Mutant insect olfactory receptor protein

Abstract

To provide a technique for improving response activity of an olfactory receptor to a chemical substance.SOLUTION: To introduce a mutation into a specific site in an insect olfactory receptor protein so as to satisfy specific conditions.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present disclosure relates to mutant insect olfactory receptor proteins and the like. [Background technology]

[0002] Groups of odorants that characterize specific human diseases and mental states have been identified, and because of their high utility as diagnostic markers, the development of various odor sensors targeting these has become active. Because biological olfactory receptors have superior properties in terms of diversity, sensitivity, selectivity, etc. that are not found in conventional odor sensor elements such as semiconductors, there are high expectations for the development of new odor sensors that use olfactory receptors as sensor elements.

[0003] Since odor markers are generally present at low concentrations, it is desirable to create highly active olfactory receptors. Currently, it has been reported that amino acid sites in olfactory receptors change the selectivity of permeable ions when substituted. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] Japanese Patent Application Laid-Open No. 2013-27376 [Patent Document 2] Japanese Patent Application Publication No. 2018-59786 [Patent Document 3] Japanese Patent Application Laid-Open No. 2012-78351 [Non-patent literature]

[0005] [Non-Patent Document 1] PLoS ONE, March 2012, Volume 7, Issue 3, e32372. Summary of the Invention [Problem to be solved by the invention]

[0006] An objective of the present disclosure is to provide a technique for improving the response activity of olfactory receptors to chemical substances. [Means for solving the problem]

[0007] The present inventors have conducted extensive research in light of the above-mentioned problems and have found that introducing a mutation into a specific site in an insect olfactory receptor protein so as to satisfy specific conditions can improve the response activity to chemical substances. Based on this finding, the present inventors have conducted further research and have completed the presently disclosed invention. Specifically, the present disclosure encompasses the following aspects.

[0008] Item 1. A mutant insect olfactory receptor protein, The corresponding wild-type insect olfactory receptor protein has the general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 [In the formula, X1 to X6 and Z1 to Z3 represent amino acids derived from the amino acid sequence of a wild-type insect olfactory receptor, φ1 represents a hydrophobic amino acid, φ2 to φ7 each independently represent an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid.] and an amino acid sequence B obtained by mutating an amino acid sequence A represented by the formula: Conditions 1 to 3 below: (Condition 1) In the amino acid sequence B, X3 and / or X4 are substituted, and X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (Condition 2) When X5 and X6 in the amino acid sequence A are both positively charged polar amino acids, X6 in the amino acid sequence B is an amino acid other than a positively charged polar amino acid; and (Condition 3) When one or both of X1 and X2 in the amino acid sequence A are positively charged polar amino acids, in the amino acid sequence B, X1 and / or X2 are substituted, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. Satisfying at least one condition selected from the group consisting of: Mutant insect olfactory receptor proteins.

[0009] Item 2. A mutant insect olfactory receptor protein according to Item 1, which satisfies Condition 1 above, wherein X3 is isoleucine or leucine and / or X4 is serine or asparagine.

[0010] Item 3. A mutant insect olfactory receptor protein according to Item 1 or 2, which satisfies Requirement 2 above and in which X6 is an uncharged polar amino acid.

[0011] Item 4. The mutant insect olfactory receptor protein according to any one of Items 1 to 3, which satisfies Requirement 2 above and in which X6 is serine or threonine.

[0012] Item 5. A mutant insect olfactory receptor protein according to any one of Items 1 to 4, which satisfies Requirement 3 above, wherein X1 is serine or glutamine and / or X2 is alanine.

[0013] Item 6. In Condition 1, X3 is isoleucine or leucine and / or X4 is serine or asparagine; In condition 2, X6 is serine or threonine, Item 6. The mutant insect olfactory receptor protein according to any one of Items 1 to 5, wherein, under Condition 3, X1 is serine or glutamine and / or X2 is alanine.

[0014] Section 7. Conditions 1A to 3A below: (Condition 1A) In the amino acid sequence B, X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. (Condition 2A) In the amino acid sequence B, X6 is an amino acid other than a positively charged polar amino acid; and (Condition 3A) In the amino acid sequence B, X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. Satisfying at least one condition selected from the group consisting of: Item 7. A mutant insect olfactory receptor protein according to any one of Items 1 to 6.

[0015] Item 8. The mutant insect olfactory receptor protein according to any one of Items 1 to 7, wherein the amino acid sequence A is a sequence contained on the C-terminal side of the amino acid sequence of the wild-type insect olfactory receptor protein.

[0016] Item 9. The mutant insect olfactory receptor protein according to any one of Items 1 to 8, wherein the wild-type insect olfactory receptor protein is a wild-type olfactory receptor protein of an Entopteran insect.

[0017] Item 10. A polynucleotide comprising a coding sequence for the mutant insect olfactory receptor protein according to any one of Items 1 to 9.

[0018] Item 11. A cell comprising the polynucleotide according to Item 10.

[0019] Item 12. A non-human animal comprising the cell according to Item 11.

[0020] Item 13. A chemical substance detection element comprising the mutant insect olfactory receptor protein according to any one of Items 1 to 9.

[0021] Item 13A. Use of the mutant insect olfactory receptor protein according to any one of Items 1 to 9 as a chemical substance detection element.

[0022] Item 13B. Use of the mutant insect olfactory receptor protein according to any one of Items 1 to 9 for producing a chemical substance detection element.

[0023] Item 14. A chemical substance detection sensor comprising a lipid bilayer membrane containing the chemical substance detection element according to Item 13, a cell, or a non-human animal containing the cell.

[0024] Item 14A. Use of a lipid bilayer membrane, a cell, or a non-human animal containing the mutant insect olfactory receptor protein according to any one of Items 1 to 9 as a chemical substance detection sensor.

[0025] Item 14B. Use of a lipid bilayer membrane, a cell, or a non-human animal containing the mutant insect olfactory receptor protein according to any one of Items 1 to 9 for the production of a chemical substance detection sensor.

[0026] Item 15. A chemical substance detection method, comprising contacting a chemical substance with the mutant insect olfactory receptor protein according to any one of Items 1 to 9, the chemical substance detection element according to Item 13, or the chemical substance detection sensor according to Item 14. [Effects of the Invention]

[0027] According to the present disclosure, a technique for improving the response activity of olfactory receptors to chemical substances can be provided. [Brief explanation of the drawings]

[0028] [Figure 1] This figure shows the results of measuring the response activity of Drosophila olfactory receptor 47a and its mutants to a chemical substance (pentyl acetate) (Test Example 1). The horizontal axis shows the amount of fluorescence (= activity intensity), and the vertical axis shows the olfactory receptors and their amino acid sequences. The olfactory receptors are listed in the following order from top to bottom: wild-type (Comparative Example 1-1), mutant (RX4S, Example 1-1), mutant (VX3L-RX4S, Example 1-2), and mutant (VX3L-RX4S+alpha, Example 1-3). In the amino acid sequences, "·" indicates that the amino acid is the same as in the wild-type (no mutation introduced). The concentration of the test substance in the culture medium is shown above the graph. [Figure 2] This figure shows the results of measuring the response activity of silkworm olfactory receptor 56 and its mutants to a chemical substance (cis-jasmone) (Test Example 2). The horizontal axis shows the amount of fluorescence (= activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are arranged in the following order from top to bottom: wild-type (Comparative Example 2-1), mutant (IX1Q, Example 2-1), mutant (RX2A, Example 2-2), mutant (KX4S, Example 2-3), mutant (KX4N, Example 2-4), and mutant (IX1Q-RX2A-KX4S, Example 2-5). In the amino acid sequences, "·" indicates the same amino acid as the wild-type (no mutation introduced). The concentration of the test substance in the culture medium is shown above the graph. [Figure 3] This figure shows the results of measuring the response activity of Anopheles olfactory receptor 1 and its mutants to a chemical substance (phenol) (Test Example 3). The horizontal axis shows the amount of fluorescence (= activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are listed in the following order from top to bottom: wild-type (Comparative Example 3-1), mutant (MX3L-KX4S, Example 3-1), mutant (MX3L-KX4N, Example 3-2), and mutant (MX3L-KX4S+alpha, Example 3-3). In the amino acid sequences, "·" indicates that the amino acid is the same as in the wild-type (no mutation introduced). The concentration of the test substance in the culture medium is shown above the graph. [Figure 4] This figure shows the results of measuring the response activity of Aedes mosquito olfactory receptor 9 and its mutants to a chemical substance (skatole) (Test Example 4). The horizontal axis shows the amount of fluorescence (= activity intensity), and the vertical axis shows the olfactory receptor and its amino acid sequence. The olfactory receptors are listed in the following order from top to bottom: wild type (Comparative Example 4-1), mutant type (RX6T, Example 4-1), and mutant type (RX6T+alpha, Example 4-2). In the amino acid sequence, "·" indicates that the amino acid is the same as the wild type (no mutation introduced). The concentration of the test substance in the culture medium is shown above the graph. DETAILED DESCRIPTION OF THE INVENTION

