleobase) can be a purine or pyrimidine base. Purine bases include adenine (A) and guanine (G), as well as modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), as well as modified derivatives or analogs thereof. The C-1 atom of deoxyribose is linked to the N-1 atom of a pyrimidine or the N-9 atom of a purine. Nucleic acid analogs may have an altered phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNAs).

[0026] The term "polymer hydrogel" refers to a semi-rigid polymer that is permeable to liquids and gases. Polymer hydrogels can swell when liquid (e.g., water) is absorbed and shrink when the liquid is removed, for example, by drying. Although hydrogels can absorb water, they are not water-soluble.

[0027] As used herein, "positive photoresist" refers to a photosensitive material in which portions exposed to light of a particular wavelength become soluble in a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. This portion may be referred to herein as a "soluble positive photoresist." In some examples, the portion of the positive photoresist exposed to light (i.e., the soluble photoresist) is at least 98%, e.g., 99%, 99.5%, or 100% soluble in the developer. In a positive photoresist, light exposure changes the chemical structure of the exposed portion of the material so that it is more soluble in the developer (than the unexposed portion).

[0028] In contrast to soluble positive photoresist, any portion of the positive photoresist that is not exposed to light is insoluble (less than 5% soluble) in the developer. This portion may be referred to as "insoluble positive photoresist." The insoluble positive photoresist is not soluble in the developer, but may be at least 99% soluble in a remover that is different from the developer. In some examples, the insoluble positive photoresist is at least 98%, e.g., 99%, 99.5%, or 100% soluble in the remover. The remover may be a solvent or solvent mixture used in the lift-off process.

[0029] As used herein, the term "post" refers to a discrete convex feature of a substrate, the post having a base portion at least partially surrounded by a clearance region of the substrate and having an upper surface positioned a distance spaced from the base portion by a post body. The post can have any of a variety of shapes on the upper portion, including, by way of example, circular, elliptical, square, polygonal, star-shaped (having any number of vertices), etc. The cross-section of the post taken perpendicular to the substrate surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. Several exemplary posts are described herein.

[0030] As used herein, the term "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers are part of a primer set that function as initiation points for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, function as initiation points for DNA synthesis. The 5' end of each primer in a primer set can be modified to allow for a coupling reaction with a functional group on a polymer chain. Primers can be any number of bases long and can contain a variety of non-naturally occurring nucleotides. In one example, sequencing primers are short, ranging from 10 to 60 bases or 20 to 40 bases.

[0031] The term "partially patterned substrate" refers to a single layer or multilayer support that includes bonding areas but does not include active areas.

[0032] The term "patterned substrate" refers to a single layer or multilayer support that includes active areas and binding areas.

[0033] The term "surface chemistry" refers to polymer hydrogels and primers that facilitate the desired reactions to be detected when a flow cell containing the patterned substrate is in operation.

[0034] The term "transparent" refers to a material, e.g., in the form of a layer, that can transmit a specific wavelength or range of wavelengths. For example, the material may be transparent to the wavelengths used in sequencing operations. Transparency may be quantified using transmittance, i.e., the ratio of light energy incident on an object to light energy transmitted through the object. The transmittance of a transparent layer depends on the thickness of the layer, the wavelength of light, and the dose of light exposure. In the examples disclosed herein, the transmittance of the transparent metal layer may range from 0.1 (10%) to 1 (100%). The material of the transparent metal layer may be a pure material, a material containing some impurities, or a mixture of materials, as long as the resulting layer allows for the desired transmittance.

[0035] Flow cell Examples of flow cells disclosed herein include at least one patterned substrate. A top view of an example of a patterned substrate 10 is shown in Figure 1. Patterned substrate 10 includes an active area 12 or 12' and a binding area 14 or 14' and 14" that at least partially surrounds active area 12 or 12'.

[0036] The patterned substrate 10 shown in Figure 1 includes two active areas 12 or 12' and a respective bonding region 14 or 14' adjacent to the active areas 12 or 12'. While two active areas 12 or 12' are shown in Figure 1, it should be understood that any number of active areas 12 or 12' (e.g., a single active area 12 or 12', four active areas 12 or 12', eight active areas 12 or 12', etc.) may be included in the patterned substrate 10. Each active area 12 or 12' is separated from each other active area 12 or 12' (e.g., by a bonding region 14 or 14') so that fluid introduced into any particular active area 12 or 12' does not flow into any of the other active areas 12 or 12'.

[0037] In one example, active area 12 or 12' has a substantially rectangular configuration with pointed or rounded ends. The length and width, respectively, of active area 12 or 12' can be smaller than the length and width, respectively, of layer 18 (see, e.g., FIG. 2A ) in which active area 12 or 12' is formed, such that a portion of layer 18 surrounding each active area 12 or 12' is available as bonding area 14 or 14' and 14"—i.e., for attachment to cover 30. Examples of cover 30 include lid 46 (FIGS. 2A and 2B), a partially patterned substrate 48 (FIG. 2C), or another patterned substrate 10" (FIG. 2D). In some examples, the width of each active area 12 or 12' can be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some cases, the length of each active region 12 or 12' can be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each active region 12 or 12' can be greater than, less than, or between the values ​​specified above.

[0038] The bonding region 14 or 14' adjacent to the long side of the active region 12 or 12' is patterned with recesses 16' (see, e.g., FIG. 2A) or posts 34' (see, e.g., FIG. 2B) that increase the surface area of ​​the layer 18 that contacts the adhesive 28 (see, e.g., FIG. 2A).

[0039] In one example, the bonding regions 14 or 14' have a rectangular configuration. The length and width of the bonding regions 14 or 14' may be the same as the length and width of the active regions 12 or 12', respectively. Alternatively, the length and width of the bonding regions 14 or 14' may be slightly smaller than the length and width of the active regions 12 or 12', respectively. In some examples, the width of each bonding region 14 or 14' may be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some examples, the length of each bonding region 14 or 14' may be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each bonding region 14 or 14' may be greater than, less than, or between the values ​​specified above.

[0040] Another bonding region 14'' is adjacent to a short side of the active region 12 or 12' and a short side of the bonding region 14 or 14'. This bonding region 14'' is not patterned with recesses 16' or posts 34', but rather is a substantially flat portion of the layer 18.

[0041] Examples of flow cells 20A, 20B, 20C, 20D including at least one patterned substrate 10 are shown in Figures 2A, 2B, 2C, and 2D. The exemplary flow cells 20A, 20C, 20D shown in Figures 2A, 2C, and 2D are examples of patterned substrates 10 having active areas 12 and binding areas 14, 14' at least partially surrounding the active areas 12, where the active areas 12 are defined by first recesses 16 defined in layer 18 of the patterned structure 10, surface chemistries (e.g., polymer hydrogel 22 and primers 24A, 24B) positioned within the first recesses 16, and binding areas 14, 14' at least partially surrounding the first recesses 16. and a first gap region 26 surrounding the second recess 16', and the bonding region 14 includes a second recess 16' defined in the layer 18 and a second gap region 26' surrounding the second recess 16'; an adhesive 28 positioned within the second recess 16' and over the second gap region 26'; and a cover 30 attached to the adhesive 28 such that a flow channel 32 is defined between a portion of the cover 30 and the active region 12.

[0042] The exemplary flow cell 20B shown in FIG. 2B is another example of a patterned substrate 10′ having an active area 12′ and a binding area 14′ at least partially surrounding the active area 12′, the active area 12′ being comprised of first posts 34 defined within a layer 18 of the patterned substrate 10′, surface chemistry (e.g., polymer hydrogel 22 and primers 24A, 24B) positioned on the first posts 34, and a first gap surrounding the first posts 34. 1. Another example of a patterned substrate 10′ includes a layer 18 having a gap region 26, and a bonding region 14′ includes second posts 34′ defined in the layer 18 and second gap regions 26′ surrounding the second posts 34′, an adhesive 28 positioned over the second gap regions 26′ and over the second posts 34′, and a cover 30 attached to the adhesive 28 such that a flow channel 32 is defined between a portion of the cover 30 and the active region 12.

[0043] When flow cells 20A, 20B, 20C, 20D are used in conjunction with an optical detection device, layer 18 may be a patterned single-layer substrate or may be part of a multi-layer substrate that includes (patterned) layer 18 positioned on one or more additional layers.

[0044] When layer 18 is a single layer substrate, layer 18 can be any support material that can be patterned with recesses 16, 16′ or posts 34, 34′. Examples of suitable materials for single layer substrates include epoxy siloxane, glass, modified or functionalized glass, plastics (including acrylics, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cycloolefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, etc.), nylon (polyamide), ceramic / ceramic oxide, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO), carbon, metals, inorganic glasses, etc. In some instances, the single layer substrate is selected to be transparent to the excitation and emission wavelengths used in the optical detection of reactions occurring within flow cells 20A, 20B, 20C, 20D.

[0045] An example of a multilayer substrate includes a layer 18 patterned with recesses 16, 16′ or posts 34, 34′ and positioned on a base support 36. As one example, the layer 18 can be an inorganic oxide that is selectively applied to the base support 36 in a desired pattern. Examples of suitable inorganic oxides include tantalum oxide (e.g., TaO), aluminum oxide (e.g., AlO), silicon oxide (e.g., SiO), hafnium oxide (e.g., HfO), and the like. As another example, the layer 18 can be a resin matrix material that is applied to the base support 36 and then patterned. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® by Bellex), and combinations thereof.

[0046] As used herein, the term "polyhedral oligomeric silsesquioxane" (commercially available from Hybrid Plastics under the trademark POSS®) refers to a hybrid intermediate between silica (SiO2) and silicone (R2SiO) (e.g., RSiO 1.5 ) refers to a chemical composition having the chemical formula [RSiO 3 / 2 ] nwherein the R groups can be the same or different. Exemplary R groups of the polyhedral oligomeric silsesquioxanes include epoxy, azide / azido, thiol, poly(ethylene glycol), norbornene, tetrazine, acrylate, and / or methacrylate, or further, for example, alkyl, aryl, alkoxy, and / or haloalkyl groups. The resin compositions disclosed herein can include one or more different cage or core structures as monomer units. The average cage content can be adjusted during synthesis and / or controlled by purification methods, and a distribution of cage sizes of the monomer units can be used in the embodiments disclosed herein.

[0047] The multi-layer base support 36 can be any of the examples described herein for the single layer substrate.

[0048] When flow cells 20A, 20B, 20C, and 20D are used with electronic detection devices, layer 18 can be a passivation layer or one of multiple stacked passivation layers bonded to a complementary metal-oxide semiconductor (CMOS) chip (see FIG. 15). In these examples, layer 18 can provide a level of corrosion protection for the buried metal layer of the CMOS chip closest to layer 18. If a stacked passivation layer is used, the layer forming the bottom of recess 16 or defining post 34 is selected to be transparent to light emitted (e.g., visible light) resulting from reactions occurring with surface chemistries. Also, when a stacked passivation layer is used, the outermost layer is selected to be at least initially resistant to fluid environments and moisture that may be introduced into or present within flow channel 32. The at least initially resistant material acts as an etching barrier to high-pH reagents (e.g., pH values ​​in the range of 8 to 14) and as a moisture barrier. Examples of materials suitable for the passivation layer include silicon nitride (Si3N4), silicon oxide (SiO2), tantalum oxide (e.g., tantalum pentoxide (TaO5)), hafnium oxide (HaO2), boron-doped p+ silicon, and the like. In some examples, the passivation layer stack may also include a non-passivating material, such as a tantalum layer. While some exemplary materials have been provided, it should be understood that other layers may be used that provide suitable etch rates for creating the desired recess shape and passivation (if desired). The total thickness of the passivation layer (including layer 18) may range from about 100 nm to about 500 nm.

[0049] In the example shown in Figures 2A, 2C and 2D, the active region 12 and the bonding region 14 include recesses 16, 16'.

[0050] In some examples, the geometric shape of each of the first recesses 16 and each of the second recesses 16' is the same. In other words, in these examples, all of the recesses 16, 16' have the same shape. In these examples, the shape of the recesses 16, 16' is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular prism, a semi-circular cylinder, a polygonal prism, and combinations thereof. Examples of suitable polygonal prisms include a triangular prism, a square prism (i.e., a cube), a rectangular prism (i.e., a rectangular prism), a pentagonal prism, a hexagonal prism, an octagonal prism, or a trapezoidal prism. Any of the shapes that typically have angled corners can instead have rounded corners. Additionally, it should be understood that recesses 16, 16' that include a combination of shapes have an overall shape that combines two or more of the listed three-dimensional shapes.

[0051] Several perspective views of the shapes of the recesses 16, 16' are shown in Figures 3A and 3B. In particular, a perspective view of a cylindrical recess 16, 16' is shown in Figure 3A, and a perspective view of an elliptical cylindrical recess 16, 16' is shown in Figure 3B.

