mRNA treatment of pompe disease

Abstract

To provide mRNA therapy for Pompe disease.SOLUTION: The present invention provides, inter alia, methods of treating Pompe disease comprising administering to a subject in need thereof a composition comprising an mRNA encoding acid alpha glucosidase (GAA) at an effective dose and dosing interval, thereby reducing the intensity, severity, or frequency, or delaying the onset of at least one symptom or feature of Pompe disease. In some embodiments, the mRNA is encapsulated in a liposome comprising one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 62 / 135,338, filed March 19, 2015, the disclosure of which is incorporated herein by reference.

[0002] Sequence Listing This specification references a Sequence Listing (submitted electronically as a .txt file entitled "SHR_1185WO_SL" on March 17, 2016). The .txt file was generated on March 17, 2016 and is 28,284 bytes in size. The contents of the Sequence Listing are incorporated herein by reference in their entirety. [Background technology]

[0003] Pompe disease (glycogen storage disease type II; acid α-glucosidase deficiency; acid maltase deficiency; GAA deficiency; GSD II; cardiac form of generalized glycogenosis type II; diffuse glycogenic cardiac hypertrophy; acid maltase deficiency; AMD; or α-1,4-glucosidase deficiency) is an autosomal recessive metabolic genetic disorder characterized by mutations in the gene encoding the lysosomal enzyme acid α-glucosidase (GAA) (also known as acid maltase). Mutations in the GAA gene eliminate or reduce the ability of the GAA enzyme to hydrolyze the α-1,4 and α-1,6 bonds in glycogen, maltose, and isomaltose. As a result, glycogen accumulates in the lysosomes and cytoplasm of cells throughout the body, leading to cell and tissue destruction. Tissues particularly affected include skeletal and cardiac muscles. Accumulated glycogen causes progressive muscle weakness, cardiac hypertrophy, difficulty walking, and respiratory failure.

[0004] Three forms of Pompe disease have been identified, including classic infantile-onset disease, nonclassic infantile-onset disease, and late-onset disease. Classic infantile-onset disease is characterized by muscle weakness, hypotonia, hepatomegaly, and cardiac defects. The incidence of this disease is approximately 1 in 140,000. Patients with this form of the disease often die of heart failure within the first year of life. Nonclassic infantile-onset disease is characterized by delayed motor acquisition, progressive muscle weakness, and possibly cardiac hypertrophy. Patients with this form of the disease often survive only in early childhood due to respiratory failure. Late-onset disease may occur in adolescence, adolescence, or adulthood and is characterized by progressive muscle weakness of the legs and trunk.

[0005] Currently, there is no cure for Pompe disease, and the standard of care is enzyme replacement therapy (ERT) with supportive care for cardiomyopathy and physical therapy for muscle weakness and respiratory symptoms. Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention The present invention provides, inter alia, improved methods and compositions for treating Pompe disease based on mRNA therapy, including the observation that administration of liposomally encapsulated mRNA encoding the human GAA protein results in highly efficient and sustained protein production in vivo, effectively reducing, for example, glycogen levels in liver and muscle, which are clinically relevant markers of the disease.

[0007] In one aspect, the present invention provides a method for treating a subject in need thereof by administering to the subject a composition comprising mRNA encoding acid alpha glucosidase (GAA) at an effective dose and at an effective interval, thereby In some embodiments, the mRNA is encapsulated in a liposome.

[0008] In another aspect, the present invention provides methods for treating Pompe disease, comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising mRNA encoding acid alpha-glucosidase (GAA), thereby treating hypertrophic cardiomyopathy in the subject. In some embodiments, the mRNA is encapsulated in a liposome.

[0009] In another aspect, the present invention provides a composition for treating Pompe disease comprising an effective amount of mRNA encoding GAA encapsulated in liposomes.

[0010] In some embodiments, suitable liposomes comprise one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids.

[0011] In some embodiments, the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0012] In some embodiments, the one or more cationic lipids are compounds of formula I-c1-a: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1‐3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1‐3 is alkyl; Each R L independently C 8‐12 It is alkyl.

[0013] In some embodiments, the one or more cationic lipids are cKK-E12: [ka] Includes:

[0014] In some embodiments, the one or more non-cationic lipids suitable for the present invention are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), and combinations thereof.

[0015] In some embodiments, the one or more cholesterol-based lipids are selected from cholesterol, PEGylated cholesterol and DC-Chol (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine, and combinations thereof.

[0016] In some embodiments, the liposome further comprises one or more PEG-modified lipids. In some embodiments, the one or more PEG-modified lipids have a chain length of C6 to C6 20The PEG-modified lipid comprises a poly(ethylene) glycol chain of a maximum chain length of 5 kDa covalently attached to a lipid having alkyl chain(s). In some embodiments, the PEG-modified lipid is a derivatized ceramide, such as N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000]. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or dimyristoylglycerol (DMG)-PEG-2K.

[0017] In some embodiments, suitable liposomes comprise a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol, and DMG-PEG2K.

[0018] In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE and / or HGT4003) comprises about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 30-55%, about 30-60%, about 30-70%, about 30-75%, about 30-80%, about 30-85%, about 30-90%, about 30-95%, about 30-100%, about 30-110%, about 30-120%, about 30-130%, about 30-140%, about 30-150%, about 30-160%, about 30-200%, about 30-250%, about 30-260%, about 30-270%, about 30-310%, about 30-320%, about 30-330%, about 30-340%, about 30-350%, about 30-450%, about 30-460%, about 30-470%, about 30-510%, about 30-520%, about 30-530%, about 30-540%, about 30-550%, about 30-600%, about 30-650%, about 30-750%, about 30-800%, about 30-850%, about 30-900%, about 30-160%, about 30-260%, about 30-270%, about 30-320%, about 30-340%, about 30-450%, about 30-460%, about 30-530%, about 30-540%, In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) comprises about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% of the liposome molar ratio.

[0019] In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) may be between about 30:60:25:35:20:30:1:15, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE, and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid(s) (e.g., cKK-E12, C12-200, ICE and / or HGT4003), non-cationic lipid(s) (e.g., DOPE), cholesterol-based lipid(s) (e.g., cholesterol), and PEGylated lipid(s) (e.g., DMG-PEG2K) is approximately 50:25:20:5.

[0020] In some embodiments, the size of liposomes is determined by the maximum diameter of the liposome particle.In some embodiments, suitable liposomes have a size of less than about 500nm, 400nm, 300nm, 250nm, 200nm, 150nm, 100nm, 75nm, or 50nm.In some embodiments, suitable liposomes have a size of less than about 100nm, 90nm, 80nm, 70nm, or 60nm.In certain embodiments, liposomes have a size of less than about 100nm.

[0021] In some embodiments, the mRNA is administered in an amount of about 0.1 to 5.0 mg / kg body weight, e.g., about 0.1 to 4.5, 0.1 to 4.0, 0.1 to 3.5, 0.1 to 3.0, 0.1 to 2.5, 0.1 to 2.0, 0.1 to 1.5, 0.1 to 1.0, 0.1 to 0.5, 0.1 to 0.3, 0.3 to 5.0, 0.3 to 4.5, 0.3 to 4.0, 0.3 The mRNA is administered at a dose ranging from about 5.0, 4.5, 4.0, 3.5, 3.0, 2.5, 2.0, 1.5, 1.0, 0.8, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 mg / kg body weight or less. In certain embodiments, the mRNA is administered at a dose of about 1.0 mg / kg body weight or less.

[0022] In some embodiments, the provided compositions are administered intravenously. In some embodiments, the provided compositions are administered intramuscularly. In particular embodiments, the intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, the provided compositions are administered intramuscularly. , administered via pulmonary delivery. In certain embodiments, pulmonary delivery is achieved by aerosolization, inhalation, nebulization, or instillation. In some embodiments, provided compositions are formulated as respirable particles, nebulizable lipids, or inhalable dry powders.

[0023] In some embodiments, provided compositions are administered once daily, once weekly, twice weekly, twice monthly, or once monthly, hi some embodiments, provided compositions are administered once every 7 days, once every 10 days, once every 14 days, once every 28 days, or once every 30 days.

[0024] In some embodiments, regular administration of a therapeutically effective amount results in expression of GAA protein in the liver. In some embodiments, regular administration of a therapeutically effective amount results in expression of GAA protein in muscle tissue or muscle cells. Muscle tissue can be, for example, skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof. Muscle cells can be, for example, myocytes, myotubes, myoblasts, cardiomyocytes, cardiac myoblasts, and combinations thereof. In some embodiments, regular administration of a therapeutically effective amount results in GAA protein being found in serum.

[0025] In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in an increase in the subject's liver GAA protein level compared to the subject's baseline liver GAA protein level before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in an increase in the subject's muscle GAA protein level compared to the subject's baseline muscle GAA protein level before treatment. In some embodiments, the muscle is skeletal muscle (e.g., striated muscle, voluntary muscle), smooth muscle (e.g., visceral muscle, involuntary muscle), or cardiac muscle. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's muscle glycogen level compared to the subject's baseline muscle glycogen level before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's liver glycogen level compared to the subject's baseline liver glycogen level before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's serum creatine kinase level compared to the subject's baseline serum creatine kinase level before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's urinary glucose tetrasaccharide (Glcα1-6Glcα1-4Glcα1-4Glc (Glc4) level compared to the subject's pre-treatment baseline Glc4 level. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's serum aspartate transaminase (e.g., AST, aspartate aminotransferase, serum glutamic oxaloacetic transaminase) level compared to the subject's pre-treatment baseline AST level. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's serum alanine transaminase (e.g., ALT, alanine aminotransferase, serum glutamic pyruvic transaminase) level compared to the subject's pre-treatment baseline ALT level. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition results in a decrease in the subject's serum lactate dehydrogenase (e.g., LDH, lactate dehydrogenase) level compared to the subject's pre-treatment baseline LDH level.In some embodiments, regular administration of a therapeutically effective amount of a provided composition results in an increase in the level of GAA enzyme activity in a biological sample compared to the baseline GAA enzyme activity level prior to treatment.

[0026] In some embodiments, administration of a provided composition results in an increase in the subject's liver GAA protein level compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition results in an increase in liver GAA protein level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level before treatment. In some embodiments, administration of a provided composition results in an increase in liver GAA protein level compared to the liver GAA protein level of an untreated subject.

[0027] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the subject's skeletal muscle compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in skeletal muscle by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in skeletal muscle compared to GAA protein levels in skeletal muscle of an untreated subject.

[0028] In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels in the subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels compared to myocardial GAA protein levels in an untreated subject.

[0029] In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels in a subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels compared to smooth muscle GAA protein levels in an untreated subject.

[0030] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in muscle cells of the subject compared to pre-treatment baseline levels. Typically, the baseline levels are measured immediately prior to treatment. In some embodiments, the muscle cells are myocytes, myotubes, myoblasts, cardiomyocytes, or cardiomyoblasts. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in muscle cells by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in muscle cells compared to GAA protein levels in muscle cells of an untreated subject.

[0031] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells (e.g., hepatocytes, sinusoidal lining cells) of the subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells compared to GAA protein levels in liver cells of an untreated subject.

[0032] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the subject's plasma or serum compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the plasma or serum by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels ... The GAA protein level in the plasma or serum of the subject is elevated compared to the GAA protein level in the plasma or serum of an untreated subject.

[0033] In some embodiments, administration of a provided composition results in a decrease in a subject's serum creatine kinase level compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum creatine kinase level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline serum creatine kinase level immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum creatine kinase level to less than about 2000 IU / L, 1500 IU / L, 1000 IU / L, 750 IU / L, 500 IU / L, 250 IU / L, 100 IU / L, 90 IU / L, 80 IU / L, 70 IU / L, or 60 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum creatine kinase levels relative to serum creatine kinase levels in an untreated subject.

[0034] In some embodiments, administration of a provided composition results in a decrease in a subject's urinary Glc4 level compared to a pre-treatment baseline level. Typically, the baseline level is measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in urinary Glc4 level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to a pre-treatment baseline level. In some embodiments, administration of a provided composition results in a reduction in urinary Glc4 levels to less than about 100 mmol Glc4 / mol creatinine, 90 mmol Glc4 / mol creatinine, 80 mmol Glc4 / mol creatinine, 70 mmol Glc4 / mol creatinine, 60 mmol Glc4 / mol creatinine, 50 mmol Glc4 / mol creatinine, 40 mmol Glc4 / mol creatinine, 30 mmol Glc4 / mol creatinine, or 20 mmol Glc4 / mol creatinine. In some embodiments, administration of a provided composition results in a reduction in urinary Glc4 levels compared to the urinary Glc4 levels of an untreated subject.

[0035] In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels in a subject compared to baseline levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels compared to muscle glycogen levels in an untreated subject. In certain embodiments, the muscle is skeletal muscle, smooth muscle, or cardiac muscle.

[0036] In some embodiments, administration of a provided composition results in a decrease in the subject's liver glycogen levels compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in liver glycogen levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in liver glycogen levels compared to liver glycogen levels in an untreated subject.