[0029] 1. Definition etc. In this specification, the expressions "contain" and "comprise" include the concepts of "contain", "include", "consist essentially of" and "consist only of".

[0030] As used herein, the "identity" of an amino acid sequence refers to the degree of correspondence between two or more comparable amino acid sequences. Therefore, the greater the identity between two amino acid sequences, the greater the identity or similarity between those sequences. The level of identity between amino acid sequences can be determined, for example, using the sequence analysis tool FASTA with default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (Karlin S, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes," Proc. Natl. Acad. Sci. USA. 87:2264-2268 (1990); Karlin S, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences," Proc. Natl. Acad. Sci. USA. 90:5873-7 (1993)). A program called BLASTX, based on the BLAST algorithm, has been developed. Specific techniques for these analysis methods are known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). The "identity" of nucleotide sequences is also defined in the same manner as above.

[0031] In this specification, "conservative substitution" means that an amino acid residue is substituted with an amino acid residue having a similar side chain.For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine is considered to be conservative substitution.Other than this, substitution between amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues having β-branched side chains such as threonine, valine, and isoleucine; and amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine are also considered to be conservative substitutions.

[0032] As used herein, nucleotides such as DNA and RNA may be chemically modified as described below. To prevent degradation by hydrolases such as nucleases, the phosphate residue of each nucleotide may be substituted with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithioate. The hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide may be substituted with -OR (where R represents, for example, CH3(2'-O-Me), CH2CHOCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, or CH2CH2CN). Furthermore, the base moiety (pyrimidine or purine) may be chemically modified, for example by introducing a methyl group or a cationic functional group into the 5-position of the pyrimidine base, or by substituting a thiocarbonyl group for the carbonyl group at the 2-position. Further examples include, but are not limited to, those in which the phosphate moiety or hydroxyl moiety is modified with, for example, biotin, an amino group, a lower alkylamine group, an acetyl group, etc. Also preferably used are BNA (LNA), in which the conformation of the sugar moiety is fixed to N-type by bridging the 2' oxygen and 4' carbon of the sugar moiety of the nucleotide.

[0033] Olfactory receptor proteins are membrane proteins with seven transmembrane structures, and are composed of the following linked sequences from their amino terminus (hereinafter sometimes referred to as the "N terminus") to their carboxyl terminus (hereinafter sometimes referred to as the "C terminus"): the N-terminal region (NT), the first transmembrane domain (TM1), the first extracellular loop (EC1), the second transmembrane domain (TM2), the first intracellular loop (IC1), the third transmembrane domain (TM3), the second extracellular loop (EC2), the fourth transmembrane domain (TM4), the second intracellular loop (IC2), the fifth transmembrane domain (TM5), the third extracellular loop (EC3), the sixth transmembrane domain (TM6), the third intracellular loop (IC3), the seventh transmembrane domain (TM7), and the C-terminal region (CT). In the present disclosure, each region is determined by structure prediction (default conditions) using TMpred (K. Hofmann, W. Stoffel, TMbase - a database of membrane spanning protein segments, Biol. Chem. Hoppe-Seyler, 374 (1993), p. 166, https: / / embnet.vital-it.ch / software / TMPRED_form.html).

[0034] As used herein, amino acid mutation specifically refers to amino acid deletion, substitution, insertion, or addition. The olfactory receptor protein may be an olfactory receptor peptide in which amino acids that have little effect on chemical response activity are deleted, for example, an olfactory receptor peptide in which some amino acids outside the transmembrane domain are deleted.

[0035] In this specification, OR indicates odorant receptor, Orco indicates odorant receptor co-receptor, Dm indicates Drosophila melanogaster, Bm indicates Bombyx mori, Ag indicates Anopheles gambiae, and Aa indicates Aedes aegypti.

[0036] As used herein, chemical response activity refers to the property of an olfactory receptor recognizing a chemical substance, activating an olfactory receptor complex formed by the olfactory receptor and an olfactory receptor co-receptor, and exhibiting ion channel activity. The chemical response activity of an olfactory receptor can be measured using the ion channel activity of the olfactory receptor complex formed by the olfactory receptor and olfactory receptor co-receptor in contact with the chemical substance as an indicator. For example, a chemical substance is contacted with cells expressing proteins that develop color or emit light in response to ions (e.g., calcium ions) that flow into the cells when the olfactory receptor responds to (a) an olfactory receptor, (b) an olfactory receptor co-receptor, and (c) an olfactory receptor, and the amount of luminescence from the cells is measured. The greater the measured amount of luminescence, the higher the chemical response activity of the olfactory receptor. Specific examples of measuring chemical response activity are described in Test Examples 1-2 and 1-3 below.

[0037] Chemical substances (e.g., odorants) to which each olfactory receptor responds are known or can be determined by known screening methods. For example, chemical substances to which DmOR47a responds include pentyl acetate, chemical substances to which BmOR56 responds include cis-jasmone, chemical substances to which AgOR1 responds include phenol, chemical substances to which AaOR9 responds include skatole, and chemical substances to which AgOR2 responds include indole.

[0038] 2. Olfactory receptor proteins In one aspect, the present disclosure relates to a mutant insect olfactory receptor protein (sometimes referred to herein as the "olfactory receptor protein of the present disclosure") that comprises an amino acid sequence B obtained by mutating amino acid sequence A represented by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 in a corresponding wild-type insect olfactory receptor protein, and that satisfies at least one condition selected from the group consisting of conditions 1 to 3. This is described below.

[0039] The olfactory receptor proteins of the present disclosure are mutant insect olfactory receptor proteins obtained by mutating amino acids in a wild-type insect olfactory receptor protein.

[0040] The wild-type insect olfactory receptor protein is not particularly limited, as long as it is derived from an insect, i.e., an olfactory receptor that is endogenously expressed (inherently possessed) by an insect, and contains the amino acid sequence A represented by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6.

[0041] In general formula (1), X1 to X6 and Z1 to Z3 represent amino acids derived from the amino acid sequence of a wild-type insect olfactory receptor. For example, in the wild-type insect olfactory receptor, the sequence corresponding to the amino acid sequence A is F. SSIVRTA MSYITML RS (a part of the amino acid sequence shown in SEQ ID NO: 1), the underlined amino acids are, from left to right, X1, X2, Z1, X3, X4, Z2, Z3, X5, and X6.

[0042] In general formula (1), φ1 represents a hydrophobic amino acid. Examples of hydrophobic amino acids include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan. Among these, preferred are leucine, methionine, isoleucine, valine, alanine, and phenylalanine, more preferred are leucine, methionine, isoleucine, and valine, even more preferred are leucine and methionine, and even more preferred is leucine.

[0043] In general formula (1), φ2 to φ7 each independently represent an uncharged polar amino acid or a hydrophobic amino acid. Examples of uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Examples of hydrophobic amino acids include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, and tryptophan.

