LAMP method primer set
A primer set for the LAMP method targeting the Lip b 1 gene of Liposcelis insects addresses the limitations of existing allergen detection methods by providing a rapid, sensitive, and cost-effective solution for detecting indoor and food allergens.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2026-03-13
AI Technical Summary
Existing methods for detecting indoor and food allergens, such as morphological and immunological methods, are either costly, require specialized equipment, or lack sensitivity and quantification capabilities, necessitating a more efficient and cost-effective detection technique.
A primer set for the LAMP method targeting the Lip b 1 gene of insects in the genus Liposcelis, specifically designed for detecting Liposcelis bostrychophila, which includes forward and backward inner and outer primers, and optional loop primers, enabling isothermal nucleic acid amplification without temperature control, enhancing sensitivity and specificity.
The primer set allows for rapid, sensitive, and cost-effective detection of indoor and food allergens by amplifying the Lip b 1 gene, improving detection sensitivity and specificity through the LAMP method.
Smart Images

Figure 2026046333000004 
Figure 2026046333000005 
Figure 2026046333000006
Abstract
Description
Technical Field
[0001] The present disclosure relates to a primer set for the LAMP method and the like.
Background Art
[0002] As existing analytical methods for indoor allergens and food allergens, there are mainly morphological methods and immunological methods. The former is a method of observing collected indoor suspended matter samples and food samples under a microscope and identifying each organism (complete body and part of the body) contained therein one by one. The advantage is that it does not require special equipment or reagents other than a microscope, but it requires the skill and time of the examiner. The latter is a method of immunologically detecting proteins specific to allergens, and is further divided into the ELISA method and the immunochromatographic method. The ELISA method has both high sensitivity and accuracy and enables quantitative evaluation, but it is disadvantageous in terms of cost because two types of highly specific monoclonal antibodies are required. In addition, dedicated equipment and time are required for measurement. On the other hand, the immunochromatographic method enables rapid and simple measurement on-site, but it is similarly costly and inferior in terms of quantification and sensitivity.
Prior Art Documents
Non-Patent Documents
[0003]
Non-Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0004] An object of the present disclosure is to provide a simple allergen detection technique that can be used for detecting indoor allergens and / or food allergens.
Means for Solving the Problems
[0005] Tiny insects of the genus Liposcelis often multiply explosively indoors when temperature and humidity conditions are suitable, sometimes damaging food, paper, and wood products. Recent studies have shown that approximately 20% of allergic asthma patients are sensitized to Liposcelis bostrychophila, a type of booklouse that is particularly common indoors, making it clear that this insect is an environmental allergen. Therefore, Liposcelis bostrychophila is a sanitary pest that can cause harm to human health, and it is important to understand its occurrence in indoor environments and take appropriate measures.
[0006] The inventors, through diligent research focusing on insects of the genus Liposcelis, have discovered that a primer set for the LAMP method, comprising a forward inner primer, a backward inner primer, a forward outer primer, and a backward outer primer, with a target nucleotide sequence being a nucleotide sequence within the Lip b 1 gene of an insect of the genus Liposcelis, can solve the above-mentioned problems.
[0007] This disclosure includes the following aspects:
[0008] Item 1. A primer set for the LAMP method comprising a forward inner primer, a backward inner primer, a forward outer primer, and a backward outer primer, wherein the target nucleotide sequence is a nucleotide sequence within the Lip b 1 gene of an insect of the genus Liposcelis.
[0009] Item 2. The LAMP primer set according to Item 1, wherein the target nucleotide sequence is a nucleotide sequence within one exon of the Lip b 1 gene.
[0010] Item 3. The LAMP primer set described in Item 2, wherein the exon is the third exon.
[0011] Item 4. A primer set for the LAMP method according to any one of items 1 to 3, wherein the insect of the genus Liposcelis is Liposcelis bostrychophila.