[0052] Each recess 16, 16' is a three-dimensional space that extends inward (downward) from the surface of layer 18. Thus, recess 16, 16' is a concave region relative to interstitial regions 26, 26' of layer 18 that surround recess 16, 16', respectively.

[0053] The layout or pattern of the recesses 16 in the active region 12 can be the same as or different from the layout or pattern of the recesses 16' in the bonding region 14. The respective layouts can be regular, repeating, or irregular patterns. In one example, the recesses 16, 16' in the active region 12 and bonding region 14 are arranged in a hexagonal lattice for close packing and improved density. Other layouts can include, for example, a rectangular layout, a triangular layout, etc. In some examples, the layout or pattern can be an xy format of the recesses 16, 16' in rows and columns, separated by gap regions 26, 26'. The recesses 16, 16' can be arranged in other patterns, such as stripes, spirals, lines, triangles, rectangles, circles, arcs, checks, diagonals, arrows, and / or squares. The recesses 16, 16' can also be configured as trenches extending partially along the length or width of the layer 18.

[0054] The layout or pattern of the recesses 16 or 16' may be characterized in terms of the density (e.g., number of recesses 16, 16') of the recesses 16, 16', respectively, within the active region 12 and the bonding region 14. For example, the recesses 16 and / or 16' may be spaced apart from each other by 1 mm 2 They may be present at a density of about 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2The density of the recesses 16 or 16' may be adjusted to different densities, including densities of about 50 million per recess, or more or less. It should be further understood that the density of the recesses 16 or 16' may be between one of the lower and upper limits selected from the ranges above. By way of example, a high-density array may be characterized as having recesses 16 or 16' separated by less than about 100 nm, a medium-density array may be characterized as having recesses 16 or 16' separated by about 400 nm to about 1 μm, and a low-density array may be characterized as having recesses 16 or 16' separated by more than about 1 μm. While several density examples are provided, it should be understood that any suitable density may be used. In some cases, it may be desirable for the spacing between the recesses 16 or 16' to be even greater than the examples listed herein.

[0055] The layout or pattern of the recesses 16 or 16' may also, or alternatively, be characterized in terms of average pitch, or the spacing from the center of one recess 16 or 16' to the center of an adjacent recess 16 or 16' (center-to-center spacing), or the spacing from the left edge of one recess 16 or 16' to the right edge of an adjacent recess 16 or 16' (edge-to-edge spacing). The pattern may be regular, such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch of a particular pattern of recesses 16 or 16' may be between one of the lower and upper limits selected from the ranges above. In one example, the recesses 16 or 16' have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of average pitch values ​​have been provided, it should be understood that other average pitch values ​​may also be used.

[0056] The size of each recess 16, 16' may be characterized by its volume, opening area, depth, and / or diameter or length and width.

[0057] Each recess 16, 16' may have any volume capable of receiving the desired materials (e.g., surface chemistry for recess 16 and adhesive 28 for recess 16'). By way of example, the volume may be at least about 1×10 -3 μm 3 , at least about 1 x 10 -2 μm 3 , at least about 0.1 μm 3 , at least about 1 μm 3 , at least about 10 μm 3 , at least about 100 μm 3 Alternatively or additionally, the volume may be at most about 1×10 4 μm 3 , up to about 1 × 10 3 μm 3 , up to about 100 μm 3 , up to about 10 μm 3 , up to about 1 μm 3 , up to about 0.1 μm 3 , or even less.

[0058] The area occupied by each recess opening is at least about 1×10 -3 μm 2 , at least about 1 x 10 -2 μm 2 , at least about 0.1 μm 2 , at least about 1 μm 2 , at least about 10 μm 2 , at least about 100 μm 2 Alternatively or additionally, the area may be at most about 1×10 3 μm 2 , up to about 100 μm 2 , up to about 10 μm 2 , up to about 1 μm 2 , up to about 0.1 μm 2 , up to about 1 × 10 -2 μm 2 The area occupied by each recess opening may be greater than, less than, or anything in between.

[0059] The depth of each recess 16 is large enough to accommodate the surface chemistry, and the depth of each recess 16' depends on the desired surface area for bonding. The depth may be measured from the surface of layer 18 to the deepest point at the bottom of recess 16 or 16'. By way of example, the depth of each recess 16, 16' may be at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the depth of each recess 16, 16' may be at most about 1×10 3 The depth of each recess 16, 16' may be greater than, less than, or between the values ​​specified above.

[0060] In some examples, the diameter, or length and / or width, or other longest dimension of a particular shape of recess 16, 16′ can be at least about 10 nm, at least about 0.1 μm, at least about 0.5 μm, at least about 1 μm, at least about 10 μm, at least about 100 μm, or more. Alternatively or additionally, the dimension can be at most about 1×10 3 The diameter of each recess 16, 16' may be greater than or equal to about 100 μm, greater than or equal to about 10 μm, greater than or equal to about 1 μm, greater than or equal to about 1 μm, greater than or equal to about 0.5 μm, greater than or equal to about 0.1 μm, or less (e.g., about 50 nm). In one example, the dimensions of a particular recess shape (e.g., diameter, length and / or width, or other longest dimension) range from about 10 nm to about 10 μm. In some examples, the diameter of each cylindrical recess 16, 16' is about 0.4 μm. The dimensions of each recess 16, 16' may be greater than, less than, or between the values ​​specified above.

[0061] In other examples, the geometric shape of each of the first recesses 16 is different from the geometric shape of each of the second recesses 16'. In other words, in these other examples, all of the recesses 16 in the active region 12 have one type of shape, and all of the recesses 16' in the bonding region 14 have a different type of shape. In these examples, the shapes of the recesses 16 are selected from the group consisting of cylinders, elliptical cylinders, spheres, cubes, rectangular parallelepipeds, semi-circular cylinders, polygonal prisms, and combinations thereof, and the geometric shapes of the recesses 16' in the bonding region 14 are different shapes selected from the same group.

[0062] In one example, the geometric shape of each of the first recesses 16 is cylindrical, and the geometric shape of each of the second recesses 16' is an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a semi-cylinder, a polygon, or a combination thereof. In another example, the geometric shape of each of the first recesses 16 is an elliptical cylinder, and the geometric shape of each of the second recesses 16' is a cylinder, a sphere, a cube, a rectangular parallelepiped, a semi-cylinder, a polygon, or a combination thereof. Any of these shape layouts, dimensions, and / or other characteristics may be used.

[0063] In another example, the geometric shape of each of the first recesses 16 is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a cone, and a polygonal prism, and the geometric shape of each of the second recesses 16′ is selected from the group consisting of a wide portion P W Narrow part P that opens to N Any of the layouts, dimensions, and / or other characteristics described herein for a circular cylinder or an elliptical cylinder may be used for the first recess 16 in these other examples.

[0064] 4A to 4E show the wide portion P W Narrow part P that opens to N 10A and 10B depict cross-sectional views of different examples of shapes including a narrow portion P N The dimension D1 across the opening of the W At least one dimension of the axial length is smaller than D2.

[0065] 4A-4E, it should be understood that the adhesive 28 fills the entire recess 16'. W The wide portion P increases the surface area of ​​the patterned substrate 10 available for bonding. W The overhangs and / or sloped or curved walls that define the recess 16' also form a cavity that can effectively confine the adhesive 28 within the recess 16'.

[0066] In the example shown in FIGS. 4A to 4D, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped, and the wide portion P W has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a semi-cylinder, a sphere, a polygonal prism, and a cone.

[0067] In each of these examples, the patterned substrate 10 includes a layer 18, at least one additional layer 38 underlying the layer 18, and a base support 36 underlying the at least one additional layer 38, and the geometric shape of each of the second recesses 16′ includes a narrow portion P N is defined in and through layer 18. W is defined in and through at least one additional portion 38, and the base support 36 has a wide portion P W The additional layer 38 may be any of the materials described herein for layer 18 or may be any of the passivation layers described herein. The base support 36 may be any of the examples described herein.

[0068] In the example shown in FIG. 4A, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped, and the wide portion P W An example of this type of recess 16' is shown in FIG. N and the conical wide part P W It has.

[0069] The narrow portion P in the example shown in FIG. N If is a circular cylinder or an elliptical cylinder, the dimension D1 across the opening is the diameter, which can be any of the dimensions described herein for the recess shape. N If the narrow portion P is a cube or a rectangular parallelepiped, the dimension D1 across the opening is the width or height of the cube or rectangular parallelepiped, which may be equivalent to any of the dimensions described herein for the recess shape. N The depth of the narrow part P N depends on the thickness of the layer 18 to be formed.

[0070] In the example shown in FIGS. 4A and 5, the narrow portion P N The wide portion P of the recess 16' W The narrow portion P N The dimension D2 of the cone shape parallel to the dimension D1 across the opening of the layer 18 is the width of the wide portion P moving from the layer 18 towards the base support 36. W The dimension D2 at any point along the cone shape can range from about 10 nm to about 10 μm.

[0071] In the exemplary shape of FIG. 4A, the angled walls defined in layer 38 increase the bonding surface area and also form cavities for adhesive 28.

[0072] In the example shown in FIG. 4B, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped, and the wide portion P W Each recess 16' has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped. An example of this type of recess 16' is shown in FIG. 6, which shows a cube-shaped narrow portion P N and a rectangular parallelepiped (or rectangular prism) shaped wide portion P W and

[0073] The narrow portion P in the example shown in FIG. NWhen the recessed portion P is a cylinder or an elliptical cylinder, the dimension D1 across the opening is a diameter, which can be any of the dimensions (e.g., diameter, length, etc.) described herein for the recessed shape. N If the narrow portion P is a cube or a rectangular parallelepiped, the dimension D1 across the opening is the width or height of the cube or rectangular parallelepiped, which may be equivalent to any of the dimensions described herein for the recess shape. N The depth of the narrow part P N depends on the thickness of the layer 18 to be formed.

[0074] In the example shown in FIG. 4B and FIG. 6, the narrow portion P N The wide portion P of the recess 16' W The narrow portion P opens into the shape of a cylinder, an elliptical cylinder, a cube, or a rectangular parallelepiped. N Dimension D2 of the cylindrical, elliptical cylinder, cubic, or rectangular parallelepiped shape parallel to dimension D1 across the opening of the layer 18 is a wide portion P W The dimension D2 at any point along the shape of the cylinder, elliptical cylinder, cube, or rectangular parallelepiped can range from about 10 nm to about 10 μm.

[0075] In the exemplary configuration of FIG. 4B, layer 18 has a wide portion P W , which increases the bonding surface area and also creates a cavity for adhesive 28.

[0076] In the example shown in FIG. 4C, the narrow portion P N has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped, and the wide portion P W 4C also has a geometric shape selected from the group consisting of a sphere or a semi-cylinder. The overall shape of the recess 16' shown in Figure 4C resembles an inverted light bulb. An example of this type of recess 16' is shown in Figure 7, where the cylindrical narrow portion P N and the wide part of the semi-cylinder P W It has the following.

[0077] The narrow portion P in the example shown in FIG. N If is a circular cylinder or an elliptical cylinder, the dimension D1 across the opening is the diameter, which can be any of the dimensions described herein for the recess shape. N If the narrow portion P is a cube or a rectangular parallelepiped, the dimension D1 across the opening is the width or height of the cube or rectangular parallelepiped, which may be equivalent to any of the dimensions described herein for the recess shape. N The depth of the narrow part P N depends on the thickness of the layer 18 to be formed.

[0078] In the examples shown in FIGS. 4C and 7, the narrow portion P N The wide portion P of the recess 16' W The narrow portion P N The dimension D2 of the spherical or semi-cylindrical shape, which is parallel to the dimension D1 across the opening of the layer 18, is the width of the wide portion P moving from the layer 18 towards the base support 36. W The dimension D2 varies along the depth of the layer 18. In particular, the dimension D2 increases and then decreases as one moves from the layer 18 toward the base support 36. The dimension D2 at any point along the sphere or semi-cylinder shape can range from about 10 nm to about 10 μm. In this example, the sphere or semi-cylinder extends through the depth of the layer 38 such that the underlying base support 36 forms the bottom of the recess 16′.

[0079] In the exemplary shape of FIG. 4C, the curved walls defined in layer 38 increase the bonding surface area and also form cavities for adhesive 28.

[0080] In the example shown in FIG. 4D, the narrow portion P N has a conical shape and a wide portion P W The overall shape of the recess 16' shown in Figure 4D resembles a teardrop or raindrop.