[0044] As φ2, preferably, hydrophobic amino acids are used, more preferably, leucine, phenylalanine, isoleucine, valine, methionine, etc. are used, and even more preferably, leucine is used.

[0045] Preferred examples of φ3 include threonine, alanine, methionine, leucine, etc., and more preferred examples include threonine.

[0046] Preferred examples of φ4 include phenylalanine, leucine, tyrosine, isoleucine, and valine, and more preferred examples include phenylalanine, leucine, and tyrosine.

[0047] Preferred examples of φ5 include tyrosine, phenylalanine, isoleucine, cysteine, and methionine, and more preferred examples include tyrosine.

[0048] Preferred examples of φ6 include tyrosine, phenylalanine, glycine, tryptophan, valine, leucine, isoleucine, alanine, serine, and methionine, more preferably tyrosine, phenylalanine, glycine, and tryptophan, and even more preferably tyrosine and phenylalanine.

[0049] Preferred examples of φ7 include phenylalanine, tyrosine, leucine, methionine, asparagine, serine, valine, cysteine, alanine, glycine, and threonine, more preferably phenylalanine, tyrosine, and leucine, and even more preferably phenylalanine and tyrosine.

[0050] In general formula (1), U represents an uncharged polar amino acid. Examples of uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Among these, preferred are serine, threonine, glutamine, asparagine, and glycine, more preferred are serine, threonine, and glutamine, and even more preferred are serine and threonine.

[0051] The position of amino acid sequence A in a wild-type insect olfactory receptor protein is not particularly limited. Due to its sequence characteristics, amino acid sequence A is usually a sequence contained on the C-terminal side of the amino acid sequence of a wild-type insect olfactory receptor protein. The C-terminal side refers to, for example, from the C-terminus of the amino acid sequence of a wild-type insect olfactory receptor protein to, for example, the 70th, preferably the 60th, more preferably the 50th, even more preferably the 40th, and even more preferably the 35th amino acid counting from the C-terminal amino acid.

[0052] Insects from which wild-type insect olfactory receptor proteins are derived are preferably Enoptera insects, more preferably Diptera insects such as Culicidae and Drosophilidae; Lepidoptera insects such as Bombycidae; Hymenoptera insects such as Apidae; even more preferably Diptera insects such as Culicidae and Drosophilidae; and even more preferably Culicidae insects. Examples of Culicidae insects include Anopheles gambiae, Aedes aegypti, and Culex quinquefasciatus. Examples of Drosophilidae insects include Drosophila melanogaster, Drosophila pseudoobscura, and Drosophila virillis. Examples of insects of the Bombycidae family include the silkworm moth (Bombyx mori), the mulberry silkworm (Bombyx mandarina), the fig cassowary (Trilocha varians), etc. Examples of insects of the Apidae family include the European honeybee (Apis mellifera), the oriental honeybee (Apis florea), the giant honeybee (Apis dorsata), the European bumblebee (Bombus terrestris), etc.

[0053] Specific examples of wild-type insect olfactory receptor proteins include DmOR47a (amino acid sequence: SEQ ID NO: 1), BmOR56 (amino acid sequence: SEQ ID NO: 2), AgOR1 (amino acid sequence: SEQ ID NO: 3), AaOR9 (amino acid sequence: SEQ ID NO: 4), AgOR28 (amino acid sequence: SEQ ID NO: 65), AgOR47 (amino acid sequence: SEQ ID NO: 66), AgOR11 (amino acid sequence: SEQ ID NO: 67), AgOR27 (amino acid sequence: SEQ ID NO: 68), AaOR5 (amino acid sequence: SEQ ID NO: 69), AaOR31 (amino acid sequence: SEQ ID NO: 70), AaOR72 (amino acid sequence: SEQ ID NO: 71), AaOR110 (amino acid sequence: SEQ ID NO: 72), AgOR2 (amino acid sequence: SEQ ID NO: 73), AgOR10 (amino acid sequence: SEQ ID NO: 74), and AaOR15 (amino acid sequence: SEQ ID NO: 75).

[0054] The olfactory receptor protein of the present disclosure comprises amino acid sequence B, which is obtained by mutating amino acid sequence A. The mutation is preferably a substitution.

[0055] The olfactory receptor protein of the present disclosure satisfies at least one condition selected from the group consisting of conditions 1 to 3 for amino acid sequence B.

[0056] Condition 1 is that in amino acid sequence B, X3 and / or X4 are substituted, and X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid.

[0057] In condition 1, "X3 and / or X4 are substituted" means that X3 and / or X4 in amino acid sequence B are substituted for X3 and / or X4 in amino acid sequence A (i.e., are different amino acids).

[0058] In condition 1, examples of the branched-chain amino acid represented by X3 in the amino acid sequence B include valine, leucine, isoleucine, etc. Among these, isoleucine, leucine, etc. are preferred.

[0059] In condition 1, examples of the uncharged polar amino acid represented by X4 in the amino acid sequence B include glycine, threonine, serine, asparagine, glutamine, tyrosine, cysteine, etc. Among these, preferred are serine, asparagine, etc.

[0060] In condition 1, it is preferable that in the amino acid sequence B, X3 is a branched-chain amino acid and X4 is an uncharged polar amino acid.

[0061] Condition 2 is that when X5 and X6 are both positively charged polar amino acids in amino acid sequence A, X6 is an amino acid other than a positively charged polar amino acid in amino acid sequence B. In other words, condition 2 is limited to the case where X5 and X6 are both positively charged polar amino acids in amino acid sequence A.

[0062] In condition 2, examples of the positively charged polar amino acid represented by X5 or X6 in the amino acid sequence A include lysine, arginine, histidine, etc., and preferred examples include lysine, arginine, etc.

[0063] In condition 2, the amino acid represented by X6 in amino acid sequence B is not particularly limited as long as it is an amino acid other than a positively charged polar amino acid. Such amino acids are preferably uncharged polar amino acids. Examples of such uncharged polar amino acids include glycine, threonine, serine, asparagine, glutamine, tyrosine, and cysteine. Among these, serine and threonine are particularly preferred.

[0064] Condition 3 is that when one or both of X1 and X2 in amino acid sequence A are positively charged polar amino acids, X1 and / or X2 are substituted in amino acid sequence B, and X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid. That is, condition 3 is limited to the case where one or both of X1 and X2 in amino acid sequence A are positively charged polar amino acids.

[0065] In condition 3, it is preferable that at least X2 of X1 and X2 in the amino acid sequence A is a positively charged polar amino acid, and it is more preferable that only X2 is a positively charged polar amino acid.

[0066] In condition 3, examples of the positively charged polar amino acid represented by X1 or X2 in the amino acid sequence A include lysine, arginine, histidine, etc., preferably lysine, arginine, etc., more preferably arginine.

[0067] In condition 3, "X1 and / or X2 are substituted" means that X1 and / or X2 in amino acid sequence B are substituted for X1 and / or X2 in amino acid sequence A (i.e., they are different amino acids).

[0068] In condition 3, examples of the uncharged polar amino acid represented by X1 in the amino acid sequence B include glycine, threonine, serine, asparagine, glutamine, tyrosine, cysteine, etc. Among these, preferred are serine, glutamine, etc.

[0069] In condition 3, examples of the hydrophobic amino acid represented by X2 in the amino acid sequence B include alanine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tryptophan, etc. Among these, alanine, valine, leucine, isoleucine, etc. are preferred, and alanine is more preferred.

[0070] In condition 3, it is preferable that in the amino acid sequence B, X1 is an uncharged polar amino acid and X2 is a hydrophobic amino acid.

[0071] In one embodiment of the present disclosure, the olfactory receptor protein of the present disclosure preferably has amino acid sequence B that satisfies at least one condition selected from the group consisting of conditions 1A to 3A.

[0072] Condition 1A is that, in amino acid sequence B, X3 is a branched-chain amino acid and / or X4 is an uncharged polar amino acid. Condition 1A is the same as condition 1, except that it is irrelevant whether X3 and / or X4 are substituted in amino acid sequence B. In other words, condition 1A also encompasses the case where, in amino acid sequence B, X3 and / or X4 are not substituted from amino acid sequence A.