[0012] Item 5. The forward inner primer includes, in order from the 5' side, an F1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 1, and an F2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 2. The backward inner primer includes, in order from the 5' side, a B1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 4, and a B2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 5. The forward outer primer includes an F3 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in Sequence ID No. 7, and The backward outer primer includes a B3 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in Sequence ID No. 8. A primer set for the LAMP method as described in any of items 1 to 4.
[0013] Item 6. The forward inner primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 3, and The backward inner primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 6. Primer set for the LAMP method as described in item 5.
[0014] Item 7. A primer set for the LAMP method according to any one of items 1 to 6, further comprising a forward-loop primer and a backward-loop primer.
[0015] Item 8. The forward loop primer consists of a base sequence having 70% or more identity to the base sequence represented by SEQ ID NO: 9, and the backward loop primer consists of a base sequence having 70% or more identity to the base sequence represented by SEQ ID NO: 10, The primer set for LAMP method according to Item 7.
[0016] Item 9. A composition for LAMP method reaction containing the primer set for LAMP method according to any one of Items 1 to 8.
[0017] Item 10. The composition for LAMP method reaction according to Item 9, which is for detecting insects of the genus Liposcelis.
[0018] Item 11. The composition for LAMP method reaction according to Item 10, which is used for detecting insects of the genus Liposcelis as an allergen. [[ID=IM1]]
[0019] Item 12. The composition for LAMP method reaction according to Item 11, wherein the allergen is an indoor allergen and / or a food allergen.
Advantages of the Invention
[0020] According to the present disclosure, a simple allergen detection technique that can be used for detecting indoor allergens and / or food allergens can be provided.
Brief Description of the Drawings
[0021] <000009G> [Figure 1] Results of detecting the specific allergen protein gene Lip b 1 of Liposcelis divinatorius by the LAMP method (Test Example 2). The vertical axis indicates the fluorescence intensity (reflecting the amount of amplified nucleic acid). The horizontal axis indicates the LAMP reaction time. <00°0092> [Figure 2]Results of detection of Liposcelis bostrychophila mixed in oats by the LAMP method (Test Example 3) are shown. The vertical axis indicates fluorescence intensity (reflecting the amount of amplified nucleic acid). The horizontal axis indicates the LAMP reaction time. Lip b 1 cDNA is a positive control using a purified product of the DNA as a DNA sample. [Figure 3] Results of detection of the Lip b 1 gene sequence by the LAMP method with an added reverse transcription reaction are shown (Test Example 4). The vertical axis indicates fluorescence intensity (reflecting the amount of amplified nucleic acid). The horizontal axis indicates the LAMP reaction time.
Mode for Carrying Out the Invention
[0022] In this specification, the expressions "containing" and "comprising" include the concepts of "containing", "comprising", "consisting essentially of", and "consisting only of".
[0023] 1. Primer set In one aspect, the present invention relates to a primer set for the LAMP method (which may also be referred to as "the primer set of the present disclosure" in this specification), including a forward inner primer, a backward inner primer, a forward outer primer, and a backward outer primer, and having a target base sequence that is a base sequence within the Lip b 1 gene of insects of the genus Liposcelis. This will be described below.
[0024] The primer set disclosed herein can be used to amplify the target nucleotide sequence within the Lip b 1 gene of Liposcelis insects using the LAMP method. The LAMP method (loop-mediated isothermal amplification) is a nucleic acid amplification method (International Publication No. 00 / 28082) that does not require temperature control, which is essential in the PCR method. This method enables isothermal complementary strand synthesis by annealing the 3' end of a template nucleotide to serve as the starting point for complementary strand synthesis, and by combining this with a primer that anneals to the loop formed at this time. Furthermore, in the LAMP method, because the 3' end of the primer always anneals to a region derived from the sample, the check mechanism by complementary binding of nucleotide sequences functions repeatedly, resulting in a highly sensitive and specific nucleic acid amplification reaction.