[0037] In some embodiments, administration of a provided composition results in a decrease in the subject's serum aspartate transaminase (AST) levels compared to the baseline level prior to treatment. Typically, the baseline level is measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in the serum AST levels by at least 10% compared to the baseline level immediately prior to treatment. A reduction of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% occurs. In some embodiments, administration of provided compositions results in a reduction in serum AST levels to less than about 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, 100 IU / L, 50 IU / L, 25 IU / L, 20 IU / L, or 10 IU / L. In some embodiments, administration of provided compositions results in a reduction in serum AST levels compared to serum AST levels in an untreated subject.

[0038] In some embodiments, administration of a provided composition results in a decrease in a subject's serum alanine transaminase (ALT) levels compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in serum ALT levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in serum ALT levels to less than about 1000 IU / L, 900 IU / L, 800 IU / L, 700 IU / L, 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, 100 IU / L, 50 IU / L, 25 IU / L, 20 IU / L, or 10 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum ALT levels relative to serum ALT levels in an untreated subject.

[0039] In some embodiments, administration of a provided composition results in a decrease in a subject's serum lactate dehydrogenase (LDH) level compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum lactate dehydrogenase LDH level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum LDH level to less than about 2000 IU / L, 1500 IU / L, 1000 IU / L, 900 IU / L, 800 IU / L, 700 IU / L, 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, or 100 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum LDH levels compared to serum LDH levels in an untreated subject.

[0040] In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity in a biological sample from the subject compared to baseline levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity compared to GAA enzyme activity in an untreated subject.

[0041] In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels in a biological sample from the subject compared to baseline expression levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. Biological samples include, for example, whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels compared to GAA mRNA expression levels in an untreated subject.

[0042] In some embodiments, the mRNA is codon-optimized. In some embodiments, the codon-optimized mRNA has SEQ ID NO:3 (corresponding to the codon-optimized human GAA mRNA sequence). In some embodiments, the mRNA has a 5'UTR sequence of SEQ ID NO:8 (corresponding to 5'UTR sequence X). In some embodiments, the mRNA has a 3'UTR sequence of SEQ ID NO:9 (corresponding to 3'UTR sequence Y). In some embodiments, the mRNA has a 3'UTR sequence of SEQ ID NO:10 (corresponding to 3'UTR sequence Y). In some embodiments, the codon-optimized mRNA has SEQ ID NO:11 or SEQ ID NO:12 (corresponding to the codon-optimized human GAA mRNA sequence with 5'UTR and 3'UTR sequences).

[0043] In some embodiments, the mRNA comprises one or more modified nucleotides. In some embodiments, the one or more modified nucleotides comprise pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C5-propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and / or 2-thiocytidine. In some embodiments, the mRNA is unmodified.

[0044] In one aspect, the present invention provides a composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in liposomes, wherein the liposomes are encapsulated in a cationic lipid, cKK-E12: [ka] Includes:

[0045] In one embodiment, the liposome further comprises one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. In some embodiments, the one or more non-cationic lipids are selected from the group consisting of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), and DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

[0046] In another embodiment, the one or more cholesterol-based lipids are selected from cholesterol and / or PEGylated cholesterol. In a further embodiment, the one or more PEG-modified lipids have a chain length of C6 to C6. 20 It comprises a poly(ethylene) glycol chain of a maximum chain length of 5 kDa covalently attached to a lipid having alkyl chain(s).

[0047] In another embodiment, the liposome comprises cKK-E12, DOPE, cholesterol, and DMG-PEG2K. In a specific embodiment, the cationic lipid is present in a molar ratio of about 30-50% relative to the liposome. In another embodiment, the cationic lipid is present in a molar ratio of about 40% relative to the liposome.

[0048] In another embodiment, the molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:30:20:10. In a particular embodiment, the molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:30:25:5. In yet another embodiment, the molar ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:32:25:3. In one embodiment, the liposome has a size of less than approximately 100 nm.

[0049] In one embodiment, the composition is formulated for intravenous administration. In another embodiment, the composition is formulated for intramuscular administration. In another embodiment, the mRNA has SEQ ID NO:3. In a further embodiment, the mRNA further comprises the 5' UTR sequence of SEQ ID NO:8. In yet another embodiment, the mRNA further comprises the 3' UTR sequence of SEQ ID NO:9 or SEQ ID NO:10. In certain embodiments, the mRNA has SEQ ID NO:11 or SEQ ID NO:12.

[0050] In one aspect, the present invention provides a composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, wherein the mRNA has SEQ ID NO:3, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0051] In one aspect, the present invention provides a composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, wherein the mRNA has SEQ ID NO:11 or SEQ ID NO:12, and the liposome further comprises a cationic or non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0052] Other features, objects, and advantages of the present invention will be apparent in the detailed description set forth below, the accompanying drawings, and the claims. It should be understood, however, that while the detailed description, drawings, and claims set forth embodiments of the present invention, they are given by way of example only, and not by way of limitation. Various changes and modifications within the scope of the present invention will become apparent to those skilled in the art. In certain embodiments, for example, the following are provided: (Item 1) 1. A method for treating Pompe disease, comprising administering to a subject in need thereof a composition comprising mRNA encoding acid alpha-glucosidase (GAA) at an effective dose and interval to reduce the intensity, severity, or frequency of, or delay the onset of, at least one symptom or characteristic of Pompe disease. (Item 2) A method for treating Pompe disease, comprising administering to a subject in need thereof a therapeutically effective amount of a composition comprising mRNA encoding acid alpha-glucosidase (GAA), thereby treating hypertrophic cardiomyopathy in the subject. (Item 3) 3. The method according to item 1 or 2, wherein the mRNA is encapsulated in a liposome. (Item 4) Item 5. The method according to Item 3, wherein the liposome comprises one or more cationic lipids, one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. 5. The method of claim 4, wherein the one or more cationic lipids comprise a cationic lipid selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and mixtures thereof. (Item 6) The one or more cationic lipids may be cKK-E12: [ka] Item 6. The method according to item 5, comprising: (Item 7) 7. The method of any one of items 4 to 6, wherein the one or more non-cationic lipids are selected from the group consisting of DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), and combinations thereof. (Item 8) 8. The method according to any one of items 4 to 7, wherein the one or more cholesterol-based lipids are cholesterol and / or PEGylated cholesterol. (Item 9) The one or more PEG-modified lipids have a chain length of C6 to C 209. The method according to any one of items 4 to 8, comprising a poly(ethylene) glycol chain of a maximum chain length of 5 kDa covalently attached to a lipid having alkyl chain(s) of 10 kDa. (Item 10) 10. The method of any one of the preceding items, wherein the cationic lipid comprises about 30-50% by weight of the liposome. (Item 11) 11. The method of claim 10, wherein the cationic lipid comprises about 40% by weight of the liposome. (Item 12) 12. The method according to any one of items 4 to 11, wherein the molar ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is approximately 40:30:20:10. (Item 13) 12. The method according to any one of items 4 to 11, wherein the ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is approximately 40:30:25:5 by weight. (Item 14) 12. The method according to any one of items 4 to 11, wherein the ratio of cationic lipid:non-cationic lipid:cholesterol:PEGylated lipid is approximately 40:32:25:3 by weight. (Item 15) The liposomes comprising: cKK‐E12, DOPE, cholesterol and DMG‐PEG2K; C12‐200, DOPE, cholesterol and DMG‐PEG2K; HGT4003, DOPE, cholesterol and DMG-PEG2K; or 16. The method according to any one of items 3 to 15, comprising a combination selected from ICE, DOPE, cholesterol and DMG-PEG2K. (Item 16) 16. The method according to any one of items 3 to 15, wherein the liposomes have a size of less than about 100 nm. (Item 17) The method of any one of the preceding items, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 5.0 mg / kg body weight. (Item 18) The method of any one of the preceding items, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 3.0 mg / kg body weight. (Item 19) The method of any one of the preceding items, wherein the mRNA is administered at an effective dose in the range of about 0.1 to 1.0 mg / kg body weight. (Item 20) The method of any one of the preceding items, wherein the mRNA is administered at an effective dose of about 1.0 mg / kg body weight. (Item 21) The method of any one of the preceding items, wherein the composition is administered intravenously. (Item 22) Item 11. The method of any one of the preceding items, wherein the composition is administered intramuscularly. (Item 23) 23. The method of claim 22, wherein the intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof. (Item 24) The method of any one of the preceding items, wherein the composition is administered once a week. (Item 25) 24. The method of any one of items 1 to 23, wherein the composition is administered twice a week. (Item 26) 24. The method of any one of items 1 to 23, wherein the composition is administered twice a month. (Item 27) 24. The method of any one of items 1 to 23, wherein the composition is administered once a month. (Item 28) 24. The method of any one of items 1 to 23, wherein the composition is administered once every 14 days. (Item 29) The method of any one of the preceding items, wherein said administering said composition results in expression of GAA protein in the liver. (Item 30) The method of any one of the preceding items, wherein said administration of said composition results in expression of GAA protein in muscle tissue or muscle cells. (Item 31) 31. The method of claim 30, wherein the muscle tissue is selected from skeletal muscle, smooth muscle, cardiac muscle, and combinations thereof. (Item 32) 31. The method of claim 30, wherein the muscle cells are selected from the group consisting of myocytes, myotubes, myoblasts, cardiomyocytes, cardiomyoblasts, and combinations thereof. (Item 33) The method of any one of the preceding items, wherein administration of the composition results in GAA protein expression in serum. (Item 34) The method of any one of the preceding items, wherein said administering of said composition results in a decrease in the subject's urinary Glc4 level compared to the subject's baseline urinary Glc4 level before treatment. (Item 35) The method of any one of the preceding items, wherein said administration of said composition results in a decrease in muscle glycogen levels in said subject compared to pre-treatment baseline muscle glycogen levels. (Item 36) The method of any one of the preceding items, wherein said administering of said composition results in a decrease in liver glycogen levels in said subject compared to pre-treatment baseline liver glycogen levels. (Item 37) The method of any one of the preceding items, wherein said administration of said composition results in a decrease in the subject's serum aspartate transaminase level compared to the subject's baseline serum aspartate transaminase level before treatment. (Item 38) The method of any one of the preceding items, wherein said administration of said composition results in a decrease in the subject's serum alanine transaminase level compared to the subject's baseline serum alanine transaminase level before treatment. (Item 39) The method of any one of the preceding items, wherein said administering of said composition results in a decrease in the subject's serum creatine kinase level compared to the subject's baseline serum creatine kinase level before treatment. (Item 40) The method of any one of the preceding items, wherein said administering of said composition results in a decrease in the subject's serum lactate dehydrogenase level compared to the subject's baseline serum lactate dehydrogenase level before treatment. (Item 41) The method of any one of the preceding items, wherein the administration of the composition results in an increase in the GAA enzyme activity level in a biological sample from the subject compared to the baseline GAA enzyme activity level in a biological sample before treatment. (Item 42) Item 10. The method of any one of the preceding items, wherein the mRNA is codon-optimized. (Item 43) 43. The method of claim 42, wherein the codon-optimized mRNA has SEQ ID NO: 3. (Item 44) Item 45. The method of Item 43, wherein the mRNA further comprises the 5'UTR sequence of SEQ ID NO: 8. 44. The method of item 43, wherein the mRNA further comprises the 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO: 10. (Item 46) Item 10. The method of any one of the preceding items, wherein the mRNA has SEQ ID NO:11 or SEQ ID NO:12. (Item 47) Item 11. The method of any one of the preceding items, wherein the mRNA comprises one or more modified nucleotides. (Item 48) 48. The method of item 47, wherein the one or more modified nucleotides comprise pseudouridine, N-1-methyl-pseudouridine, 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine and / or 2-thiocytidine. (Item 49) 47. The method of any one of items 1 to 46, wherein the mRNA is unmodified. (Item 50) A composition for treating Pompe disease comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in liposomes, the liposomes comprising a cationic lipid cKK-E12: [ka] The therapeutic composition comprising: (Item 51) 51. The composition of claim 50, wherein the liposome further comprises one or more non-cationic lipids, one or more cholesterol-based lipids, and one or more PEG-modified lipids. (Item 52) The one or more non-cationic lipids may be DSPC (1,2-distearoyl-sn-glycol). 52. The composition of claim 51, wherein the glycerol is selected from the group consisting of DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), and combinations thereof. (Item 53) 53. The composition of claim 51 or 52, wherein the one or more cholesterol-based lipids are selected from cholesterol and / or PEGylated cholesterol. (Item 54) The one or more PEG-modified lipids have a chain length of C6 to C 2054. The composition of any one of items 51 to 53, comprising a poly(ethylene) glycol chain of a maximum chain length of 5 kDa covalently attached to a lipid having alkyl chain(s) of 10 kDa. (Item 55) 55. The composition according to any one of items 50 to 54, wherein the liposome comprises cKK-E12, DOPE, cholesterol and DMG-PEG2K. (Item 56) 56. The composition according to any one of items 50 to 55, wherein the cationic lipid accounts for about 30 to 50 mol % of the liposome. (Item 57) 57. The composition of claim 56, wherein the cationic lipid comprises about 40 mol% of the liposome. (Item 58) 58. The composition of any one of items 55 to 57, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:30:20:10 by molar ratio. (Item 59) 58. The composition of any one of items 55 to 57, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:30:25:5 by molar ratio. (Item 60) 58. The composition of any one of items 55 to 57, wherein the ratio of cKK-E12:DOPE:cholesterol:DMG-PEG2K is approximately 40:32:25:3 by molar ratio. (Item 61) 61. The composition according to any one of items 50 to 60, wherein the liposomes have a size of less than about 100 nm. (Item 62) 62. The composition of any one of items 50 to 61, wherein the composition is formulated for intravenous administration. (Item 63) 62. The composition of any one of items 50 to 61, wherein the composition is formulated for intramuscular administration. (Item 64) The composition according to any one of Items 50 to 63, wherein the mRNA has SEQ ID NO: 3. (Item 65) 65. The composition of item 64, wherein the mRNA further comprises a 5'UTR sequence of SEQ ID NO:8. (Item 66) 65. The composition of item 64, wherein the mRNA further comprises a 3'UTR sequence of SEQ ID NO: 9 or SEQ ID NO: 10. (Item 67) 67. The composition of any one of items 50 to 66, wherein the mRNA has SEQ ID NO: 11 or SEQ ID NO: 12. (Item 68) 1. A composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, the mRNA having SEQ ID NO: 3; and The therapeutic composition, wherein the liposome further comprises a cationic lipid, a non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid. (Item 69) 1. A composition for treating Pompe disease, comprising an effective amount of mRNA encoding acid alpha-glucosidase (GAA) encapsulated in a liposome, the mRNA having SEQ ID NO: 11 or SEQ ID NO: 12; and The therapeutic composition, wherein the liposome further comprises a cationic lipid, a non-cationic lipid, a cholesterol-based lipid, and a PEG-modified lipid.

