Formulation of antisense oligomer conjugates

A benzyl alcohol and antisense oligomer conjugate addresses the challenges of stability and distribution issues in antisense technology by providing a stable and resistant pharmaceutical composition with improved shelf life and performance.

JP2025537104APending Publication Date: 2025-11-14SAREPTA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025524269
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-11-02
Filing Date
2023-11-02
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Existing antisense oligonucleotides and peptide-oligonucleotide conjugates face challenges with improved antisense or antigene performance, including reduced toxicity, enhanced affinity to DNA and RNA without impairing sequence selectivity, improved pharmacokinetics and tissue distribution, and reliable and controllable in vivo distribution.

Method used

A benzyl alcohol and antisense oligomer conjugate of formula (I) is developed, which is resistant to aggregation and degradation, maintaining stability under various conditions, and is compatible with PES and PVDF membranes, with a shelf life of at least 5 years at 2-8°C.

Benefits of technology

The conjugate demonstrates enhanced stability and resistance to aggregation, photolysis, shear, and freeze-thaw stress, ensuring long-term effectiveness and reliability in pharmaceutical compositions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025537104000001_ABST
    Figure 2025537104000001_ABST
Patent Text Reader

Abstract

Provided herein is a pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of Formula (I). JPEG2025537104000129.jpg7741 Also provided herein is a method for treating a progeroid disease, such as Hutchinson-Gilford Progeria Syndrome (HGPS), in a subject in need thereof, comprising administering to the subject a pharmaceutical composition described herein.The present disclosure relates to a pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of Formula (I) as defined herein.
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 382,043, filed November 2, 2022, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing Description The sequence listing associated with this application is provided in xml format in lieu of a paper copy and is incorporated herein by reference. The name of the text file containing the sequence listing is 8192WO00_SEQ_LISTING.xml. The text file is approximately 48 KB, was created on November 1, 2023, and will be submitted electronically via EFS Web.

[0003] Antisense technology provides a means for regulating the expression of one or more specific gene products, including alternative splicing products, and is uniquely useful in many therapeutic, diagnostic, and research applications. The principle behind antisense technology is that antisense compounds, such as oligonucleotides that hybridize to target nucleic acids, regulate gene expression activities such as transcription, splicing, or translation through any one of many antisense mechanisms. The sequence specificity of antisense compounds makes them attractive as tools for target validation and gene function, as well as therapeutic agents that selectively regulate the expression of genes involved in disease.

[0004] Although there has been remarkable progress in the field of antisense technology, there remains a need for oligonucleotide and peptide-oligonucleotide-conjugate with improved antisense or antigene performance.This improved antisense or antigene performance includes at least, for example, reduced toxicity, enhanced affinity to DNA and RNA without impairing sequence selectivity, improved pharmacokinetics and tissue distribution, improved cellular delivery, and reliable and controllable in vivo distribution.

[0005] Hutchinson-Gilford Progeria Syndrome (HGPS) is a rare genetic disorder characterized by premature arteriosclerosis and degeneration of vascular smooth muscle cells (SMCs). HGPS manifests most notably as accelerated, premature aging in affected children. Children with HGPS have progressive symptoms, including growth retardation, alopecia, loss of subcutaneous fat, and bone abnormalities. Average life expectancy is 12 years, and the most common cause of death is myocardial infarction or stroke.

[0006] Most HGPS cases are caused by a single point mutation in the laminin A (LMNA) gene, resulting in the production of progerin, a truncated splice variant of laminin A. The single point mutation is a de novo silent substitution (1824C>T, Gly608Gly) in exon 11 of the laminin A (LMNA) gene. The substitution activates a cryptic splice donor site, resulting in the production of a dominant-negative mutant laminin A protein with an internal deletion of 50 amino acids. The mutant protein, called progerin, accumulates on the nuclear envelope and causes characteristic nuclear blebbing (Scaffidi and Misteli 2005; Cao, Blair et al. 2011).

[0007] It is known that aberrant splicing can be corrected using phosphorodiamidate morpholino oligonucleotides (PMOs), or more specifically, splice switch oligonucleotides (SSOs). SSOs block aberrant splicing sites by hybridizing at or near the aberrant splicing site, thereby preventing recognition by the cellular splicing machinery. Exemplary SSOs are nuclease-resistant, and the resulting double-stranded structure eliminates the possibility of RNA cleavage by RNase H. SSOs have been shown to effectively restore splicing patterns in thalassemia and Duchenne muscular dystrophy both in vitro and in vivo (Kinali, Arechavala-Gomeza et al. 2009; Svasti, Suwanmanee et al. 2009). The aberrant splicing of LMNA associated with HGPS has been shown to be alleviated in both cell culture (Scaffidi and Misteli 2005) and relevant animal models (Osorio, Navarro et al. 2011) by correcting the aberrant splicing event using modified antisense oligonucleotides targeted to activated cryptic splice sites.

[0008] Given the role of LMNA in HGPS, oligonucleotides that modulate the splicing of LMNA pre-mRNA and abolish progerin expression are needed. Summary of the Invention [Means for solving the problem]

[0009] The present disclosure relates in particular to benzyl alcohol and an antisense oligomer conjugate of formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein A′, R 1 , R 2, t, and E' are as defined herein. The present disclosure also provides a method for treating Hutchinson-Gilford Progeria Syndrome (HGPS) in a subject in need thereof, comprising administering to the subject a pharmaceutical composition of the present disclosure. [Brief explanation of the drawings]

[0010] [Figure 1] FIG. 1 shows the effect of concentration of an antisense oligomer conjugate of the present disclosure on viscosity. [Figure 2] Figure 2 shows an SCX-HPLC overlay of antisense oligomer conjugate test solutions at various concentrations. Monomeric and higher order species resulting from aggregation are identified. [Figure 3] 3 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure and additional excipients in citrate buffer. For each excipient, t data is shown in the left bar and t data in the right bar. [Figure 4] 4 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure and excipients in phosphate buffer. For each excipient, the t data is shown in the left bar and the t data in the right bar. [Figure 5] 5 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure and excipients in either citrate or phosphate buffer after 7 days. For each excipient, data for the citrate buffer composition is presented in the left bar, and data for the phosphate buffer composition is presented in the right bar. [Figure 6] Figure 6 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure. For each composition, data for t0 (room temperature) are presented in the left bar, data for t7 days (room temperature) in the middle bar, and data for t7 days (2-8°C) in the right bar. [Figure 7]Figure 7 shows aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure. For each composition, data for t0 (room temperature) are presented in the leftmost bar, data for t7 days (room temperature) in the middle left bar, data for t7 days (2-8°C) in the middle right bar, and data for t14 days (room temperature) in the rightmost bar. [Figure 8] 8 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure maintained at 25° C. For each composition, data for t0 is presented in the left bar, data for t7 days in the middle bar, and data for t14 days in the right bar. [Figure 9] 9 shows the aggregation profiles of compositions of antisense oligomer conjugates of the present disclosure held at 60° C. For each composition, data for t0 is presented in the left bar, data for t7 days in the middle bar, and data for t14 days in the right bar. [Figure 10] FIG. 10 shows the decomposition rate constant plot assuming first order kinetics. [Figure 11] FIG. 11 shows the decomposition rate constant plot assuming second-order kinetics. [Figure 12] FIG. 12 shows a set of Arrhenius plots used to calculate the estimated shelf life of pharmaceutical compositions of the present disclosure. [Figure 13] FIG. 13 shows the shelf life calculations for pharmaceutical compositions of the present disclosure. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present disclosure relates to pharmaceutical compositions comprising benzyl alcohol and an antisense oligomer conjugate of Formula (I) as defined herein. The conjugates of the present disclosure are susceptible to the formation of higher-order species (i.e., aggregates) upon storage under various conditions. Applicants have surprisingly found that compositions comprising the conjugates of the present disclosure and benzyl alcohol are resistant to aggregation and are significantly and unexpectedly more stable than compositions lacking benzyl alcohol. Indeed, pharmaceutical compositions of the present disclosure have been shown to be highly stable, compatible with both PES and PVDF membranes, resistant to degradation under photolysis, shear, and freeze-thaw stress, and have a shelf life of at least 5 years at 2-8°C.

[0012] definition Below are definitions of various terms used to describe this disclosure. These definitions apply to the terms as they are used throughout this specification and claims, unless otherwise limited in specific instances, either individually or as part of a larger group.

[0013] The term "about" will be understood by those of skill in the art and will vary to some extent in the context in which it is used. As used herein, when referring to a measurable value such as an amount, duration, etc., the term "about" is meant to encompass variations of ±20% or ±10%, including ±5%, ±1%, and ±0.1%, as such variations are appropriate for practicing the disclosed methods.

[0014] The term "alkyl" refers, in certain embodiments, to a saturated, straight-chain, or branched-chain hydrocarbon moiety containing one to six, or one to eight, carbon atoms. 1-6 Examples of -alkyl moieties include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, neopentyl, and n-hexyl moieties; 1-8Examples of -alkyl moieties include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, tert-butyl, neopentyl, n-hexyl, heptyl, and octyl moieties.

[0015] The number of carbon atoms in an alkyl substituent is expressed as "C x-y " where x is the minimum and y is the maximum number of carbon atoms in the substituent. x Chain means an alkyl chain containing x carbon atoms.

[0016] The term "heteroalkyl," by itself or in combination with another term, unless otherwise stated, refers to a stable straight- or branched-chain alkyl group containing the specified number of carbon atoms and one or two heteroatoms selected from the group consisting of O, N, and S, where the nitrogen and sulfur atoms are optionally oxidized and the nitrogen heteroatom is optionally quaternized. The heteroatom may be placed at any position of the heteroalkyl group, including between the remainder of the heteroalkyl group and the fragment to which it is attached, as well as attached to the most distal carbon atom in the heteroalkyl group. Examples include: -O-CH-CH-CH, -CH-CH-CH-OH, -CH-CH-NH-CH, -CH-S-CH-CH, and -CH-CH-S(=O)-CH. 3。 Up to two heteroatoms may be consecutive, such as, for example, -CH2-NH-OCH3, or -CH2-CH2-SS-CH3.

[0017] The term "aryl," when used alone or in combination with other terms, unless otherwise specified, refers to a carbocyclic aromatic system containing one or more rings (generally one, two, or three rings), which may be attached in a pendant fashion, such as biphenyl, or may be fused, such as naphthalene. Examples of aryl groups include phenyl, anthracyl, and naphthyl. In various embodiments, example aryl groups are phenyl (e.g., C-aryl) and biphenyl (e.g., C 12 In some embodiments, the aryl group has 6 to 16 carbon atoms. In some embodiments, the aryl group has 6 to 12 carbon atoms (e.g., C 6-12 -aryl). In some embodiments, the aryl group has 6 carbon atoms (e.g., C6-aryl).

[0018] As used herein, the terms "heteroaryl" or "heteroaromatic" refer to heterocycles having aromatic character. Heteroaryl substituents include, for example, C 1-9 -Heteroaryl may be defined by the number of carbon atoms, such that it indicates the number of carbon atoms contained in the heteroaryl group, not including the number of heteroatoms. For example, C 1-9 -Heteroaryl will contain one to four additional heteroatoms. Polycyclic heteroaryls can contain one or more partially saturated rings. Non-limiting examples of heteroaryls include pyridyl, pyrazinyl, pyrimidinyl (e.g., including 2- and 4-pyrimidinyl), pyridazinyl, thienyl, furyl, pyrrolyl (e.g., including 2-pyrrolyl), imidazolyl, thiazolyl, pyrazolyl (e.g., including 3- and 5-pyrazolyl), isothiazolyl, 1,2,3-triazolyl, 1,2,4-triazolyl, 1,3,4-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl.

[0019] Non-limiting examples of polycyclic heterocycles and heteroaryls include indolyl (e.g., 3-, 4-, 5-, 6-, and 7-indolyl), indolinyl, quinolyl, tetrahydroquinolyl, isoquinolyl (e.g., including 1- and 5-isoquinolyl), 1,2,3,4-tetrahydroisoquinolyl, cinnolinyl, quinoxalinyl (e.g., including 2- and 5-quinoxalinyl), quinazolinyl, phthalazinyl, 1,8-naphthyridinyl, 1,4-benzodioxanyl, coumarin, dihydrocoumarin, 1,5-naphthyridinyl, benzofuryl (e.g., 3-, 4-, 5-, 6-, and 7-indolyl), and the like. and 7-benzofuryl), 2,3-dihydrobenzofuryl, 1,2-benzisoxazolyl, benzothienyl (e.g., 3-, 4-, 5-, 6-, and 7-benzothienyl), benzoxazolyl, benzothiazolyl (e.g., 2-benzothiazolyl and 5-benzothiazolyl), purinyl, benzimidazolyl (e.g., including 2-benzimidazolyl), benzotriazolyl, thioxanthinyl, carbazolyl, carbonyl, acridinyl, pyrrolidinyl, and quinolizidinyl.