[0073] Condition 2A is that X6 in amino acid sequence B is an amino acid other than a positively charged polar amino acid. Condition 2A is the same as condition 2, except that it is irrelevant whether X5 and X6 are both positively charged polar amino acids in amino acid sequence A. In other words, condition 2A also encompasses the case where X5 and / or X6 in amino acid sequence B are not substituted.

[0074] Condition 3A is that X1 is an uncharged polar amino acid and / or X2 is a hydrophobic amino acid in amino acid sequence B. Condition 3A is the same as condition 3, except that it is irrelevant whether one or both of X1 and X2 are positively charged polar amino acids in amino acid sequence A. In other words, condition 3A also encompasses the case where X1 and / or X2 in amino acid sequence B are not substituted from amino acid sequence A.

[0075] The olfactory receptor protein of the present disclosure can contain amino acid mutations other than those described in conditions 1 to 3, so long as the chemical response activity is not significantly reduced. "Not significantly reduced" means, for example, that the chemical response activity of an olfactory receptor protein of the present disclosure that contains other amino acid mutations is higher than the chemical response activity of the corresponding wild-type insect olfactory receptor, and is, for example, 50% or more, preferably 60% or more, more preferably 70% or more, even more preferably 80% or more, and even more preferably 90% or more of the 100% chemical response activity of an olfactory receptor protein of the present disclosure that does not contain other amino acid mutations.

[0076] The amino acid sequence of the olfactory receptor protein of the present disclosure has, for example, 85% or more identity, more preferably 90% or more identity, even more preferably 95% or more identity, and even more preferably 97% or more identity to the amino acid sequence of a mutant insect olfactory receptor that contains only mutations under at least one condition selected from the group consisting of conditions 1 to 3.

[0077] When the olfactory receptor protein of the present disclosure contains other amino acid mutations, the amino acid sequence of the olfactory receptor protein of the present disclosure is preferably an amino acid sequence in which one or more amino acids have been mutated relative to the amino acid sequence of a mutant insect olfactory receptor that contains only mutations under at least one condition selected from the group consisting of conditions 1 to 3. "Multiple" means, for example, 2 to 50, preferably 2 to 30, more preferably 2 to 20, even more preferably 2 to 10, and even more preferably 2 to 5 amino acids.

[0078] Other amino acid mutations include, for example, substitution, deletion, addition, insertion, etc., preferably substitution, and more preferably conservative substitution. In addition, in the case of mutations at φ2 to φ7 in general formula (1), substitution of an uncharged polar amino acid with a hydrophobic amino acid is also preferred.

[0079] The chemical response activity of the olfactory receptor protein of the present disclosure is higher than that of the corresponding wild-type insect olfactory receptor, for example, 1.2 times or more, 1.5 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 15 times or more, or 20 times or more that of the corresponding wild-type insect olfactory receptor.

[0080] The olfactory receptor proteins of the present disclosure may be those to which other amino acid sequences, such as proteins or peptides, such as protein tags, fluorescent proteins, luminescent proteins, signal sequences, etc., are added, so long as their chemical response activity is not significantly impaired. Examples of protein tags include biotin, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags.

[0081] The olfactory receptor proteins of the present disclosure may be chemically modified as long as their chemical response activity is not significantly impaired.

[0082] The olfactory receptor protein of the present disclosure has a C-terminus that is a carboxyl group (-COOH), a carboxylate (-COO - ), amide (-CONH2) or ester (-COOR).

[0083] Here, R in the ester is, for example, C such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc. 1-6 Alkyl groups; for example, C groups such as cyclopentyl and cyclohexyl 3-8 Cycloalkyl groups such as phenyl and α-naphthyl 6-12 Aryl groups; for example, phenyl-C such as benzyl and phenethyl 1-2 Alkyl groups; α-naphthyl-C such as α-naphthylmethyl 1-2 C such as alkyl group 7-14 Aralkyl groups, pivaloyloxymethyl groups, etc. are used.

[0084] In the olfactory receptor protein of the present disclosure, a carboxyl group (or carboxylate) other than that at the C-terminus may be amidated or esterified. In this case, the ester may be, for example, the C-terminal ester described above.

[0085] Furthermore, in the olfactory receptor protein of the present disclosure, the amino group of the N-terminal amino acid residue is protected by a protecting group (e.g., a C group such as a formyl group or an acetyl group). 1-6C such as alkanoyl 1-6 those in which the N-terminal glutamine residue that can be generated by cleavage in vivo is pyroglutamated; those in which the substituents on the side chains of amino acids in the molecule (e.g., -OH, -SH, amino group, imidazole group, indole group, guanidino group, etc.) are protected by an appropriate protecting group (e.g., C group such as formyl group, acetyl group, etc.); 1-6 C such as alkanoyl group 1-6 Also included are those protected by an acyl group or other suitable glycan, or conjugated proteins such as glycoproteins to which sugar chains are attached.

[0086] The olfactory receptor protein of the present disclosure may be in the form of a salt with an acid or a base. The salt is not particularly limited, and either an acid salt or a basic salt can be used. Examples of acid salts include inorganic acid salts such as hydrochloride, hydrobromide, sulfate, nitrate, and phosphate; organic acid salts such as acetate, propionate, tartrate, fumarate, maleate, malate, citrate, methanesulfonate, and paratoluenesulfonate; and amino acid salts such as aspartate and glutamate. Examples of basic salts include alkali metal salts such as sodium salt and potassium salt; and alkaline earth metal salts such as calcium salt and magnesium salt.

[0087] The olfactory receptor protein of the present disclosure may be in the form of a solvate. The solvent is not particularly limited, and examples thereof include water, ethanol, glycerol, and acetic acid.

[0088] The olfactory receptor proteins of the present disclosure can be easily produced using known genetic engineering techniques, such as PCR, restriction enzyme digestion, DNA ligation, in vitro transcription / translation, and recombinant protein production techniques.

[0089] 3. Polynucleotides, cells, and non-human animals In one aspect, the present disclosure relates to a polynucleotide (sometimes referred to herein as a "polynucleotide of the present disclosure") comprising a coding sequence for an olfactory receptor protein of the present disclosure, a cell (sometimes referred to herein as a "cell of the present disclosure") comprising a polynucleotide of the present disclosure, and a non-human animal (sometimes referred to herein as a "non-human animal of the present disclosure") comprising a cell of the present disclosure. These are described below.

[0090] The coding sequence for the olfactory receptor protein of the present disclosure is not particularly limited, as long as it is a polynucleotide consisting of a base sequence that encodes the olfactory receptor protein of the present disclosure.

[0091] In one aspect, the polynucleotide of the present disclosure comprises an expression cassette for the olfactory receptor protein of the present disclosure.

[0092] The expression cassette for the olfactory receptor protein of the present disclosure is not particularly limited as long as it is a polynucleotide that is capable of expressing the olfactory receptor protein of the present disclosure in cells. Typical examples of expression cassettes for the olfactory receptor protein of the present disclosure include a promoter and a polynucleotide comprising a coding sequence for the olfactory receptor protein of the present disclosure placed under the control of the promoter.

[0093] The promoter contained in the expression cassette for the olfactory receptor protein of the present disclosure is not particularly limited and can be selected appropriately depending on the target cell. For example, various Pol II promoters can be used. Pol II promoters are not particularly limited, but examples include the CMV promoter, EF1 promoter, SV40 promoter, and MSCV promoter. Other examples of promoters include tryptophan promoters such as trc and tac, lac promoters, T7 promoters, T5 promoters, T3 promoters, SP6 promoters, arabinose-inducible promoters, cold shock promoters, and tetracycline-inducible promoters.