[0053] The drawings are for illustrative purposes only and are not limiting. [Brief explanation of the drawings]

[0054] [Figure 1A] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 6 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 1B] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 12 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 2A]1 shows an example of glycogen depletion in the liver of a GAA knockout mouse 24 hours after treatment with a single intravenous dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 2B] An example of glycogen accumulation in the liver of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 3] An example of GAA mRNA detection by in situ hybridization performed on muscle tissue from a mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 4A] 1 shows an example of glycogen depletion in the quadriceps muscle of a GAA knockout mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 4B] 1 shows an example of glycogen depletion in the quadriceps muscle of a GAA knockout mouse 24 hours after treatment with a single intramuscular dose of 1.0 mg / kg of GAA mRNA-encapsulated lipid nanoparticles. [Figure 4C] An example of glycogen levels in the quadriceps muscle of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. [Figure 4D] An example of glycogen levels in the quadriceps muscle of a GAA knockout mouse that was not treated with GAA mRNA-encapsulated lipid nanoparticles is shown. DETAILED DESCRIPTION OF THE INVENTION

[0055] definition In order that the present invention may be more readily understood, certain terms are first defined below. Additional definitions of these terms and other terms are provided throughout the specification. Publications and other reference materials referred to herein that describe the background of the invention and provide further details regarding its practice are hereby incorporated by reference.

[0056] Alkyl: As used herein, "alkyl" refers to a straight or branched chain saturated hydrocarbon group having 1 to 15 carbon atoms ("C 1‐15 In some embodiments, an alkyl group has 1 to 3 carbon atoms ("C 1‐3 alkyl). C 1‐3 Examples of alkyl groups include methyl (C1), ethyl (C2), n-propyl (C3), and isopropyl (C3). In some embodiments, the alkyl group has 8 to 12 carbon atoms ("C 8‐12 C 8‐12 Examples of alkyl include n-octyl (C8), n-nonyl (C9), and n-decyl (C 10 ), n-undecyl (C 11 ), n-dodecyl (C 12 The prefix "n-" (normal) refers to an unbranched alkyl group. For example, n-C alkyl refers to -(CH2)7CH3, and n-C 10 Alkyl refers to -(CH2)9CH3, etc.

[0057] Amino Acid: As used herein, the term "amino acid" in its broadest sense refers to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure HN-C(H)(R)-COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a d-amino acid; in some embodiments, an amino acid is an l-amino acid. A "standard amino acid" refers to any of the 20 standard l-amino acids commonly found in naturally occurring peptides. A "non-standard amino acid" refers to any amino acid other than the standard amino acids, whether synthetically prepared or obtained from a natural source. As used herein, "synthetic amino acid" encompasses chemically modified amino acids, including, but not necessarily limited to, salts, amino acid derivatives (such as amides), and / or substitutions. Amino acids, including those at the carboxy and / or amino termini of peptides, can be modified by methylation, amidation, acetylation, substitution with protecting groups, and / or other chemical groups, which can alter the circulating half-life of the peptides without adversely affecting their activity. Amino acids may also participate in disulfide bonds. Amino acids may contain mono- or post-translational modifications, such as association with one or more chemical entities (e.g., methyl groups, acetate groups, acetyl groups, phosphate groups, formyl moieties, isoprenoid groups, sulfate groups, polyethylene glycol moieties, lipid moieties, carbohydrate moieties, biotin moieties, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and may refer to free amino acids and / or peptide amino acid residues. Whether a term refers to a free amino acid or a peptide residue will be clear from the context in which the term is used.

[0058] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to humans at any stage of development. In some embodiments, "animal" refers to non-human animals at any stage of development. In particular embodiments, the non-human animal is a mammal (e.g., a rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, animals include, but are not necessarily limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or worms. In some embodiments, animals may be transgenic animals, genetically modified animals, and / or clones.

[0059] Approximately or about: As used herein, the term "approximately" or "about," when applied to one or more values ​​of interest, refers to a value similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a value that is 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 25%, 20 ... Refers to a numerical range that falls within 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less (unless such number exceeds 100% of the possible values).

[0060] Biologically active: As used herein, the phrase "biologically active" refers to the property of any agent that has activity within a biological system, particularly within an organism. For example, an agent that, when administered to an organism, has a biological effect on that organism is considered to be biologically active.

[0061] Delivery: As used herein, the term "delivery" encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which the mRNA is delivered to a target tissue, where the encoded protein is expressed and retained within the target tissue (also referred to as "local distribution" or "local delivery"), as well as situations in which the mRNA is delivered to a target tissue, where the encoded protein is expressed and secreted into the patient's circulatory system (e.g., serum), distributed throughout the body, and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0062] Expression: As used herein, "expression" of a nucleic acid sequence refers to the translation of mRNA into a polypeptide, the assembly of multiple polypeptides into an intact protein (e.g., an enzyme), and / or the post-translational modification of a polypeptide or fully assembled protein (e.g., an enzyme). The terms "expression" and "production," and grammatical equivalents, are used interchangeably herein.

[0063] Functional: As used herein, a "functional" biomolecule is a biomolecule in a form in which it exhibits a property and / or activity that characterizes it.

[0064] Half-life: As used herein, the term "half-life" refers to the time required for a quantity, such as the concentration or activity of a nucleic acid or protein, to fall to half of its value measured at the beginning of a period of time.

[0065] Improve, Elevate, or Decrease: As used herein, the terms "improve," "elevate," or "decrease," or grammatical equivalents, refer to a value compared to a baseline measurement, such as a measurement in the same individual prior to the initiation of a treatment described herein, or a measurement in a control subject (or control subjects) in the absence of a treatment described herein. A "control subject" is a subject of approximately the same age as the subject being treated, who suffers from the same type of disease as the subject being treated.

[0066] In vitro: As used herein, the term "in vitro" refers to events that take place not within a multicellular organism but in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc.

[0067] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms, such as humans and non-human animals. In the context of cell-based systems, the term may also be used to refer to events that occur within living cells (as opposed to, for example, in vitro systems).

[0068] Isolated: As used herein, the term "isolated" refers to (1) a substance and / or entity that is separated from at least some of the components with which it is associated when originally produced (in nature and / or in an experimental setting), and / or (2) that has been produced, prepared, and / or manufactured by the hand of man. Isolated substances and / or entities are those that are free from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 120%, about 140%, about 160%, about 180%, about 200%, about 220%, about 240%, about 260%, about 280%, about 300%, about 320%, about 360%, about 380%, about 400%, about 420%, about 440%, about 480%, about 500%, about 520%, about 540%, about 560%, about 580%, about 590%, about 600%, about 610%, about 610%, about 620%, about 630%, about 640%, about 650%, about 660%, about 670%, about 680%, about 700%, about 720%, about 750%, about 760%, about 770%, about 780%, about 790%, about 800%, about 810%, about 820%, about 830%, about 840%, about 850%, about 860%, about 870%, about 880%, about 890%, about 900%, about 910%, about 920%, about 930%, about 940%, about 950%, about 960%, about 970%, about 980%, about 990%, about 1000%, about 1010 The isolated agent may be separated from 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99%. In some embodiments, the isolated agent is pure to a level of about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99%. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, excipients (e.g., buffers, solvents, water, etc.) should not be included in calculations of percent purity of isolated substances and / or entities.

[0069] Local distribution or delivery: As used herein, the terms "local distribution," "local delivery," or grammatical equivalents refer to tissue-specific delivery or distribution. Generally, local distribution or delivery requires that the mRNA-encoded protein (e.g., an enzyme) be translated and expressed intracellularly or be secreted to a limited extent to avoid it entering the patient's circulatory system.

[0070] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA encompasses both modified and unmodified RNA. mRNA can contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and further purified as needed, or chemically synthesized. Suitably, for example, in the case of chemically synthesized molecules, mRNA can include nucleoside analogs, such as analogs with chemically modified bases or sugars, backbone modifications, etc. Unless otherwise specified, mRNA sequences are presented in the 5' to 3' direction. In some embodiments, the mRNA is designed to contain natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, the bases are or contain: 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine; chemically modified bases; biologically modified bases (e.g., methylated bases); intercalating bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose sugars); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).

[0071] Muscle cell or muscle tissue: As used herein, the term "muscle cell" or "muscle tissue" refers in its broadest sense to a cell or group of cells derived from muscle, including, but not necessarily limited to, cells and tissue derived from skeletal muscle (e.g., striated, voluntary); smooth muscle (e.g., visceral, involuntary) derived from the digestive tract, bladder, and blood vessels; and cardiac muscle. The term refers to muscle cells in vivo and in vitro. The term also includes differentiated and undifferentiated or non-differentiated muscle cells, such as myocytes, myotubes, myoblasts, cardiomyocytes, and cardiomyoblasts.

[0072] Nucleic Acid: As used herein, the term "nucleic acid" in its broadest sense refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, nucleic acids are compounds and / or substances that are or can be incorporated into a polynucleotide chain via phosphodiester bonds. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA as well as single- and / or double-stranded DNA and / or cDNA.

[0073] Patient: As used herein, the term "patient" or "subject" refers to any living organism to which a provided composition can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Human includes prenatal and postnatal forms.

[0074] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to a material that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit-risk ratio.

[0075] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts include salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or lunaronic acid, or by other methods used in the art, such as ion exchange. Examples of other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, Salts derived from appropriate bases include: lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N + (C 1‐4Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Where appropriate, further pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed with counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharmaceutically acceptable salts include salts formed by quaternizing an amine with a suitable electrophile, such as an alkyl halide, to form a quaternary alkylated amino salt.

[0076] Systemic distribution or delivery: As used herein, the term "systemic distribution," "systemic delivery," or grammatical equivalents refer to a mechanism or approach of delivery or distribution that affects the entire body or organism. Typically, systemic distribution or delivery is achieved via the body's circulatory system, e.g., the bloodstream. Compare the definition of "local distribution or delivery."

[0077] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include both prenatal and postnatal forms. In many embodiments, a subject is a human. A subject can be a patient, i.e., refers to a human who visits a health care provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient." A subject is likely to be suffering from or susceptible to a disease or disorder, but may or may not exhibit symptoms of the disease or disorder.

[0078] Substantially: As used herein, the term "substantially" refers to the qualitative condition indicating that a characteristic or property of interest is present throughout or nearly throughout. Those skilled in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or achieve perfection, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of perfection inherent in many biological and chemical phenomena.

[0079] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease to be treated. In some embodiments, target tissues include tissues that exhibit symptoms, symptoms, or characteristics associated with the disease.

[0080] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" of a therapeutic agent means an amount sufficient to treat, diagnose, prevent, and / or delay the onset of a symptom(s) of a disease, disorder, and / or condition when administered to a subject suffering from or susceptible to the disease, disorder, and / or condition. Those skilled in the art will understand that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.

[0081] Treatment: As used herein, the terms "treat," "treatment," or "treating" refer to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset, reduce severity, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition in a subject. Treatment may also be administered to subjects who do not exhibit symptoms of the disease and / or who exhibit only early symptoms of the disease, in order to reduce the risk of developing symptoms associated with the disease.

[0082] Detailed Description The present invention provides, inter alia, methods and compositions for treating Pompe disease based on mRNA therapy. In particular, the present invention provides a method for treating Pompe disease by administering to a subject in need of treatment a composition containing mRNA encoding acid alpha-glucosidase (GAA) at an effective dose and at an effective interval, thereby reducing the intensity, severity, or frequency of, or delaying the onset of, at least one symptom or characteristic of Pompe disease. The present invention also provides a method for treating Pompe disease, comprising administering to a subject in need of treatment a therapeutically effective amount of a composition containing mRNA encoding acid alpha-glucosidase (GAA), thereby treating hypertrophic cardiomyopathy in the subject. In some embodiments, the mRNA is encapsulated within one or more liposomes. As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticle vesicle. Generally, liposomes as used herein can be formed by mixing one or more lipids or by mixing one or more lipids with one or more polymer(s). Thus, the term "liposome" as used herein refers to both lipid-based and polymer-based nanoparticles. In some embodiments, liposomes suitable for the present invention contain cationic or non-cationic lipid(s), cholesterol-based lipid(s), and PEG-modified lipid(s).