[0020] The term "protecting group" or "chemical protecting group" refers to a chemical moiety that blocks some or all reactive moieties in a compound, preventing them from participating in a chemical reaction until the protecting group is removed. For example, such moieties are listed and described in T.W. Greene, P.G.M. Buts, Protective Groups in Organic Synthesis, 3rd ed. John Wiley & Sons (1999). When different protecting groups are used, it can be advantageous for each (different) protecting group to be removable by a different means. Protecting groups that are cleaved under completely different reaction conditions allow for differential removal of such protecting groups. For example, protecting groups can be removed by acid, base, and hydrogenolysis. Groups such as trityl, monomethoxytrityl, dimethoxytrityl, acetal, and tert-butyldimethylsilyl are acid-labile and can be used to protect carboxy and hydroxy reactive moieties in the presence of hydrogenolysis-removable Cbz groups and amino groups protected with the base-labile Fmoc group. Carboxylic acid moieties may be blocked with base-labile groups such as, but not limited to, methyl or ethyl, and hydroxy reactive moieties may be blocked with base-labile moieties such as acetyl in the presence of acid-labile groups such as tert-butyl carbamate, or amines blocked with both acid- and base-stable but hydrolytically removable carbamates.

[0021] Carboxylic acid and hydroxyl reactive moieties may also be blocked with hydrolytically removable protecting groups such as benzyl groups, while amine groups may be blocked with base-labile groups such as Fmoc. A particularly useful amine protecting group for the synthesis of compounds of formula (I) is trifluoroacetamide. Carboxylic acid reactive moieties may be blocked with oxidatively removable protecting groups such as 2,4-dimethoxybenzyl, while existing amino groups may be blocked with fluoride-labile silyl carbamates.

[0022] Allyl-blocking groups are useful in the presence of acid- and base-protecting groups because the former are stable and can be subsequently removed by metal or pi-acid catalysts. For example, allyl-blocked carboxylic acids can be deprotected with a palladium(0)-catalyzed reaction in the presence of acid-labile t-butyl carbamate or base-labile acetate amine protecting groups. Another form of protecting group is a resin to which a compound or intermediate can be attached. As long as the residue is attached to the resin, the functional group is blocked and cannot react. Once released from the resin, the functional group becomes reactive.

[0023] The terms "nucleobase," "base pairing moiety," "nucleobase-pairing moiety," or "base" refer to the heterocyclic portion of a nucleoside, nucleotide, and / or morpholino subunit. Nucleobases can be naturally occurring or can be modified or analogous to these naturally occurring nucleobases; for example, one or more nitrogen atoms of a nucleobase can be independently replaced by carbon in each occurrence. Exemplary analogs include hypoxanthine (the base component of the nucleoside inosine), 2,6-diaminopurine; 5-methylcytosine; C5-propynyl-modified pyrimidines, 10-(9-(aminoethoxy)phenoxazinyl) (G-clamp), and the like.

[0024] Further examples of base-pairing moieties include, but are not limited to, uracil, thymine, adenine, cytosine, guanine and pyrimidine analogs such as acyl protecting groups, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine and pseudouracil, and other modified nucleobases such as 8-substituted purines, xanthines, or hypoxanthines (the latter two being natural degradation products). Also contemplated are modified nucleobases disclosed in Chiu and Rana (2003) RNA 9:1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196, and Revankar and Rao, Comprehensive Natural Products Chemistry, vol. 7, 313, the contents of which are incorporated herein by reference.

[0025] Further examples of base pairing moieties include, but are not limited to, extended size nucleobases with one or more added benzene rings. Nucleobase substitutions described in the Glen Research catalog (www.glenresearch.com), Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150, Kool, ET, Acc. Chem. Res., 2002, 35, 936-943, Benner SA, et al., Nat. Rev. Genet., 2005, 6, 553-543, Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733, Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627 (the contents of which are incorporated herein by reference) are contemplated as being useful in the synthesis of the oligomers described herein. Examples of extended-size nucleobases are shown below: [ka]

[0026] The term "oligonucleotide" or "oligomer" refers to a compound comprising a plurality of linked nucleosides, nucleotides, or a combination of both nucleosides and nucleotides. In certain embodiments provided herein, the oligonucleotide is a morpholino oligonucleotide.

[0027] The term "morpholino oligonucleotide" or "PMO" refers to a modified oligonucleotide having morpholino subunits joined by phosphoramidate or phosphorodiamidate linkages that connect the morpholino nitrogen of one subunit to the 5'-exocyclic carbon of an adjacent subunit. Each morpholino subunit contains a nucleobase pairing moiety effective to bind to a target nucleobase by nucleobase-specific hydrogen bonding.

[0028] The terms "antisense oligomer," "antisense compound," and "antisense oligonucleotide" are used interchangeably and refer to a sequence of subunits, each having base-pairing moieties and joined by intersubunit linkages that hybridize to a target sequence in a nucleic acid (typically RNA) by Watson-Crick base pairing to form a nucleic acid:oligomer heteroduplex within the target sequence. The oligomer may have exact (perfect) or approximate (full) sequence complementarity to the target sequence, with sequence variations near the ends of the oligomer generally being preferable to variations in the interior.

[0029] Such antisense oligomers, which can be designed to block or inhibit mRNA translation or to inhibit / alter natural or aberrant pre-mRNA splicing processing, can be said to be "directed" or "targeted" to the target sequence to which they hybridize. The target sequence is typically a region containing the AUG start codon of an mRNA, a translation suppressor oligomer, or a splice site or splice suppressor oligomer (SSO) of a pre-processed mRNA. A splice site target sequence can include an mRNA sequence downstream of the normal splice acceptor junction of the processed mRNA, from 1 to about 25 base pairs at its 5' end. In various embodiments, the target sequence can be any region of the processed mRNA that includes the splice site, is contained entirely within the exon coding sequence, or spans the splice acceptor or donor site. When an oligomer is targeted to a target nucleic acid in the manner described above, it is more generally said to be "targeted against" a biological target, such as a protein, virus, or bacterium.

[0030] Antisense oligonucleotides and target RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other, and thus stable and specific binding occurs between oligonucleotides and targets.Therefore, "specifically hybridizable" and "complementary" are terms used to indicate a sufficient degree of complementarity or precise pairing between oligonucleotides and targets, so that stable and specific binding occurs.Those skilled in the art will understand that the sequence of an oligonucleotide does not need to be 100% complementary to its target sequence to be specifically hybridizable.An oligonucleotide is specifically hybridizable if the binding of the oligonucleotide to its target molecule interferes with the normal function of target RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of antisense oligonucleotides to non-target sequences under the conditions where specific binding is desired, that is, under physiological conditions for in vivo assays or therapeutic treatments, and under the conditions where assays are performed for in vitro assays.

[0031] Oligonucleotides may also contain modified or substituted nucleobases (simply referred to in the art as "bases"). Oligonucleotides containing modified or substituted bases include oligonucleotides in which one or more of the most common purine or pyrimidine bases found in nucleic acids are replaced with less common or unnatural bases. In some embodiments, the nucleobase is covalently linked to the morpholine ring of the nucleoside at the N atom of a purine base or the N atom of a pyrimidine base.

[0032] Purine bases contain a pyrimidine ring fused to an imidazole ring, as described by the general formula: [ka]

[0033] Adenine and guanine are the two most commonly found purine nucleobases in nucleic acids, which can be substituted with other naturally occurring purines, including but not limited to, N6-methyladenine, N2-methylguanine, hypoxanthine, and 7-methylguanine.

[0034] Pyrimidine bases contain a six-membered pyrimidine ring as described by the general formula: [ka]

[0035] Cytosine, uracil, and thymine are the most commonly found pyrimidine bases in nucleic acids. They can be substituted with other naturally occurring pyrimidines, including but not limited to 5-methylcytosine, 5-hydroxymethylcytosine, pseudouracil, and 4-thiouracil. In one embodiment, the oligonucleotides described herein comprise thymine bases instead of uracil.

[0036] Other modified or substituted bases include, but are not limited to, 2,6-diaminopurine, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and derivatives thereof, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, super T), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaaden ... These include degenerate or universal bases such as 7-deaza-2,6-diaminopurine, super-G, super-A, and N4-ethylcytosine, or their derivatives; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP); pseudouracil, or its derivatives; and abasic bases such as 2,6-difluorotoluene or abasic moieties (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced with nitrogen (azaribose)). Pseudouracil is a naturally occurring isomerized version of uracil, resulting from a C-glycosidic rather than the usual N-glycosidic form in uridine.

[0037] Certain modified or substituted nucleobases are particularly useful for improving the binding affinity of the antisense oligonucleotides of the present disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcitrine. In various embodiments, the nucleobases may contain 5-methylcytosine substituents, which have been shown to improve the stability of the double helix structure of nucleic acids by 0.6 to 1.2°C.

[0038] In some embodiments, modified or substituted nucleobases are useful for facilitating the purification of antisense oligonucleotides.For example, in certain embodiments, antisense oligonucleotides can contain three or more (for example, 3, 4, 5, 6 or more) consecutive guanine bases.In certain antisense oligonucleotides, a string of three or more consecutive guanine bases can cause oligonucleotide aggregation, complicating purification.In such antisense oligonucleotides, one or more consecutive guanine bases can be substituted with hypoxanthine.Substituting hypoxanthine for one or more guanines in a string of three or more consecutive guanine bases can reduce the aggregation of antisense oligonucleotides, thereby facilitating purification.

[0039] The oligonucleotides provided herein are synthetic and do not include antisense compositions of biological origin. The molecules of the present disclosure may be mixed, encapsulated, conjugated, or otherwise associated with molecules, molecular structures, or compound mixtures, or combinations thereof, such as liposomes, receptor-targeting molecules, oral, rectal, topical, or other formulations, for example, to aid in uptake, distribution, or absorption.

[0040] The terms "complementary" and "complementarity" refer to oligonucleotides (i.e., nucleotide sequences) related by the base-pairing rules. For example, the sequence "TGA(5'-3')" is complementary to the sequence "TCA(5'-3')." Complementarity can be "partial," in which only some of the nucleic acid bases match according to the base-pairing rules. Alternatively, there can be "complete," "total," or "perfect" (100%) complementarity between nucleic acids. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands. While perfect complementarity is often desirable, some embodiments can include one or more mismatches to the target RNA, preferably 6, 5, 4, 3, 2, or 1 mismatch. Such hybridization can occur with "near" or "substantial" complementarity of the antisense oligomer to the target sequence, as well as complete complementarity. In some embodiments, the oligomer can hybridize to the target sequence with about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% complementarity. Variation at any position within the oligomer is included. In certain embodiments, sequence variation near the ends of the oligomer is generally preferred over variation within the interior, and, if present, is typically about 6, 5, 4, 3, 2, or 1 nucleotide at the 5' end, 3' end, or both ends.

[0041] The term "naturally occurring amino acid" refers to the 20 (L)-amino acids utilized in protein biosynthesis, as well as amino acids present in naturally occurring proteins, such as 4-hydroxyproline, hydroxylysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. The term "unnatural amino acid" refers to amino acids not present in proteins found in nature, and examples include beta-alanine (β-Ala), 6-aminohexanoic acid (Ahx), and 6-aminopentanoic acid. Further examples of "unnatural amino acids" include, but are not limited to, the (D)-amino acids known to those skilled in the art, such as norleucine, norvaline, p-fluorophenylalanine, and ethionine.

[0042] The term "peptide" refers to a compound comprising multiple linked amino acids. The peptides provided herein may be considered cell membrane-penetrating peptides.

[0043] The terms "cell penetrating peptide" and "CPP" are used interchangeably and refer to cationic cell membrane-penetrating peptides, also referred to as transport peptides, carrier peptides, or peptide transduction domains. The peptides provided herein have the ability to induce cell membrane permeation within 100% of cells in a given cell culture population, enabling macromolecular translocation within multiple tissues in vivo upon systemic administration. In various embodiments, CPP embodiments of the present disclosure may include arginine-rich peptides, as further described below.

[0044] As used herein, the term "treatment" or "treating" is defined as the application or administration of a therapeutic agent, i.e., a conjugate of the present disclosure (in the form of a pharmaceutical composition), to a patient, or the application or administration of a therapeutic agent to a tissue or cell line isolated from a patient (e.g., for diagnostic or ex vivo applications). Such treatments may be specifically tailored or modified based on knowledge gained from the field of pharmacogenomics.