[0094] The expression cassette for the olfactory receptor protein of the present disclosure may include other elements as needed (e.g., a multiple cloning site (MCS), a drug resistance gene, an origin of replication, an enhancer sequence, a repressor sequence, an insulator sequence, a reporter protein (e.g., a fluorescent protein, etc.) coding sequence, a drug resistance gene coding sequence, etc.).

[0095] The polynucleotide of the present disclosure may be in the form of a vector. An appropriate vector is selected depending on the intended use (cloning, protein expression) and the type of host cell. Examples of vectors using E. coli as a host include M13 phage or modified versions thereof, λ phage or modified versions thereof, and pBR322 or modified versions thereof (pB325, pAT153, pUC8, etc.); examples of vectors using yeast as a host include pYepSec1, pMFa, pYES2, and pPIC3.5K; examples of vectors using insect cells as a host include pAc and pVL; and examples of vectors using mammalian cells as a host include pcDNA, pCDM8, and pMT2PC.

[0096] The cell of the present disclosure is not particularly limited as long as it contains the polynucleotide of the present disclosure. Examples of the cell include Escherichia coli such as Escherichia coli K12, Bacillus bacteria such as Bacillus subtilis MI114, yeast such as Saccharomyces cerevisiae AH22, the Sf cell line derived from Spodoptera frugiperda or the HighFive cell line derived from Trichoplusia ni, insect cells such as olfactory nerve cells, and animal cells such as COS7 cells. Preferred animal cells include cultured cells derived from mammals, specifically COS7 cells, CHO cells, HEK293 cells, HEK293FT cells, Hela cells, PC12 cells, N1E-115 cells, SH-SY5Y cells, etc.

[0097] The cells of the present disclosure preferably contain a coding sequence for an insect olfactory receptor co-receptor, from the viewpoint that they can be used directly for chemical substance detection applications described below. Insect olfactory receptor co-receptors are membrane proteins with a seven-transmembrane structure, just like olfactory receptors, but they do not recognize odorants themselves, but function by forming a heterocomplex with the olfactory receptor. The olfactory receptor complex, which is a heterocomplex composed of an olfactory receptor and an olfactory receptor co-receptor, has ion channel activity that is activated by odorants, and when activated, it transports sodium ions (Na + ), calcium ions (Ca 2+ ) into the cell.

[0098] From a similar perspective, the cells of the present disclosure preferably contain a coding sequence for a protein that develops color or emits light in response to ions (such as calcium ions) that flow into the cells when the olfactory receptor responds. Examples of such proteins include aequorin, Yellow Cameleon (YC), and GCaMP. Alternatively, the cells of the present disclosure preferably contain a calcium ion-dependent fluorescent dye (e.g., Fura-2, Fluo-3, Fluo-4, etc.).

[0099] From a similar perspective, the cells of the present disclosure contain the olfactory receptor protein of the present disclosure, i.e., the olfactory receptor protein of the present disclosure is expressed in the cells of the present disclosure. In this case, the olfactory receptor protein of the present disclosure has a seven-transmembrane structure and is therefore arranged on the cell membrane as a membrane protein.

[0100] The non-human animal of the present disclosure is not particularly limited as long as it contains the cells of the present disclosure. The non-human animal is not particularly limited, but insects are preferred from the viewpoint of their suitability for chemical detection applications described below. Regarding insects, the same applies as in "2. Olfactory receptor proteins" above. Furthermore, from the same viewpoint, the cells of the present disclosure in the non-human animal of the present disclosure preferably contain olfactory nerve cells.

[0101] 4.Applications The olfactory receptor protein of the present disclosure responds to chemicals by secreting cations (sodium ions (Na + ), calcium ions (Ca 2+ ) and the like). Chemical substances can be detected by detecting these cations or by detecting behavioral changes based on the activation of olfactory nerve cells caused by the influx of these cations. Therefore, the olfactory receptor protein of the present disclosure can be used as a chemical substance detection element.

[0102] In one aspect, the present disclosure relates to a chemical detection element (detection element of the present disclosure) consisting of an olfactory receptor protein of the present disclosure, and further to a chemical detection sensor (detection sensor of the present disclosure) comprising a cell, a lipid bilayer membrane (artificial cell membrane), or a non-human animal containing the cell, which contains the detection element of the present disclosure.

[0103] Chemical substance detection sensors that use cells, lipid bilayer membranes, or non-human animals are already known, and specific configurations thereof can be those described in, for example, Patent Document 1, Patent Document 2, Patent Document 3, etc. A chemical substance detection sensor that includes the cells or lipid bilayer membrane of the present disclosure includes, for example, a container that holds the cells or lipid bilayer membrane of the present disclosure, a sensor that outputs a signal when it detects a chemical substance response (e.g., light) in the cells of the present disclosure, and a determiner that detects the chemical substance based on the signal. A chemical substance detection sensor that includes the non-human animal of the present disclosure includes, for example, a detection unit (e.g., a motion sensor, a vibration sensor, a sound sensor, etc.) that detects the movement of the non-human animal of the present disclosure. [Example]

[0104] Hereinafter, one embodiment of the present invention will be described in detail based on examples, but the present invention is not limited to these examples.

[0105] The wild-type olfactory receptor genes used in the following examples are as follows:

[0106] [Table 1]

[0107] Test Example 1: Measurement of chemical response activity of DmOR47a The response activity of the olfactory receptors (wild-type DmOR47a and mutant DmOR47a) to chemicals was measured.

[0108] Test Example 1-1. Preparation of expression plasmid < Comparative Example 1-1 .Construction of wild-type DmOR47a expression plasmid cDNA was obtained by reverse transcription using adult Drosophila melanogaster RNA (Takara) as a template and SuperScript III reverse transcriptase (Invitrogen) at 55°C for 50 minutes and then at 75°C for 15 minutes. PCR was performed using 1 μL of the resulting cDNA as a template with 1 μL of 10 μL of forward primer DmOR47a-5' (5'-caccatggacagttttctgcaagtacagaa; SEQ ID NO: 9), 1 μL of 10 μM reverse primer DmOR47a-3' (5'-ttaggagaatgatctcagcattgtgatgta; SEQ ID NO: 10), and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was performed at (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, and (3) 68°C for 1.5 minutes. Steps (2) and (3) were repeated 35 times. The PCR product was subjected to agarose gel electrophoresis, and the approximately 1.2 kb DNA detected on the gel was recovered. The recovered DNA was inserted into the pENTR / D-TOPO vector (Invitrogen) to obtain a plasmid designated pENTR-DmOR47a. 4 μL of pENTR-DmOR47a, 1 μL of pcDNA6.2V5-DEST, and 2 μL of LR clonase II (Invitrogen) were mixed and incubated at room temperature for 1 hour. The resulting mixture was then introduced into E. coli and cultured to obtain an expression plasmid designated pcDNA6.2-DmOR47a. Analysis of the nucleotide sequence of the expression plasmid pcDNA6.2-DmOR47a using a DNA sequencer revealed that it contains the nucleotide sequence shown in SEQ ID NO: 5. The nucleotide sequence shown in SEQ ID NO: 5 encodes the amino acid sequence shown in SEQ ID NO: 1. Figure 1 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence shown in SEQ ID NO: 1 that corresponds to the amino acid sequence.

[0109] < Example 1-1 Construction of mutant DmOR47a (RX4S) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 12) of mutant DmOR47a (RX4S) (amino acid sequence: SEQ ID NO: 11), in which arginine, the 372nd amino acid residue (X4 in general formula (1)) in the amino acid sequence of wild-type DmOR47a, was mutated to serine, was constructed as follows.

[0110] PCR primers (primer F: CCTTCTCATCGATTGTTAGCACGGCGATGTCCTAC (SEQ ID NO: 13) and primer R: GTAGGACATCGCCGTGCTAACAATCGATGAGAAGG (SEQ ID NO: 14)) were synthesized to convert the arginine residue at position 372 (X4 in general formula (1)) in the wild-type DmOR47a amino acid sequence to serine. These primers were used to perform PCR amplification using pcDNA6.2-DmOR47a as a template (reaction procedure and conditions were standard). The amplified PCR reaction solution was digested with DpnI and then transformed into Escherichia coli (DH5α). The transformed E. coli was plated on a 25 cm square plate (supplemented with ampicillin) and cultured at 37°C to allow colony formation. Two colonies were selected and cultured again in LB liquid medium. The nucleotide sequences of the plasmids contained in these primers were then determined, and the mutant DmOR47a (RX4S) expression plasmid was obtained.