[0083] Pompe disease The present invention may be used to treat subjects suffering from or susceptible to Pompe disease. Pompe disease is an autosomal recessive metabolic genetic disorder characterized by mutations in the gene encoding the acid alpha-glucosidase (GAA) enzyme. The GAA enzyme is also known as: acid maltase, maltase, maltase-glucoamylase, gluoinvertase, glucoside sucrase, aglucosidase alpha, alpha-1,4-glucosidase, amyloglucosidase, glucoamylase, LYAG, LYAG_HUMAN, lysosomal alpha-glucosidase, and alpha-glucosidase, acid. The GAA gene (glucosidase alpha; acid) is also known as: acid maltase, alpha-1,4-glucosidase, and alpha-glucosidase, acid. More than 200 mutations that cause Pompe disease have been identified in the GAA gene. Most of these mutations involve single amino acid substitutions and small insertions or deletions. Many mutations in the GAA gene affect the structure of the resulting protein and may reduce its activity. Some GAA gene mutations result in the production of an abnormally shortened enzyme that cannot effectively perform its role in glycogen hydrolysis.

[0084] Deficiency of the acid alpha-glucosidase enzyme reduces the cell's ability to hydrolyze glycogen, resulting in the accumulation of glycogen in cells and tissues, particularly in the liver and muscle. Glycogen accumulation leads to cell death, which manifests as progressive muscle weakness, cardiomyopathy, and respiratory failure.

[0085] The compositions and methods described herein may be used to treat at least one symptom or feature of Pompe disease. In particular, the compositions and methods described herein may be used to treat hypertrophic cardiomyopathy.

[0086] Acid alpha-glucosidase (GAA) In some embodiments, the present invention provides methods and compositions for delivering mRNA encoding GAA to a subject for the treatment of Pompe disease. Suitable GAA mRNA encodes either a full-length, fragment, or portion of the GAA protein that can replace the activity of the native GAA protein and / or reduce the intensity, severity, and / or frequency of one or more symptoms associated with Pompe disease.

[0087] In some embodiments, a suitable mRNA sequence is an mRNA sequence encoding the human GAA protein. The naturally occurring human GAA mRNA coding sequence and corresponding amino acid sequence are shown in Table 1: [Table 1-1] [Table 1-2]

[0088] In some embodiments, a suitable mRNA is the wild-type human GAA mRNA of the sequence (SEQ ID NO: 1). In some embodiments, a suitable mRNA may be a codon-optimized hGAA sequence, such as the sequence shown below:

[0089] Codon-optimized human GAA coding sequence (SEQ ID NO:3): AUGGGAGUCAGACACCCGCCGUGCUCGCACAGGCUUCUGCGGUUGCGCGUCGUUGCUGGGCACAUUCUUCUCCCACCACUUUCUCUUGGUGCCCGAGAAUUGUCGGCUCGCUGCCGGUACUGGAAGAAACCCACCCCGCACAUCAGCAGGCGUGCGCGCCGGCGAGGGAUGCCCAGCAAUCCCGGAAGGCCCAGGCCGUCCCGACUCAAUGUGACGUACCUCCCAAUUCCCGGUUGCGCAGACAAGGCAUAUCCAGCAAGAGCAGUGCGAGCGAGCCCGUGGUUGCUGCUAUAUUCCCGCGCAAGCAGGGACUUCAGGGAGCCCAGAUGGGGCAGCCCUUGGUUUCUUCCCGCCUUCCUAUUCCCUCAUAUAAAGCUGGAAUUUGUCCUCCUCGGAAAUUG AUCAAUGUCCACCUCAGGGCGGGUUACAUUAUCCCUCUCCAAGGCCCUGGGUUGACCACCACAGAGUCGCGCCAGCAGCCAAUGGCACUUGCGGUCGCAUUGACGAAAGGGGGUGAAGCCCGAGGGGAACUGUUUUGGGAUGACGGGGAAAGCCUUGAGGUGCUGGAACGGGGAGCGUACACACAAGUCAUUUUCUUGGCCAGGAACAAC ACUAUUGUCAACGAGUUGUGGCGUGACCUCUGAGGGUGCCGGACUGCAACUGCAGAAGGUCACGGUCCUCGGAGUGGCGACAGCACCCCAACAGGUCCUUAGUAACGGAGUACCUGUCUCGAACUUUACAUACUCCCCGGACACGAAGGUGCUCGACAUCUGUGUCGCUGCUUAUGGGGAACAGUUUCUCGUGAGCUGUGCUAG

[0090] Further exemplary mRNA sequences are provided in the Examples section below, for example, SEQ ID NO:11 and SEQ ID NO:12, which contain 5' and 3' untranslated regions surrounding a codon-optimized GAA-encoding mRNA.

[0091] In some embodiments, a suitable mRNA sequence may be an mRNA sequence of a homolog or analog of a human GAA protein. For example, a homolog or analog of a human GAA protein may be a modified human GAA protein that contains one or more amino acid substitutions, deletions, and / or insertions compared to a wild-type, i.e., naturally occurring, human GAA protein, while substantially retaining GAA protein activity. In some embodiments, an mRNA suitable for the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to SEQ ID NO: 2. In some embodiments, an mRNA suitable for the present invention encodes a protein substantially identical to a human GAA protein. In some embodiments, mRNA suitable for the present invention encodes an amino acid sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 2. In some embodiments, mRNA suitable for the present invention encodes a fragment or portion of a human GAA protein. In some embodiments, mRNA suitable for the present invention encodes a fragment or portion of a human GAA protein, wherein the protein fragment or portion still maintains GAA activity similar to the wild-type protein. In some embodiments, mRNA suitable for the present invention has a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:11 or SEQ ID NO:12.

[0092] In some embodiments, a suitable mRNA encodes a fusion protein comprising a full-length, fragment, or portion of the GAA protein fused to another protein (e.g., an N- or C-terminal fusion). In some embodiments, the protein fused to the mRNA encoding the full-length, fragment, or portion of the GAA protein encodes a signal sequence or a cellular targeting sequence.

[0093] delivery vehicle According to the present invention, mRNA encoding a GAA protein described herein (e.g., a full-length, fragment, or portion of a GAA protein) may be delivered as naked RNA (unpackaged) or via a delivery vehicle. As used herein, the terms "delivery vehicle," "transport vehicle," "nanoparticle," or grammatical equivalents are used interchangeably.

[0094] In some embodiments, mRNA encoding a GAA protein may be delivered via a single delivery vehicle. In some embodiments, mRNA encoding a GAA protein may be delivered via one or more delivery vehicles, each with a different composition. According to various embodiments, suitable delivery vehicles include, but are not limited to, polymeric carriers such as polyethyleneimine (PEI), lipid nanoparticles and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, exosomes of both natural and synthetic origin, natural, synthetic, and semi-synthetic lamellar bodies, nanoparticulates, calcium phosphate-silicate nanoparticles, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline microparticles, semiconductor nanoparticles, poly(D-arginine), sol-gels, nanodendrimers, starch-based delivery systems, micelles, emulsions, niosomes, multidomain block polymers (vinyl polymers, polypropylacrylic acid polymers, dynamic polyconjugates), dry powder formulations, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vector tags.

[0095] Liposomal Delivery Vehicles In some embodiments, a suitable delivery vehicle is a liposome delivery vehicle, such as a lipid nanoparticle. As used herein, liposome delivery vehicles, such as lipid nanoparticles, are typically characterized as extremely small vesicles with an internal aqueous space separated from the external medium by one or more bilayer membranes. The bilayer membrane of a liposome is typically formed by amphiphilic molecules, such as synthetic or naturally occurring lipids, which have spatially separated hydrophilic and hydrophobic domains (Lasic, Trends Biotechnol., 16:307-321, 1998). The bilayer membrane of a liposome can also be formed by amphiphilic polymers and surfactants (e.g., polymerosomes, niosomes, etc.). In the context of the present invention, liposome delivery vehicles generally serve to transport desired mRNA to target cells or tissues.

[0096] cationic lipids In some embodiments, liposomes may contain one or more cationic lipids. As used herein, the term "cationic lipid" refers to any of a number of lipid species that have a net positive charge at a selected pH, such as physiological pH. Several cationic lipids have been described in the literature, many of which are commercially available. Cationic lipids that are particularly suitable for use in the compositions and methods of the present invention include those described in International Patent Publications WO2010 / 053572 (especially CI2-200, as described in paragraph

[0225] ) and WO2012 / 170930, which are incorporated herein by reference. In certain embodiments, the compositions and methods of the present invention comprise ionizable cationic lipids described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012, which is incorporated herein by reference, such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z, Lipid nanoparticles containing (18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001) and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002) were used.

[0097] In some embodiments, provided liposomes comprise cationic lipids as described in WO2013 / 063468 and in U.S. provisional application entitled "Lipid Formulations for Delivery of Messenger RNA," filed concurrently with this application, both of which are incorporated herein by reference.

[0098] In some embodiments, the cationic lipid has the formula I-c1-a: [ka] or a pharmaceutically acceptable salt thereof, wherein: Each R 2 are independently hydrogen or C 1‐3 is alkyl; each q is independently 2 to 6; Each R' is independently hydrogen or C 1‐3 is alkyl; And each R L is independently C 8‐12 It is alkyl.

[0099] In some embodiments, each R 2 is independently hydrogen, methyl, or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0100] In some embodiments, each q is independently 3 to 6. In some embodiments, each q is independently 3 to 5. In some embodiments, each q is 4.

[0101] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0102] In some embodiments, each R L is independently C 8‐12 In some embodiments, each R L are independently n‐C 8‐12 In some embodiments, each R L is independently C 9‐11 In some embodiments, each R L are independently n‐C 9‐11 In some embodiments, each R L is independently C 10 In some embodiments, each R L are independently n‐C 10 It is alkyl.

[0103] In some embodiments, each R 2 is independently hydrogen or methyl; each q is independently 3 to 5; each R' is independently hydrogen or methyl; each R L independently C 8‐12 It is alkyl.

[0104] In some embodiments, each R 2 is hydrogen; each q is independently 3 to 5; each R' is hydrogen; and each R L is independently C 8‐12 It is alkyl.

[0105] In some embodiments, each R 2 is hydrogen; each q is 4; each R' is hydrogen ;Each R L is independently C 8‐12 It is alkyl.

[0106] In some embodiments, the cationic lipid has the formula I-g: [ka] or a pharmaceutically acceptable salt thereof, wherein each R L is independently C 8‐12 In some embodiments, each R L are independently n‐C 8‐12 In some embodiments, each R L is independently C 9‐11 In some embodiments, each R L are independently n‐C 9‐11 In some embodiments, each R L is independently C 10 In some embodiments, each R L n-C 10 It is alkyl.

[0107] In certain embodiments, provided liposomes comprise the cationic lipid cKK-E12, i.e., (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below: [ka]

[0108] In some embodiments, one or more cationic lipids can be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA" (Feigner et al. (Proc. Nat'l Acad. Sci. 84, 7413 (1987); US Pat. No. 4,897,355). DOTMA can be formulated alone or in combination with a neutral lipid, dioleoylphosphatidylethanolamine or "DOPE," or other cationic or non-cationic lipids, within liposome delivery vesicles or lipid nanoparticles. Such liposomes can be used to enhance delivery of nucleic acids to target cells. Other suitable cationic lipids include, but are not limited to, 5-carboxyspermylglycine dioctadecylamide (DOGS), 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-1-propanaminium (DOSPA) (Behr et al. Proc. Nat. Acad. Sci. 86, 6982 (1989); US Pat. No. 5,171,678; US Pat. No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane (DODAP), and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP).

[0109] Further examples of cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA," 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA," 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA," 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA," N-dioleyl-N,N-dimethylammonium chloride or "DODAC," N,N-distearyl N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-ene-3-β-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane or "CLinDMA", 2-[5'-(cholest-5-ene-3-β-oxy)-3'-oxapentoxy]-3-dimethyl-1-(cis,cis s-9',1-2'-octadecadienooxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleoylcarbamyl-3- Dimethylaminopropane or "DLinCDAP," 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin-DMA," 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA," and 2-(2,2-di((9Z,12Z)-octadeca-9,11-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA)) (WO2010 / 042877; Semple et al., Nature Biotech.28:172-176 (2010)), or mixtures thereof. (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, DV., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO2005 / 121348A1). In some embodiments, one or more of the cationic lipids comprises at least one of an imidazole, dialkylamino, or guanidinium moiety.

[0110] In some embodiments, the one or more cationic lipids are selected from the group consisting of XTC (2,2-Dilinoley 1-4-dimethylaminoethyl-1-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3 ]dioxol-5-amine), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioyl-3-dimethylammonium propane), HGT4003 (WO2012 / 170889, the contents of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the contents of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the contents of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), aminoalcohol lipidoids such as those disclosed in WO 2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic DLin-KC2-DMA (Semple, SC et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KTet al. "Lipid-like materials for low-dose in vivo gene silencing" PNAS 2010, 107, 1864-1869).