[0045] As used herein, the term "prevent" or "prevention" refers to the absence of onset of a disorder or disease if the disorder or disease has not already occurred, or the absence of further onset of a disorder or disease if the disorder or disease has already occurred. Also considered is the ability to prevent some or all of the symptoms associated with a disorder or disease.

[0046] An "effective amount" or "therapeutically effective amount" refers to an amount of a therapeutic compound, such as an antisense oligomer, administered to a mammalian subject, either in a single dose or as part of a series, effective to produce the desired therapeutic effect.

[0047] The term "amelioration" refers to a decrease in the severity of at least one indicator of a condition or disease. In certain embodiments, amelioration includes a slowing or alleviation in the progression of one or more indicators of a condition or disease. The severity of an indicator may be determined by subjective or objective measures known to those skilled in the art.

[0048] As used herein, " pharmaceutically acceptable salts " refers to the derivative of the oligonucleotide of the present disclosure, and parent oligonucleotide is modified by converting existing acid or base moiety into its salt form.The list of suitable salts is listed in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p.1418 and Journal of Pharmaceutical Science, 66, 2 (1977), each of which is incorporated herein by reference in its entirety.

[0049] Pharmaceutical Composition Benzyl alcohol and an antisense oligomer conjugate of formula (I): [ka] or a pharmaceutically acceptable salt thereof, During the ceremony, A' is -OH, [ka] is selected from R 5 is -C(O)(O-alkyl) x -OH, wherein x is 3 to 10, and each alkyl group, in each occurrence, is independently selected from the group consisting of C 2-6 - alkyl or or R 5 But -H, -C(O)C 1-6 -Alkyl, trityl, monomethoxytrityl, -(C 1-6 -alkyl)-R 6 , -(C 1-6 -heteroalkyl)-R 6 , -C 6-10 -aryl-R 6 , 5- to 10-membered heteroaryl-R 6 , -C(O)O-(C 1-6 -alkyl)-R 6 , -C(O)O-(C 6-10 -aryl)-R 6 , —C(O)O—(5- to 10-membered heteroaryl)-R 6 , and selected from the following: [ka] R 6 is selected from -OH, -SH, and -NH2, or R 6 is O, S, or NH, each of which is covalently attached to a solid support; R 9 is C 1-6 -alkyl, Each R 1 is -OH and -N(R 3 )(R 4) independently selected from 3 and R 4 is independently in each occurrence -H or -C 1-6 -alkyl, Each R 2 is independently, at each occurrence, selected from -H, a nucleobase, and a nucleobase functionalized with a chemical protecting group, wherein the nucleobase and the nucleobase functionalized with a chemical protecting group comprise, independently at each occurrence, a ring selected from pyridine, pyrimidine, purine, and deazapurine; t is 8 to 40; E' is -H, -C 1-6 -Alkyl, -C(O)C 1-6 -Alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, [ka] is selected from During the ceremony, Q is —C(O)(CH)C(O)— or —C(O)(CH)S(CH)C(O)—; R 7 But -(CH2)2OC(O)N(R 8 )2, where R 8 is -(CH2)6NHC(=NH)NH2, L is a linking amino acid, wherein L is covalently attached by an amide bond to the N-terminus or C-terminus of J; J is a cell membrane-permeable peptide, G is -H, -C(O)C 1-6 -alkyl, benzoyl, and stearoyl; G is covalently bonded to J; At least one of the following is true: (1) A' is [ka] or (2) E' is [ka] Provided herein is a pharmaceutical composition wherein

[0050] Antisense oligomeric conjugates of formula (I) The pharmaceutical compositions of the present disclosure comprise an antisense oligomer conjugate of Formula (I) as defined herein. Particular embodiments of the antisense oligomer conjugate of Formula (I) are as follows:

[0051] In some embodiments of the conjugate of Formula (I), A' is -OH, [ka] is selected from.

[0052] In some embodiments of the conjugate of Formula (I), A' is [ka] is selected from.

[0053] In some embodiments of the conjugate of Formula (I), A' is [ka] is selected from.

[0054] In some embodiments of the conjugate of Formula (I), A' is [ka] is selected from.

[0055] In some embodiments of the conjugate of Formula (I), A' is [ka] is selected from.

[0056] In some embodiments of the conjugate of formula (I), A' is -OH. In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] is.

[0057] In some embodiments of the conjugate of Formula (I), A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] is.

[0058] In some embodiments of the conjugate of Formula (I), R 5 is -C(O)(OCH2CH2) x -OH, where x is 3 to 10. In some embodiments, R 5 teeth, [ka] In some embodiments, R 5 is -C(O)(OCH2CH2) x -OH, where x is 3 to 10, or R 5 teeth, [ka] is.

[0059] In some embodiments of the conjugate of Formula (I), R 9 is methyl. In some embodiments, R 9 is ethyl. In some embodiments, R 9 is n-propyl. In some embodiments, R 9 is isopropyl.

[0060] In some embodiments of the conjugate of Formula (I), R 1 is —OH. In some embodiments, each R 1 is —OH. In some embodiments, R 1 is -N(R 3 )(R 4 In some embodiments, each R 1 is -N(R 3 )(R 4 In some embodiments, each R 3 is —H. In some embodiments, each R 3 -C 1-6 -alkyl. In some embodiments, each R 4 is —H. In some embodiments, each R 4 -C 1-6 In some embodiments, R 1 is —N(CH). In some embodiments, each R 1 is -N(CH3)2.

[0061] In some embodiments of the conjugate of Formula (I), R 2 is —H. In some embodiments, R 2 is a nucleobase comprising a ring selected from pyridine, pyrimidine, purine, and deazapurine. 2 is a nucleobase comprising a ring selected from pyridine, pyrimidine, purine, and deazapurine. 2is a nucleobase functionalized with a chemical protecting group, wherein the nucleobase comprises a ring selected from pyridine, pyrimidine, purine, and deazapurine. 2 is a nucleobase functionalized with a chemical protecting group, wherein the nucleobase comprises a ring selected from pyridine, pyrimidine, purine, and deazapurine. 2 is selected from the group consisting of adenine, guanine, cytosine, 5-methyl-cytosine, thymine, uracil, and hypoxanthine. 2 is selected from the group consisting of adenine, guanine, cytosine, thymine, and uracil.

[0062] In some embodiments of the conjugate of Formula (I), t is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. In some embodiments, t is an integer between 10 and 30. In some embodiments, t is an integer between 18 and 30. In some embodiments, t is an integer between 13 and 33. In some embodiments, t is an integer between 15 and 35. In some embodiments, t is 18. In some embodiments, t is 19. In some embodiments, t is 20. In some embodiments, t is 21. In some embodiments, t is 22. In some embodiments, t is 23. In some embodiments, t is 24. In some embodiments, t is 25. In some embodiments, t is 26. In some embodiments, t is 27. In some embodiments, t is 28. In some embodiments, t is 29. In some embodiments, t is 30.

[0063] In some embodiments of the conjugate of Formula (I), each R 2 are the nucleobases, and all R 2The groups together form a targeting sequence. In some embodiments, the targeting sequence is complementary to one or more bases of exon 11 of the human LMNA gene, including the wild-type sequence (SEQ ID NO: 1) and / or the sequence found in HGPS patients, as shown in SEQ ID NO: 2. These targeting sequences are shown in Table 1 below. [Table 1]

[0064] Examples include targeting sequences that are fully complementary to LMNA exon 11 (SEQ ID NO: 1 or 2), including targeting sequences that are also complementary to the cryptic splice sites of LMNA exon 11 underlined in SEQ ID NO: 1 and 2 in Table 1 (e.g., CAGGTGGGC / T).

[0065] In certain embodiments, the degree of complementarity between the target and the antisense targeting sequence is sufficient to form a stable duplex. The complementary region of the antisense oligomer containing the target RNA sequence can be as short as 8-11 bases, but is preferably 12-15 bases or longer, e.g., 12-20 bases, 12-25 bases, or 15-25 bases, including all integers and ranges therebetween. An antisense oligomer of about 14-15 bases is generally long enough to have a unique complementary sequence within the target mRNA. In certain embodiments, the required binding T M To achieve this, a minimum length of complementary bases may be required.

[0066] The stability of the duplex formed between the oligomer and the target sequence is M The T of an oligomer with respect to its complementary sequence RNA is a function of the T of the oligomer, which indicates the susceptibility of the duplex to enzymatic cleavage in the cell. Mcan be measured by conventional methods such as those described by Hames et al., Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108, or Miyada CG and Wallace RB, 1987, Oligomer Hybridization Techniques, Methods Enzymol. Vol. 154, pp. 94-107. In certain embodiments, the antisense oligomer is heated to a binding T of greater than body temperature, and in some embodiments, greater than about 45°C or 50°C, with respect to the complementary sequence RNA. M T in the range of 60 to 80°C M According to well-known principles, the T of an oligomer with respect to a complementary base RNA hybrid is M can be increased by increasing the ratio of C:G base pairs in the duplex, or by increasing the length (in base pairs) of the heteroduplex, or by increasing both. At the same time, it may be advantageous to limit the size of the oligomer in order to optimize cellular uptake. For this reason, compounds of the present disclosure are preferred for their length of 25 bases or less and for their high T M This includes compounds that exhibit a temperature of 45 to 50°C or higher.

[0067] In some embodiments, antisense oligonucleotides contain base modifications or substitutions. For example, specific nucleobases may be selected to improve the binding affinity of the antisense oligonucleotides described herein. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and 0-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil, 5-propynylcytosine, and 2,6-diaminopurine). 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6 to 1.2°C and may be incorporated into the antisense oligonucleotides described herein. In one embodiment, at least one pyrimidine base of the oligonucleotide comprises a 5-substituted pyrimidine base, the pyrimidine base being selected from the group consisting of cytosine, thymine, and uracil. In one embodiment, the 5-substituted pyrimidine base is 5-methylcytosine. In another embodiment, at least one purine base of the oligonucleotide comprises an N-2, N-6 substituted purine base. In one embodiment, the N-2, N-6 substituted purine base is 2,6-diaminopurine.

[0068] Table 2 provides various embodiments of the nucleotide moieties described herein. [Table 2]

[0069] In certain embodiments, oligomers as long as 40 bases may be suitable, with at least a minimum number of bases, e.g., 10-12 bases, being complementary to the target sequence. However, typically, enhanced or active uptake into cells is optimized with oligomer lengths of less than about 30 bases. Contemplated herein are antisense oligomers consisting of about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bases. and at least about 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous and / or non-contiguous bases thereof are complementary to a target sequence described herein, including the target sequences of SEQ ID NOs: 1 and / or 2, or variants thereof.

[0070] In certain embodiments, antisense oligomers can be 100% complementary to the LMNA pre-mRNA nucleic acid target sequence, or can contain mismatches, for example, to accommodate variants, as long as the heteroduplex formed between the oligomer and the target sequence is stable enough to withstand the action of cellular nucleases and other degradation or substitution patterns that may occur in vivo.If present, mismatches are less destabilizing toward the end regions of the hybrid duplex than toward the center.The number of mismatches tolerated depends on the length of the oligomer, the proportion of G:C base pairs in the duplex, and the position of the mismatch in the duplex, according to well-understood principles of duplex stability.Such antisense oligomers are not necessarily 100% complementary to the target sequence, but are effective in stably and specifically binding to the target sequence so as to regulate the biological activity of the nucleic acid target, for example, the expression of progerin protein.

[0071] In certain embodiments, the antisense activity of an oligomer can be enhanced by using a mixture of uncharged phosphorodiamidate linkages and cationic phosphorodiamidate linkages. The total number of cationic linkages in the oligomer can vary from 1 to 10 (including all integers therebetween) and can be dispersed throughout the oligomer. In some embodiments, the number of charged linkages is at least 2, and no more than half of the total backbone linkages are positively charged, for example, 2, 3, 4, 5, 6, 7, or 8, and preferably, each charged linkage is separated by at least 1, 2, 3, 4, or 5 uncharged linkages along the backbone.

[0072] Examples of antisense sequences for targeting human LMNA pre-mRNA are shown below in Table 3. Antisense oligonucleotides can include all or part of these targeting sequences. [Table 3]

[0073] Thus, in some embodiments of the conjugate of formula (I), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is selected from: (a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) (where t is 23); (b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) (where t is 23).

[0074] In some embodiments of the conjugate of Formula (I), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), where t is 23. In some embodiments, each R 2 are the nucleobases, and all R 2The groups together form a targeting sequence, and the targeting sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity or sequence homology to SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC).