[0081] The narrow portion P in FIG. NThe dimension D1 across the opening of the cylindrical recess 16, 16′ can be any of the diameters described herein for the cylindrical recess 16, 16′. N The dimension D1 across the opening is in the range of about 10 nm to about 10 μm. N The depth of the narrow part P N In this example, the thickness of the narrow portion P N The dimensions are from the opening to the wide part P W increases as you move to

[0082] In the example shown in FIG. 4D, the narrow portion P N The wide portion P of the recess 16' W The narrow portion P N The dimension D2 of the semi-cylindrical shape parallel to the dimension D1 across the opening of the layer 18 is the wide portion P W The dimension D2 varies along the depth of the recess 16'. In particular, the dimension D2 increases and then decreases as one moves from the layer 18 toward the base support 36. The dimension D2 at any point along the semi-cylinder shape can range from about 10 nm to about 10 μm. In this example, the semi-cylinder extends partially through the depth of the layer 38 such that the underlying base support 36 is not exposed. In other examples, the underlying base support 36 can form the bottom of the semi-cylinder-shaped portion of the recess 16'.

[0083] In the exemplary shape of FIG. 4D, the curved walls defined in layers 18 and 38 increase the bonding surface area and also create cavities for adhesive 28.

[0084] In the example shown in Figure 4E, recess 16' is defined in layer 18 positioned above base support 36. This shape may also be defined in a single layer substrate or the outermost passivation layer of a CMOS device. In this example, recess 16' has a re-entrant surface shape, wider than the surface entrance (opening), but with a distinct narrow portion P having a depth that extends through layer 18 such as that shown and described with reference to Figures 4A-4D. N Rather, it does not include the narrow portion P NThe wide part P W This shape resembles an underground onion.

[0085] The dimension D1 across the opening in Figure 4E can be any of the diameters described herein for the cylindrical recesses 16, 16'. W The dimension D2 of the sphere, parallel to the dimension D1 across the opening, is the depth P of the widened portion moving from the layer 18 towards the base support 36. W . In particular, dimension D2 increases and then decreases as one moves from the opening toward the base support 36. Dimension D2 at any point along the spherical shape can range from about 10 nm to about 10 μm. In this example, the sphere extends partially through the depth of layer 18 such that the underlying base support 36 (or other layer) is not exposed. In other examples, the underlying base support 36 can form the bottom of the spherical recess 16′.

[0086] In the exemplary shape of FIG. 4E, the curved walls defined in layer 18 increase the bonding surface area and also create cavities for adhesive 28.

[0087] 4A-4E and 5, 6, and 7, interstitial regions 26' in these examples are defined by the surface of layer 18 in which recesses 16' are at least partially defined. Interstitial regions 26' are therefore part of a continuous surface except where the openings to the respective recesses 16' are defined.

[0088] It should be understood that recesses 16' having any of the geometries shown in Figures 4A-4E may be positioned within bonding region 14 according to any of the layouts described herein for recesses 16, 16' described with reference to Figure 2A.

[0089] As described with reference to FIGS. 4A-4D, at least one additional layer 38 can underlie layer 18, defining at least a portion of recess 16′ within at least one additional layer 38. In some examples, two or more additional layers 38 can be included. In one particular example, two to ten additional layers can be included. Examples of recess 16′ that can be formed in a stack of layers 18, 38 are shown in FIGS. 4F and 4G. The example in FIG. 4F depicts a cross-section with a cone-like shape (having stepped sidewalls instead of smooth sidewalls), and the example in FIG. 4G depicts a cross-section with a cylinder-like shape (having two distinct diameters D1, D2 along the depth, as opposed to a single diameter along the depth).

[0090] In the example shown in FIG. 4F, the patterned substrate 10 includes a layer 18, multiple additional layers 38A-38D underlying the layer 18, and a base support 36 underlying the multiple additional layers 38A-38D. In this example, the etch rate of each of the layer 18 and the additional layers 38A-38D increases as one moves from the layer 18 toward the base support 36. Thus, the etch rates of the layers 18-38D are 18<38A<38B<38C<38D. In this example, the base support 36 is non-etchable and therefore serves as an etch stop after the layer 38D adjacent to the base support 36 is etched. Due to the different etch rates of the layers 18, 38A-38D, the slope of the recess wall can be adjusted by varying the etching conditions for each layer. In the example shown in FIG. 4F, the shape of the recess 16′ increases as one moves from the opening defined in the layer 18 toward the base support 36.

[0091] In the example shown in FIG. 4G, the patterned substrate 10 includes a layer 18, multiple additional layers 38A-38E underlying the layer 18, and a base support 36 underlying the multiple additional layers 38A-38E. In this example, the layer 18 has a first etch rate, and the etch rate of each of the additional layers 38A-38E alternates between a second etch rate and the first etch rate as one moves from the layer 18 toward the base support 36. In the example shown in FIG. 4G, the first etch rate is less than the second etch rate. Thus, the etch rates of layers 18-38E are 18=38B=38D<38A=38C=38E. In this example, the base support 36 is non-etchable and therefore serves as an etch stop after the layer 38E adjacent to the base support 36 has been etched. 4G, the shape of recess 16′ varies between a first dimension D1 and a second dimension D2 as one moves from the opening defined in layer 18 toward base support 36. The varying dimensions in this example increase the surface area for adhesive 28 to grip the sidewalls of recess 16′.

[0092] It should be understood that in instances where different layers 18, 38 having different etch rates are used in the active regions 12, 12′, the etch to form the recess 16 can be controlled so that the desired shape is formed throughout the layers 18, 38. For example, to create a cylindrical shape in layers 18-38D (as shown in FIG. 4F), the etch conditions for the layers having lower etch rates (e.g., 18, 38A, 38B) can include a longer etch time than the layers having higher etch rates (e.g., 38C, 38D).

[0093] In another example where the geometric shape of each of the first recesses 16 differs from the geometric shape of each of the second recesses 16', the geometric shape of each of the first recesses 16 is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-cylinder, a polygonal prism, and combinations thereof. The geometric shape of each of the second recesses 16' is selected from the group consisting of an inclined cylinder, an inclined elliptical cylinder, an inclined cube, an inclined rectangular parallelepiped, and an inclined polygonal prism, and each of the second recesses 16' has its central axis at a non-90-degree angle with respect to the plane of the bottom of the second recess 16'. In this example, the previously described cylinders, elliptical cylinders, cubes, rectangular parallelepipeds, and polygonal prisms (including their respective dimensions) may be used, except that they are inclined with respect to the plane in which they are formed. Furthermore, it should be understood that each of the exemplary shapes of the second recess 16' described with reference to Figures 4A-4D can be inclined so that the central axis is at a non-90 degree angle relative to the plane of the bottom of the second recess 16'.

[0094] An example cross section of a tapered cylindrical recess 16' in the bonding region 14 is shown in FIG.

[0095] In this example, the dimension D across the opening of each inclined cylindrical recess 16' can be any of the diameters described herein for the cylindrical recesses 16, 16'. Like the cylindrical recesses 16, 16', this dimension is constant along the depth of each inclined cylinder. However, unlike the cylindrical recesses 16, 16', the central axis is not at a 90° angle relative to the bottom of the recess 16'. As shown in FIG. 8, some of the recesses 16' in the bonding region 14 are inclined in a first direction, and some of the recesses 16' in the bonding region 14 are inclined in a second direction. As depicted, the recesses 16' inclined in the first direction have central axes A1 at angles θ1 ranging from about 35° to about 85°, and the recesses 16' inclined in the second direction have central axes A2 at angles θ2 ranging from about 95° to about 145°. In other examples, all of the inclined cylindrical recesses 16' in the bonding region 14 can be inclined in the same direction.

[0096] 8, the recess 16' is defined in, for example, a layer 18, 38 of a CMOS device. It should be understood that the tilted cylindrical shape may also be defined in a layer 18 positioned directly on the base support 36, or in a single layer substrate, or in a stack including multiple additional layers 38A, 38B, etc.

[0097] 9A-9C, yet another example of recesses 16′ in bonding region 14 may include features 44 suspended over recesses 16′ to provide additional surfaces for bonding of adhesive 28. In this example, patterned surface 10 further includes a plurality of features 44, each of which extends over a portion of a respective one of second recesses 16′ and is supported by second gap regions 26′ surrounding a respective one of second recesses 16′, with adhesive 28 wrapping around each feature 44 (as shown in FIGS. 9B and 9C).

[0098] As depicted in the top view of FIG. 9A , the bonding region 14 includes recesses 16′, which in this example are cylindrical or elliptical-cylindrical, and features 44 suspended over a portion of each recess 16′. A clearance region 26′ surrounding each recess 16′ provides support for the individual features 44. The shape of each feature 44 is such that it does not cover the recess opening or extend the entire depth of the recess 16′. Thus, each feature 44 only partially covers the recess opening (thus allowing adhesive 28 to enter the recess 16′) and only partially extends within the depth of the recess 16′ (thus allowing adhesive 28 to reach the bottom of each recess 16′ and wrap around the bottom of the feature 44). In the example shown, the features 44 are beams whose diameter is smaller than the diameter of the recess 16′ and which have rounded portions that extend partially within the depth of the recess 16′.

[0099] 9A-9C, the recess 16' is defined in a layer 18 positioned above a base support 36, and the feature 44 is supported by the layer 18. However, it should be understood that the feature 44 may be incorporated into a cylindrical or elliptical cylindrical recess 16' formed in the layer 18, 38 of a CMOS device, or formed in a single layer substrate.

[0100] In other examples, the features 44 are formed in the layers 18, 38. In these examples, the layers 18, 38 are continuous except where the second recesses 16' are formed.

[0101] It should be understood that in each example of patterned structure 10 including recesses 16' within bond regions 14, adhesive 28 fills recesses 16' and resides over gap regions 26' within bond regions 14.

[0102] Referring now to FIG. 2B, another example of an active area 12' and a coupling area 14' includes posts 34, 34'.

[0103] In some examples (as shown in FIG. 2B ), the geometric shape of each of the first posts 34 and each of the second posts 34′ is the same. In other words, in these examples, all of the posts 34, 34′ have the same shape. In these examples, the shape of the posts 34, 34′ is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a cone, a polygonal prism, and combinations thereof. A perspective view of a cylindrical post 34, 34′ is shown in FIG. 10A , and a perspective view of an elliptical cylindrical post 34, 34′ is shown in FIG. 10B . Other post 34, 34′ shapes are shown and described with reference to FIGS. 11-14B .

[0104] Each post 34, 34' is a three-dimensional structure that extends outward from the surface of layer 18 (or another layer, e.g., layer 38, or base support 36). Thus, post 34, 34' is a convex region relative to the interstitial region 26, 26' of layer 18 or 38 or base support 36 that surrounds post 34, 34', respectively.

[0105] The layout or pattern of the posts 34 in the active region 12' can be the same as or different from the layout or pattern of the posts 34' in the bonding region 14'. The respective layouts can be regular, repeating, or irregular patterns. In one example, the posts 34, 34' in the active region 12' and bonding region 14' are arranged in a hexagonal grid for close packing and improved density. Other layouts can include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern can be an xy format of the posts 34 or 34' in rows and columns, separated by gap regions 26 or 26'. The posts 34 or 34' can be arranged in other patterns, such as stripes, spirals, lines, triangles, rectangles, circles, arcs, checks, diagonals, arrows, and / or squares.

[0106] The layout or pattern of the posts 34 or 34' may be characterized in terms of the density (e.g., number of posts 34, 34') of the posts 34, 34', respectively, within the active area 12' and the bonding area 14'. For example, the posts 34 and / or 34' may be spaced apart from each other by 1 mm 2 They may be present at a density of about 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2The density of the posts 34 or 34' may be adjusted to different densities, including densities of about 50 million per 1000,000, or more or less. It should be further understood that the density of the posts 34 or 34' may be between one of the lower limit values ​​and one of the upper limit values ​​selected from the ranges above. By way of example, a high-density array may be characterized as having posts 34 or 34' separated by less than about 100 nm, a medium-density array may be characterized as having posts 34 or 34' separated by about 400 nm to about 1 μm, and a low-density array may be characterized as having posts 34 or 34' separated by more than about 1 μm. While several density examples are provided, it should be understood that any suitable density may be used. In some cases, it may be desirable for the spacing between the posts 34 or 34' to be even greater than the examples listed herein.

[0107] The layout or pattern of the posts 34 or 34' may also, or alternatively, be characterized in terms of average pitch, or the spacing from the center of one post 34 or 34' to the center of an adjacent post 34 or 34' (center-to-center spacing), or the spacing from the left edge of one post 34 or 34' to the right edge of an adjacent post 34 or 34' (edge-to-edge spacing). The pattern may be regular, such that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or more or less. The average pitch for a particular pattern of posts 34 or 34' may be between one of the lower and upper limits selected from the ranges above. While example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may also be used.