[0111] In some embodiments, the proportion of cationic lipid in the liposome may be greater than 10%, greater than 20%, greater than 30%, greater than 40%, greater than 50%, greater than 60%, or greater than 70%. In some embodiments, the cationic lipid(s) comprise about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome by weight. In some embodiments, the cationic lipid (e.g., cKK-E12) comprises about 30%, about 35%, about 40%, about 45%, or about 50% of the liposome by molar ratio.

[0112] Non-cationic / Helper Lipids In some embodiments, provided liposomes contain one or more non-cationic ("helper") lipids. As used herein, the phrase "non-cationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine (DPPG ... The amines include, but are not necessarily limited to, 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans-PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof.

[0113] In some embodiments, such non-cationic lipids can be used alone, but are preferably used in combination with other excipients, such as cationic lipids. In some embodiments, the non-cationic lipids may comprise a molar ratio of about 5% to about 90%, or about 10% to about 70%, of the total lipids present in the liposome. In some embodiments, the non-cationic lipids are neutral lipids, i.e., lipids that have no net charge under the conditions in which the composition is formulated and / or administered. In some embodiments, the proportion of non-cationic lipids in the liposomes may be greater than 5%, greater than 10%, greater than 20%, greater than 30%, or greater than 40%.

[0114] Cholesterol-based lipids In some embodiments, the provided liposomes comprise one or more cholesterol-based lipids. For example, suitable cholesterol-based cationic lipids include DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); US Pat. No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid may comprise about 2% to about 30%, or about 5% to about 20% by molar ratio of the total lipids present in the liposome. In some embodiments, the proportion of cholesterol-based lipids in the lipid nanoparticles may be greater than 5%, 10%, 20%, 30%, or 40%.

[0115] PEGylated lipids In some embodiments, the provided liposomes comprise one or more PEGylated lipids. For example, the present invention contemplates the use of polyethylene glycol (PEG)-modified phospholipids, including N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide), and derivatized lipids, such as derivatized ceramides (PEG-CER), in combination with one or more cationic lipids, and in some embodiments, other lipids, to form liposomes. PEG-modified lipids contemplated include those with chain lengths of C6 to C8. 20 Examples of suitable PEG-modified or PEGylated lipids include, but are not limited to, polyethylene glycol chains having alkyl chain(s) of up to 5 kDa in length covalently attached to the lipid. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. The addition of such components may prevent complex aggregation, prolong circulation life, and provide a means of enhancing delivery of lipid-nucleic acid compositions to target cells (Klibanov et al. (1990) FEBS Letters, 268(1):235-237), or components may be selected to be rapidly cleared from the formulation in vivo (see U.S. Pat. No. 5,885,613).

[0116] In some embodiments, particularly useful exchangeable lipids are those with shorter acyl chains (e.g., C 14 or C 18 The PEG-modified phospholipid and derivatized lipid of the present invention may have a molar ratio of about 0% to about 15%, about 0.5% to about 15%, about 1% to about 15%, about 4% to about 10%, or about 2% of the total lipids present in the liposome.

[0117] According to various embodiments, the selection of cationic lipid, non-cationic lipid and / or PEG-modified lipid comprising lipid nanoparticles and the relative molar ratio of these lipids will depend on the characteristics of selected lipid(s), the nature of the intended target cell, and the characteristics of the mRNA to be delivered.Further considerations include, for example, the saturation degree of alkyl chain, and the size, charge, pH, pKa, membrane fusion property and toxicity of selected lipid(s).Therefore, the molar ratio can be adjusted accordingly.

[0118] polymer In some embodiments, suitable delivery vehicles are formulated using polymers as carriers, either alone or in combination with other carriers, including various lipids, as described herein. Thus, in some embodiments, the liposome delivery vehicles used herein also encompass nanoparticles containing polymers. Suitable polymers may include, for example, polyacrylate, polyalkylcyanoacrylate, polylactide, polylactide-polyglycolide copolymer, polycaprolactone, dextran, albumin, gelatin, alginate, collagen, chitosan, cyclodextrin, protamine, PEGylated protamine, PLL, PEGylated PLL, and polyethyleneimine (PEI). When PEI is present, it may be branched PEI with a molecular weight ranging from 10 to 40 kDa, such as 25 kDa branched PEI (Sigma #408727).

[0119] Liposomes suitable for the present invention may contain any one or more of the cationic lipids, non-cationic lipids, cholesterol lipids, PEGylated lipids, and / or polymers described herein in various ratios. As a non-limiting example, a suitable liposome formulation may contain a combination selected from cKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT4003, DOPE, cholesterol, and DMG-PEG2K; or ICE, DOPE, cholesterol, and DMG-PEG2K.

[0120] In various embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) accounts for about 30-60% (e.g., about 30-55%, about 30-50%, about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the liposome. In some embodiments, the cationic lipid (e.g., cKK-E12, C12-200, ICE, and / or HGT4003) accounts for about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% or more of the liposome.

[0121] In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be about 30-60:25-35:20-30:1-15, respectively. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be approximately 40:30:20:10, respectively. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be approximately 40:30:25:5, respectively. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be approximately 40:32:25:3, respectively. In some embodiments, the ratio of cationic lipid(s), non-cationic lipid(s), cholesterol-based lipid(s), and PEGylated lipid(s) may be approximately 50:25:20:5, respectively.

[0122] mRNA synthesis The mRNA of the present invention may be synthesized according to any of a variety of known methods. For example, the mRNA of the present invention may be synthesized by in vitro transcription (IVT). Briefly, IVT is typically performed using a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may contain DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or RNAse inhibitor. The exact conditions will vary depending on the specific application.

[0123] In some embodiments, a DNA template is transcribed in vitro to prepare mRNA according to the present invention. A suitable DNA template typically comprises a promoter for in vitro transcription, such as a T3, T7, or SP6 promoter, downstream of which is the desired nucleotide sequence of the desired mRNA, and a termination signal.

[0124] The desired mRNA sequence(s) according to the present invention may be determined using standard methods and incorporated into a DNA template. For example, starting from the desired amino acid sequence (e.g., an enzyme sequence), virtual back-translation is performed based on the degenerate genetic code. Appropriate codons may then be selected using an optimization algorithm. Generally, the G / C content may be optimized to achieve the highest possible G / C content, and on the other hand, to take into account the frequency of tRNAs as much as possible according to codon usage. The optimized RNA sequence may be established and displayed, for example, using a suitable display device, and compared with the original (wild-type) sequence. The secondary structure may also be analyzed to calculate the stabilizing and destabilizing properties of the RNA, or the regions corresponding to each.

[0125] modified mRNA In some embodiments, mRNA according to the present invention may be synthesized as unmodified mRNA or modified mRNA. Generally, mRNA is modified to increase stability. Modification of mRNA may include, for example, modifications of nucleotides of RNA. Thus, modified mRNA according to the present invention may include, for example, backbone modifications, sugar modifications, or base modifications. In some embodiments, mRNA may be synthesized from natural nucleotides and / or nucleotide analogs (modified nucleotides), examples of which include purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyladenine, 2-methyladenine, 2-methylthio-N-6-isopentenyl adenine. N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydrouracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethyluracil Aminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil Examples of suitable nucleotides include, but are not limited to, methyl uracil-5-oxyacetic acid, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosylqueosine, wybutoxosine, and phosphoramidates, thiophosphates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine.The preparation of such analogs is known to those skilled in the art, e.g., from U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642, the disclosures of which are incorporated herein by reference in their entireties.

[0126] In some embodiments, the mRNA (e.g., the mRNA encoding GAA) The backbone modification may include an RNA backbone modification. Generally, the backbone modification is a chemical modification of the phosphate of the backbone of the nucleotide contained in the RNA. Common backbone modifications include, but are not limited to, modifications from the group consisting of methylphosphonate group, methylphosphoramidate group, phosphoramidate group, phosphorothioate group (e.g., cytidine 5'-O-(1-thiophosphate)), boranophosphate, positively charged guanidinium group, etc., which means that the phosphodiester bond is replaced with another anionic group, cationic group, or neutral group.

[0127] In some embodiments, an mRNA (e.g., an mRNA encoding GAA) may include a sugar modification. Common sugar modifications are chemical modifications of the sugar of a nucleotide, including, but not limited to, 2'-deoxy-2'-fluoro-oligoribonucleotides (2'-fluoro-2'-deoxycytidine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-deoxy-2'-deamine-oligoribonucleotides (2'-amino-2'-deoxycytidine 5'-triphosphate, 2'-amino-2'-deoxyuridine 5'-triphosphate), 2'-O-alkyloligoribonucleotides (2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-fluoro-2'-deoxyuridine 5'-triphosphate, 2'-fluoro-2'-deoxyuridine 5'-triphosphate), 2'-amino-2'-deoxyuridine 5'-triphosphate, ... The oligoribonucleotides include 2'-deoxy-2'-C-alkyl oligoribonucleotides (2'-O-methylcytidine 5'-triphosphate, 2'-methyluridine 5'-triphosphate), 2'-C-alkyl oligoribonucleotides, and their isomers (2'-aracytidine 5'-triphosphate, 2'-aruridine 5'-triphosphate), or azido triphosphate (2'-azido-2'-deoxycytidine 5'-triphosphate, 2'-azido-2'-deoxyuridine 5'-triphosphate).

[0128] In some embodiments, an mRNA (e.g., an mRNA encoding GAA) may contain a modification of the base of a nucleotide (base modification). Modified nucleotides containing a base modification are also referred to as base-modified nucleotides. Examples of such base-modified nucleotides include 2-amino-6-chloropurine riboside 5'-triphosphate, 2-aminoadenosine 5'-triphosphate, 2-thiocytidine 5'-triphosphate, 2-thiouridine 5'-triphosphate, 4-thiouridine 5'-triphosphate, 5-aminoallylcytidine 5'-triphosphate, 5-aminoallyluridine 5'-triphosphate, 5-bromocytidine 5'-triphosphate, 5-bromouridine 5'-triphosphate, 5-iodocytidine 5'-triphosphate, 5-iodouridine 5'-triphosphate, 5-methylcytidine 5'-triphosphate, 5-methyluridine 5'-triphosphate, 6-azacyt ... Examples of suitable anti-inflammatory drugs include, but are not limited to, thiazolinone 5'-triphosphate, 6-chloropurine riboside 5'-triphosphate, 7-deazaadenosine 5'-triphosphate, 7-deazaguanosine 5'-triphosphate, 8-azaadenosine 5'-triphosphate, 8-azidoadenosine 5'-triphosphate, benzimidazole riboside 5'-triphosphate, N1-methyladenosine 5'-triphosphate, N1-methylguanosine 5'-triphosphate, N6-methyladenosine 5'-triphosphate, O6-methylguanosine 5'-triphosphate, pseudouridine 5'-triphosphate, puromycin 5'-triphosphate, and xanthosine 5'-triphosphate.

[0129] Generally, mRNA synthesis involves the addition of a "cap" to the N-terminus (5') and a "tail" to the C-terminus (3'). The presence of the cap is important in conferring resistance to nucleases found in many eukaryotic cells. The presence of the "tail" helps protect the mRNA from degradation by exonucleases.

[0130] Thus, in some embodiments, an mRNA (e.g., an mRNA encoding GAA) includes a 5'-end cap structure. The 5'-end cap is generally added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphate groups; then, a guanylyltransferase adds guanosine triphosphate (GTP) to the terminal phosphate group, forming a 5'5'5 triphosphate bond. and a methyltransferase methylates the nitrogen at position 7 of the guanine. Examples of cap structures include, but are not limited to, mG(5')ppp(5')A, G(5')ppp(5')A, and G(5')ppp(5')G.

[0131] In some embodiments, an mRNA (e.g., an mRNA encoding GAA) comprises a 3' poly(A) tail structure. The poly(A) tail at the 3' end of the mRNA typically comprises about 10-300 adenosine nucleotides (SEQ ID NO: 4) (e.g., about 10-200 adenosine nucleotides, about 10-150 adenosine nucleotides, about 10-100 adenosine nucleotides, about 20-70 adenosine nucleotides, or about 20-60 adenosine nucleotides). In some embodiments, an mRNA comprises a 3' poly(C) tail structure. A suitable poly(C) tail at the 3' end of an mRNA typically comprises about 10-200 cytosine nucleotides (SEQ ID NO: 5) (e.g., about 10-150 cytosine nucleotides, about 10-100 cytosine nucleotides, about 20-70 cytosine nucleotides, about 20-60 cytosine nucleotides, or about 10-40 cytosine nucleotides). The poly-C tail may be added to or may replace the poly-A tail.

[0132] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region may be approximately 50-500 nucleotides in length.

[0133] In some embodiments, the 3' untranslated region comprises one or more polyadenylation signals, binding sites for proteins that affect the intracellular stability of mRNA, or one or more miRNA binding sites. In some embodiments, the 3' untranslated region may be 50 to 500 or more nucleotides in length.