[0075] In some embodiments of the conjugate of Formula (I), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG), where t is 23. In some embodiments, each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity or sequence homology to SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGGG).

[0076] In some embodiments of the conjugate of Formula (I), E' is -H, -C 1-6 -Alkyl, -C(O)C 1-6 In some embodiments, E' is selected from -alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, and trimethoxytrityl. 1-6 -Alkyl, -C(O)C 1-6 -Alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, and [ka] is selected from.

[0077] In some embodiments of the conjugate of Formula (I), E' is selected from -H, -C(O)CH3, benzoyl, stearoyl, trityl, 4-methoxytrityl, and [ka] is selected from.

[0078] In some embodiments of the conjugate of Formula (I), E' is -H. In some embodiments, E' is -C 1-6 In some embodiments, E' is -C(O)C 1-6 In some embodiments, E' is -alkyl. In some embodiments, E' is -C(O)CH3. In some embodiments, E' is benzoyl. In some embodiments, E' is stearoyl. In some embodiments, E' is trityl. In some embodiments, E' is monomethoxytrityl. In some embodiments, E' is dimethoxytrityl. In some embodiments, E' is trimethoxytrityl. In some embodiments, E' is 4-methoxytrityl. In some embodiments, E' is [ka] is.

[0079] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is selected from [ka] is.

[0080] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is selected from [ka] is.

[0081] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0082] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0083] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0084] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0085] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0086] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is [ka] is.

[0087] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is selected from H, -C(O)CH3, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0088] In some embodiments of the conjugate of Formula (I), A' is [ka] and E' is selected from H, -C(O)CH3, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0089] The variable L of the conjugate of Formula (I) can be any natural or unnatural amino acid (e.g., a β- or γ-amino acid). Thus, in some embodiments, L is alanine, arginine, asparagine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine. In other embodiments, L is isoglutamine, γ-aminobutyric acid, beta-alanine, 6-aminohexanoic acid, 6-aminopentanoic acid, norleucine, norvaline, p-fluorophenylalanine, or ethionine. In some embodiments of the conjugate of Formula (I), L is glutamic acid, isoglutamine, glycine, proline, γ-aminobutyric acid, or β-alanine. In some embodiments, L is glycine, proline, or β-alanine. In some embodiments, L is glutamic acid. In some embodiments, L is glutamic acid, provided that -COOH, if present in the glutamic acid residue, is replaced with -CONH2. In some embodiments, L is isoglutamine. In some embodiments, L is glycine. In some embodiments, L is proline. In some embodiments, L is γ-aminobutyric acid. In some embodiments, L is β-alanine.

[0090] The variable J of the conjugate of formula (I) may be any cell membrane penetrating peptide (referred to herein as a "CPP") known in the art.

[0091] A CPP has the ability to induce cell membrane permeability in up to 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of cells in a given cell culture population, including all integers therebetween, enabling macromolecular translocation within multiple tissues in vivo upon systemic administration. In some embodiments, the CPP is an arginine-rich peptide. The term "arginine-rich" refers to a CPP having at least two, preferably 2, 3, 4, 5, 6, 7, or 8, arginine residues, each optionally separated by one or more uncharged hydrophobic residues, and optionally containing about 6 to 14 amino acid residues. In some embodiments, the CPP is linked at its carboxy terminus to the 3' and / or 5' terminus of the antisense oligonucleotide via a linking amino acid, L, and the CPP is capped at its amino terminus with a substituent, G. [Table 4]

[0092] Transport moieties such as those described above have been shown to significantly enhance cellular import of the attached oligomer relative to uptake of the oligomer in the absence of the attached transport moiety, with uptake being enhanced by at least ten-fold, and in some embodiments, twenty-fold, relative to the unconjugated compound.

[0093] The use of arginine-rich peptide transporters (i.e., cell membrane-permeable peptides) is particularly useful in implementing the present disclosure. Certain peptide transporters have been shown to be highly effective in delivering antisense compounds to primary cells, including muscle cells. Furthermore, compared to other known peptide transporters, such as penetratin and Tat peptides, the peptide transporters described herein exhibit enhanced ability to alter the splicing of some gene transcripts when conjugated to antisense PMOs.

[0094] CPPs, their synthesis, and methods of conjugating to oligomers are further described in U.S. Application Publication No. 2012 / 0289457, and PCT Patent Application Publication Nos. WO2004 / 097017, WO2009 / 005793, and WO2012 / 150960, the disclosures of which are incorporated herein by reference in their entireties.

[0095] In some embodiments, J comprises or is selected from SEQ ID NOs: 5-21. In some embodiments, J comprises or is selected from SEQ ID NOs: 22-25. In some embodiments, J comprises or is selected from SEQ ID NOs: 26-27. In certain embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27.

[0096] In some embodiments of the conjugate of Formula (I), G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H or -C(O)C 1-6 In some embodiments, G is -alkyl. In some embodiments, G is -H or -C(O)CH. In some embodiments, G is H. In some embodiments, G is -C(O)C 1-6 In some embodiments, G is -alkyl. In some embodiments, G is -C(O)CH. In some embodiments, G is benzoyl. In some embodiments, G is stearoyl.

[0097] In some embodiments, [ka] has the following structure: [ka] wherein J is selected from SEQ ID NOs: 1-27, and G is selected from -H, -C(O)CH3, benzoyl, and stearoyl. In some embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27. In some embodiments, G is -H. In some embodiments, G is -C(O)CH3.

[0098] In some embodiments, [ka] has the following structure: [ka] wherein G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H. In some embodiments, G is -C(O)CH.

[0099] In some embodiments, [ka] has the following structure: [ka] wherein J is selected from SEQ ID NOs: 1-27, and G is selected from -H, -C(O)CH3, benzoyl, and stearoyl. In some embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27. In some embodiments, G is -H. In some embodiments, G is -C(O)CH3.

[0100] In some embodiments, [ka] has the following structure: [ka] wherein G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H. In some embodiments, G is -C(O)CH.

[0101] In some embodiments, [ka] has the following structure: [ka] wherein J is selected from SEQ ID NOs: 1-27, and G is selected from -H, -C(O)CH3, benzoyl, and stearoyl. In some embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27. In some embodiments, G is -H. In some embodiments, G is -C(O)CH3.

[0102] In some embodiments, [ka] has the following structure: [ka] wherein G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H. In some embodiments, G is -C(O)CH.

[0103] In some embodiments, [ka] has the following structure: [ka] wherein J is selected from SEQ ID NOs: 1-27, and G is selected from -H, -C(O)CH3, benzoyl, and stearoyl. In some embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27. In some embodiments, G is -H. In some embodiments, G is -C(O)CH3.

[0104] In some embodiments, [ka] has the following structure: [ka] wherein G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H. In some embodiments, G is -C(O)CH.

[0105] In some embodiments, [ka] has the following structure: [ka] wherein J is selected from SEQ ID NOs: 1-27, and G is selected from -H, -C(O)CH3, benzoyl, and stearoyl. In some embodiments, J is SEQ ID NO: 11. In some embodiments, J is SEQ ID NO: 25. In some embodiments, J is SEQ ID NO: 26. In some embodiments, J is SEQ ID NO: 27. In some embodiments, G is -H. In some embodiments, G is -C(O)CH3.

[0106] In some embodiments, [ka] has the following structure: [ka] wherein G is selected from -H, -C(O)CH, benzoyl, and stearoyl. In some embodiments, G is -H. In some embodiments, G is -C(O)CH.

[0107] In some embodiments, the antisense oligomer conjugate of formula (I) has a structure according to formula (IA): [ka] or a pharmaceutically acceptable salt thereof.

[0108] In some embodiments of the antisense oligomer conjugate of formula (IA), A' is [ka] In some embodiments, A' is a moiety selected from: [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] In some embodiments, A' is [ka] is.

[0109] In some embodiments of the antisense oligomer conjugate of Formula (IA), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), where t is 23. In some embodiments of the conjugate of Formula (IA), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, the targeting sequence being SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) (where t is 23).

[0110] In some embodiments, the antisense oligomer conjugate of formula (I) has a structure according to formula (II): [ka] or a pharmaceutically acceptable salt thereof.

[0111] In some embodiments of the antisense oligomer conjugate of Formula (II), each R 2 are the nucleobases, and all R 2The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), where t is 23. In some embodiments of the conjugate of Formula (II), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) (where t is 23).

[0112] In some embodiments, the antisense oligomer conjugate of Formula (I) has a structure according to Formula (IIA): [ka] In the formula, n is 9 to 39.

[0113] In some embodiments of the antisense oligomer conjugate of Formula (IIA), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, and the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), where n is 24. In some embodiments of the conjugate of Formula (IIA), each R 2 are the nucleobases, and all R 2 The groups together form a targeting sequence, the targeting sequence being SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG), where n is 24.

[0114] In some embodiments, the antisense oligomer conjugate of Formula (I) has a structure according to Formula (IIIa): [ka] or a pharmaceutically acceptable salt thereof.

[0115] In some embodiments, the antisense oligomer conjugate of Formula (I) has a structure according to Formula (IIIb): [ka] or a pharmaceutically acceptable salt thereof.

[0116] In some embodiments, the antisense oligomer conjugate of Formula (I) has a structure according to Formula (IVa): [ka] or a pharmaceutically acceptable salt thereof.

[0117] In some embodiments, the antisense oligomer conjugate of Formula (I) has a structure according to Formula (IVb): [ka] or a pharmaceutically acceptable salt thereof.

[0118] For clarity, the structural formulas of the antisense oligomer conjugates of formulas (IIIa), (IIIb), (IVa), and (IVb) are presented herein as 5'-to-3' sequential structural formulas, with various graphical breaks labeled "BREAK A," "BREAK B," and "BREAK C" to facilitate illustrating the entire structural formula in a compact form. Those skilled in the art will understand that, for example, each "BREAK A" designation indicates a continuation of the structural formula at these points. The same applies to each instance of "BREAK B" and "BREAK C" in the structural formulas of the antisense oligomers of formulas (IIIa), (IIIb), (IVa), and (IVb). None of the graphical breaks described above or used herein are intended to indicate, and those skilled in the art will not understand, an actual break in the structural formulas of the antisense oligomer conjugates of formulas (IIIa), (IIIb), (IVa), and (IVb).

[0119] In some embodiments, the antisense oligomer conjugates of the present disclosure, including, for example, conjugates of Formula (I), (IA), (II), (IIIa), (IIIb), (IVa), and (IVb), are pharmaceutically acceptable salts. In certain embodiments, the pharmaceutically acceptable salt is an HCl (hydrochloric acid) salt. For example, in some embodiments, the conjugate of Formula (I) is an HCl salt. In certain embodiments, the conjugate of Formula (I) is a 6HCl salt. In some embodiments, the conjugate of Formula (IA) is an HCl salt. In certain embodiments, the conjugate of Formula (IA) is a 6HCl salt. In some embodiments, the conjugate of Formula (II) is an HCl salt. In certain embodiments, the conjugate of Formula (IIa) is an HCl salt. In certain embodiments, the conjugate of Formula (IIIa) is an HCl salt. In certain embodiments, the conjugate of Formula (IIIa) is a 6HCl salt. In some embodiments, the conjugate of Formula (IIIb) is an HCl salt. In certain embodiments, the conjugate of Formula (IIIb) is a 6HCl salt. In some embodiments, the conjugate of Formula (IVa) is an HCl salt. In certain embodiments, the conjugate of Formula (IVa) is a 6HCl salt. In some embodiments, the conjugate of Formula (IVb) is an HCl salt. In certain embodiments, the conjugate of Formula (IVb) is a 6HCl salt.

[0120] In some embodiments, the antisense oligomer conjugate is present in the pharmaceutical composition at a concentration of about 10 mg / mL to about 125 mg / mL. In some embodiments, the antisense oligomer conjugate is present in the pharmaceutical composition at a concentration of about 50 mg / mL to about 125 mg / mL. In some embodiments, the antisense oligomer conjugate is present in the pharmaceutical composition at a concentration of about 75 mg / mL to about 125 mg / mL. In some embodiments, the antisense oligomer conjugate is present in the pharmaceutical composition at a concentration of about 90 mg / mL to about 110 mg / mL. In some embodiments, the antisense oligomer conjugate is present in the pharmaceutical composition at a concentration of about 100 mg / mL.

[0121] Excipients, diluents, and carriers In addition to the antisense oligomer conjugate of Formula (I) described herein, the pharmaceutical composition of the present disclosure comprises benzyl alcohol. The pharmaceutical composition may further comprise an additional excipient, diluent, or carrier.