[0111] < Example 1-2 Construction of mutant DmOR47a (VX3L-RX4S) expression plasmid In the amino acid sequence of wild-type DmOR47a, the 371st amino acid residue (X3 in general formula (1)) valine is mutated to leucine, and the 372nd amino acid residue (X4 in general formula (1)) arginine is mutated to serine. A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 16) of mutant DmOR47a (VX3L-RX4S) (amino acid sequence: SEQ ID NO: 15) was prepared. Specifically, as PCR primers, primer F: CCTTCTCATCGATTCTTAGCACGGCGATGTCC (SEQ ID NO: 17) and primer R: GGACATCGCCGTGCTAAGAATCGATGAGAAGG (SEQ ID NO: 18) were used, and the mutant DmOR47a (RX4S) expression plasmid (Example 1-1) was used as the PCR template. It was prepared in the same manner as in Example 1-1.

[0112] < Examples 1-3 Construction of mutant DmOR47a (VX3L-RX4S+alpha) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 20) of mutant DmOR47a (VX3L-RX4S+alpha) (amino acid sequence: SEQ ID NO: 19), which is a mutant DmOR47a (VX3L-RX4S) with multiple additional mutations, was constructed. The mutation sites are shown in Figure 1. Specifically, the mutant DmOR47a (VX3L-RX4S) expression plasmid (Example 1-2) was used as a PCR template, and mutations were sequentially introduced using each mutation-introducing primer set to construct the plasmid.

[0113] < Reference example 1-1 Construction of chimeric Orco expression plasmid Following a previous report (JP 2018-50556 A), we constructed a plasmid (pcDNA3.1) containing the coding sequence (nucleotide sequence: SEQ ID NO: 22) for Dm(NT-TM4)AmORCO (amino acid sequence: SEQ ID NO: 21), a fusion protein composed of a portion of the Drosophila coreceptor and a portion of the honeybee coreceptor. In Dm(NT-TM4)AmORCO, the amino acid sequence from the N-terminal region (NT) to the fourth transmembrane domain (TM4) (the amino acid sequence from the N-terminal amino acid residue to the 234th amino acid residue) is derived from the Drosophila coreceptor (Dm(NT-TM4)), and the amino acid sequence from the second intracellular loop to the C-terminal region is derived from the honeybee coreceptor (Am(IC2-CT)).

[0114] Test Example 1-2. Introduction of expression plasmid into cells HEK293FT cells (purchased from Invitrogen) were seeded at 3 x 10^6 cells / dish in 10 cm dishes and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. 1.5 μg of one of the olfactory receptor expression plasmids, 3.0 μg of the olfactory receptor co-receptor expression plasmid, and 8 μg of the GFP-aequorin (GAP) expression plasmid were mixed with 12.5 μL of Plus Reagent and 31.25 μL of Lipofectamine LTX (Invitrogen) and incubated for 10 minutes. The mixture was then transfected into the cells. Four hours after the start of transfection, the cells were seeded at 9x10^4 cells / well in a 96-well plate and cultured in DMEM medium (Nacalai Tesque) containing 10% FBS at 37°C and 5% CO2 for approximately 24 hours. This resulted in transformed cells transiently transfected with the olfactory receptor expression plasmid, olfactory receptor co-receptor expression plasmid, and GAP expression plasmid.

[0115] Test Example 1-3. Activity measurement When GFP-aequorin (GAP) binds to calcium ions, it is activated in the presence of substrates such as coelenterazine and emits green fluorescence. Therefore, an increase in the intracellular calcium ion concentration in cells expressing GAP is directly reflected as an increase in the amount of fluorescence. Therefore, whether the olfactory receptor complex functions as an ion channel upon addition of a test substance can be measured from the change in the amount of fluorescence.

[0116] The culture medium of the transformed cells was removed and replaced with assay buffer (Hanks-HEPES (20 mM pH 7.4) containing 0.5 μM coelenterazine h (Promega) and 0.3% BSA) and allowed to stand at room temperature for another 4 hours. Next, using a Flexstation 3 (Molecular Devices), a test substance corresponding to the olfactory receptor was added to the cell culture medium and the fluorescence intensity of the cells was measured.

[0117] In this test example, pentyl acetate, a chemical substance recognized by DmOR47a, was used as the test substance.

[0118] The results are shown in Figure 1. It was found that the mutant DmOR47a of Examples 1-1 to 1-3 had higher chemical response activity than the wild-type DmOR47a.

[0119] Test Example 2: Measurement of chemical response activity of BmOR56 The response activity of the olfactory receptors (wild-type BmOR56 and mutant BmOR56) to chemicals was measured.

[0120] Test Example 2-1. Preparation of expression plasmid < Comparative Example 2-1 Preparation of wild-type BmOR56 expression plasmid Double-stranded DNA containing the base sequence shown in SEQ ID NO: 6 on one of the DNA strands was synthesized. PCR was performed using 100 ng of this double-stranded DNA as a template, 1 μL of 10 μM forward primer BmOR56-5' (5'-tggaattctgcagatcaccatgaagctcctggagaagctag; SEQ ID NO: 23), 1 μL of 10 μM reverse primer BmOR56-3' (5'-gccactgtgctggattcatgttttattcatttgcgactgac; SEQ ID NO: 24), and 1 μL of KOD Plus neo DNA polymerase (Toyobo). PCR was performed as follows: (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes. Steps (2) to (4) were repeated 35 times. The resulting PCR product was ligated to EcoRV-digested pcDNA6.2 (Invitrogen) using the In-Fusion HD Cloning Kit (TAKARA). The ligated DNA was transformed into Escherichia coli and cultured to obtain an expression plasmid designated pcDNA6.2-BmOR56. Analysis of the nucleotide sequence of the expression plasmid pcDNA6.2-BmOR56 using a DNA sequencer revealed that it contained the nucleotide sequence shown in SEQ ID NO:6. The nucleotide sequence shown in SEQ ID NO:6 encodes the amino acid sequence shown in SEQ ID NO:2. Figure 2 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence shown in SEQ ID NO:2 that corresponds to the amino acid sequence.

[0121] < Example 2-1 Construction of mutant BmOR56(IX1Q) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 26) of mutant BmOR56(IX1Q) (amino acid sequence: SEQ ID NO: 25), in which the 380th amino acid residue (X1 in general formula (1)) in the amino acid sequence of wild-type BmOR56 isoleucine was mutated to glutamine, was constructed as follows.

[0122] PCR primers (primer F: CGGTCGCCACTTTTCAGAGGATCCTCAAAGGAG (SEQ ID NO: 27) and primer R: CTCCTTTGAGGATCCTCTGAAAAGTGGCGACCG (SEQ ID NO: 28)) designed to convert isoleucine, the 380th amino acid residue (X1 in general formula (1)) in the amino acid sequence of wild-type BmOR56, to glutamine were synthesized. Mutations were introduced by PCR using these primers and pcDNA6.2-BmOR56 as a template, as in the above examples, to obtain a mutant BmOR56 (IX1Q) expression plasmid.

[0123] < Example 2-2 Construction of mutant BmOR56(RX2A) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 30) of mutant BmOR56 (RX2A) (amino acid sequence: SEQ ID NO: 29), in which the 381st amino acid residue (X2 in general formula (1)) in the amino acid sequence of wild-type BmOR56 was mutated to alanine, was prepared. Specifically, the plasmid was prepared in the same manner as in Example 2-1, except that the PCR primers used were primer F: GTCGCCACTTTTATCGCAATCCTCAAAGGAGCC (SEQ ID NO: 31) and primer R: GGCTCCTTTGAGGATTGCGATAAAAGTGGCGAC (SEQ ID NO: 32).