[0134] Cap Structure In some embodiments, the mRNA comprises a 5'-end cap structure. The 5'-end cap is generally added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphate groups; then, a guanylyltransferase adds guanosine triphosphate (GTP) to the terminal phosphate group, generating a 5'5'5 triphosphate bond; and finally, a methyltransferase methylates the nitrogen at position 7 of guanine. Examples of cap structures include, but are not limited to, mG(5')ppp(5'(A), G(5')ppp(5')A, and G(5')ppp(5')G.

[0135] The natural cap structure contains a 7-methylguanosine attached by a triphosphate bridge to the 5' end of the primary transcribed nucleotide, which is 7 The dinucleotide cap is G(5')ppp(5')N (where N is any nucleoside). In vivo, enzymatic capping is performed. The cap is added in the cell nucleus and is catalyzed by the enzyme guanylyltransferase. Capping of the 5' end of RNA occurs immediately after transcription initiation. The terminal nucleoside is usually guanosine, and is in the reverse orientation relative to all other nucleotides, i.e., G(5')ppp(5')GpNpNp.

[0136] The general mRNA cap produced by in vitro transcription is m 7G(5')ppp(5')G, which has been used as a dinucleotide cap in in vitro transcription with T7 or SP6 RNA polymerase to obtain RNA with a 5'-capped structure. The most common method for synthesizing capped mRNA in vitro is to use a preformed m 7 G(5')ppp(5')G("m 7 G pppG) type dinucleotides are used as transcription initiation factors.

[0137] To date, the usual type of synthetic dinucleotide cap used in in vitro translation experiments is the anti-reverse cap analog ("ARCA") or modified ARCA, which is generally a modified cap analog in which the OH group at the 2' or 3' position is replaced with -OCH3.

[0138] As a further cap analogue, m 7 GpppG, m 7 GpppA, m 7 a chemical structure selected from the group consisting of GpppC; a non-methylated cap analog (e.g., GpppG); a dimethylated cap analog (e.g., m 2,7 GpppG), trimethylated cap analogs (e.g., m 2,2,7 GpppG), symmetrically dimethylated cap analogs (e.g., m 7 Gpppm 7 G), or anti-reverse cap analogs (e.g., ARCA; m 7,2’Ome GpppG, m 72’d GpppG, m 7,3’Ome GpppG, m 7,3’d GpppG and their tetraphosphate derivatives) (see, for example, Jemielity, J. et al., "Novel 'anti-reverse' cap analogs with superior translational properties", RNA, 9:1108-1122 (2003)), but are not necessarily limited to these.

[0139] In some embodiments, a suitable cap comprises 7-methylguanylic acid ("m") attached by a triphosphate bridge to the 5' end of the primary transcribed nucleotide. 7 G"), which is m 7 G(5')ppp(5')N (N is any nucleoside). 7 The preferred embodiment of the G-cap is m 7 G(5')ppp(5')G.

[0140] In some embodiments, the cap is a Cap0 structure. A Cap0 structure has no 2'-O-methyl residues on the ribose attached to bases 1 and 2. In some embodiments, the cap is a Cap1 structure. A Cap1 structure has a 2'-O-methyl residue on base 2. In some embodiments, the cap is a Cap2 structure. A Cap2 structure has 2'-O-methyl residues attached to both bases 2 and 3.

[0141] A wide variety of m 7 G-cap analogs are known in the art, many of which are commercially available. These include the m 7 These include GpppG, and ARCA 3'-OCH3 and 2'-OCH3 cap analogs (Jemielity, J. et al., RNA, 9:1108-1122 (2003)). Additional cap analogs for use in embodiments of the present invention include N7-benzylated dinucleoside tetraphosphate analogs (described in Grudzien, E. et al., RNA, 10:1479-1487 (2004)), thiophosphate cap analogs (Grudzien-Nogalska, E., et al., RNA, 10:1479-1487 (2004)), and the like. et al., RNA, 13:1745-1755 (2007)), and cap analogs (including biotinylated cap analogs) described in U.S. Patent Nos. 8,093,367 and 8,304,529, which are incorporated herein by reference.

[0142] Tail Structure Generally, the presence of a "tail" helps protect mRNA from degradation by exonucleases. Poly-A tails are thought to stabilize natural messenger and synthetic sense RNA. Thus, in some embodiments, a long poly-A tail can be added to an mRNA molecule, thereby making the RNA more stable. Poly-A tails can be added using a variety of techniques recognized in the art. For example, synthetic RNA or in vitro transcribed RNA can be polymerized with a long poly-A polymerase. A tail can be added (Yokoe, et al. Nature Biotechnology. 1996;14:1252-1256). A long polyA tail can also be encoded in the transcription vector. Furthermore, a polyA tail can be added by direct transcription from a PCR product. PolyA can also be ligated to the 3' end of the sense RNA using RNA ligase (see, e.g., Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1991 edition)).

[0143] In some embodiments, the mRNA comprises a 3' poly(A) tail structure. Generally, the length of the poly(A) tail can be at least about 10, 50, 100, 200, 300, 400, or at least 500 nucleotides (SEQ ID NO: 6). In some embodiments, the poly(A) tail at the 3' end of the mRNA generally comprises about 10-300 adenosine nucleotides (SEQ ID NO: 4) (e.g., about 10-200 adenosine nucleotides, about 10-150 adenosine nucleotides, about 10-100 adenosine nucleotides, about 20-70 adenosine nucleotides, or about 20-60 adenosine nucleotides). In some embodiments, the mRNA comprises a 3' poly(C) tail structure. A suitable poly-C tail at the 3' end of an mRNA generally contains about 10 to 200 cytosine nucleotides (SEQ ID NO: 5) (e.g., about 10 to 150 cytosine nucleotides, about 10 to 100 cytosine nucleotides, about 20 to 70 cytosine nucleotides, about 20 to 60 cytosine nucleotides, or about 10 to 40 cytosine nucleotides). The poly-C tail may be added to or replace the poly-A tail.

[0144] In some embodiments, the length of the poly-A tail or poly-C tail is adjusted to control the stability of the modified sense mRNA molecules of the present invention, thereby controlling protein transcription. For example, because the length of the poly-A tail affects the half-life of the sense mRNA molecule, the length of the poly-A tail can be adjusted to alter the nuclease resistance of the mRNA, thereby controlling the time course of polynucleotide expression and / or polypeptide production in target cells.

[0145] 5' and 3' untranslated regions In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect mRNA stability or translation, such as an iron-responsive element. In some embodiments, the 5' untranslated region may be approximately 50-500 nucleotides in length.

[0146] In some embodiments, the 3' untranslated region comprises one or more polyadenylation signals, binding sites for proteins that affect the intracellular stability of mRNA, or one or more miRNA binding sites. In some embodiments, the 3' untranslated region may be 50 to 500 or more nucleotides in length.

[0147] Exemplary 3' and / or 5' UTR sequences can be derived from stable mRNA molecules (e.g., globin, actin, GAPDH, tubulin, histones, or enzymes of the citric acid cycle) to enhance the stability of the sense mRNA molecule. For example, the 5' UTR sequence can include a subsequence of the CMV immediate early 1 (IE1) gene, or a fragment thereof, to enhance nuclease resistance and / or improve the half-life of the polynucleotide. It is also contemplated to include a sequence encoding human growth hormone (hGH), or a fragment thereof, at the 3' end or untranslated region of the polynucleotide (e.g., mRNA) to further stabilize the polynucleotide. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the polynucleotide compared to the unmodified polynucleotide. However, these modifications also include, for example, modifications made to improve the resistance of such polynucleotides to digestion by in vivo nucleases.

[0148] Liposome formation Liposomal delivery vehicles for use in the compositions of the present invention can be prepared by a variety of techniques currently known in the art. Liposomes for use in the provided compositions can be prepared by a variety of techniques currently known in the art. For example, multilamellar liposomes (MLVs) can be prepared according to conventional techniques, such as dissolving selected lipids in an appropriate solvent and depositing the lipids on the inside wall of a suitable container or vessel, followed by evaporating the solvent to dryness, leaving a thin film on the inside of the container, or by spray drying. An aqueous phase can then be added to the vessel with vortexing, thereby forming MLVs. Unilamellar liposomes (ULVs) can then be formed by homogenizing, sonicating, or extruding the multilamellar liposomes. Additionally, unilamellar liposomes can be formed by detergent removal methods.

[0149] In some embodiments, the provided composition comprises liposomes, wherein mRNA is associated with both sides of the liposome and encapsulated within the same liposome.For example, during the preparation of the composition of the present invention, cationic liposomes can be associated with mRNA through electrostatic interaction.For example, during the preparation of the composition of the present invention, cationic liposomes can be associated with mRNA through electrostatic interaction.

[0150] In some embodiments, the compositions and methods of the present invention include mRNA encapsulated within liposomes. In some embodiments, more than one mRNA species may be encapsulated within the same liposome. In some embodiments, more than one mRNA species may be encapsulated within different liposomes. In some embodiments, the mRNA is encapsulated within one or more liposomes that differ in lipid composition, molar ratio of lipid components, size, charge (zeta potential), targeting ligand, and / or combinations thereof. In some embodiments, one or more liposomes may differ in composition of cationic lipids, neutral lipids, PEG-modified lipids, and / or combinations thereof. In some embodiments, one or more liposomes may differ in the molar ratios of cationic lipids, neutral lipids, cholesterol, and PEG-modified lipids used to prepare the liposomes.

[0151] The process of incorporating a desired mRNA into liposomes is often referred to as "loading." One example of this process is described in Lasic, et al., FEBS Lett., 312:255-258, 1992, which is incorporated herein by reference. The nucleic acid incorporated into liposomes may be located, completely or partially, in the interior space of the liposome, within the liposome bilayer, or associated with the outer surface of the liposome membrane. The incorporation of nucleic acids into liposomes is also referred to herein as "encapsulation," in which the nucleic acid is contained entirely within the interior space of the liposome. The purpose of incorporating mRNA into a transport vehicle such as a liposome is often to protect the nucleic acid from an environment that may contain enzymes or chemicals that degrade the nucleic acid and / or systems or receptors that rapidly excrete the nucleic acid. Thus, in some embodiments, a suitable delivery vehicle can enhance the stability of the mRNA it carries and / or facilitate delivery of the mRNA to target cells or tissues.

[0152] Liposome size Suitable liposomes of the present invention may be produced in a variety of sizes. In some embodiments, the provided liposomes may be smaller than previously known mRNA-encapsulating liposomes. In some embodiments, reduced liposome size is associated with higher efficiency of mRNA delivery. Selection of the appropriate liposome size may take into account the target cell or tissue site and, to some extent, the application for which the liposomes are produced.

[0153] In some embodiments, liposomes of appropriate size are selected to facilitate the systemic distribution of the mRNA-encoded antibody. In some embodiments, it may be desirable to restrict the transfection of mRNA to specific cells or tissues. For example, to target hepatocytes, liposomes may be sized to be smaller than the pores of the endothelial cell layer of the liver sinusoidal lining, and in such cases, liposomes may be able to easily pass through these pores of the endothelial cells and reach the targeted hepatocytes.

[0154] Alternatively or additionally, liposomes may be sized to have a diameter sufficient to limit or significantly prevent delivery to particular cells or tissues, for example, liposomes may be sized to be larger than the pores of the endothelial cell layer lining the liver sinusoids, thereby limiting delivery of liposomes to hepatocytes.

[0155] In some embodiments, liposome size is determined by the longest diameter of the liposome particle. In some embodiments, suitable liposomes are about 250 nm or less in size (e.g., about 225 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, or 50 nm or less). In some embodiments, suitable liposome sizes are in the range of about 10 to 250 nm (e.g., about 10 to 225 nm, 10 to 200 nm, 10 to 175 nm, 10 to 150 nm, 10 to 125 nm, 10 to 100 nm, 10 to 75 nm, or 10 to 50 nm). In some embodiments, suitable liposome sizes are in the range of about 100 to 250 nm (e.g., about 100 to 225 nm, 100 to 200 nm, 100 to 175 nm, or 100 to 150 nm). In some embodiments, suitable liposomes have a size in the range of about 10 to 100 nm (e.g., in the range of about 10 to 90 nm, 10 to 80 nm, 10 to 70 nm, 10 to 60 nm, or 10 to 50 nm). In certain embodiments, suitable liposomes have a size of less than about 100 nm.

[0156] Various alternative methods known in the art are available for controlling the size of liposome populations. One such size control method is described in U.S. Pat. No. 4,737,323, which is incorporated herein by reference. Sonication of a liposome suspension using bath or probe sonication results in a stepwise size reduction, producing small ULVs with diameters less than approximately 0.05 μm. Homogenization is another method for reducing large liposomes using shear energy. A typical homogenization procedure involves passing MLVs through a standard emulsion homogenizer and recirculating them until liposomes of a selected size, typically approximately 0.1-0.5 μm, are obtained. Liposome size may also be measured by quasi-elastic light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421-150 (1981), which is incorporated herein by reference. Sonication of formed liposomes can reduce the average liposome diameter. Intermittent sonication cycles may be alternated with QELS assessment to efficiently synthesize liposomes.