[0122] In some embodiments, benzyl alcohol is present in the range of about 0.1% to about 10% by weight, more preferably about 0.5% to about 7% by weight, and more preferably about 0.5% to about 5% by weight. In some embodiments, the pharmaceutical composition comprises about 0.5% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 1% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 1.5% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 2.5% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 3.0% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 3.5% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 4.0% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 4.5% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 5.0% by weight of benzyl alcohol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% benzyl alcohol by weight.

[0123] In some embodiments, the pharmaceutical composition further comprises one or more of histidine, mannitol, propylene glycol, glycerin, arginine, lysine, tryptophan, or phenol. In some embodiments, the pharmaceutical composition further comprises histidine or tryptophan. In some embodiments, the pharmaceutical composition further comprises histidine. In some embodiments, the pharmaceutical composition further comprises mannitol. In some embodiments, the pharmaceutical composition further comprises propylene glycol. In some embodiments, the pharmaceutical composition further comprises glycerin. In some embodiments, the pharmaceutical composition further comprises arginine. In some embodiments, the pharmaceutical composition further comprises lysine. In some embodiments, the pharmaceutical composition further comprises tryptophan. In some embodiments, the pharmaceutical composition further comprises phenol.

[0124] In some embodiments, the pharmaceutical composition further comprises a buffer. Suitable buffers for administering a compound to a subject (e.g., via subcutaneous administration) are known in the art and within the skill of the art. In some examples, the pharmaceutical composition further comprises a buffer selected from phosphate, histidine, or citrate. In some embodiments, the pharmaceutical composition further comprises histidine or citrate.

[0125] In some embodiments, the pharmaceutical composition further comprises histidine. In some embodiments, the histidine is present in the pharmaceutical composition at a concentration ranging from about 5 mM to about 50 mM, more preferably from about 10 mM to about 40 mM, and more preferably from about 15 mM to about 25 mM. In some embodiments, the histidine is present in the pharmaceutical composition at a concentration of about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, or about 50 mM. In some embodiments, the histidine is present in the pharmaceutical composition at a concentration of about 10 mM to about 30 mM. In some embodiments, the histidine is present in the pharmaceutical composition at a concentration of about 15 mM to about 25 mM. In some embodiments, the histidine is present in the pharmaceutical composition at a concentration of about 20 mM.

[0126] In some embodiments, the pharmaceutical composition further comprises citrate. In some embodiments, citrate is present in the pharmaceutical composition at a concentration ranging from about 5 mM to about 50 mM, more preferably from about 10 mM to about 40 mM, and more preferably from about 15 mM to about 25 mM. In some embodiments, citrate is present in the pharmaceutical composition at a concentration of about 5 mM, about 10 mM, about 15 mM, about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, or about 50 mM. In some embodiments, citrate is present in the pharmaceutical composition at a concentration of about 10 mM to about 30 mM. In some embodiments, citrate is present in the pharmaceutical composition at a concentration of about 15 mM to about 25 mM. In some embodiments, citrate is present in the pharmaceutical composition at a concentration of about 20 mM.

[0127] In some embodiments, the pharmaceutical composition further comprises tryptophan. In some embodiments, tryptophan is present in a range of about 0.1% to about 10% by weight, more preferably about 0.5% to about 7% by weight, and more preferably about 0.5% to about 5% by weight. In some embodiments, the pharmaceutical composition comprises about 0.5% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 1% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 1.5% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 2.5% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 3.0% by weight tryptophan. In some embodiments, the pharmaceutical composition comprises about 0.5% to about 3% by weight tryptophan.

[0128] In some embodiments, the pharmaceutical composition further comprises propylene glycol. In some embodiments, propylene glycol is present in the range of about 0.1% to about 10% by weight, more preferably about 0.5% to about 7% by weight, and more preferably about 0.5% to about 5% by weight. In some embodiments, the pharmaceutical composition comprises about 0.5% by weight propylene glycol. In some embodiments, propylene glycol is present in the range of about 2% to about 3% by weight. In some embodiments, the pharmaceutical composition comprises about 1% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 1.5% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.1% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.2% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.3% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.4% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.5% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 3.0% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 3.5% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 4.0% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 4.5% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 5.0% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight propylene glycol.

[0129] In some embodiments, the pharmaceutical composition further comprises mannitol. In some embodiments, mannitol is present in the range of about 0.1% to about 10% by weight, more preferably about 0.5% to about 7% by weight, and more preferably about 1% to about 7% by weight. In some embodiments, the pharmaceutical composition comprises about 1% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 2% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 3% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 4% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 4.5% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 5% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 5.5% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 6% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 7% by weight mannitol. In some embodiments, the pharmaceutical composition comprises about 8% mannitol. In some embodiments, the pharmaceutical composition comprises about 2.0% to about 8.0% by weight of mannitol.

[0130] In some embodiments, the pharmaceutical composition further comprises histidine and propylene glycol.

[0131] In some embodiments, the pharmaceutical composition further comprises histidine and mannitol.

[0132] In some embodiments, the pharmaceutical composition has a pH in the range of about 5.5 to about 7.5. In some embodiments, the pharmaceutical composition has a pH in the range of about 6.0 to about 7.0. In some embodiments, the pharmaceutical composition has a pH in the range of about 6.5 to about 7.0. In some embodiments, the pharmaceutical composition has a pH of about 6.4. In some embodiments, the pharmaceutical composition has a pH of about 6.5. In some embodiments, the pharmaceutical composition has a pH of about 6.6. In some embodiments, the pharmaceutical composition has a pH of about 6.7. In some embodiments, the pharmaceutical composition has a pH of about 6.8. In some embodiments, the pharmaceutical composition has a pH of about 6.9. In some embodiments, the pharmaceutical composition has a pH of about 7.0. In some embodiments, the pharmaceutical composition has a pH of about 7.1.

[0133] In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight of benzyl alcohol, and the composition has a pH of about 6.5 to about 7.0. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight of benzyl alcohol, and the composition has a pH of about 6.5.

[0134] In some embodiments, the pharmaceutical composition comprises an antisense oligomer conjugate of the present disclosure, benzyl alcohol, histidine, and propylene glycol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight of benzyl alcohol and about 1.0% to about 3.0% by weight of propylene glycol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight of benzyl alcohol, about 10 mM to about 30 mM of histidine, and about 1.0% to about 3.0% by weight of propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.0% to about 3.0% by weight of benzyl alcohol, about 10 mM to about 30 mM of histidine, and about 1.0% to about 3.0% by weight of propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.0% to about 3.0% by weight of benzyl alcohol and about 2.0% by weight of propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight benzyl alcohol and about 2.2% by weight propylene glycol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight benzyl alcohol, histidine at a concentration of about 20 mM, and about 2.0% by weight propylene glycol. In some embodiments, the pharmaceutical composition has a pH of about 6.5.

[0135] In some embodiments, the pharmaceutical composition comprises an antisense oligomer conjugate of the present disclosure, benzyl alcohol, histidine, and mannitol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight of benzyl alcohol and about 2.0% to about 8.0% by weight of mannitol. In some embodiments, the pharmaceutical composition comprises about 1.0% to about 3.0% by weight of benzyl alcohol, about 10 mM to about 30 mM of histidine, and about 2.0% to about 8.0% by weight of mannitol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight of benzyl alcohol and about 5.0% by weight of mannitol. In some embodiments, the pharmaceutical composition comprises about 2.0% by weight of benzyl alcohol, about 20 mM of histidine, and about 5.0% by weight of mannitol. In some embodiments, the pharmaceutical composition has a pH of about 6.5.

[0136] In one embodiment, the pharmaceutical composition comprises about 2% by weight benzyl alcohol, and the composition has a pH of about 6.5. In another embodiment, the pharmaceutical composition comprises about 2% by weight benzyl alcohol and about 2-3% by weight propylene glycol, and the composition has a pH of about 6.5. In another embodiment, the pharmaceutical composition comprises about 2% by weight benzyl alcohol and about 2.2% by weight propylene glycol, and the composition has a pH of about 6.5. In another embodiment, the pharmaceutical composition comprises about 2% by weight benzyl alcohol and about 5% by weight mannitol, and the composition has a pH of about 6.5.

[0137] In some embodiments, the pharmaceutical composition has a viscosity of about 20 centipoise (cp) or less. In some embodiments, the pharmaceutical composition has a viscosity of about 10 cp or less. In some embodiments, the pharmaceutical composition has a viscosity of about 5 cp or less. In some embodiments, the pharmaceutical composition has a viscosity of about 2 cp to about 4 cp. In some embodiments, the pharmaceutical composition has a viscosity of about 2.5 cp to about 3.5 cp. In some embodiments, the pharmaceutical composition has a viscosity of about 3 cp.

[0138] The term "pharmaceutically acceptable" is used herein to refer to those compounds, substances, compositions, and / or dosage forms which, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0139] As used herein, the term "pharmaceutically acceptable carrier" means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium, calcium, or zinc stearate, or stearic acid), or solvent encapsulating material that is involved in carrying or transporting a compound of interest from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.

[0140] The pharmaceutical compositions of the present disclosure may be specially formulated for administration in solid or liquid form, including those adapted for: (1) oral administration, e.g., as an immersion solution (aqueous or non-aqueous solution or suspension), tablet, e.g., buccal, sublingual, or tablet targeted for systemic absorption, bolus, powder, granule, paste for application to the tongue; (2) parenteral administration, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection, e.g., as a sterile solution or suspension or sustained release formulation; (3) topical application, e.g., as a cream, ointment, or controlled-release patch or spray for application to the skin; (4) vaginal or rectal administration, e.g., as a pessary, cream, or foam; (5) sublingual administration; (6) ocular administration; (7) transdermal administration; or (8) nasal administration.

[0141] Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository wax; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; and (10) glycols, such as protease inhibitors. (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol, (12) esters, such as ethyl oleate and ethyl laurate, (13) agar, (14) buffers, such as magnesium hydroxide and aluminum hydroxide, (15) alginic acid, (16) pyrogen-free distilled water, (17) isotonic saline, (18) Ringer's solution, (19) ethyl alcohol, (20) pH buffers, (21) polyesters, polycarbonates, and / or polyanhydrides, and (22) other non-toxic compatible materials used in pharmaceutical formulations.

[0142] Additional non-limiting examples of drugs suitable for formulation with the antisense oligomer conjugates of Formula (I) and benzyl alcohol of the present disclosure include PEG-conjugated nucleic acids, phospholipid-conjugated nucleic acids, nucleic acids containing lipophilic moieties, phosphorothioates, P-glycoprotein inhibitors (such as Pluronic® P85) which can enhance drug entry into various tissues; biodegradable polymers, such as poly(DL-lactide-coglycolide) microspheres for sustained delivery after implantation (Emerich, DF et al., 1999, Cell Transplant, 8, 47-58) Alkermes, Inc. Cambridge, Mass.; and loaded nanoparticles, such as those composed of polybutylcyanoacrylate, which can deliver drugs across the blood-brain barrier and alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).

[0143] The present disclosure also provides compositions comprising surface-modified liposomes containing poly(ethylene glycol) lipids (PEG-modified, branched, and unbranched, or a combination thereof, or long-circulating or stealth liposomes). The oligomers of the present invention can also contain covalently attached PEG molecules of various molecular weights. These formulations provide a method for increasing drug accumulation in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear cell phagocytic system (MPS or RES), thereby allowing for extended blood circulation time and enhanced tissue exposure of encapsulated drugs (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to selectively accumulate in tumors, likely due to extravasation and entrapment in angiogenic target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). Long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes, which are known to accumulate in MPS tissues (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International Patent Publication No. WO96 / 10391; Ansell et al., International Patent Publication No. WO96 / 10390; Holland et al., International Patent Publication No. WO96 / 10392). Long-circulating liposomes also likely protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.

[0144] In a further embodiment, the composition of the present disclosure comprises the oligomer composition prepared for delivery, as described in U.S. Patent Nos. 6,692,911, 7,163,695, and 7,070,807. In this regard, in one embodiment, the present disclosure provides the oligomer of the present invention in a composition comprising the lysine and histidine (HK) copolymer described in U.S. Patent Nos. 7,163,695, 7,070,807, and 6,692,911, alone or in combination with PEG (for example, branched or unbranched PEG, or a mixture of both), in combination with PEG and a targeting moiety, or in combination with a crosslinker. In certain embodiments, the present disclosure provides a composition comprising an antisense oligomer conjugate, benzyl alcohol, and gluconate-modified polyhistidine or gluconyl-modified polyhistidine / transferrin-polylysine. Those skilled in the art will also recognize that His, and amino acids with properties similar to Lys, can be substituted within the compositions.