[0108] The size of each post 34 or 34' may be characterized by its top surface area, height, and / or diameter (if the shape is circular or oval) or length and width. The top surface of post 34 or 34' may be approximately 1×10 -3 μm 2 ~about 100μm 2, for example, about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2 The height of post 34 or 34' may be in the range of about 0.1 μm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or each of the length and width of post 34 or 34' may be in the range of about 10 nm to about 100 μm, e.g., about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0109] In other examples, the geometric shape of each of the first posts 34 is different from the geometric shape of each of the second posts 34'. In other words, in these other examples, all of the posts 34 in the active region 12' have one type of shape, and all of the posts 34' in the coupling region 14' have a different type of shape. In these examples, the shapes of the posts 34 in the active region 12' are selected from the group consisting of cylinders, elliptical cylinders, cubes, rectangular parallelepipeds, cones, and polygonal prisms, and the geometric shapes of the posts 34' in the coupling region 14' are different shapes selected from the same group.

[0110] In one example, the geometric shape of each of the first posts 34 is cylindrical and the geometric shape of each of the second posts 34' is elliptical cylindrical. In another example, the geometric shape of each of the first posts 34 is elliptical cylindrical and the geometric shape of each of the second posts 34' is cylindrical. Any of these geometric layouts, dimensions, and / or other characteristics may be used.

[0111] Other examples of suitable shapes for the posts 34' in the bonding region 14' are shown in Figures 11 and 12. In these examples, the geometric shape of each of the second posts 34' is such that the widened portion P W2 Narrow portion P extending to N2 For each of these second post 34' geometric shapes, a narrow portion P N2 The dimension D3 across the base of theW2 At least one dimension of the axial length is smaller than D4.

[0112] 11 and 12, it should be understood that adhesive 28 overlies gap region 26', fills the space surrounding post 34', and extends over post 34' (similar to adhesive 28 shown in FIG. 2B). W2 increases the surface area of ​​the patterned substrate 10' within the bonding region 14' available for bonding.

[0113] In the example shown in FIGS. 11 and 12, the narrow portion P N2 has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, and a cone, and the wide portion P W2 has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped.

[0114] In each of these examples, the patterned substrate 10′ includes a layer 18, at least one additional layer 38 underlying the layer 18, and a base support 36 underlying the at least one additional layer 38, and for each geometric shape of the second posts 34′, a wide portion P W2 is defined in the layer 18, and the narrow portion P N2 is defined in at least one additional layer 38. The two (or more) layers 18, 38 may be supported by a base support 36. These additional layers 38 may be any of the materials described herein for layer 18 or may be any of the passivation layers described herein.

[0115] In the example shown in FIG. W2 has a cylindrical shape, and the narrow part P N2 has a conical shape. W2 The dimension D4 of the cylinder defining the narrow portion P can be any of the diameters described herein for the cylindrical or elliptical cylindrical recess 16, 16'. N2 The maximum dimension of the wide part P W2, and the dimension of the cone decreases along the height of the post 34' moving from the layer 18 toward the base support 36. Thus, the smallest dimension D3 of the post 34' is at the base of the cone shape and is less than dimension D4. The height of the post 34' shown in FIG. 11 can be any of the dimensions described herein for the depth of the recesses 16, 16'.

[0116] In the example shown in FIG. W2 and narrow part P N2 Both have a rectangular parallelepiped shape, but the wide portion P W2 may alternatively be a cube or an elliptical cylinder, and the narrow portion P N2 may alternatively be a cylinder, an elliptical cylinder, or a cube. W2 The dimension D4 of the rectangular parallelepiped (or other shape) defining the narrow portion P can be any of the dimensions described herein for the recess shape. N2 Dimension D3 of the rectangular parallelepiped (or other shape) defining the recess 16, 16′ is less than dimension D4. The height of the post 34′ shown in FIG. 12 can be any of the dimensions described herein for the depth of the recess 16, 16′.

[0117] In another example where the geometric shape of each of the first posts 34 differs from the geometric shape of each of the second posts 34', the geometric shape of each of the first posts 34 is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-circular cylinder, a polygonal prism, and combinations thereof. The geometric shape of each of the second posts 34' is selected from the group consisting of an angled cylinder, an angled elliptical cylinder, an angled cube, an angled rectangular parallelepiped, and an angled polygonal prism, and each of the second posts 34' has its central axis at a non-90 degree angle relative to the plane of the base of the second post 34'. A perspective view of an angled cylindrical post 34' is shown in FIG. 13.

[0118] In this example, the dimension D across the top surface of the angled cylindrical post 34' can be any of the diameters described herein for the cylindrical recesses 16, 16'. Like the cylindrical recesses 16, 16', this dimension is constant along the height of each angled cylindrical post 34'. However, unlike the cylindrical recesses 16, 16', the central axis A of the post 34' is not at a 90° angle relative to the plane in which the post 34' is formed. In one example, the central axis A is at an angle θ ranging from about 35° to about 85° or from about 95° to about 145° relative to the plane in which the post 34' is formed.

[0119] If the bonding region 14' includes multiple inclined cylindrical posts 34' (or other inclined shapes), the posts 34' may be inclined in the same direction, or some of the posts 34' may be inclined in a first direction while other parts of the posts 34' may be inclined in a second direction (similar to the inclined cylindrical recesses shown in FIG. 8).

[0120] 13, the posts 34' are defined in a layer 18 positioned above the base support 36. Alternatively, the posts 34' may be formed in a stack of layers 18, 38, such as that of a CMOS device, or in a single layer substrate.

[0121] As described with reference to FIGS. 11 and 12, at least one additional layer 38 may underlie layer 18, with at least a portion of post 34' defined within at least one additional layer 38. In some examples, two or more additional layers 38 may be included. In one specific example, two to ten additional layers may be included. Examples of posts 34' that may be formed in a stack of layers 18, 38 are shown in FIGS. 14A and 14B. The example in FIG. 14A depicts a cross-section with a cone-like shape (an inverted cone with stepped sidewalls instead of smooth sidewalls), while the example in FIG. 14B depicts a cross-section with a cylinder-like shape (having two different diameters along the depth, as opposed to a single diameter along the depth).

[0122] In the example shown in FIG. 14A , the patterned substrate 10′ includes a layer 18, multiple additional layers 38A-38C below the layer 18, and a base support 36 below the multiple additional layers 38A-38C. In this example, the etch rate of each of the layer 18 and the additional layers 38A-38C increases as one moves from the layer 18 toward the base support 36. Therefore, the etch rates of the layers 18-38C are 18<38A<38B<38C. In this example, the base support 36 is non-etchable and therefore serves as an etch stop after the layer 38C adjacent to the base support 36 is etched. Because the etch rates of the layers 18, 38A-38C are different, the slope of the post walls can be adjusted by varying the etching conditions for each layer. In the example shown in FIG. 14A , the shape of the post 34′ decreases as one moves from the layer 18 toward the base support 36.

[0123] In the example shown in FIG. 14B , the patterned substrate 10′ includes a layer 18, multiple additional layers 38A-38C underlying the layer 18, and a base support 36 underlying the multiple additional layers 38A-38C. In this example, the layer 18 has a first etch rate, and the etch rate of each of the additional layers 38A-38C alternates between a second etch rate and the first etch rate as one moves from the layer 18 toward the base support 36. In the example shown in FIG. 14B , the first etch rate is less than the second etch rate. Thus, the etch rates of layers 18-38C are 18=38B<38A=38C. In this example, the base support 36 is non-etchable and therefore acts as an etch stop after the layer 38C adjacent to the base support 36 has been etched. In the example shown in FIG. 14B, the shape of 34' varies between a first dimension D1 and a second dimension D2 as one moves from layer 18 towards base support 36.

[0124] Although a single post 34' is shown in each of Figures 11, 12, and 13 and two posts 34' are shown in Figures 14A and 14B, it should be understood that an array of posts 34' can be formed in the bonding region 14'. In the exemplary shapes of Figures 11-13, the angled walls or overhangs 42 formed by the posts 34' increase the bonding surface area for the adhesive 28. In the exemplary shapes of Figures 14A and 14B, the varying dimensions increase the surface area for the adhesive 28 to grip the sidewalls of the posts 34'.

[0125] In any of the examples disclosed herein that include one or more additional layers 38 between layer 18 and base support 36, the recesses 16 or posts 34 in the active area 12, 12' may be defined in only the outermost layer 18, or in the outermost layer 18 and any number of additional layers 38, depending on the desired depth of the recesses 16 or the desired height of the posts 34.

[0126] 2A-2D, each example flow cell 20A, 20B, 20C, 20D includes a surface chemistry within recesses 16 in active areas 12, 12′ or on posts 34. The surface chemistry includes a polymer hydrogel 22 and primers 24A, 24B.

[0127] Polymer hydrogel 22 can be any gel material that can swell when liquid is introduced and shrink when the liquid is removed, for example, by drying. In one example, polymer hydrogel 22 comprises an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0128] [ka] During the ceremony, R Ais selected from the group consisting of azide, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; R B is H or optionally substituted alkyl, R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted; p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0129] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM).

[0130] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative and that the monomer subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0131] The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 1000 kDa, or in a specific example, can be about 312 kDa.

[0132] In some instances, the acrylamide copolymer is a linear polymer. In other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0133] In another example, the gel material can be a variation of structure (I). In one example, the acrylamide units are N,N-dimethylacrylamide.

[0134] [ka] In this example, the acrylamide unit in structure (I) can be replaced by

[0135] [ka] (In the formula, R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H may each be replaced with a C1-C6 alkyl (instead of H, as in acrylamide). In this example, q may be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide may be used. In this example, structure (I) has, in addition to the repeating "n" and "m" features,

[0136] [ka] where R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0137] As another example of polymer hydrogel 22, the "n" repeating features in structure (I) may be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0138] [ka] In the formula, R1 is H or C1-C6 alkyl, and R 2 is H or C1-C6 alkyl; L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide with H or C1-C4 alkyl attached to the N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0139] As yet another example, the gel material may include repeat units of each of structures (III) and (IV):

[0140] [ka] R 1a , R 2a , R 1b , and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b are each independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; L 1 and L 2 are each independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0141] In yet another example, the acrylamide copolymer is formed using nitroxide-mediated polymerization, and therefore, at least a portion of the copolymer chain has an alkoxyamine end group. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, where each of R1 and R2 can be the same or different and can independently be a linear or branched alkyl, or a ring structure, and the oxygen atom is attached to the remainder of the copolymer chain. In some examples, the alkoxyamine also is attached to some of the repeating acrylamide monomers, such as R1 in structure (I). A Thus, in one example, structure (I) includes an alkoxyamine end group, and in another example, structure (I) includes an alkoxyamine end group and an alkoxyamine group on at least some of the side chains.

[0142] It should be understood that other molecules can be used to form the polymer hydrogel 22, so long as they can be functionalized with the desired chemicals (e.g., a single primer set). Some examples of materials suitable for the polymer hydrogel 22 include functionalized silanes, such as norbornene silane, azido silane, alkyne-functionalized silane, amine-functionalized silane, maleimide silane, or any other silane with functional groups to which the desired chemicals can be attached. Further examples of materials suitable for the polymer hydrogel 22 include those with colloidal structures, such as agarose, or polymer mesh structures, such as gelatin, or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or azide-decomposed versions of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or vinyl-containing acrylic acid, or from monomers that form a [2+2] photocycloaddition reaction. Still other examples of materials suitable for the polymer hydrogel 22 include mixed copolymers of acrylamide and acrylate. Examples disclosed herein may utilize a variety of polymeric architectures that include acrylic monomers (e.g., acrylamide, acrylates, etc.), such as dendrimers (e.g., multi-arm or star polymers), branched polymers, including star or star-block polymers, etc. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) may be incorporated into the branches (arms) of the dendrimer, either randomly or in blocks.

[0143] The gel material for polymer hydrogel 22 can be formed using any suitable copolymerization process, such as nitroxide mediated polymerization (NMP), reversible addition-fragmentation chain-transfer (RAFT) polymerization, etc.

[0144] Attachment of the polymer hydrogel 22 to the primer layer 18 can be by covalent bonding. In some instances, the primer layer 18 can be first activated, for example, by silanization or plasma ashing. Covalent bonding is useful for maintaining the primer in the desired area throughout the life of the flow cell during various uses.

[0145] Primers 24A and 24B constitute a primer set used in sequential paired-end sequencing, in which each forward strand generated is sequenced and removed, and then each reverse strand generated, sequenced, and removed.

[0146] As examples, the primer set may include P5 and P7 primers, P15 and P7 primers, or any combination of PA, PB, PC, and PD primers described herein. As exemplary combinations, the primer set may include any two PA, PB, PC, or PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer.