[0157] Pharmaceutical Composition To facilitate expression of mRNA in vivo, delivery vehicles such as liposomes can be formulated into pharmaceutical compositions in combination with one or more additional nucleic acids, carriers, targeting ligands, or stabilizers, or mixed with appropriate excipients. Techniques for drug formulation and administration are described in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition.

[0158] The provided liposome-encapsulated or -associated mRNA and compositions containing the same are Administration and dosing may be in accordance with current medical practice, taking into account factors relevant to a skilled clinician, such as the subject's clinical condition, the site and method of administration, the administration schedule, and the subject's age, sex, and weight. An "effective amount" for purposes herein may be determined by considering relevant factors well known to those skilled in the art of pilot clinical studies, pharmacology, clinical, and medical science. In some embodiments, the dosage is effective to achieve at least some stabilization, improvement, or elimination of symptoms and other indicators selected by those skilled in the art as appropriate measures of disease progression, regression, or improvement. For example, a suitable amount and administration regimen is one that results in at least transient production of a protein (e.g., an enzyme).

[0159] Suitable routes of administration include, for example, oral, enteral, vaginal, transmucosal, intratracheal or pulmonary, including inhalation, or enteral administration; parenteral delivery by intradermal, transdermal (topical), intramuscular, subcutaneous, or intramedullary injection, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal, or intranasal parenteral delivery. In certain embodiments, intramuscular administration is to a muscle selected from the group consisting of skeletal muscle, smooth muscle, and cardiac muscle. In some embodiments, administration results in delivery of the mRNA to muscle cells. In some embodiments, administration results in delivery of the mRNA to hepatocytes (i.e., liver cells). In certain embodiments, intramuscular administration results in delivery of the mRNA to muscle cells.

[0160] Alternatively or additionally, liposome-encapsulated mRNA and compositions of the present invention may be administered locally rather than systemically, for example, by direct injection of the pharmaceutical composition into the target tissue, preferably as a sustained-release formulation. Local delivery can be affected in a variety of ways, depending on the target tissue. For example, aerosols containing the compositions of the present invention can be inhaled (nasal, tracheal, or bronchial delivery); compositions of the present invention can be injected, for example, at the site of an injury, disease manifestation, or pain; compositions can be provided in lozenges for oral, tracheal, or esophageal application; compositions can be provided in the form of liquids, tablets, or capsules for gastric or intestinal administration, or in suppositories for rectal or vaginal application; or compositions can even be delivered to the eye, using creams, eye drops, or injections. Formulations containing the provided compositions complexed with therapeutic molecules or ligands can also be administered via surgical procedures, for example, by association with polymers or other structures or substances that allow the compositions to diffuse from the implantation site to surrounding cells. Alternatively, they can be applied in a surgical procedure without the use of a polymer or support.

[0161] The methods provided herein contemplate single as well as multiple administrations of a therapeutically effective amount of a therapeutic agent (e.g., an mRNA encoding a GAA protein) described herein. The therapeutic agent can be administered at regular intervals depending on the nature, severity, and extent of the subject's condition (e.g., Pompe disease). In some embodiments, a therapeutically effective amount of a therapeutic agent (e.g., an mRNA encoding a GAA protein) of the present invention may be administered intrathecally at regular intervals (e.g., yearly, every 6 months, every 5 months, every 3 months, every other month (every 2 months), monthly (monthly), every other week (every 2 weeks), twice a month, every 30 days, every 28 days, every 14 days, every 10 days, every 7 days, weekly, twice a week, daily, or continuously).

[0162] In some embodiments, the provided liposomes and / or compositions are formulated to favor sustained release of the mRNA they contain. Such sustained release compositions can extend the administration interval, making them more convenient for administration to a subject. For example, in one embodiment, the compositions of the present invention are administered to a subject twice daily, on consecutive days, or every other day. In preferred embodiments, the compositions of the present invention are administered to a subject twice weekly, once weekly, once every 7 days, once every 10 days, once every 14 days, once every 28 days, once every 30 days, once every 2 weeks, once every 3 weeks, or, more preferably, once every 4 weeks, once a month, twice a month, once every 6 weeks, once every 8 weeks, once every 2 months, once every 3 months, or once every 4 weeks. The subject is administered once a month, once every six months, once every eight months, once every nine months, or annually. Compositions and liposomes formulated for depot administration (e.g., intramuscular, subcutaneous, intravitreal) to deliver or release mRNA over an extended period of time are also contemplated. Preferably, the sustained release method used is combined with modifications to enhance mRNA stability.

[0163] As used herein, the term "therapeutically effective amount" is determined primarily based on the total amount of the therapeutic agent contained in the pharmaceutical composition of the present invention. Generally, a therapeutically effective amount is sufficient to achieve a meaningful benefit to the subject (e.g., treatment, modulation, cure, prevention, and / or amelioration of Pompe disease). For example, a therapeutically effective amount may be an amount sufficient to achieve a desired therapeutic and / or prophylactic effect. Generally, the amount of a therapeutic agent (e.g., mRNA encoding a GAA protein) administered to a subject in need of treatment will vary depending on the characteristics of the subject. Such characteristics include the subject's condition, disease severity, overall health, age, sex, and weight. Those skilled in the art will readily be able to determine appropriate dosages depending on these and other relevant factors. Furthermore, objective and subjective assessments may optionally be used to identify optimal dosage ranges.

[0164] A therapeutically effective amount is generally administered in a dosage regimen that may include multiple unit doses. For any particular therapeutic protein, the therapeutically effective amount (and / or appropriate unit dose within the effective dosage regimen) may vary depending on, for example, the route of administration, the combination with other pharmaceutical preparations, etc. The specific therapeutically effective amount (and / or unit dose) for any particular patient will also depend on a variety of factors, including the disorder being treated and the severity of the disorder; the activity of the specific preparation used; the specific composition used; the patient's age, weight, general health, sex, and diet; the administration time, administration route, and / or excretion rate or metabolic rate of the specific protein used; the duration of treatment; and similar factors well known in the medical field.

[0165] In some embodiments, the therapeutically effective amount is in the range of about 0.005 mg / kg body weight to 500 mg / kg body weight, e.g., about 0.005 mg / kg body weight to 400 mg / kg body weight, about 0.005 mg / kg body weight to 300 mg / kg body weight, about 0.005 mg / kg body weight to 200 mg / kg body weight, about 0.005 mg / kg body weight to 100 mg / kg body weight, about 0.005 mg / kg body weight to 90 mg / kg body weight, about 0.005 mg / kg body weight to 80 mg / kg body weight, about 0.005 mg / kg body weight to 10 ... The ranges are about 0.005mg / kg body weight to 70mg / kg body weight, about 0.005mg / kg body weight to 60mg / kg body weight, about 0.005mg / kg body weight to 50mg / kg body weight, about 0.005mg / kg body weight to 40mg / kg body weight, about 0.005mg / kg body weight to 30mg / kg body weight, about 0.005mg / kg body weight to 25mg / kg body weight, about 0.005mg / kg body weight to 20mg / kg body weight, about 0.005mg / kg body weight to 15mg / kg body weight, and about 0.005mg / kg body weight to 10mg / kg body weight.

[0166] In some embodiments, the therapeutically effective amount is greater than about 0.1 mg / kg body weight, greater than about 0.5 mg / kg body weight, greater than about 1.0 mg / kg body weight, greater than about 3 mg / kg body weight, greater than about 5 mg / kg body weight, greater than about 10 mg / kg body weight, greater than about 15 mg / kg body weight, greater than about 20 mg / kg body weight, greater than about 30 mg / kg body weight, greater than about 40 mg / kg body weight, greater than about 50 mg / kg body weight, greater than about 60 mg / kg body weight, greater than about 70 mg / kg body weight, greater than about 80 mg / kg body weight, greater than about 90 mg / kg body weight, greater than about 100 mg / kg body weight, greater than about 150 mg / kg body weight, greater than about 200 mg / kg body weight, greater than about 250 mg / kg body weight, greater than about 300 mg / kg body weight, greater than about 350 mg / kg body weight, greater than about 400 mg / kg body weight, greater than about 450 mg / kg body weight, or greater than about 500 mg / kg body weight. In certain embodiments, the therapeutically effective amount is 1.0 mg / kg. In some embodiments, the therapeutically effective amount of 1.0 mg / kg is administered intramuscularly or intravenously.

[0167]

[0006] The present disclosure relates to lyophilized pharmaceutical compositions comprising one or more liposomes disclosed herein, and to uses of such compositions, for example, U.S. Provisional Application No. 2004 / 0029994, filed June 8, 2011. Methods such as those disclosed in Application No. 61 / 494,882 are also contemplated, and the disclosure of which is incorporated herein by reference in its entirety. For example, the lyophilized pharmaceutical compositions of the present invention may be reconstituted prior to administration, or may be reconstituted in vivo. For example, the lyophilized pharmaceutical compositions may be formulated into an appropriate dosage form (e.g., an intradermal dosage form such as a disk, rod, or membrane) and administered, allowing the dosage form to be rehydrated in vivo over time by the individual's bodily fluids.

[0168] The provided liposomes and compositions may be administered to any desired tissue. In some embodiments, the GAA mRNA delivered by the provided liposomes or compositions is expressed in the tissue to which the liposomes and / or compositions are administered. In some embodiments, the delivered mRNA is expressed in a tissue different from the tissue to which the liposomes and / or compositions are administered. Exemplary tissues to which the delivered mRNA may be delivered and / or expressed include, but are not necessarily limited to, the liver, kidney, heart, spleen, serum, brain, skeletal muscle, lymph nodes, skin, and / or cerebrospinal fluid.

[0169] In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels in a biological sample from a subject compared to baseline expression levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. Examples of biological samples include whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline expression levels immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA mRNA expression levels compared to GAA mRNA expression levels in an untreated subject.

[0170] According to the present invention, when a therapeutically effective amount of a provided composition is administered periodically, a subject's liver GAA protein level is increased compared to their baseline liver GAA protein level before treatment. In some embodiments, when a therapeutically effective amount of a provided composition is administered periodically, a subject's muscle GAA protein level is increased compared to their baseline muscle GAA protein level before treatment. In some embodiments, the muscle is skeletal muscle (e.g., striated muscle, voluntary muscle), smooth muscle (e.g., visceral muscle, involuntary muscle), or cardiac muscle. In some embodiments, when a therapeutically effective amount of a provided composition is administered periodically, a subject's serum creatine kinase level is decreased compared to their baseline creatine kinase level before treatment. In some embodiments, when a therapeutically effective amount of a provided composition is administered periodically, a subject's urinary glucose tetrasaccharide (Glcα1-6Glcα1-4Glcα1-4Glc or Glc4) level is decreased compared to their baseline Glc4 level before treatment. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition reduces a subject's serum aspartate transaminase (e.g., AST, aspartate aminotransferase, serum glutamic oxaloacetic transaminase) level compared to pre-treatment baseline AST levels. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition reduces a subject's serum alanine transaminase (e.g., ALT, alanine aminotransferase, serum glutamic pyruvic transaminase) level compared to pre-treatment baseline ALT levels. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition reduces a subject's serum lactate dehydrogenase (e.g., LDH, lactate dehydrogenase) level compared to pre-treatment baseline LDH levels. In some embodiments, periodic administration of a therapeutically effective amount of a provided composition increases a subject's GAA enzyme activity level in a biological sample from a subject compared to pre-treatment baseline GAA enzyme activity level.

[0171] In some embodiments, administration of a provided composition results in an increase in liver GAA protein levels in a subject. In some embodiments, administration of a provided composition results in an increase in hepatic GAA protein levels compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in hepatic GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in hepatic GAA protein levels compared to hepatic GAA protein levels in an untreated subject.

[0172] In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels in a subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in skeletal muscle GAA protein levels compared to skeletal muscle GAA protein levels in an untreated subject.

[0173] In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels in a subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in myocardial GAA protein levels compared to myocardial GAA protein levels in an untreated subject.

[0174] In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels in a subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in smooth muscle GAA protein levels compared to smooth muscle GAA protein levels in an untreated subject.

[0175] In some embodiments, administration of a provided composition results in an increase in intracellular GAA protein levels in the subject's muscle cells compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, the muscle cells are myocytes, myotubes, myoblasts, cardiomyocytes, or cardiomyoblasts. In some embodiments, administration of a provided composition results in an increase in intracellular GAA protein levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in intracellular GAA protein levels in the muscle cells compared to GAA protein levels in untreated subjects.

[0176] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells (e.g., hepatocytes) of the subject compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in liver cells compared to GAA protein levels in liver cells of an untreated subject.

[0177] In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the subject's plasma or serum compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the plasma or serum by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to pre-treatment baseline levels. In some embodiments, administration of a provided composition results in an increase in GAA protein levels in the plasma or serum compared to GAA protein levels in the plasma or serum of an untreated subject.

[0178] In some embodiments, administration of provided compositions results in a decrease in a subject's serum creatine kinase level compared to a baseline level prior to treatment. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of provided compositions results in a decrease in serum creatine kinase level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline serum creatine kinase level immediately prior to treatment. In some embodiments, administration of provided compositions results in a decrease in serum creatine kinase level to less than about 2000 IU / L, 1500 IU / L, 1000 IU / L, 750 IU / L, 500 IU / L, 250 IU / L, 100 IU / L, 90 IU / L, 80 IU / L, 70 IU / L, or 60 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum creatine kinase levels relative to serum creatine kinase levels in an untreated subject.