[0145] Wetting agents, emulsifying agents, and lubricating agents, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring, and perfuming agents, preservatives, and antioxidants can also be present in the composition.

[0146] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants, such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, etc.; and (3) metal chelating agents, such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.

[0147] In certain embodiments, compositions of the present disclosure comprise an excipient selected from cyclodextrins, celluloses, liposomes, micelle-forming agents such as bile acids, and polymeric carriers such as polyesters and polyanhydrides, an antisense oligomer conjugate of Formula (I), and benzyl alcohol. In certain embodiments, the above formulations render the oligomers of the present invention orally bioavailable.

[0148] Compositions of the present disclosure include formulations suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. In certain embodiments, pharmaceutical compositions are formulated for subcutaneous administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will generally be that amount of the compound that produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about 99 percent of the active ingredient, preferably from about 5 percent to about 70 percent, and most preferably from about 10 percent to about 30 percent.

[0149] Methods of preparing these compositions include the step of bringing into association an antisense oligomer conjugate of Formula (I), benzyl alcohol, and, optionally, one or more accessory ingredients or carriers. In general, the formulations are prepared by uniformly and intimately bringing into association a conjugate of the present disclosure with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0150] Methods of Use and Additional Formulation Ingredients The present disclosure further provides a method for treating a progeroid disease, such as a laminopathic disorder or a related disease or condition, in a subject in need thereof by administering to the subject a pharmaceutical composition comprising benzyl alcohol and an antisense oligomer conjugate of Formula (I) described herein. In some embodiments, the oligonucleotide inhibits expression of mutant LMNA protein mRNA by modulating splicing of LMNA pre-mRNA. In certain aspects, the present disclosure provides a method for treating Hutchinson-Gilford Progeria Syndrome (HGPS) in a subject in need thereof, comprising administering to the subject a pharmaceutical composition of the present disclosure. In some embodiments, the pharmaceutical composition is formulated for subcutaneous administration to the subject. In some embodiments, the pharmaceutical composition is administered to the subject by subcutaneous administration.

[0151] In certain aspects, for example, these and related methods may be applied to treat progeroid laminopathies in clinical settings where progerin expression is associated with diseases such as HGPS. These and related embodiments may also be combined with methods of treating or reducing progeroid laminopathies by administering the disclosed methods simultaneously or sequentially with other treatments.

[0152] The methods described herein can be generalized to the aging process and related conditions and diseases beyond progeroid laminopathies. This is because HGPS is closely related to the normal aging process in many ways. HGPS continues to be recognized as a useful model of aging (Fossel, J. Pediatr Endocrinol Metab 13 Suppl 6:1477-1481, 2000). For example, there is a strong link to atherosclerosis, particularly in the coronary arteries. Furthermore, the alopecia in HGPS is similar to that seen in elderly subjects. Furthermore, a key cellular characteristic of HGPS is early cellular senescence, as described many years ago by Hayflick et al. (Hayflick, N Engl J Med 295:1302-1308, 1976). The limited number of cell divisions in HGPS fibroblasts is similar to that seen in fibroblasts derived from elderly individuals. This was further explored by studies showing similarities in gene expression patterns between HGPS fibroblasts and those derived from elderly individuals, distinguishing them from fibroblasts derived from younger individuals (Ly et al., Science 287:2486-2492, 2000).

[0153] Thus, it will be understood that a method for treating a progeroid disease or related condition, as described herein, can include treatment of a progeroid laminopathic disorder such as HGPS, or another progeroid disease or condition, an age-related condition, or a cardiovascular disease or condition (such as atherosclerosis).

[0154] It will be understood that effective in vivo treatment regimens using the methods of the present disclosure may vary depending on the duration, dose, frequency, and route of administration of the pharmaceutical composition, as well as the condition of the subject being treated (i.e., preventive administration versus administration according to a pre-existing condition).Therefore, such in vivo therapy often requires monitoring by tests appropriate for the particular type of disease being treated, and corresponding adjustment of the dose or treatment regimen to achieve optimal treatment results.

[0155] In certain embodiments, the methods of the present disclosure use formulations or compositions suitable for therapeutic delivery of the antisense oligomers described herein. Thus, in certain embodiments, the methods of the present disclosure use pharmaceutically acceptable compositions comprising a therapeutically effective amount of one or more of the antisense oligomer conjugates described herein, formulated with benzyl alcohol, and optionally one or more pharmaceutically acceptable carriers (additives) and / or diluents.

[0156] Methods for delivery of nucleic acid molecules are described, for example, in Akhtar et al., 1992, Trends Cell Bio., 2:139; and Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar; Sullivan et al., PCT Application Publication No. WO 94 / 02595.

[0157] Compositions and formulations suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (with a flavored base, usually sucrose and acacia or tragacanth), powders, granules, or as a solution or suspension in an aqueous or non-aqueous liquid, or as an oil-in-water or water-in-oil liquid emulsion, or as an elixir or syrup, or as a pastille (with an inert base, e.g., gelatin and glycerin, or sucrose and acacia), and / or as a mouthwash, each containing a predetermined amount of a compound of the present invention as an active ingredient. Compositions of the present disclosure may also be administered as a bolus, electuary, or paste.

[0158] In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules, lozenges, etc.), the active ingredient may be incorporated into one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and / or the following: (1) fillers or extenders, such as starch, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) humectants, such as glycerol; (4) disintegrants, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) disintegrants, such as sorbitol, ... (5) dissolution retarders, such as paraffin; (6) absorption enhancers, such as quaternary ammonium compounds and surfactants, such as poloxamers and sodium lauryl sulfate; (7) wetting agents, such as cetyl alcohol, glycerol monostearate, and nonionic surfactants; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (10) coloring agents; and (11) release-controlling agents, such as crospovidone or ethylcellulose. For capsules, tablets, and pills, the pharmaceutical compositions may also contain buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-shell gelatin capsules, using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols.

[0159] Tablets may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surface-active agents, or dispersing agents. Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.

[0160] Tablets and other solid dosage forms of pharmaceutical compositions used in accordance with the present disclosure, such as dragees, capsules, pills, and granules, can be optionally scored or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They can also be formulated to provide sustained or controlled release of the active ingredient therein, using, for example, hydroxypropylmethylcellulose in various proportions to provide the desired release profile, other polymer matrices, liposomes, and / or microspheres. They can also be formulated for rapid release, such as by lyophilization. They can be sterilized, for example, by filtration through a bacteria-retaining filter or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved in sterile water or some other sterile injectable medium immediately before use. These compositions can also optionally contain opacifying agents and can be compositions that release the active ingredient only, or preferentially, in a certain portion of the digestive tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0161] The liquid dosage form for oral administration of the compound of the present disclosure includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.In addition to active ingredient, liquid dosage form can contain the inert diluent commonly used in the art, such as water or other solvent, solubilizer and emulsifier, for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and fatty acid ester of sorbitan, and their mixtures.

[0162] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

[0163] In addition to the active compound, suspensions may contain suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.

[0164] Compositions or formulations for rectal or vaginal administration may be presented as suppositories, which can be prepared by mixing one or more conjugates of the present invention with one or more suitable non-irritating excipients or carriers including, for example, cocoa butter, polyethylene glycol, a suppository wax, or a salicylate, which are solid at room temperature but liquid at body temperature and therefore will melt in the rectum or vaginal cavity and release the active compound.

[0165] The compositions or formulations for topical or transdermal administration of the conjugates provided herein include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants.The active oligomer can be mixed under sterile conditions with a pharmaceutically acceptable carrier and any preservatives, buffers, or propellants that may be required.Ointments, pastes, creams, and gels can contain excipients such as animal and vegetable fats, oils, waxes, paraffins, starches, tragacanth, cellulose derivatives, polyethylene glycol, silicones, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof, in addition to the active compound of the present invention.

[0166] Powders and sprays can contain, in addition to the conjugates of the present disclosure, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures of these substances. Sprays can additionally contain customary propellants, such as chlorofluorohydrocarbons, and volatile unsubstituted hydrocarbons, such as butane and propane.

[0167] Transdermal patches have the additional advantage of providing controlled delivery of the conjugates of the present disclosure into the body. Such dosage forms can be prepared by dissolving or dispersing the conjugates in a suitable medium. Absorption enhancers can also be used to increase the flux of the drug across the skin. The rate of such flux can be controlled by providing a rate-controlling membrane or dispersing the drug in a polymer matrix or gel, among other methods known in the art.

[0168] Pharmaceutical compositions suitable for parenteral administration may contain one or more antisense oligomer conjugates of Formula (I) and benzyl alcohol in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted immediately before use into sterile injectable solutions or dispersions, which may contain sugars, alcohols, antioxidants, buffers, bacteriostatic agents, solutes that make the formulation isotonic with the blood of the intended recipient, or suspending agents or thickening agents. Examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (glycerol, propylene glycol, polyethylene glycol, etc.), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.

[0169] The compositions of the present disclosure may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of microbial action on the subject oligomers can be ensured by including various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, and the like. It may also be desirable to include isotonic agents, such as sugars and sodium chloride, in the compositions. Furthermore, prolonged absorption of the injectable dosage form can be brought about by including agents that delay absorption, such as aluminum monostearate and gelatin.

[0170] In some cases, in order to prolong the effect of drugs, it is desirable to delay the absorption of drugs from subcutaneous injection or intramuscular injection.This can be achieved by using a liquid suspension of poorly water-soluble, crystalline or amorphous material, among other methods known in the art.The absorption rate of drug then depends on its dissolution rate, which in turn depends on crystal size and crystalline form.Alternatively, the delayed absorption of parenterally administered drug forms can be achieved by dissolving or suspending the drug in an oil vehicle.

[0171] Injectable depot forms can be made by forming microencapsulated matrices of the subject conjugates in biodegradable polymers such as polylactide-polyglycolide. The rate of oligomer release can be controlled depending on the ratio of oligomer to polymer and the properties of the particular polymer used. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0172] As mentioned above, the formulations or preparations used in the present disclosure can be administered orally, parenterally, topically, or rectally. They are typically administered in a form suitable for each administration route. For example, they are administered in the form of tablets or capsules, by injection, inhalation, eye lotion, ointment, suppository, etc., by injection, infusion, or inhalation, by topical administration with lotion or ointment, and by rectal administration with suppositories.

[0173] As used herein, the phrases "parenteral administration" and "administered parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion. In certain embodiments, the pharmaceutical composition is administered to a subject by subcutaneous administration.

[0174] As used herein, the phrases "systemic administration," "systemically administered," "peripheral administration," and "peripherally administered" refer to the administration of a compound, drug, or other substance other than by direct administration into the central nervous system, e.g., subcutaneous administration, thereby entering the patient's system and thereby becoming subject to metabolism and other similar processes.

[0175] Regardless of the route of administration selected, the compositions of the present disclosure can be formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. The actual dosage level of the active ingredient in the pharmaceutical compositions of the present invention can be varied to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration without being unacceptably toxic to the patient.

[0176] The selected dosage level will depend on a variety of factors, including the activity of the particular conjugate of the present disclosure employed, the route of administration, the time of administration, the rate of excretion or metabolism of the particular oligomer employed, the rate and extent of absorption, the duration of treatment, other drugs, compounds, and / or materials used in combination with the particular oligomer employed, the age, sex, weight, condition, general health, and medical history of the patient being treated, and similar factors well known in the medical arts.

[0177] A physician or veterinarian of ordinary skill in the art can easily determine and prescribe the effective amount of the pharmaceutical composition required. For example, a physician or veterinarian can start administering the conjugate of the present disclosure used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved. Generally, a suitable daily dose of the conjugate of the present disclosure is the amount of the conjugate that is the lowest dose effective to produce a therapeutic effect. Such an effective amount will generally depend on the factors described above. Generally, oral, intravenous, intracerebroventricular, and subcutaneous doses of the conjugate of the present disclosure for a patient, when used for the indicated effect, range from about 0.0001 to about 100 mg per kilogram of body weight per day.

[0178] If desired, the effective daily dose of the conjugate may be administered as two, three, four, five, six, or more subdoses administered separately at appropriate intervals throughout the day, optionally in unit dosage forms. In certain circumstances, administration is a single daily administration. In certain embodiments, administration is one or more administrations every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months, as needed to treat the desired condition.