[0147] Exemplary P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina Inc., for example, for sequencing on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms. The P5 primer is as follows: P5: 5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1) The P7 primer can be either: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 2) P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 3) P7#3:5'→3' CAAGCAGAAGACGGCATACnAnAT (SEQ ID NO: 4) where "n" is 8-oxoguanine in each of these sequences. The P15 primer is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 5) where "n" is allyl-T (a thymine nucleotide analogue with an allyl functionality). Other primers (PA-PD) mentioned above include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 6) cPA(PA') 5'→3'CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC (SEQ ID NO: 7) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 8) cPB(PB')5'→3'AGTTCATATCCACCGAAGCGCCATGGCAGACGACG (SEQ ID NO: 9) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 10) cPC(PC')5'→3' AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT (SEQ ID NO: 11) PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 12) cPD(PD')5'→3' GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC (SEQ ID NO: 13).

[0148] Although not shown in the exemplary sequences of PA through PD, it should be understood that any of these primers may contain a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc., at any point in the strand, so long as the cleavage sites of primers 24A and 24B are orthogonal (i.e., the cleavage chemistry of primer 24A is different from the cleavage chemistry of primer 24B, and therefore the two primers 24A, 24B are sensitive to different cleavage agents).

[0149] Each of primers 24A and 24B disclosed herein may also include a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region includes 2 to 20 T bases. As specific examples, the poly-T region may include 3, 4, 5, 6, 7, or 10 T bases.

[0150] The 5'-ends of primers 24A, 24B vary depending on the chemistry of polymer hydrogel 22. As two examples, the 5'-end functional group can be a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). The terminal alkyne can attach to an azide group on polymer hydrogel 22. In another example, primers 24A, 24B can include an alkene at the 5'-end that can react with a reactive thiol group on polymer hydrogel 22. In yet other specific examples, succinimidyl (NHS) ester-terminated primers can be reacted with amine groups on polymer hydrogel 22, aldehyde-terminated primers can be reacted with hydrazine groups on polymer hydrogel 22, azide-terminated primers can be reacted with alkynes or DBCO (dibenzocyclooctyne) on polymer hydrogel 22, or amino-terminated primers can be reacted with activated carboxylate groups on polymer hydrogel 22.

[0151] Each example flow cell 20A, 20B, 20C, 20D also includes an adhesive 28 within the bonding region 14, 14'. Examples of suitable adhesives 28 include pressure sensitive adhesives and reactive curing adhesives.

[0152] Examples of pressure-sensitive adhesives include the following amorphous polymer chemicals: natural rubber (polyisoprene), styrene block copolymers (such as styrene-isoprene block copolymer (SIS) or styrene-butadiene-styrene block copolymer (SBS)), styrene-butadiene random copolymers, polybutadiene, polyisobutylene, acrylics, silicones, polyvinyl ethers, or thermoplastic elastomers. These formulations may contain tackifiers, plasticizers, or crosslinking additives to impart stereoregularity to the adhesive. The amorphous polymer film in the pressure-sensitive adhesive may be unsupported (often referred to as a "transfer tape") or may be supported by a carrier film such as polyester, polyurethane, polyethylene, polypropylene, nonwoven fibers, or metal foil. If a carrier film is used, the pressure-sensitive adhesive may be coated on one side of the carrier film (single-coated) or on both sides of the carrier film (double-coated).

[0153] Reactive curing adhesives can be in two categories: one-component or two-component formulations. One-component formulations can be composed of the following chemistries: epoxy, phenolic, polyurethane, polyimide, or polyvinyl-phenolic copolymer. The reaction within a one-component adhesive formulation can be triggered by the following mechanisms: moisture, heat, or ultraviolet light. Dimethacrylate adhesives are another type of one-component adhesive that can be used. This particular example cures on reactive metal surfaces in the absence of air. Two-component adhesive formulations crosslink and cure during mixing of two functionalized monomers and can be of the following chemistries: epoxy, phenolic, polyurethane, polyimide, polyvinylphenol, or acrylic.

[0154] In some examples, adhesive 28 can be selected so that its surface energy matches the surface energy of the surface to which it is bonded (e.g., layers 18, 38, 36). To achieve a desired surface energy, materials can be selected to match, or one or both of adhesive 28 and layers 18, 38 and / or base support 36 can be modified, for example, via a surface treatment, a surface coating, or by the addition of an additive. Examples of suitable surface treatments include reactive plasma ashing, corona discharge plasma, solvent cleaning, or anodizing.

[0155] In bonding region 14, adhesive 28 fills recesses 16' and covers gap regions 26'. The sidewalls of recesses 16' increase the bonding surface area in region 14. In bonding region 14', adhesive 28 fills the space adjacent to gap regions 26' surrounding posts 34' and extends over posts 34'. The sidewalls of posts 34' increase the bonding surface area in region 14'.

[0156] Each of flow cells 20A, 20B, 20C, and 20D also includes a cover 30 attached to patterned substrate 10 via adhesive 28. Flow cells 20A, 20B in FIGS. 2A and 2B illustrate a lid 46 as cover 30. Flow cell 20C in FIG. 2C illustrates a partially patterned substrate 48 as cover 30. Flow cell 20D in FIG. 2D illustrates another patterned substrate 10'' as cover 30.

[0157] As mentioned, the lid 46 is the cover 30 of the flow cells 20A, 20B shown in FIGS. 2A and 2B. The lid 46 can be any material transparent to the excitation light directed toward the active regions 12, 12′. In some optical detection systems, the lid 46 can also be transparent to the luminescence generated from the reactions occurring in the active regions 12, 12′. By way of example, the lid 46 can comprise glass (e.g., borosilicate, fused silica, etc.) or a transparent polymer. A commercially available example of a suitable borosilicate glass is D 263®, available from Schott North America, Inc. A commercially available example of a suitable plastic material, i.e., a cycloolefin polymer, is the ZEONOR® product, available from Zeon Chemicals LP.

[0158] The lid 46 is physically connected to the patterned substrate 10 via adhesive 28 at the bonding regions 14, 14′. In one example, the lid 46 can be a block of material having the same length and width as the patterned substrate 10. The lid 46 can have a flat outer surface and a recess 51 defined in the inner surface (i.e., the surface that is adhered to the patterned substrate 10). The recess 51 can be etched or otherwise defined in the transparent block and can have dimensions corresponding to the dimensions of the active areas 12, 12′. Thus, when the lid 46 is attached to the patterned substrate 10, the recesses 51 are aligned with the active areas 12, 12′, respectively, and partially define the flow channels 32, respectively.

[0159] Although not shown, the lid 46 may include respective inlet and outlet ports configured to fluidly engage other ports (not shown) to direct fluid into each flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of each flow channel 32 (e.g., to a waste removal system).

[0160] 2C, the partially patterned substrate 48 is the cover 30 of the flow cell 20C. The partially patterned substrate 48 can be any material that is transparent to the excitation light directed toward the active regions 12, 12′. In some optical detection systems, the partially patterned substrate 48 can also be transparent to the luminescence generated from reactions occurring in the active regions 12, 12′. Any example of the lid 46 or base support 36 can be used for the partially patterned substrate 48, so long as the material exhibits the desired transparency.

[0161] The partially patterned substrate 48 is physically connected to the patterned substrate 10 via the adhesive 28 at the bonding regions 14, 14′. In one example, the partially patterned substrate 48 can be a block of material having the same length and width as the patterned substrate 10. The partially patterned substrate 48 can have flat outer and inner surfaces and recesses 16″ defined in the inner surfaces in areas that align with the bonding regions 14, 14′. These recesses 16″ can have any of the geometries disclosed herein for the recesses 16′, thus increasing adhesion between the substrates 10 and 48. In the example shown in FIG. 2C , the adhesive 28 defines the sidewalls of the flow channels 32 defined between the respective active regions 12, 12′ and the partially patterned substrate 48.

[0162] In another example (not shown), the partially patterned substrate 48 may also include recesses 51 defined in its interior surface, similar to those described with reference to Figures 2A and 2B. These recesses 51 align with the active areas 12, 12' of the patterned substrate 10 to partially define the flow channels 32.

[0163] Although not shown in FIG. 2C, the partially patterned substrate 48 may include respective inlet and outlet ports configured to fluidly engage other ports (not shown) to direct fluid into each flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of each flow channel 32 (e.g., to a waste removal system).

[0164] 2D, another patterned substrate 10'' is used as a cover 30 for flow cell 20D. The patterned structure 10'' can be any example of patterned substrate 10 or patterned substrate 10', where recesses 16, 16' or posts 34, 34' define active areas 12 and bonding areas 14 or 12', 14'. The two patterned substrates 10 or 10' and 10'' are aligned such that the bonding areas 14, 14' are adhered to one another via adhesive 28 and the active areas 12, 12' are aligned.

[0165] Although not shown in FIG. 2D, the patterned substrate 10 or 10'' may include respective inlet and outlet ports configured to fluidly engage other ports (not shown) to direct fluid into each flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of each flow channel 32 (e.g., to a waste removal system).

[0166] As will be mentioned, some examples of flow cells 20A, 20B, 20C, 20D are integrated with an electronic detection device such as a complementary metal oxide semiconductor chip 50, an example of which is shown in FIG.

[0167] In the illustrated example, the patterned substrate 10 is directly attached to the complementary metal oxide semiconductor chip 50 via one or more fastening mechanisms (e.g., adhesives, bonds, fasteners, etc.) and may therefore be in physical contact with the complementary metal oxide semiconductor chip 50. It should be understood that the patterned substrate 10 may be removably coupled to the complementary metal oxide semiconductor (CMOS) chip 50.

[0168] The CMOS chip 50 includes multiple stacked layers 52 including, for example, silicon layers, dielectric layers, metal-dielectric layers, metal layers, etc. The stacked layers 52 form the device circuitry, including the detection circuitry.

[0169] The CMOS chip 50 includes optical components, such as optical sensors 54 and optical waveguides 56. The optical components are arranged such that each optical sensor 54 is at least substantially aligned with, and therefore operatively associated with, a single optical waveguide 56 and a single reaction site (i.e., a recess 16 having a surface chemistry therein or a post 34 having a surface chemistry thereon) of the patterned substrate 10, 10′. However, in other examples, a single optical sensor 54 may receive photons through two or more optical waveguides 56 and / or from two or more reaction sites. In these other examples, a single optical sensor 54 is operatively associated with two or more optical waveguides 56 and / or two or more reaction sites.

[0170] As used herein, a single optical sensor 54 may be an optical sensor that includes one pixel or more than one pixel. By way of example, each optical sensor 54 may have a resolution of approximately 50 μm 2 As another example, the detection area may be less than about 10 μm 2 As yet another example, the detection area may be less than about 2 μm 2In the latter example, the optical sensor 54 may comprise a single pixel. The average read noise of each pixel of the optical sensor 54 may be, for example, less than about 150 electrons. In other examples, the read noise may be less than about 5 electrons. The resolution of the optical sensor 54 may be greater than about 0.5 megapixels (Mpixels). In other examples, the resolution may be greater than about 5 Mpixels or greater than about 10 Mpixels.

[0171] Also, as used herein, a single optical waveguide 56 may be a light guide including a cured filter material that i) filters excitation light 58 (propagating from outside the flow cell into the flow channel 32) and ii) allows optical emission (resulting from a reaction at a reaction site, not shown) to propagate therethrough toward a corresponding optical sensor 54. In one example, the optical waveguide 56 may be, for example, an organic absorption filter. As a specific example, the organic absorption filter may filter excitation light 58 at a wavelength of approximately 532 nm and allow emission at wavelengths of approximately 570 nm or greater. The optical waveguide 56 may be formed by first forming a guide cavity in the dielectric layer 60 and then filling the guide cavity with a suitable filter material.

[0172] The light guide 56 can be configured with respect to the dielectric material 60 to form a light guiding structure. For example, the light guide 56 can have a refractive index of about 2.0 such that the emitted light is substantially reflected at the interface between the light guide 56 and the surrounding dielectric material 60. In a particular example, the light guide 56 is selected so that the optical density (OD) or absorbance of the excitation light 58 is at least about 4 OD. More specifically, the filter material can be selected, and the light guide 56 can be dimensioned, to achieve at least 4 OD. In other examples, the light guide 56 can be configured to achieve at least about 5 OD or at least about 6 OD.

[0173] In this example, layers 18, 38 (not shown in FIG. 15 ) of patterned substrate 10 may be passivation layers. The layers may or may not be supported by base support 36, which should be transparent to the excitation and emission light used during analysis. At least a portion of patterned substrate 10 (and thus one of passivation layers 18, 38 or base support 36) contacts first buried metal layer 62 of CMOS chip 50 and also contacts input region 64 of optical waveguide 56. Contact between substrate 10 and first buried metal layer 62 may be direct contact or indirect contact via shielding layer 66.

[0174] The passivation layer 18, 38 of the patterned substrate 10 may provide a level of corrosion protection for the buried metal layer 62 of the CMOS chip 50 that is closest to the patterned substrate 10. In this example, the passivation layer may be formed from a material that is transparent to the emitted light (e.g., visible light) resulting from the reaction at the reaction site, and that is at least initially resistant to the fluid environment and moisture that may be introduced into or present within the flow channel 32.