[0179] In some embodiments, administration of a provided composition results in a decrease in the subject's urinary Glc4 level compared to the baseline level before treatment. Typically, the baseline level is measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in the urinary Glc4 level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in the urinary Glc4 level by at least about 100 mmol Glc4 / mol creatinine, 90 mmol Glc4 / mol creatinine, 80 mmol Glc4 / mol creatinine, or 95%. Glc4 / mol creatinine, 70 mmol Glc4 / mol creatinine, 60 mmol Glc4 / mol creatinine, 50 mmol Glc4 / mol creatinine, 40 mmol Glc4 / mol creatinine, 30 mmol Glc4 / mol creatinine, or 20 mmol Glc4 / mol creatinine. In some embodiments, administration of a provided composition results in a decrease in urinary Glc4 levels compared to the urinary Glc4 levels of an untreated subject.

[0180] In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels in a subject compared to baseline levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in muscle glycogen levels compared to muscle glycogen levels in an untreated subject. In certain embodiments, the muscle is skeletal muscle, smooth muscle, or cardiac muscle.

[0181] In some embodiments, administration of a provided composition results in a decrease in liver glycogen levels in the subject compared to baseline levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in liver glycogen levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels ... compared to baseline levels in the liver of an untreated subject. It decreases relative to glycogen levels.

[0182] In some embodiments, administration of a provided composition results in a decrease in the subject's serum aspartate transaminase (AST) level compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum AST level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum AST level to less than about 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, 100 IU / L, 50 IU / L, 25 IU / L, 20 IU / L, or 10 IU / L. In some embodiments, administration of a provided composition results in a decrease in serum AST level compared to the serum AST level in an untreated subject.

[0183] In some embodiments, administration of a provided composition results in a decrease in a subject's serum alanine transaminase (ALT) levels compared to pre-treatment baseline levels. Typically, baseline levels are measured immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in serum ALT levels by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in a decrease in serum ALT levels to less than about 1000 IU / L, 900 IU / L, 800 IU / L, 700 IU / L, 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, 100 IU / L, 50 IU / L, 25 IU / L, 20 IU / L, or 10 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum ALT levels relative to serum ALT levels in an untreated subject.

[0184] In some embodiments, administration of a provided composition results in a decrease in a subject's serum lactate dehydrogenase (LDH) level compared to the baseline level before treatment. Typically, the baseline level is measured immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum lactate dehydrogenase LDH level by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the baseline level immediately before treatment. In some embodiments, administration of a provided composition results in a decrease in serum LDH level to less than about 2000 IU / L, 1500 IU / L, 1000 IU / L, 900 IU / L, 800 IU / L, 700 IU / L, 600 IU / L, 500 IU / L, 400 IU / L, 300 IU / L, 200 IU / L, or 100 IU / L. In some embodiments, administration of provided compositions results in a decrease in serum LDH levels compared to serum LDH levels in an untreated subject.

[0185] In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity in a biological sample from the subject compared to baseline levels prior to treatment. Typically, baseline levels are measured immediately prior to treatment. Examples of biological samples include whole blood, serum, plasma, urine, and tissue samples (e.g., muscle, liver, skin fibroblasts). In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to baseline levels immediately prior to treatment. In some embodiments, administration of a provided composition results in an increase in GAA enzyme activity compared to GAA enzyme activity in an untreated subject.

[0186] According to various embodiments, the timing of expression of the delivered mRNA can be tailored to suit a particular medical need. In some embodiments, expression of the protein encoded by the provided mRNA is detectable 1, 2, 3, 6, 12, 24, 48, 72, and / or 96 hours after administration of the provided liposomes and / or compositions. In some embodiments, expression of the protein encoded by the delivered mRNA is detectable one week, two weeks, and / or one month after administration. [Example]

[0187] While certain compounds, compositions and methods of the present invention have been specifically described according to certain embodiments, the following examples serve only to illustrate the compounds of the present invention and are not intended to limit them.

[0188] Example 1. Exemplary liposome formulations for delivery and expression of GAA mRNA This example presents an exemplary liposome formulation for effective delivery and expression of GAA mRNA in vivo. lipid material The formulations described herein are designed to encapsulate mRNA encoding the GAA protein and contain a multi-component lipid mixture using one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol-based lipids), and PEGylated lipids in various ratios. Cationic lipids include DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. "Cationic lipid saturation influences intracellular delivery." of encapsulated nucleic acids”J.Contr.Rel.2005,107,276-287), DLin-KC2-DMA(Semple,SCet al.“Rational Design of Cationic Lipids for siRNA Delivery”Nature Biotech.2010,28,172-176), C12-200(Love,KTet al.“Lipid-like materials for low-dose in vivo gene silencing”PNAS 2010,107,1864-1869), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione), HGT5000, HGT5001, HGT4003, ICE, dialkylamino-based, imidazole-based, guanidinium-based, etc. (However, these are not limited to these.) Helper lipids include DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), and DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine). Examples of PEGylated lipids include, but are not limited to, DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)), and cholesterol. PEGylated lipids with chain lengths of C6 to C7 20 Examples of suitable lipids include, but are not limited to, poly(ethylene) glycol chains of up to 5 kDa in length covalently attached to lipids having alkyl chain(s) of

[0189] Codon-optimized human acid alpha-glucosidase (GAA) messenger RNA was synthesized by in vitro transcription from a plasmid DNA template encoding the gene, followed by the addition of a 5' cap structure (Cap1) (Fechter, P.; Brownlee, G.G. "Recognition of mRNA cap structures by viral and cellular proteins” J. Gen. Virology 2005, 86, 1239-1249), and the chain length measured by gel electrophoresis was approximately 250 nm. A 3' poly(A) tail of nucleotides (SEQ ID NO: 7) was added. The 5' and 3' untranslated regions present in each mRNA product are designated as X and Y, respectively, and are defined as described (see below). Exemplary codon-optimized human acid alpha-glucosidase (GAA) mRNA Structure Design: X - SEQ ID NO:3 - Y 5' and 3' UTR sequences X(5'UTR sequence) = GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG [SEQ ID NO: 8] Y(3'UTR sequence)= CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 9] or GGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAAGCU [SEQ ID NO: 10]

[0190] An exemplary codon-optimized human GAA mRNA sequence has SEQ ID NO:3, provided in the Detailed Description section.

[0191] An exemplary full-length codon-optimized human acid alpha glucosidase (GAA) messenger RNA sequence is shown below: GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGACCACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGGUGCCAAGAGUGACUCACCGUCCUUGACACGAUGGGAGUCAGACACCCGCCGUGCUCGCACAGGCUUCUGGCCGUGUGCGCACUCGUGAGUCUGGCACUGCUGCGUUGCUGGGGCAAUCUUCCCAC GACUUUCUCUGUGCCCCGAGAAUUGUGGGCUCGUCGCCGGUACUGGAAAACCCACCCCGCACAUCAGCAGGGCGCGUCGCGGGCCUGGUCCGAGGGAUGCCCAGGCACUCCCGGAAGGCCACGAGCCGUCCCGACUCAAUGUGACGUACCUCCCAAUUCCCGGUUCGACUGUGCGCCAGACAAGGCAAUCACGCAAGAGCAGUGCGAAGCCCGUGGAUGCUGCUAUAUUCGGCG AAGCAGGGACUUCAGGGAGCCCAGAUGGGCAGCCCUGGUGUUUCUUCCCGCCUUCCUAUCCCUCUAUAUAGCUGGAGAAUUUGUCGUCUUCCUGGAAAUGGGGGUAUACCGCUACUCUUACGGAACCACCCCCACAUUCUUUCGAAGCAUCCUUACUCUGCGGCUCGACGUGAUGAUGGGAGACAGAAAAUAGGCUGCUCCACCUUGCAUUUCACGAUCAAAGACCCGGCGAACCCGGAGAAUAUAGAGGUUCCGCUUGCACCCUUGCUUCCACCCUUGUGCUUCCGCUUCACCUUGUACUUCGGUGAGUUCCGGUGAUCGUCACGCAACUUGUAGGUAUGGUAUUGCUCUGAACACAACGGUCGCCCCCUUGUUUUCGCGCGACUUUCGACACUAUUCAGACUGCUGCCUUGUUUCGCCGCAGCAGUUUCUGCACUUUCGACACUAUUCAGACUGCUGCCUUCCAGUAUAUUCACCGCGGAGCAUCUUUCACCCCUAUUCACCGCUAUUCAGACUGCUGAGCAUCUUCGCAGUU GCUGCUUAUGGGGGAACAGUUUCUCGUGAGCUGGUGCUAGCGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU [SEQ ID NO: 11]

[0192] In another example, the full-length codon-optimized human acid alpha glucosidase (GAA) messenger RNA sequence is shown below:

[0193] Exemplary Formulation Protocol A. cKK‐E12 Aliquots of 50 mg / mL ethanol solutions of cKK-E12, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8°C. The final concentration was 0.64 mg / mL GAA mRNA (encapsulated). Z ave = 80 nm; PDI = 0.17. Encapsulation rate = 85%; yield = 89%.

[0194] B. C12‐200 50 mg / mL of C12-200, DOPE, cholesterol, and DMG-PEG2K Mix the ethanol solution aliquots and dilute with ethanol to a final volume of 3 mL. Separately, prepare a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Rapidly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting nanoparticle suspension, diafilter it with 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0195] C. HGT4003 Aliquots of 50 mg / mL ethanol solutions of HGT4003, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0196] D.ICE Aliquots of 50 mg / mL ethanol solutions of ICE, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0197] E. HGT5001 Aliquots of 50 mg / mL ethanol solutions of HGT5001, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0198] F. HGT5000 Aliquots of 50 mg / mL ethanol solutions of HGT5000, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0199] G. DLinKC2DMA 50 mg of DLinKC2DMA, DOPE, cholesterol, and DMG-PEG2K Mix aliquots of the 1 mg / mL ethanol solution and dilute with ethanol to a final volume of 3 mL. Separately, prepare a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) from a 1 mg / mL stock. Rapidly inject the lipid solution into the aqueous mRNA solution and shake to obtain a final suspension in 20% ethanol. Filter the resulting nanoparticle suspension, diafilter it with 1x PBS (pH 7.4), concentrate it, and store it at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0200] H. DODAP Aliquots of 50 mg / mL ethanol solutions of DODAP, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50) and Dv (90) Measure.

[0201] I. DODMA Aliquots of 50 mg / mL ethanol solutions of DODMA, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of GAA mRNA (10 mM citric acid / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1x PBS (pH 7.4), concentrated, and stored at 2-8 °C. The final concentration of GAA-encapsulated mRNA, Z ave , Dv (50)and Dv (90) Measure.

[0202] Example 2. Intravenous administration of liposomal nanoparticles loaded with GAA mRNA This example describes an exemplary method for administering GAA mRNA-loaded liposomal nanoparticles and analyzing GAA mRNA and glycogen in various target tissues in vivo.

[0203] All studies were performed using GAA knockout mice. Mice were treated with cKK-E12-based lipid nanoparticles loaded with human GAA mRNA via a single bolus tail vein injection at a dose of 1.0 mg / kg. Mice were sacrificed and perfused with saline at 30 minutes, 3 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days.

[0204] Tissues such as liver and muscle from each mouse were harvested, divided into separate portions, and preserved in 10% neutral buffered formalin or snap-frozen and stored at -80°C for analysis.

[0205] Direct detection of the active pharmaceutical ingredient (GAA mRNA) in the muscles of treated mice was achieved using an in situ hybridization (ISH)-based method. As shown in Figures 1A and 1B, exogenous human GAA messenger RNA was detected at 6 and 12 hours.

[0206] After administration of GAA mRNA lipid nanoparticles, liver glycogen levels (Fig. 2A) were reduced compared to liver glycogen levels in untreated GAA knockout mice (Fig. 2B).

[0207] Example 3. Intramuscular administration of GAA mRNA-loaded liposomal nanoparticles This example illustrates an exemplary method for administering GAA mRNA-loaded liposomal nanoparticles and for analyzing GAA mRNA and glycogen in various target tissues in vivo.

[0208] All studies were performed using GAA knockout mice. Mice were treated with cKK-E12-based lipid nanoparticles loaded with human GAA mRNA via a single intramuscular injection at a dose of 1.0 mg / kg. Mice were sacrificed and perfused with saline at 24 hours.

[0209] Tissues such as liver and muscle from each mouse were harvested, divided into separate portions, and preserved in 10% neutral buffered formalin or snap-frozen and stored at -80°C for analysis.

[0210] Direct detection of the active pharmaceutical ingredient (GAA mRNA) in the muscles of treated mice was achieved using an in situ hybridization (ISH)-based method. As shown in Figure 3, high levels of exogenous human GAA messenger RNA were detected at 24 hours.

[0211] After administration of GAA mRNA lipid nanoparticles, quadriceps muscle glycogen levels (FIGS. 4A and 4B) were reduced compared to those of untreated GAA knockout mice (FIGS. 4C and 4D).

[0212] equivalent Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited to the above description, but rather is set forth in the appended claims.

Claims

[Claim 1] The invention as set forth in the drawings.

Images