[0179] In certain embodiments, the formulations used in the present disclosure comprise a biocompatible polymer selected from the group consisting of polyamides, polycarbonates, polyalkylenes, polymers of acrylic and methacrylic esters, polyvinyl polymers, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, cellulose, polypropylene, polyethylene, polystyrene, polymers of lactic and glycolic acid, polyanhydrides, poly(ortho)esters, poly(butic acid), poly(valeric acid), poly(lactide-co-caprolactone), polysaccharides, proteins, polyhyaluronic acid, polycyanoacrylates, and blends, mixtures, or copolymers thereof.

[0180] Antisense oligomer conjugates can be formulated to be contained in or adapted to be released by surgical or medical devices or implants.In certain embodiments, implants can be coated with oligomers or otherwise treated.For example, hydrogels or other polymers such as biocompatible and / or biodegradable polymers can be used to coat implants with the compositions of the present invention (i.e., the compositions can be adapted to be used with medical devices by using hydrogels or other polymers).Polymers and copolymers for coating medical devices with drugs are well known in the art.Examples of implants include, but are not limited to, stents, drug-eluting stents, sutures, prostheses, vascular catheters, dialysis catheters, vascular grafts, artificial heart valves, cardiac pacemakers, implantable cardioverter-defibrillators, IV needles, bone and osteogenic devices, such as pins, screws, plates, and other devices, and artificial tissue matrices for wound healing.

[0181] In addition to the methods provided herein, compositions for use according to the present disclosure may be formulated for administration in any convenient manner for use in human or veterinary medicine, by analogy with other pharmaceuticals. The compositions may be administered alone or in combination with other therapeutic strategies in the treatment of relevant indications.

[0182] According to the method of the present disclosure, routes of antisense oligomer delivery include, but are not limited to, oral and parenteral routes, such as intravenous, subcutaneous, intraperitoneal, and intramuscular routes, as well as various systemic routes, including inhalation, transdermal, pulmonary, and local delivery.Appropriate routes can be determined by those skilled in the art as needed for the condition of the subject being treated.For example, suitable routes for the delivery of antisense oligomer conjugates in the treatment of skin conditions may include local delivery, while the delivery of antisense oligomer conjugates for the treatment of respiratory conditions (e.g., COPD) may include inhalation, intranasal, or pulmonary delivery.Conjugates may also be delivered directly to the site of inflammation, infection, or the bloodstream.

[0183] The composition can be administered in any convenient physiologically acceptable vehicle.Such composition can contain any of a variety of standard pharmaceutically acceptable carriers used by those skilled in the art.Examples include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions such as oil / water emulsions or triglyceride emulsions, tablets, and capsules.The selection of suitable physiologically acceptable carriers depends on the selected administration method.

[0184] Sustained-release compositions may also be used. These may include semipermeable polymer matrices in the form of shaped articles, such as films, or microcapsules.

[0185] In certain embodiments, the composition may be administered in an amount and manner effective to produce a peak blood concentration of the antisense oligomer conjugate of at least 200-400 nM. Typically, one or more doses of the conjugate are administered, generally at regular intervals, for a period of about 1-2 weeks. A preferred dose for oral administration is about 1-100 mg of conjugate per 70 kg. In some cases, doses exceeding 100 mg of conjugate per patient may be required. For intravenous (iv) administration, a preferred dose is about 1 mg-500 mg of conjugate per 70 kg. The conjugate may be administered at regular intervals for a short period of time, for example, daily, for up to two weeks. However, in some cases, the conjugate is administered intermittently for a longer period of time. Administration may be followed by or concurrent with the administration of antibiotics or other therapeutic treatments. The treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated based on the results of immunoassays, other biochemical tests, and physiological tests of the subject being treated.

[0186] kit In another aspect of the present disclosure, a kit is provided.The kit according to the present disclosure comprises a package containing the pharmaceutical composition of the present disclosure.In some embodiments, the kit comprises benzyl alcohol and an antisense oligonucleotide conjugate according to Formula I, or a pharmaceutically acceptable salt thereof.

[0187] The term "package" refers to any container that contains the pharmaceutical composition provided herein. In some embodiments, the package may be a box or a package. Packaging materials for use in packaging pharmaceuticals are well known to those skilled in the art. Examples of pharmaceutical packaging materials include, but are not limited to, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, bottles, and any packaging material appropriate for the selected formulation and intended administration method and treatment.

[0188] The kit may also include items that are not contained within the package but are attached to the outside of the package, such as, for example, pipettes.

[0189] The kit may further include instructions for administering the composition of the present disclosure to a patient. The kit may also include instructions for use of the antisense oligonucleotide conjugate described herein that have been approved by a regulatory agency, such as the U.S. Food and Drug Administration. The kit may also include a label or product insert for the conjugate. The package, the product insert, or both may themselves be approved by a regulatory agency. The kit may also include buffers for preparing solutions for carrying out the method, and pipettes for transferring liquids from one container to another. [Example]

[0190] Examples are described below for illustrative purposes to describe certain specific embodiments of the present disclosure.However, the scope of the claims is in no way limited by the examples described herein.Various changes and modifications to the disclosed embodiments are apparent to those skilled in the art, and such changes and modifications, including but not limited to, those relating to the chemical structures, substituents, derivatives, formulations or methods of the present disclosure, can be made without departing from the spirit of the present disclosure and the scope of the appended claims.The definitions of variables in the structures in the schemes herein are equivalent to those of the corresponding positions in the formulas presented herein.

[0191] Example 1: Viscosity testing of antisense oligomer conjugates To determine the highest acceptable concentration (viscosity ≦20 cp) of the antisense oligomer conjugate of the present disclosure for subcutaneous administration, solutions of the antisense oligomer conjugate of Formula (IVb) at various concentrations were prepared and tested for viscosity and syringeability.

[0192] Test conditions were prepared non-volumetrically from solid conjugate material in a buffer solution (50 mM citrate, pH = 6.5). Viscosity was measured at room temperature, and samples of 50 mg / mL and 100 mg / mL conjugate were tested both at room temperature and after 24 hours of storage at 2-8 °C. No pH adjustment was performed before QS. Syringeability was performed using a 30-gauge needle. Recovery and chromatographic overlay were measured via SCX-HPLC and SEC-HPLC, respectively. The test results are shown in Table 5 and Figure 1. [Table 5]

[0193] The viscosity of the tested antisense oligomer conjugates was found to increase exponentially with increasing concentration. Concentrations below 126 mg / mL (approximately 12 cP) were found to be syringeable through a 30 cc gauge needle. A slight increase in viscosity (<1 cP) was reported after overnight storage at 2-8°C. The presence of higher order species (as a result of aggregation) was observed in all test solutions and was found to be concentration-dependent (Figure 2).

[0194] Example 2: Excipient testing Several excipients compatible with subcutaneous administration were screened with the aim of lowering the concentration of antisense oligomer conjugates upon administration and reducing the formation of higher order species that may present potential toxicity.

[0195] Excipient Screening: Round 1 Formulations were prepared and screened to determine the effect of buffer type (phosphate vs. citrate) on inhibition of higher order species (aggregation). The effect of various excipient types (e.g., amino acids, cosolvents, salts, and sugar alcohols) on aggregation was also investigated.

[0196] Test solutions were prepared at 100 mg / mL of the antisense oligomer conjugate of Formula (IVb) from solid material and excipients in volumetric flasks containing 20 mM citrate or potassium phosphate buffer (both pH = 6.5). Samples were adjusted to a pH of approximately 6.5 prior to QS. Samples were stored at either room temperature or 2-8 °C between time points as indicated in the table below and analyzed via SEC-HPLC. The results of the studies are shown in Tables 6 and 7 and Figures 3, 4, and 5. [Table 6] [Table 7]

[0197] Of the excipients tested, benzyl alcohol had the greatest protective effect against the formation of higher order species in either citrate or phosphate buffers. Arginine was the second best-performing excipient when tested in citrate buffer, but no effect was observed for arginine in phosphate buffer. Of the two buffers tested, citrate appeared to confer a protective effect, particularly for the benzyl alcohol and arginine compositions. Most samples were found to be hypotonic.

[0198] Excipient Screening: Round 2 A second round of screening was conducted to explore the excipient chemical space of the best-performing conditions from Round 1 as well as to optimize the formulation osmolality through the use of sugars and polyalcohols. Formulations were prepared and tested as described in Round 1. The results of the testing are shown in Table 8 and Figure 6. [Table 8-1] [Table 8-2]

[0199] Testing additional cosolvents did not appear to significantly affect aggregation. Of the excipients and excipient combinations tested, only the benzyl alcohol composition was able to minimize aggregation of antisense oligonucleotide conjugates. A slight reduction in aggregation (<5%) was reported only in preparations containing glycerin, NMP, and propylene glycol. Generally, samples stored at room temperature were observed to have higher aggregation than samples stored at 2-8°C, likely due to increased molecular mobility. Most formulations were reported to be isotonic.

[0200] Excipient Screening: Round 3 Noting that the protective effect of benzyl alcohol may be due to π-stacking interactions occurring between the solvent and the antisense oligonucleotide conjugate, a third round of screening was conducted to evaluate alternative aromatic excipients compatible with subcutaneous administration. Solutions were prepared and tested as described in Round 1. The results of the testing are shown in Table 9 and Figure 7. [Table 9-1] [Table 9-2] [Table 9-3]

[0201] When used as single excipients, tryptophan and histidine showed some reduction (approximately 9%) in conjugate aggregation during preparation. Combination with benzyl alcohol showed a significant reduction in aggregation for both excipients, even after two weeks of storage at room temperature. Without wishing to be bound by theory, it is believed that π-stacking interactions between aromatic groups remain the primary reason for the increased physical stability. No significant effect was reported for phenol, phenylalanine, and m-cresol when used as single excipients.

[0202] Example 3: Accelerated Stability Testing The stability of compositions containing the antisense oligomer conjugate of Formula (IVb) was determined under accelerated conditions. The vehicles were designed based on the results of the screening round described in Example 2 and cover a formulation space of two buffers (citrate and histidine), two tonicity agents (mannitol and propylene glycol), one cosolvent (benzyl alcohol), and one stabilizer (tryptophan) at a pH ranging from 6.0 to 7.0. The four formulations screened in the accelerated stability study are listed in Table 10. [Table 10]

[0203] Formulations were volumetrically prepared from solid PPMO material in a vehicle. The pH of each formulation was adjusted to target prior to QS. Samples were placed under accelerated stability conditions at 60°C and tested via SCX-HPLC and SEC-HPLC at the time of preparation, after 7 days, and after 14 days. Recovery was set at 100% for pre-filtered samples. Purity was based on the relative total peak area obtained from SCX-HPLC analysis. The results of the testing are shown in Tables 11-18 and Figures 8 and 9. [Table 11] [Table 12] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17] [Table 18]

[0204] Of the formulations tested, the histidine / propylene glycol / benzyl alcohol and histidine / mannitol / benzyl alcohol compositions appeared to have the best stability.

[0205] After 14 days, a color change was observed in all tryptophan-containing formulations (light yellow at 25°C, orange at 60°C), likely due to excipient degradation. The color was observed to become more intense with increasing pH. At pH 7.0, a significant pH shift (approximately 0.4-0.5 pH units) was observed in the citrate / tryptophan-containing formulation. The histidine / mannitol / benzyl alcohol formulation showed a very light yellow discoloration, while the histidine / propylene glycol / benzyl alcohol formulation remained clear. Aggregation was observed to increase at elevated temperatures, likely due to increased molecular mobility. In general, the histidine formulations showed less aggregation over time than the citrate formulations. Furthermore, histidine appeared to inhibit aggregation at elevated temperatures. The polyethylene glycol formulations showed reduced aggregation at pH ≥ 6.5 compared to the mannitol formulations.

[0206] All formulations appeared chemically stable at 25°C (loss of purity and recovery ≤2%). At 60°C, citrate formulations generally showed greater degradation with increasing pH, although purity values ​​at pH 6–6.5 were reported to be very similar. The citrate / mannitol / benzyl alcohol formulation showed approximately 13–17% purity loss after two weeks at 60°C, while the citrate / propylene glycol / benzyl alcohol formulation showed approximately 19–21% purity loss under similar conditions. The histidine formulations showed overall greater chemical stability than the citrate formulations. The histidine / mannitol / benzyl alcohol formulation showed approximately 8–10% purity loss after two weeks at 60°C, while the histidine / propylene glycol / benzyl alcohol formulation showed 6–8% purity loss under similar conditions.

[0207] Example 4: Filter membrane compatibility The suitability of the two histidine buffered formulations of Example 4 for sterilization was determined by filtration through two membranes, polyethersulfone (PES) and polyvinylidene fluoride (PVDF), at pH 6.5.