[0175] An example of flow cell 20C is shown in Figure 15 and thus includes a partially patterned substrate 48 as cover 30, as described with reference to Figure 2C. In Figure 15, a single active area 12 and two binding areas 14 are depicted, and thus flow cell 20C includes a single flow channel 12. In this example, partially patterned substrate 48 includes inlet and outlet ports 70, 72 configured to fluidly engage other ports (not shown) for directing fluid into flow channel 32 (e.g., from a reagent cartridge or other fluid storage system component) and out of flow channel 32 (e.g., to a waste removal system).

[0176] Each reaction site is a localized area within the patterned substrate 10 where a designated reaction can occur. Each reaction site includes a recess 16 having a polymer hydrogel 22 and primers 24A, 24B therein.

[0177] In one example, a reaction site is at least substantially aligned with the input region 64 of a single optical waveguide 56. Thus, optical emission at the reaction site can be directed into the input region 64, through the waveguide 56, and to an associated optical sensor 54. In another example, one reaction site can be aligned with several input regions 64 of several optical waveguides 56. In yet another example, several reaction sites can be aligned with one input region 64 of one optical waveguide 56.

[0178] The buried metal layer 62 can be any suitable CMOS metal, such as aluminum (Al), aluminum chloride (AlCu), tungsten (W), nickel (Ni), or copper (Cu). The buried metal layer 62 is a functional part of the CMOS AVdd line and is also electrically connected to the optical sensor 54 through the stack 52. Thus, the buried metal layer 62 participates in the detection / sensing operation.

[0179] It should be understood that the other optical sensors 54 and associated components may be configured in the same or similar manner. However, it should be understood that the CMOS chip 50 may not be manufactured identically or uniformly throughout. Instead, one or more optical sensors 54 and / or associated components may be manufactured differently or have different relationships to one another.

[0180] The stack 52 may include interconnected conductive elements (e.g., conductors, traces, vias, interconnects, etc.) capable of conducting electrical current. The circuitry may be configured to selectively transmit a data signal based on the detected photons. The circuitry may also be configured for signal amplification, digitization, storage, and / or processing. The circuitry may collect and analyze the detected luminescence and generate a data signal for communicating the detection data to a bioassay system. The circuitry may also perform additional analog and / or digital signal processing in the CMOS chip 50.

[0181] CMOS chip 50 may be fabricated using an integrated circuit fabrication process. CMOS chip 50 may include multiple layers, such as a sensor base / layer (e.g., a silicon layer or wafer, or a dielectric layer 60). The sensor base may include an optical sensor 54. Once CMOS chip 50 is fully formed, optical sensor 54 may be electrically coupled to the rest of the circuitry in stack 52 via gates, transistors, etc.

[0182] 15, the term "layer" is not limited to a single contiguous body of material unless otherwise specified. For example, a sensor base / layer may include multiple sublayers that are different materials and / or may include coatings, adhesives, etc. Additionally, one or more of the layers (or sublayers) may be modified (e.g., etched, deposited with material, etc.) to provide the features described herein.

[0183] The stack 52 also includes a plurality of metal-dielectric layers, each of which includes a metal element (e.g., M1-M5, which may be, for example, W (tungsten), Cu (copper), Al (aluminum), or any other suitable CMOS conductive material) and a dielectric material 60 (e.g., SiO2). A variety of metal elements M1-M5 and dielectric materials 60 may be used, such as those suitable for integrated circuit fabrication.

[0184] In the example shown in FIG. 15, each of the multiple metal-dielectric layers L1-L6 includes both metal elements M1, M2, M3, M4, and M5 and a dielectric material 60. In each of layers L1-L6, the metal elements M1, M2, M3, M4, and M5 are interconnected and embedded within the dielectric material 60. Additional metal elements may be included in some of the metal-dielectric layers L1-L6. Some of these additional metal elements may be used to address individual pixels via row and column selectors. The voltages on these elements may vary and switch between approximately −1.4 V and approximately 4.4 V depending on which pixel the device is reading.

[0185] It should be understood that the configuration of metal elements M1, M2, M3, M4, M5 and dielectric layer 60 in FIG. 15 is illustrative of the circuit, and other examples may include fewer or additional layers and / or have different configurations of metal elements M1-M5.

[0186] 15, the shield layer 66 is in contact with at least a portion of the patterned structure 10. The shield layer 66 has an opening at least partially adjacent to the input region 64 of the optical waveguide 56. This opening allows the reaction site (and at least a portion of the optical radiation therefrom) to be optically coupled to the waveguide 56. It should be understood that the shield layer 66 may have an opening at least partially adjacent to the input region 64 of each optical waveguide 56. The shield layer 66 may extend continuously between adjacent openings.

[0187] The shielding layer 66 may include any material capable of blocking, reflecting, and / or significantly attenuating the optical signal propagating through the flow channel 32. The optical signal may be excitation light 58 and / or emission from the reaction site. By way of example, the shielding layer 66 may be tungsten (W).

[0188] method The method used to form flow cells 20A, 20B, 20C and 20D depends, at least in part, on the structure of active and binding regions 12, 12', 14, 14'.

[0189] One example of the method includes forming a patterned substrate 10 by defining first recesses 16 at first predetermined locations within a predetermined region of the layer 18 surrounded by a second predetermined region of the layer 18, thereby defining active regions 12 within the layer 18, and introducing a surface chemical into each of the first recesses 16; and defining bonding regions 14 within the layer by defining second recesses 16' at second predetermined locations within the second predetermined region of the layer 18; introducing an adhesive 28 into the bonding regions 14, including each of the second recesses 16'; and positioning a cover 30 in contact with the adhesive 28, thereby securing the cover 30 to the bonding regions 14 and forming flow channels 32 between a portion of the cover 30 and the active regions 12.

[0190] If the recesses 16, 16' have the same shape, they can be formed at the same time using the same process.

[0191] Embossing or etching can be used to create identical recesses 16, 16' in the single layer substrate. When layer 18 is an etchable single layer substrate, defining first and second recesses 16, 16' having the same shape includes etching through a portion of the etchable single layer substrate at first predetermined locations and second predetermined locations.

[0192] Several different techniques can be used to create identical recesses 16, 16′ in layers 18 of a multilayer substrate. In one example, an inorganic oxide can be selectively applied to the base support 36 in a desired pattern of interstitial regions 26, 26′ and recesses 16, 16′ contours via, for example, vapor deposition, aerosol printing, or inkjet printing. In another example, a resin matrix material can be applied to the base support 36 and then patterned to form the recesses 16, 16′. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, puddle dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, and the like.

[0193] Etching techniques can be used to create identical recesses 16, 16' in multiple layers 18, 38 of a multilayer substrate. If different layers have different etch rates, the etchant, etch time, or other etching conditions can be varied to achieve the desired shape. In some cases, a photolithography mask or metal sacrificial layer can be used to protect areas from being etched and then subsequently removed in a suitable remover. Dry etching processes such as anisotropic oxygen plasma, CF4 plasma, or a mixture of 90% CF4 and 10% O2 plasma can be used to etch the resin layers 18, 38.

[0194] When the recesses 16, 16' have different shapes, they can be formed successively using different processes. Because the recess 16 is cylindrical or elliptical cylindrical, it can be formed using any of the techniques disclosed herein, including photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, or printing techniques. The tilted cylindrical recess 16' shown in FIG. 8 can also be formed using any of these techniques.

[0195] The recess 16' shown in FIGS. 4A-4D has a narrow portion P N and a wide portion P W These processes begin with a stack of layers, with a first layer 18 positioned on top of at least one additional layer 38 positioned on top of a base support 36. In these examples, the layer 18 and the at least one additional layer 38 have different etch rates, and the base support 36 is non-etchable. The second recess 16' is formed at a second predetermined location by etching through the layer 18 and then sequentially etching through the at least one additional layer 38. An anisotropic etch may be used to etch through the layer 18, and then an isotropic etch may be used to etch through the layer 38. In this example, the first recess 16 can be formed by etching through the layer 18 or by etching through the layer 18 and then sequentially etching through the at least one additional layer 38 at the first predetermined location. An anisotropic etch may be used for the recess 16 through the layers 18, 38.

[0196] The recess 16' shown in Figure 4E can be formed by the method shown in Figure 18. In this example, the second predetermined region of layer 18 (where bonding region 14 will be formed) includes etchable particles 80 mixed into layer 18, and defining the second recess 16' includes etching the etchable particles 80 from layer 18. The etchable particles 80 can be any material that has an etch rate higher than the etch rate of layer 18. Thus, the etchable particles 80 can be exposed to an etchant and removed while layer 18 remains intact.

[0197] The recesses 16' with suspended features 44 shown in Figures 9A-9C can be prepared by first creating the features 44 using any suitable technique, such as molding, 3D printing, or the like. The features 44 are then positioned on layer 18 in a pattern corresponding to the recess formation and secured to layer 18 (e.g., via an adhesive). The features 44 can also be formed at desired locations on layer 18 using vacuum deposition (e.g., through sputtering, thermal evaporation, etc.), solution-based deposition, or spray deposition through a photolithography mask that exposes the desired locations of the features 44. Once the feature material is deposited, the photolithography mask and any material thereon can be removed to leave the features 44 in the desired locations. Layer 18 is then selectively etched to form recesses 16' around and below the features 44. The etching is performed such that, after the recesses 16' are formed, the gap regions 26' of layer 18 support the features 44, but the features 44 are suspended above the recesses 16'.

[0198] Another example for forming feature 44 is shown in Figure 17. This example utilizes a negative or positive photoresist as a mask for subsequent etching. The stack of materials may include a base support 36, at least one additional layer 38, and layer 18.

[0199] In this example, a photoresist is deposited and patterned on layer 18. An example of a suitable negative photoresist is the NR® series of photoresists (available from Futurrex). Other suitable negative photoresists include the SU-8 series and KMPR® series (both available from Kayaku Advanced Materials, Inc.), or the UVN™ series (available from DuPont). Examples of suitable positive photoresists include the MICROPOSIT® S1800 series or AZ® 1500 series, both of which are available from Kayaku Advanced Materials, Inc. Another example of a suitable positive photoresist is SPR™-220 (manufactured by DuPont).

[0200] If a negative photoresist is used, it is applied onto layer 18 using any suitable technique. To develop the negative photoresist, an ultraviolet dose is directed at the portions of the resist that become insoluble. The unexposed portions become soluble and can be removed with a developer. The removed portions form a pattern P for forming second recesses 16'.

[0201] If a positive photoresist is used, it is applied onto layer 18 using any suitable technique. To develop the positive photoresist, an ultraviolet dose is directed at the portions of the resist that become soluble and removable with a developer. The removed portions form a pattern P for forming second recesses 16'. The unexposed portions become insoluble.

[0202] 16A and 16B illustrate two examples of patterned photoresist from a top view. The photoresist includes: i) insoluble photoresist features 76 over a portion of each of the second predetermined locations 78 (see FIG. 17 where the second recesses 16′ are formed); and ii) insoluble photoresist regions 74 over the second predetermined area gap regions 26′ surrounding each of the second predetermined locations 78. The outline of the pattern P defined in the insoluble photoresist 74, 76 provides the general shape of the second recesses 16′. The insoluble photoresist features 76 positioned between the patterns P define where the features 44 will be formed within the underlying layer 18, 38. The insoluble photoresist features 76 have a cross-sectional shape, relative to the surface plane of the underlying layer 18, selected from the group consisting of a rectangle ( FIG. 16A ), a cross ( FIG. 16B ), an X, and multiple intersecting spokes. The insoluble photoresist features 76 may have any configuration that forms a pattern P of etched regions that are sufficiently close together so that the conical etched regions in layer 38 merge with one another during etching (see FIG. 17).

[0203] In the exemplary method of FIG. 17, photoresist is patterned on layer 18 to define i) insoluble photoresist features 76 over a portion of each of second predetermined locations 78 (where second recesses 16' will be formed) and ii) insoluble photoresist regions 74 over gap regions 26' of second predetermined regions (i.e., bonding regions 14, 14') surrounding each of second predetermined locations 78, whereby areas 78' of layer 18 are exposed at each of second predetermined locations 78.

[0204] In this exemplary method, second recesses 16' are defined by etching exposed areas 78' of layer 18 at each of the second predetermined locations 78, thereby exposing areas 38' of at least one additional layer 38 at each of the second predetermined locations 78 and forming layer features 44' underlying each of the insoluble photoresist features 76, and then etching exposed areas 38' of the at least one additional layer 38 at each of the second predetermined locations 78, thereby removing at least a portion of second layer 38 underlying each of the layer features 44'. In this example, an anisotropic etch may be used to etch layer 18 in the areas 78' exposed between the photoresist, and then an isotropic etch may be used to etch layer 38 in the areas 38' exposed between the photoresist.