[0124] < Example 2-3 Construction of mutant BmOR56(KX4S) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 34) of mutant BmOR56 (KX4S) (amino acid sequence: SEQ ID NO: 33), in which the lysine at the 384th amino acid residue (X4 in general formula (1)) in the amino acid sequence of wild-type BmOR56 was mutated to serine, was prepared. Specifically, the plasmid was prepared in the same manner as in Example 2-1, except that the PCR primers used were primer F: CACTTTTATCAGGATCCTCAGCGGAGCCTATAGTTACTAC (SEQ ID NO: 35) and primer R: GTAGTAACTATAGGCTCCGCTGAGGATCCTGATAAAAGTG (SEQ ID NO: 36).

[0125] < Examples 2-4 Construction of mutant BmOR56(KX4N) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 38) of mutant BmOR56 (KX4N) (amino acid sequence: SEQ ID NO: 37), in which the lysine at the 384th amino acid residue (X4 in general formula (1)) in the amino acid sequence of wild-type BmOR56 was mutated to asparagine, was prepared. Specifically, the plasmid was prepared in the same manner as in Example 2-1, except that the PCR primers used were primer F: CACTTTTATCAGGATCCTCAACGGAGCCTATAGTTACTAC (SEQ ID NO: 39) and primer R: GTAGTAACTATAGGCTCCGTTGAGGATCCTGATAAAAGTG (SEQ ID NO: 40).

[0126] < Examples 2-5 Construction of mutant BmOR56 (IX1Q-RX2A-KX4S) expression plasmid In the amino acid sequence of wild-type BmOR56, the 380th amino acid residue (X1 in general formula (1)) isoleucine is mutated to glutamine, the 381st amino acid residue (X2 in general formula (1)) arginine is mutated to alanine, and the 384th amino acid residue (X4 in general formula (1)) lysine is mutated to serine. A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 42) of mutant BmOR56 (IX1Q-RX2A-KX4S) (amino acid sequence: SEQ ID NO: 41) was prepared. Specifically, a plasmid was prepared by sequentially introducing mutations using each mutation introduction primer set in the same manner as in the above example.

[0127] Test Example 2-2. Introduction of expression plasmid into cells and activity measurement The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, cis-jasmone was used as the test substance.

[0128] The results are shown in Figure 2. It was found that the mutant BmOR56s of Examples 2-1 to 2-5 had higher chemical response activity than the wild-type BmOR56.

[0129] Test Example 3: Measurement of AgOR1 chemical response activity The response activity of olfactory receptors (wild-type AgOR1 and mutant AgOR1) to chemicals was measured.

[0130] Test Example 3-1. Preparation of expression plasmid < Comparative Example 3-1 Preparation of wild-type AgOR1 expression plasmid Double-stranded DNA was synthesized, with the base sequence shown in SEQ ID NO: 7 in one of the DNA strands. Using 100 ng of this double-stranded DNA as a template, PCR was performed using 1 μL of 10 μM forward primer AgOR1-5' (5'-tggaattctgcagatcaccatgaagctgaacaaactgaac; SEQ ID NO: 43), 1 μL of 10 μM reverse primer AgOR1-3' (5'-gccactgtgctggatttactctgattccatgctctg; SEQ ID NO: 44), and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out as follows: (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes. Steps (2) to (4) were repeated 35 times. The resulting PCR product was ligated to EcoRV-digested pcDNA6.2 (Invitrogen) using the In-Fusion HD Cloning Kit (Takara). The ligated DNA was transformed into Escherichia coli and cultured to obtain an expression plasmid designated pcDNA6.2-AgOR1. Analysis of the nucleotide sequence of the expression plasmid pcDNA6.2-AgOR1 using a DNA sequencer revealed that it contained the nucleotide sequence shown in SEQ ID NO:7. The nucleotide sequence shown in SEQ ID NO:7 encodes the amino acid sequence shown in SEQ ID NO:3. Figure 3 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence shown in SEQ ID NO:3 that corresponds to the amino acid sequence.

[0131] < Example 3-1 Construction of mutant AgOR1 (MX3L-KX4S) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (base sequence: SEQ ID NO: 46) of mutant AgOR1 (MX3L-KX4S) (amino acid sequence: SEQ ID NO: 45) in which the 401st amino acid residue (X3 in general formula (1)), methionine, in the amino acid sequence of wild-type AgOR1 is mutated to leucine and the 402nd amino acid residue (X4 in general formula (1)), lysine, is mutated to serine was prepared as follows.

[0132] In the amino acid sequence of wild-type AgOR1, the 401st amino acid residue (X3 in general formula (1)) is converted to leucine, and the 402nd amino acid residue (X4 in general formula (1)) is converted to serine. PCR primer F: CACATTTTTGCAGATTTTGAGCCTATCGTACTCCTATC (SEQ ID NOs: 47 and 49) and primer R: GATAGGAGTACGATAGGCTCAAAATCTGCAAAAATGTG (SEQ ID NOs: 48 and 50) were designed to convert lysine. Using pcDNA6.2-AgOR1 as a template, PCR using these primers was performed sequentially to introduce mutations in the same manner as in the above example, and a mutant AgOR1 (MX3L-KX4S) expression plasmid was obtained.

[0133] < Example 3-2 Construction of mutant AgOR1 (MX3L-KX4N) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 52) of mutant AgOR1 (MX3L-KX4N) (amino acid sequence: SEQ ID NO: 51) in which the 401st amino acid residue (X3 of general formula (1)) of methionine in the amino acid sequence of wild-type AgOR1 is mutated to leucine and the 402nd amino acid residue (X4 of general formula (1)) of lysine is mutated to asparagine was prepared. Specifically, PCR primer F: CACATTTTTGCAGATTTTGAACCTATCGTACTCCTATC (SEQ ID NO: 53) and primer R: GATAGGAGTACGATAGGTTCAAAATCTGCAAAAATGTG (SEQ ID NO: 54)) were designed to convert the 401st amino acid residue (X4 of general formula (1)) of lysine to asparagine, and the 402nd amino acid residue (X4 of general formula (1)) of lysine to asparagine. These were synthesized and prepared in the same manner as in Example 3-1.

[0134] < Example 3-3 Construction of mutant AgOR1 (MX3L-KX4S+alpha) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 56) of mutant AgOR1 (MX3L-KX4S) with multiple additional mutations (amino acid sequence: SEQ ID NO: 55) was prepared. The mutation sites are shown in Figure 3. Specifically, the mutant AgOR1 (MX3L-KX4S) expression plasmid (Example 3-1) was used as a PCR template, and mutations were sequentially introduced using each mutation introduction primer set to prepare the plasmid.

[0135] Test Example 3-2. Introduction of expression plasmid into cells and activity measurement The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, phenol was used as the test substance.

[0136] The results are shown in Figure 3. It was found that the mutant AgOR1s of Examples 3-1 to 3-3 had higher chemical response activity than the wild-type AgOR1.

[0137] Test Example 4: Measurement of chemical response activity of AaOR9 The response activity of the olfactory receptors (wild-type AaOR9 and mutant AaOR9) to chemicals was measured.