[0208] The following two formulations were prepared from buffer, excipients, and solid PPMO in a volumetric flask and the pH was adjusted prior to QS. 100 mg / mL antisense oligomer conjugate, 20 mM histidine, 2% propylene glycol, 2% benzyl alcohol, pH 6.5 100 mg / mL antisense oligomer conjugate, 20 mM histidine, 5% mannitol, 2% benzyl alcohol, pH 6.5. Eight milliliters of the formulation was passed through the following filter membranes: 0.22μm high flow PES (Partorius, PN#16532, diameter 28mm, filtration area 6.2cm) 2 , hold-up volume 100-150 μL; 0.22μ PVDF membrane (EMD, PN#SLGVM33RS, diameter 33mm, filtration area 4.5cm 2 , hold-up volume <100 μL. The 1st, 4th, and 8th mL filtrates were collected and tested via SCX-HPLC. The results are shown in Table 19. [Table 19]

[0209] After filtration, all fractions appeared clear and colorless. No impurities were detected, and no chemical degradation was reported upon filtration through PES or PVDF membranes. Therefore, both formulations appear to be compatible with both PES and PVDF membranes.

[0210] Example 5: Stability under stress conditions The stability of a formulation containing the antisense oligomer conjugate of formula (IVb) (100 mg / mL), histidine (20 mM), benzyl alcohol (2%), and propylene glycol (2.2%) at pH 6.5 was evaluated upon exposure to photolytic stress (UV and visible light), shear force, and freeze / thaw stress.

[0211] Photolytic stress The formulations were exposed to two different photolysis conditions, with visible light ranging from 1.2 to 3.6k lux h (1, 2, and 3 times the ICH guidelines) overall, and 200 to 600 W h / m 2 The samples were exposed to UV radiation at a range of 1x, 2x, and 3x the ICH guidelines. Samples protected from radiation but exposed to the same conditions (black samples) were also used as a control. The results of the study are shown in Tables 20 and 21. [Table 20] [Table 21]

[0212] No significant changes in appearance, pH, recovery, or purity were observed under UV photolysis stress test conditions. No degradants were observed after UV exposure.

[0213] No significant purity loss or pH shift was reported after exposure to visible light. No decomposition products were observed after exposure to visible light.

[0214] shear stress The formulations were exposed to shear stress by stirring at 990 rpm for 48 hours in 2 mL serum glass vials using a magnetic stirrer. A control condition (48 hours of incubation at room temperature without stirring) was also employed. The results of the test are shown in Table 22. [Table 22]

[0215] All samples appeared clear and colorless over the course of the study. No significant loss of recovery was reported. pH values ​​appeared constant over the course of the study. No degradants were reported throughout the testing period.

[0216] Freeze-thaw stress The freeze-thaw stability of the formulations was evaluated. Samples were kept at -80°C for 2 hours, then at ambient temperature for 1.5 hours. This procedure was repeated for six freeze-thaw cycles. The results of the study are shown in Table 23. [Table 23]

[0217] All samples remained clear and colorless up to six freeze-thaw cycles. No significant loss of recovery or purity was reported. pH values ​​appeared constant over the course of the study. After six freeze-thaw cycles, a three-fold increase in particle number was observed for small-sized particles (>2 μm, <10 μm), but no increase in aggregation was observed throughout the study.

[0218] Example 6: Determining storage period An Arrhenius plot was generated by subjecting the formulation of Example 5 to different temperature conditions for up to two weeks. The resulting recovery rates were used to calculate the degradation rates required to generate the Arrhenius plot. The shelf life at different storage temperatures was then calculated to suggest appropriate storage conditions. Data from the degradation experiments are shown in Table 24. First-order and second-order degradation plots are shown in Figures 10 and 11. The Arrhenius plot is shown in Figure 12. The estimated shelf life calculation is shown in Figure 13. [Table 24]

[0219] Computational analysis suggests stability of the formulation at 2-8°C for at least 5 years of storage and at 25°C for 2 years of storage. Short-term excursions to higher temperatures (e.g., 24 hours at 40°C) appear to be acceptable during handling and transportation of the formulation.

[0220] The contents of all references cited throughout this specification (including literature references, issued patents, published patent applications, and co-pending patent applications) are hereby incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein are to be given the meaning commonly known to those skilled in the art.

[0221] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. Benzyl alcohol and an antisense oligomer conjugate of formula (I): 【Chemical 85】 or a pharmaceutically acceptable salt thereof, During the ceremony, A' is -OH, 【Chemical 86】 is selected from R 5 is —C(O)(O-alkyl) x -OH, x is 3 to 10, and each alkyl group, in each occurrence, is independently selected from the group consisting of C 2-6 - alkyl or or R 5 But -H, -C(O)C 1-6 -Alkyl, trityl, monomethoxytrityl, -(C 1-6 -alkyl)-R 6 , -(C 1-6 -heteroalkyl)-R 6 , -C 6-10 -aryl-R 6 , 5- to 10-membered heteroaryl-R 6 , -C(O)O-(C 1-6 -alkyl)-R 6 , -C(O)O-(C 6-10 -aryl)-R 6 , —C(O)O—(5- to 10-membered heteroaryl)-R 6 , and selected from: 【Chemistry 87】 R 6 is —OH, —SH, and —NH 2 or R 6 is O, S, or NH, each of which is covalently attached to a solid support; R 9 is C 1-6 - alkyl, Each R 1 is —OH and —N(R 3 ) (R 4 ) independently selected from 3 and R 4 is independently in each occurrence -H or -C 1-6 - alkyl, Each R 2 is independently selected at each occurrence from —H, a nucleobase, and a nucleobase functionalized with a chemical protecting group, wherein said nucleobase and said nucleobase functionalized with a chemical protecting group comprise, independently at each occurrence, a ring selected from pyridine, pyrimidine, purine, and deazapurine; t is 8 to 40; E' is -H, -C 1-6 -alkyl, -C(O)C 1-6 - alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, 【Chemical 88】 is selected from During the ceremony, Q is —C(O)(CH 2 ) 6 C(O)- or -C(O)(CH 2 ) 2 S 2 (CH 2 ) 2 C(O)—, R 7 But -(CH 2 ) 2 OC(O)N(R 8 ) 2 wherein R 8 But -(CH 2 ) 6 NHC (=NH)NH 2 and L is a linking amino acid, wherein L is covalently attached by an amide bond to the N-terminus or C-terminus of J; J is a cell membrane-permeable peptide, G is -H, -C(O)C 1-6 - selected from alkyl, benzoyl, and stearoyl, wherein G is covalently bonded to J; At least one of the following is true: (1) A' is 【Chemical 89】 or (2) E' is [Chemical 90] A pharmaceutical composition comprising:

2. E' is -H, -C 1-6 -alkyl, -C(O)C 1-6 2. The pharmaceutical composition of claim 1, wherein the aryl group is selected from the group consisting of alkyl, benzoyl, stearoyl, trityl, monomethoxytrityl, dimethoxytrityl, trimethoxytrityl, and the like. 【Chemistry 91】

3. E' is -H, -C(O)CH 3 3. The pharmaceutical composition of claim 1, wherein the alkyl group is selected from the group consisting of benzoyl, stearoyl, trityl, 4-methoxytrityl, and the like. 【Chemistry 92】

4. A' is 【Chemistry 93】 The pharmaceutical composition according to any one of claims 1 to 3, wherein the pharmaceutical composition is selected from the group consisting of:

5. A' is 【Chemical 94】 is selected from The pharmaceutical composition according to any one of claims 1 to 4, wherein E' is: 【Chemical 95】

6. A' is 【Chemistry 96】 and E' is H, -C(O)CH 3 6. The pharmaceutical composition of claim 1, wherein the aryl group is selected from the group consisting of aryl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

7. Each R 1 But -N(CH 3 ) 2 The pharmaceutical composition according to any one of claims 1 to 6, wherein

8. The pharmaceutical composition of any one of claims 1 to 7, wherein L is glycine, proline, or β-alanine.

9. The pharmaceutical composition according to any one of claims 1 to 8, wherein L is glycine.

10. The pharmaceutical composition according to any one of claims 1 to 8, wherein L is proline.

11. The pharmaceutical composition of any one of claims 1 to 8, wherein L is β-alanine.

12. The pharmaceutical composition according to any one of claims 1 to 11, wherein J is selected from SEQ ID NOs: 5 to 21.

13. G is —H, —C(O)CH 3 13. The pharmaceutical composition of claim 1, wherein the alkyl group is selected from the group consisting of benzoyl, benzoyl, and stearoyl.

14. G is —H or —C(O)CH 3 The pharmaceutical composition according to any one of claims 1 to 13, wherein

15. The pharmaceutical composition of any one of claims 1 to 14, wherein G is -H.

16. G is —C(O)CH 3 The pharmaceutical composition according to any one of claims 1 to 14, wherein

17. Each R 2 are nucleobases, and all R 2 The groups together form a targeting sequence, said targeting sequence comprising: a) SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC), wherein t is 23; and b) SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG), wherein t is 23.

18. The antisense oligomer conjugate has formula (IA): 【Chemistry 97】 or a pharmaceutically acceptable salt thereof, wherein: A' is 【Chem.98】 The pharmaceutical composition of any one of claims 1 to 17, wherein the moiety is selected from:

19. The antisense oligomer conjugate has the formula (II): 【Chem.99】 18. The pharmaceutical composition according to any one of claims 1 to 17, which is a pharmaceutically acceptable salt thereof.

20. 20. The pharmaceutical composition of any one of claims 1 to 19, wherein the antisense oligomer conjugate is an HCl salt.

21. 21. The pharmaceutical composition of any one of claims 1 to 20, wherein the antisense oligomer conjugate is a 6HCl salt.

22. The antisense oligomer conjugate has the formula (IIA): 【Chemistry 100】 It is of 22. The pharmaceutical composition according to any one of claims 1 to 21, wherein n is 9 to 39.

23. The pharmaceutical composition of any one of claims 1 to 22, wherein the pharmaceutical composition further comprises histidine or citrate.

24. 23. The pharmaceutical composition of any one of claims 1 to 22, further comprising one or more of histidine, mannitol, propylene glycol, glycerin, arginine, lysine, tryptophan, or phenol.

25. The pharmaceutical composition according to any one of claims 1 to 24, further comprising histidine.

26. 26. The pharmaceutical composition of any one of claims 1 to 25, wherein the pharmaceutical composition has a pH range of 6.0 to 7.

0.

27. 27. The pharmaceutical composition of any one of claims 1 to 26, wherein the composition has a pH of 6.5 to 7.

0.

28. 28. The pharmaceutical composition of any one of claims 1 to 27, wherein the composition comprises 2% by weight of benzyl alcohol and the composition has a pH of 6.

5.

29. 26. The pharmaceutical composition of any one of claims 1 to 25, further comprising histidine or tryptophan.

30. 26. The pharmaceutical composition of any one of claims 1 to 25, further comprising histidine and propylene glycol.

31. 31. The pharmaceutical composition of claim 30, wherein the composition comprises 2% by weight benzyl alcohol, 2-3% by weight propylene glycol, and wherein the composition has a pH of 6.

5.

32. 32. The pharmaceutical composition of claim 31, wherein the composition comprises 2% by weight benzyl alcohol, 2.2% by weight propylene glycol, and wherein the composition has a pH of 6.

5.

33. 33. The pharmaceutical composition of any one of claims 1 to 32, further comprising histidine and mannitol.

34. 34. The pharmaceutical composition of claim 33, wherein the composition comprises 2% by weight benzyl alcohol, 5% by weight mannitol, and wherein the composition has a pH of 6.

5.

35. 35. The pharmaceutical composition of any one of claims 1 to 34, wherein the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and t is 23.

36. The pharmaceutical composition of any one of claims 22 to 34, wherein the targeting sequence is SEQ ID NO: 3 (CTGAGCCGCTGGCAGATGCCTTGTC) and n is 24.

37. 35. The pharmaceutical composition of any one of claims 1 to 34, wherein the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG) and t is 23.

38. The pharmaceutical composition of any one of claims 22 to 34, wherein the targeting sequence is SEQ ID NO: 4 (GAGGAGATGGGTCCACCCACCTGGG), and n is 24.

39. 39. The pharmaceutical composition of any one of claims 1 to 38, wherein the pharmaceutical composition is formulated for subcutaneous administration to a subject.

40. The pharmaceutical composition of any one of claims 1 to 39, wherein the pharmaceutical composition is administered to a subject by subcutaneous administration.

41. 41. A method for treating Hutchinson-Gilford Progeria Syndrome (HGPS) in a subject in need thereof, comprising administering to the subject the pharmaceutical composition of any one of claims 1 to 40.