[0205] 17, etching of layer 38 continues partially under feature 44', thus allowing the etched areas to merge together to extend recess 16' under feature 44'. Feature 44' and any remaining portions of layer 38 attached to feature 44' form feature 44 in this example.

[0206] Although not shown in Figure 17, the photoresist regions and features 74, 76 can then be removed in a remover suitable for the photoresist used. Hardened positive photoresist can be lifted off using removers such as dimethylsulfoxide (DMSO), acetone wash, propylene glycol monomethyl ether acetate wash, or NMP (N-methyl-2-pyrrolidone)-based stripper wash with ultrasonic treatment. Hardened negative photoresist can be lifted off using removers such as dimethylsulfoxide (DMSO), acetone wash, or NMP (N-methyl-2-pyrrolidone)-based stripper wash with ultrasonic treatment.

[0207] In either of these examples, once the recesses 16, 16' are formed, a surface chemistry is introduced into the recesses 16.

[0208] An example of a suitable technique for introducing surface chemistry may include selective deposition techniques (e.g., controlled printing techniques, etc.). In one example, a pre-grafted polymer hydrogel 22 (i.e., a hydrogel 22 to which primers 24A, 24B have been grafted) may be deposited within the recesses 16, but not onto the interstitial regions 26, 26′ or within the recesses 16′. In another example, the polymer hydrogel 22 may be selectively deposited within the recesses 16, but not onto the interstitial regions 26, 26′ or within the recesses 16′, and then the primers 24A, 24B are grafted to the polymer hydrogel 22 within the recesses 16. In the latter example, it should be understood that the layer 18 does not include functional groups for attaching the primers 24A, 24B, and therefore the primers 24A, 24B are grafted to the polymer hydrogel 22 within the recesses 16, but not onto the interstitial regions 26, 26′ or the recesses 16′.

[0209] Primers 24A and 24B can be included in a carrier liquid at a concentration ranging from about 0.5 μM to about 100 μM. In one example, the primer concentration ranges from about 5 μM to about 25 μM. The carrier liquid for the primer fluid can be water. Buffers and / or salts can be added to the carrier liquid to graft primers 24A and 24B to suitable functional groups on the polymer hydrogel 22. The buffers have a pH ranging from 5 to 12, and the buffer used depends on the functional group at the 5' end of primers 24A and 24B. Neutral buffers and / or salts can be added to the primer fluid for grafting BCN-terminated primers, while alkaline buffers can be added to the primer fluid for copper-assisted grafting methods (e.g., click reactions). Any primer fluid used in copper-assisted grafting methods can also contain a copper catalyst. Examples of neutral buffers include tris(hydroxymethyl)aminomethane (TRIS) buffers, such as TRIS-HCl or TRIS-EDTA, or carbonate buffers (e.g., 0.25M to 1M). Sodium sulfate (e.g., 1M to 2M) is a suitable salt that may be used. Examples of alkaline buffers include tris(hydroxymethyl)aminomethane (CHES), 3-(cyclohexylamino)-1-propanesulfonic acid (CAPS), and alkaline buffers (manufactured by Sigma-Aldrich).

[0210] For grafting, a primer fluid is introduced into the active area 12. Grafting can be carried out at a temperature ranging from about 55°C to about 65°C for a time ranging from about 20 minutes to about 60 minutes. In one example, grafting is carried out at 60°C for about 30 or 60 minutes. It should be understood that lower temperatures and longer times, or higher temperatures and shorter times, can also be used. Some primer grafting techniques, such as those involving BCN grafting to tetrazine units, can be carried out at room temperature (e.g., 18°C ​​to about 25°C). During grafting, the primers 24A, 24B attach to at least some of the azide or tetrazine groups or other functional groups of the polymer hydrogel 22 and have no affinity for the interstitial regions 26, 26' or recesses 16' that do not have polymer hydrogel 22 therein.

[0211] Another example of a suitable technique for introducing surface chemistry may include the use of photoresist, in which the photoresist is developed to mask the bonding areas 14 while the surface chemistry (e.g., polymer hydrogel 22 and primers 24A, 24B) is applied to the active areas 12.

[0212] After placing the photoresist on the bonding region 14, a polymer hydrogel 22 mixture can be generated and applied to both the recessed 16 and interstitial regions 26 of the active region 12. In one example, any of the examples of polymer hydrogel 22 disclosed herein can be present in a mixture (e.g., with water, or with ethanol and water). The mixture can then be applied to the layer 18 in the active region 12 using spin coating, dipping or dip coating, flow of material under positive or negative pressure, or another suitable technique. These types of techniques result in a blanket deposition of the polymer hydrogel 22 onto the layer 18 in the active region 12. In some examples, the surface of the monolayer 18 can be activated, and then the mixture (including the polymer hydrogel 22) can be applied to it. In one example, a silane or silane derivative (e.g., norbornene silane) can be deposited on the surface of the layer 18 using vapor deposition, spin coating, or other deposition methods. In another example, layer 18 can be exposed to plasma ashing to generate surface-activating agents (eg, —OH groups) that can adhere to polymer hydrogel 22 .

[0213] Depending on the chemical nature of the polymer hydrogel 22, the applied mixture may be subjected to a curing process. In one example, curing may occur at temperatures ranging from room temperature (e.g., about 25° C.) to about 95° C. for times ranging from about 1 millisecond to about several days.

[0214] If a blanket deposition technique is used, polishing may then be performed to remove the polymer hydrogel 22 from the gap regions 26 while leaving the polymer hydrogel 22 in the recesses 16 at least substantially intact. Primers 24A, 24B may then be grafted to the polymer hydrogel 22 in the recesses 16 as described herein. The photoresist is then removed from the bond regions 14 using a suitable remover.

[0215] Once the surface chemistry is disposed within the active area 12 , adhesive 28 may then be selectively applied to the bonding areas 14 and a cover 30 may be placed in contact with the adhesive 28 .

[0216] The adhesive 28 can be applied using a dispense coater so as not to deposit within the active area 12. One example of a dispense coater that can be used in this exemplary method is a GPD coater equipped with a progressive cavity pump, which is a highly accurate volumetric dispense pump. Another type of dispense coater is a pressure-driven dispense system. In another example, the adhesive 28 can be applied using an inkjet or other similar printer.

[0217] The temperature and pressure used during bonding may be selected to be higher than the conditions used during operation of flow cells 20A, 20C, 20D so that the bond does not weaken during use. The adhesive 28 is allowed to cure, securing cover 30 to patterned substrate 10 to form flow cells 20A, 20C, 20D. In one example, the bonding temperature may be up to 80°C and the bonding pressure may be up to 20 kN.

[0218] Another example of the method includes forming a patterned substrate 10′ by defining first posts 34 at first predetermined locations within a predetermined region of a layer 18 surrounded by a second predetermined region of the layer, thereby defining an active region 12′ within the layer 18, and introducing a surface chemical to each of the first posts 34; and defining a bonding region 14′ of the layer by defining second posts 34′ at second predetermined locations within the second predetermined region of the layer 18; introducing an adhesive 28 into the bonding region 14 around at least each of the second posts 34′; and positioning a cover 30 in contact with the adhesive 28, thereby securing the cover 30 to the bonding region 14′ and forming a flow channel 32 between a portion of the cover 30 and the active region 12′.

[0219] If the posts 34, 34' have the same shape, they may be formed at the same time using the same process.

[0220] Embossing or etching can be used to create identical posts 34, 34' in the single layer substrate. When layer 18 is an etchable single layer substrate, defining first and second posts 34, 34' having the same shape includes etching through a portion of the etchable single layer substrate around a first predetermined location and at a second predetermined location.

[0221] Several different techniques can be used to create identical posts 34, 34' within layers 18 of a multi-layer substrate. In one example, an inorganic oxide can be selectively applied to the base support 36 in a desired pattern of posts 34, 34', for example, via vapor deposition, aerosol printing, or inkjet printing. In another example, a resin matrix material can be applied to the base support 36 and then patterned to form the posts 34, 34'. Any suitable deposition and patterning technique can be used.

[0222] If the posts 34, 34' have different shapes, they can be formed sequentially using different processes. Because the posts 34 are cylindrical or elliptical cylindrical, they can be formed using any of the techniques disclosed herein, including photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, or printing techniques. The angled cylindrical posts 34' shown in FIG. 13 can also be formed using any of these techniques.

[0223] The posts 34, 34' shown in FIGS. 11 and 12 are formed by etching a narrow portion P N and a wide portion P WThese processes begin with a stack of layers, with a first layer 18 positioned on top of at least one additional layer 38 positioned on top of a base support 36. In these examples, layer 18 and the at least one additional layer 38 have different etch rates, and the base support 36 is non-etchable. The second post 34' is formed by sequentially etching through layer 18 and then through at least one additional layer 38 to leave the post 34' in a second predetermined location. In this example, the first post 34 can be formed by etching through layer 18 or by sequentially etching through layer 18 and then through at least one additional layer 38 to leave the post 34 in a first predetermined location.

[0224] Once the posts 34, 34' are formed, a surface chemistry is introduced onto the posts 34.

[0225] An example of a suitable technique for introducing surface chemistry may include selective deposition techniques (e.g., controlled printing techniques, etc.). In one example, a pre-grafted polymer hydrogel 22 (i.e., a hydrogel 22 grafted with primers 24A, 24B) may be deposited on the posts 34, but not on the interstitial regions 26, 26′ or on the posts 34′. In another example, the polymer hydrogel 22 may be selectively deposited on the posts 34, but not on the interstitial regions 26, 26′ or on the posts 34′, and then the primers 24A, 24B are grafted to the polymer hydrogel 22 on the posts 34. In the latter example, it should be understood that the layer 18 does not include functional groups for attaching the primers 24A, 24B, and therefore the primers 24A, 24B are grafted to the polymer hydrogel 22 on the posts 34, but not on the interstitial regions 26, 26′ or the posts 34′. The primers 24A, 24B may be grafted as described herein.

[0226] Another example of a suitable technique for introducing surface chemistry may include the use of photoresist, in which the photoresist is developed to mask the bonding region 14′ and the gap regions 26 surrounding the posts 34 in the active region 12′, while the surface chemistry (e.g., polymer hydrogel 22 and primers 24A, 24B) is applied to the posts 34 in the active region 12′.

[0227] After the photoresist is positioned on the bond regions 14′ and the gap regions 26, a polymer hydrogel 22 mixture can be generated and applied to the posts 34 in the active region 12′. In one example, any of the polymer hydrogel 22 examples disclosed herein can be present in a mixture (e.g., with water, or with ethanol and water). This mixture can then be applied to the exposed posts 34 in the active region 12′ using spin coating, dipping, dip coating, flow of material under positive or negative pressure, or other suitable techniques. These types of techniques result in blanket deposition of the polymer hydrogel 22. Depending on the chemical nature of the polymer hydrogel 22, the applied mixture can be subjected to a curing process as described herein.

[0228] A suitable remover is then used to remove the photoresist from the bond areas 14' and the gap areas 26. This process also removes the polymer hydrogel 22 that is overlying the photoresist, thereby re-exposing the posts 34' and the gap areas 26, 26'.

[0229] Primers 24A, 24B may then be grafted to the polymer hydrogel 22 on posts 34 as described herein. It should be understood that posts 34' and interstitial regions 26, 26' do not contain functional groups for attaching primers 24A, 24B, and therefore primers 24A, 24B are grafted to the polymer hydrogel 22 on posts 34, but not to interstitial regions 26, 26' or posts 34'.

[0230] Once the surface chemistry is in place within the active area 12', adhesive 28 can then be selectively applied to the bonding area 14' and a cover 30 can be placed in contact with the adhesive 28. The bonding process can be performed as described herein to form the flow cell 20B.

[0231] To further illustrate the present disclosure, examples are provided herein. It should be understood that the examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0232] Non-limiting examples In this example, three different types of flow cells were used.

[0233] The first type of flow cell contained two active areas patterned with cylindrical recesses and surrounded by a binding region. Exemplary flow cells of the first type contained recesses in the binding region having small, larger, or elliptical cylindrical shapes. Comparative flow cells of the first type did not contain recesses in the binding region. One hundred three exemplary flow cells of the first type were prepared and tested, and 34 comparative flow cells of the first type were prepared and tested.

[0234] The second type of flow cell was similar to the first type but had a larger active area and a narrower binding region. Exemplary flow cells of the second type included a recess in the binding region with a small cylindrical, larger cylindrical, or elliptical cylindrical shape. Comparative flow cells of the second type did not include a recess in the binding region. Seventeen exemplary flow cells of the second type were prepared and tested, and thirteen comparative flow cells of the second type were prepared and tested.

[0235] The third type of flow cell contained eight active areas patterned with cylindrical recesses and surrounded by a binding area patterned with a larger cylindrical recess. The third type of comparative flow cell contained no recesses in the binding area. Thirteen third type example flow cells were prepared and tested, and 16 third type comparative flow cells were prepared and tested.