[0138] Test Example 4-1. Preparation of expression plasmid < Comparative Example 4-1 Preparation of wild-type AaOR9 expression plasmid Double-stranded DNA was synthesized, with the base sequence shown in SEQ ID NO: 8 in one of the DNA strands. Using 100 ng of this double-stranded DNA as a template, PCR was performed using 1 μL of 10 μM forward primer AaOR9-5' (5'-tggaattctgcagatcaccatgtccgtcgagaagatcctggc; SEQ ID NO: 57), 1 μL of 10 μM reverse primer AaOR9-3' (5'-gccactgtgctggatttagctataaacacgtttcaaaagag; SEQ ID NO: 58), and 1 μL of KOD Plus neo DNA polymerase (Toyobo). The PCR reaction was carried out as follows: (1) 94°C for 2 minutes, (2) 98°C for 10 seconds, (3) 63°C for 30 seconds, and (4) 68°C for 1.5 minutes. Steps (2) to (4) were repeated 35 times. The resulting PCR product was ligated to EcoRV-digested pcDNA6.2 (Invitrogen) using the In-Fusion HD Cloning Kit (TAKARA). The ligated DNA was transformed into Escherichia coli and cultured to obtain an expression plasmid designated pcDNA6.2-AaOR9. Analysis of the nucleotide sequence of the expression plasmid pcDNA6.2-AaOR9 using a DNA sequencer revealed that it contained the nucleotide sequence shown in SEQ ID NO:8. The nucleotide sequence shown in SEQ ID NO:8 encodes the amino acid sequence shown in SEQ ID NO:4. Figure 4 shows the correspondence between the amino acid sequence shown by general formula (1): φ7X1X2Z1X3X4Z2Z3φ6Uφ5φ4φ3φ2φ1X5X6 and a portion of the amino acid sequence shown in SEQ ID NO:4 that corresponds to the amino acid sequence.

[0139] < Example 4-1 Construction of mutant AaOR9(RX6T) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (base sequence: SEQ ID NO: 60) of mutant AaOR9 (RX6T) (amino acid sequence: SEQ ID NO: 59), in which arginine, the 374th amino acid residue (X6 in general formula (1)) in the amino acid sequence of wild-type AaOR9, was mutated to threonine, was prepared as follows.

[0140] PCR primers (primer F: CTCATATTTCACTCTTTTGAAAACGGTTTATAGCTAA (SEQ ID NO: 61) and primer R: TTAGCTATAAACCGTTTTCAAAAGAGTGAAATATGAG (SEQ ID NO: 62)) were synthesized to convert the arginine at the 374th amino acid residue (X6 in general formula (1)) in the wild-type AaOR9 amino acid sequence to threonine. Mutations were introduced by PCR using these primers and pcDNA6.2-AaOR9 as a template, as in the above examples, to obtain a mutant AaOR9 (RX6T) expression plasmid.

[0141] < Example 4-2 Construction of mutant AaOR9 (RX6T+alpha) expression plasmid A plasmid (pcDNA6.2) containing the coding sequence (nucleotide sequence: SEQ ID NO: 64) of mutant AaOR9(RX6T+alpha) (amino acid sequence: SEQ ID NO: 63), which is a mutant AaOR9(RX6T) with multiple additional mutations, was prepared. The mutation sites are shown in Figure 4. Specifically, the mutant AaOR9(RX6T) expression plasmid (Example 4-1) was used as a PCR template, and mutations were sequentially introduced using each mutation introduction primer set to prepare the plasmid.

[0142] Test Example 4-2. Introduction of expression plasmid into cells and activity measurement The expression plasmid was introduced into cells in the same manner as in Test Example 1-2, and the activity was measured in the same manner as in Test Example 1-3. In this test example, skatole was used as the test substance.

[0143] The results are shown in Figure 4. It was found that the mutant AaOR9s of Examples 4-1 and 4-2 had higher chemical response activity than the wild-type AaOR9.

[0144] Test Example 5: Measurement of chemical response activity of olfactory receptors of other insects From the results of Test Examples 1 to 4, (A) mutating X3 to a branched chain amino acid and / or X4 to an uncharged polar amino acid; (B) when X5 and X6 are both positively charged polar amino acids in the wild type, mutating X6 to an amino acid other than a positively charged polar amino acid; and (C) when one or both of X1 and X2 are positively charged polar amino acids in the wild type, mutating X1 to an uncharged polar amino acid and / or X2 to a hydrophobic amino acid; It has been found that the chemical response activity of insect olfactory receptors can be improved by at least one selected from the group consisting of:

[0145] In addition, tests were conducted in the same manner as in Test Examples 1 to 4 to compare the chemical response activity of wild-type and mutant types of a number of insect olfactory receptors (some examples include AgOR28, AgOR47, AgOR11c, AgOR27a, AaOR5, AaOR31, AaOR72a, AaOR110, etc.), and results supporting the above rule were obtained.

Claims

1. A mutant insect olfactory receptor protein, The corresponding wild-type insect olfactory receptor protein has the general formula (1): φ 7 X 1 X 2 Z 1 X 3 X 4 Z 2 Z 3 φ 6 Uφ 5 φ 4 φ 3 φ 2 φ 1 X 5 X 6 [In the formula, X 1 ~X 6 and Z 1 ~Z 3 indicates an amino acid derived from the amino acid sequence of the wild-type insect olfactory receptor, and φ 1 indicates a hydrophobic amino acid, and φ 2 ~φ 7 each independently represents an uncharged polar amino acid or a hydrophobic amino acid, and U represents an uncharged polar amino acid. and an amino acid sequence B obtained by mutating an amino acid sequence A represented by the formula: Conditions 1 to 3 below: (Condition 1) In the amino acid sequence B, X 3 and / or X 4 is substituted, and X 3 is a branched chain amino acid and / or X 4 is an uncharged polar amino acid; (Condition 2) In the amino acid sequence A, X 5 and X 6 and X are both positively charged polar amino acids, 6 is an amino acid other than a positively charged polar amino acid, and (Condition 3) In the amino acid sequence A, X 1 and X 2 When one or both of the amino acids are positively charged polar amino acids, in the amino acid sequence B, 1 and / or X 2 is substituted, and X 1 is an uncharged polar amino acid and / or X 2 is a hydrophobic amino acid, Satisfying at least one condition selected from the group consisting of: Mutant insect olfactory receptor proteins.

2. Satisfies the above condition 1, and X 3 is isoleucine or leucine and / or X 4 The mutant insect olfactory receptor protein according to claim 1, wherein is serine or asparagine.

3. Satisfies the above condition 2, and X 6 The mutant insect olfactory receptor protein according to claim 1 or 2, wherein is an uncharged polar amino acid.

4. Satisfies the above condition 2, and X 6 The mutant insect olfactory receptor protein according to any one of claims 1 to 3, wherein is serine or threonine.

5. Satisfies the above condition 3, and X 1 is serine or glutamine and / or X 2 The mutant insect olfactory receptor protein according to any one of claims 1 to 4, wherein is alanine.

6. In condition 1, X 3 is isoleucine or leucine and / or X 4 is serine or asparagine, In condition 2, X 6 is serine or threonine, In condition 3, X 1 is serine or glutamine and / or X 2 The mutant insect olfactory receptor protein according to any one of claims 1 to 5, wherein is alanine.

7. Conditions 1A to 3A below: (Condition 1A) In the amino acid sequence B, X 3 is a branched chain amino acid and / or X 4 is an uncharged polar amino acid; (Condition 2A) In the amino acid sequence B, X 6 is an amino acid other than a positively charged polar amino acid, and (Condition 3A) In the amino acid sequence B, X 1 is an uncharged polar amino acid and / or X 2 is a hydrophobic amino acid, Satisfying at least one condition selected from the group consisting of: The mutant insect olfactory receptor protein according to any one of claims 1 to 6.

8. The mutant insect olfactory receptor protein according to any one of claims 1 to 7, wherein the amino acid sequence A is a sequence contained on the C-terminal side of the amino acid sequence of the wild-type insect olfactory receptor protein.

9. The mutant insect olfactory receptor protein according to any one of claims 1 to 8, wherein the wild-type insect olfactory receptor protein is a wild-type olfactory receptor protein of an Entopteran insect.

10. A polynucleotide comprising a coding sequence for the mutant insect olfactory receptor protein according to any one of claims 1 to 9.

11. A cell comprising the polynucleotide of claim 10.

12. A non-human animal comprising the cells of claim 11.

13. A chemical substance detection element comprising the mutant insect olfactory receptor protein according to any one of claims 1 to 9.

14. A chemical substance detection sensor comprising a lipid bilayer membrane including the chemical substance detection element according to claim 13, a cell, or a non-human animal including said cell.

Images