[0236] The first, second, and third types of flow cells of the examples and comparative examples were subjected to a cyclic pressure test. Each flow cell was filled with air and held for 30 seconds to measure air leakage. If a leak was detected, the flow cell was considered to have ruptured.

[0237] Average results for the first type of example and comparative flow cells are shown in Figure 19A. Average results for the second type of example and comparative flow cells are shown in Figure 19B. Average results for the third type of example and comparative flow cells are shown in Figure 19C. In each of Figures 19A, 19B, and 19C, the exemplary flow cells are labeled "patterned" and the comparative flow cells are labeled "non-patterned." The results for each type of flow cell demonstrate that the flow cells with patterned binding regions lasted longer than the flow cells without patterned binding regions.

[0238] Additional Notes It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used expressly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.

[0239] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0240] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.

Claims

1. A flow cell, 1. A patterned substrate having an active area and a bonding area at least partially surrounding the active area, the active area comprising: a first recess defined in the patterned substrate layer; and a surface chemistry positioned within the first recess; a first gap region surrounding the first recess, wherein the bonding region comprises: a second recess defined in the layer; a second gap region surrounding the second recess; and an adhesive positioned within the second recess and over the second gap area; a cover attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

2. The flow cell of claim 1 , wherein the geometric shape of each of the first recesses and each of the second recesses is the same.

3. 3. The flow cell of claim 2, wherein the geometric shape is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-cylinder, a polygonal prism, and combinations thereof.

4. The flow cell of claim 1 , wherein the geometric shape of each of the first recesses is different from the geometric shape of each of the second recesses.

5. the geometric shape of each of the first recesses is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a polygonal prism, and combinations thereof; the geometric shape of each of the second recesses includes a narrow portion opening into a wide portion; 5. The flow cell of claim 4, wherein for each of the geometric shapes of the second recesses, a dimension across the opening of the narrow portion is smaller than at least one dimension of the wide portion that is parallel to the dimension across the opening.

6. the narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, and a rectangular parallelepiped; 6. The flow cell of claim 5, wherein the widened portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a semi-cylinder, a sphere, a polygonal prism, and a cone.

7. the patterned substrate includes at least one additional layer underlying the layer, and a base support underlying the at least one additional layer; For the geometric shape of each of the second recesses: the narrowed portion is defined in and through the layer; the widened portion is defined within and through the at least one additional layer; the base support defines a bottom of the wide portion; 7. The flow cell of claim 5 or 6, wherein the layer defines an overhang above a portion of the wide portion.

8. the geometric shape of each of the first recesses is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-circular cylinder, a polygonal prism, and combinations thereof; the geometric shape of each of the second recesses is selected from the group consisting of a tilted circular cylinder, a tilted elliptical cylinder, a tilted cube, a tilted rectangular parallelepiped, and a tilted polygonal prism; 5. The flow cell of claim 4, wherein the geometric shape of each of the second recesses has its central axis at a non-90 degree angle relative to the plane of the bottom of the second recess.

9. 10. The flow cell of claim 1, further comprising a plurality of features, each feature extending across a portion of a respective one of the second recesses and supported by the second gap region surrounding the respective one of the second recesses, and the adhesive enveloping each feature.

10. 10. The flow cell of claim 9, wherein each feature extends partially into the depth of the respective one of the second recesses.

11. The flow cell according to any one of claims 1 to 10, wherein the adhesive fills each of the second recesses.

12. the patterned substrate includes a plurality of additional layers underlying the layer; and a base support underlying the plurality of additional layers; an etch rate of the layer and each of the plurality of additional layers increases moving toward the base support; the base support is non-etchable; 12. The flow cell of claim 1 or 11, wherein the geometric shape of each of the second recesses increases moving toward the base support.

13. the patterned substrate includes a plurality of additional layers underlying the layer; and a base support underlying the plurality of additional layers; the layer has a first etch rate; an etch rate of each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; the base support is non-etchable; 12. The flow cell of claim 1 or 11, wherein the geometric shape of each of the second recesses changes between a first dimension and a second dimension as one moves toward the base support.

14. A flow cell, 1. A patterned substrate having an active area and a bonding area at least partially surrounding the active area, the active area comprising: a first post defined in the patterned substrate layer; a surface chemistry positioned on the first post; a first gap region surrounding the first post; The binding region is a second post defined in the layer; a second gap region surrounding the second post; and an adhesive positioned over the second gap region and over the second post; a cover attached to the adhesive such that a flow channel is defined between a portion of the cover and the active area.

15. the geometric shape of each of the first posts and each of the second posts is the same; 15. The flow cell of claim 14, wherein the geometric shape is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a cone, a polygonal prism, and combinations thereof.

16. 15. The flow cell of claim 14, wherein the geometric shape of each of the first posts is different from the geometric shape of each of the second posts.

17. the geometric shape of each of the first posts is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a cone, a polygonal prism, and combinations thereof; the geometric shape of each of the second posts includes a narrow portion extending outwardly to a wider portion; 17. The flow cell of claim 16, wherein for the geometric shape of each of the second posts, a dimension across the base of the narrow portion is smaller than at least one dimension of the wide portion that is parallel to the dimension across the base.

18. 18. The flow cell of claim 17, wherein the narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular prism, a cone, and a polygonal prism, and the wide portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular prism, and a polygonal prism.

19. the substrate includes the layer, at least one additional layer underlying the layer, and a base support underlying the at least one additional layer; For the geometric shape of each of the second posts: the widened portion is defined within the layer; 18. The flow cell of claim 17, wherein the narrowed portion is defined in the at least one additional layer.

20. the geometric shape of each of the first posts is selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a cone, a polygonal prism, and combinations thereof; the geometric shape of each of the second posts is selected from the group consisting of a tilted circular cylinder, a tilted elliptical cylinder, a tilted circular cylinder, a tilted rectangular parallelepiped, and a tilted polygonal prism; 17. The flow cell of claim 16, wherein the geometric shape of each of the second posts has its central axis at a non-90 degree angle relative to a plane at the base of the second post.

21. The flow cell of any one of claims 14 to 20, wherein the adhesive fills the second gap region.

22. the patterned substrate includes a plurality of additional layers underlying the layer; and a base support underlying the plurality of additional layers; an etch rate of the layer and each of the plurality of additional layers increases moving toward the base support; the base support is non-etchable; 22. The flow cell of claim 14 or 21, wherein the geometric shape of each of the second posts decreases as one moves toward the base support.

23. the patterned substrate includes a plurality of additional layers underlying the layer; and a base support underlying the plurality of additional layers; the layer has a first etch rate; an etch rate of each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; the base support is non-etchable; 22. The flow cell of claim 14 or 21, wherein the geometric shape of each of the second posts changes between a first dimension and a second dimension as it moves toward the base support.

24. 1. A method comprising: The patterned substrate is defining a first recess at a first predetermined location within a first predetermined region of the layer surrounded by a second predetermined region of the layer; and introducing a surface chemistry into each of the first recesses to thereby define an active area within the layer; defining patterned bonding regions in the layer by defining second recesses at second predetermined locations within the second predetermined region of the layer; introducing an adhesive into the patterned bonding area, including each of the second recesses; positioning a cover in contact with the adhesive, thereby securing the cover to the patterned bonding area and creating a flow channel between a portion of the cover and the active area.

25. the patterned substrate is a multi-layer substrate comprising a layer positioned over at least one additional layer over a base support; each of the first recesses is defined through the layer and the at least one additional layer, portions of the layers defining first gap regions separating the first recesses from one another; 25. The method of claim 24, wherein each of the second recesses is defined through the layer and the at least one additional layer, portions of the layer defining second gap regions separating the second recesses from one another.

26. the layer and the at least one additional layer have different etch rates, and the base support is non-etchable; defining the first recess includes sequentially etching through the layer and then through the at least one additional layer at the first predetermined location; 26. The method of claim 25, wherein defining the second recess comprises sequentially etching through the layer and then through the at least one additional layer at the second predetermined location.

27. the geometric shape of each of the first recesses extends through the layer and the at least one additional layer and is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-circular cylinder, a polygonal prism, and combinations thereof; the geometric shape of each of the second recesses includes a narrow portion extending through the layer and opening into a wider portion extending through the at least one additional layer; 27. The method of claim 26, wherein for the geometric shape of each of the second recesses, a dimension across the opening of the narrow portion is smaller than at least one dimension of the wide portion that is parallel to the dimension across the opening.

28. the narrow portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, and a polygonal prism; 28. The method of claim 27, wherein the widened portion has a geometric shape selected from the group consisting of a cylinder, an elliptical cylinder, a cube, a rectangular parallelepiped, a semi-cylinder, a sphere, a cone, a polygonal prism, and combinations thereof.

29. 28. The method of claim 27, wherein each of the second recesses is inclined such that its central axis is at a non-90 degree angle relative to the plane of the bottom of the second recess.

30. the geometric shape of each of the first recesses extends through the layer and the at least one additional layer and is selected from the group consisting of a cylinder, an elliptical cylinder, a sphere, a cube, a rectangular parallelepiped, a cone, a semi-circular cylinder, a polygonal prism, and combinations thereof; the geometric shape of each of the second recesses is selected from the group consisting of a tilted circular cylinder, a tilted elliptical cylinder, a tilted cube, a tilted rectangular prism, and a tilted polygonal prism extending through the layer and the at least one additional layer; 26. The method of claim 25, wherein the geometric shape of each of the second recesses has its central axis at a non-90 degree angle relative to the plane of the bottom of the second recess.

31. the patterned substrate is a multi-layer substrate comprising the layer positioned over a plurality of additional layers on a base support; an etch rate of the layer and each of the plurality of additional layers increases moving toward the base support; the base support is non-etchable; defining the second recess includes sequentially etching through the layer and then through each of the plurality of additional layers; 25. The method of claim 24, wherein the geometric shape of each of the second recesses increases as one moves toward the base support.

32. the patterned substrate is a multi-layer substrate comprising the layer positioned over a plurality of additional layers on a base support; the layer has a first etch rate; an etch rate of each of the plurality of additional layers alternating between a second etch rate and the first etch rate as moving toward the base support; the base support is non-etchable; defining the second recess includes sequentially etching through the layer and then through each of the plurality of additional layers; 25. The method of claim 24, wherein the geometric shape of each of the second recesses changes between a first dimension and a second dimension as it moves toward the base support.

33. the layer being an etchable material positioned on a non-etchable base support; 25. The method of claim 24, wherein defining the first recess comprises etching through the etchable material at the first predetermined location.

34. a non-etchable material is positioned over the etchable material at a portion of each of the second predetermined locations; 34. The method of claim 33, wherein defining each of the second recesses comprises etching through a portion of the etchable material around and beneath the non-etchable material at the second predetermined location, whereby the non-etchable material forms a respective feature extending across a portion of each of the second recesses.

35. the patterned substrate is a multi-layer substrate comprising a layer positioned over a second layer over a base support; the layer has a first etch rate and the second layer has a second etch rate that is greater than the first etch rate; 25. The method of claim 24, wherein defining the first recess comprises etching through the layer and the second layer at the first predetermined location.

36. patterning photoresist on the layer to define i) insoluble photoresist features over a portion of each of the second predetermined locations, and ii) insoluble photoresist regions over interstitial regions of the second predetermined region surrounding each of the second predetermined locations, whereby areas of the layer are exposed at each of the second predetermined locations; Defining the second recess includes: etching the exposed areas of the layer at each of the second predetermined locations, thereby exposing areas of the second layer at each of the second predetermined locations and forming layer features underlying each of the insoluble photoresist features; and 36. The method of claim 35, comprising: etching the exposed areas of the second layer at each of the second predetermined locations, whereby at least a portion of the second layer underlying each of the layer features is removed.

37. 37. The method of claim 36, wherein each insoluble photoresist feature has a cross-sectional shape, relative to a surface plane of the layer, selected from the group consisting of a rectangle, a cross, an X, and a plurality of intersecting spokes.

38. 25. The method of claim 24, wherein the geometric shape of each of the first recesses and each of the second recesses is the same.

39. the second predetermined region of the layer includes etchable particles mixed therein; 25. The method of claim 24, wherein defining the second recess comprises etching the etchable particles from the layer.

40. 1. A method comprising: The patterned substrate is defining a first post at a first predetermined location within a predetermined region of the layer surrounded by a second predetermined region of the layer; defining an active area within the layer by introducing a surface chemistry into each of the first posts; defining a bonding area of ​​the layer by defining second posts at second predetermined locations within the second predetermined area of ​​the layer; introducing adhesive into the bonding area around at least each of the second posts; positioning a cover in contact with the adhesive, thereby securing the cover to the bonding area and creating a flow channel between a portion of the cover and the active area.

Images