[0025] Insects of the genus Liposcelis are insects classified into the genus Liposcelis. Insects of the genus Liposcelis include, for example, Liposcelis bostrychophila, Liposcelis bicolor, Liposcelis brunnea, Liposcelis corrodens, Liposcelis decolor, Liposcelis deltachi, Liposcelis divinatorius, Liposcelis entomophila, Liposcelis formicaria, Liposcelis fusciceps, Liposcelis hirsutoides, Liposcelis lacinia, Liposcelis Mendax, Liposcelis nasus, Liposcelis nigra, Liposcelis ornata, Liposcelis paeta, Liposcelis pallens, Liposcelis pallida, Liposcelis pearmani, Liposcelis prenolepidis, Liposcelis rufa, Liposcelis silvarum, Liposcelis triocellata, Liposcelis villosa, and the like. Among these, Liposcelis bostrychophila is particularly preferred from the standpoint of its importance as an indoor allergen and a food allergen.
[0026] The Lip b 1 gene is an endogenous gene in insects of the genus Liposcelis. The Lip b 1 gene is a known gene; for example, the Lip b 1 gene of Liposcelis bostrychophila has been cloned (Non-Patent Literature 1). The Lip b 1 genes of other Liposcelis insects, i.e., orthologues of the Lip b 1 gene of Liposcelis bostrychophila, can also be easily identified based on the sequence information of the Lip b 1 gene of Liposcelis bostrychophila.
[0027] Examples of the nucleotide sequences of the Lip b 1 gene (defined herein as the sequence from the start codon to the stop codon) include the sequence shown in SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 13. These are the nucleotide sequences of two isoforms (Lip b 1.0101 and Lip b 1.0102) of the Lip b 1 gene of Liposcelis bostrychophila.
[0028] The base sequence of the Lip b 1 gene may be mutated, insofar as it is endemic to insects of the genus Liposcelis. For example, the base sequence of the Lip b 1 gene may have identity with the wild-type Lip b 1 gene of, for example, 70% or more, 80% or more, 90% or more, 95% or more, 98% or more, or 99% or more and 100% or less.
[0029] A preferred embodiment of the Lip b 1 gene sequence is having 70% or more, preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 98% or more, or particularly preferably 99% or more and 100% or less identity with the sequence shown in SEQ ID NO: 11 or SEQ ID NO: 13.
[0030] In a preferred embodiment of this disclosure, the target sequence is a sequence within one exon of the Lip b 1 gene. This allows for the amplification of amplicons of equal length consisting of the same sequence, not only in genomic DNA but also in its transcript RNA (and cDNA generated by reverse transcription from RNA), thereby improving detection sensitivity. In particular, from the viewpoint of detection specificity and detection sensitivity, the exon is preferably the third exon (the third exon from the 5' end). Exons and introns within the Lip b 1 gene can be separated according to known information, for example, according to the donor and acceptor sequences at both ends of the intron.
[0031] Examples of the nucleotide sequences of the third exon of the Lip b 1 gene include the sequence shown in SEQ ID NO: 12 and the sequence shown in SEQ ID NO: 14. These are the nucleotide sequences of the third exon of two isoforms (Lip b 1.0101 and Lip b 1.0102) of the Lip b 1 gene in Liposcelis bostrychophila.
[0032] A preferred embodiment of the nucleotide sequence of the third exon of the Lip b 1 gene is having 70% or more, preferably 80% or more, more preferably 90% or more, even more preferably 95% or more, even more preferably 98% or more, or particularly preferably 99% or more and 100% or less identity with the nucleotide sequence shown in SEQ ID NO: 12 or SEQ ID NO: 14.
[0033] The essential primers used in the LAMP reaction recognize a total of six regions of the target base sequence, namely the F3, F2, and F1 regions from the 5' end of the sense strand (the strand on which the start codon and stop codon of the Lip b 1 gene are located in that order from the 5' end), and the B3c, B2c, and B1c regions from the 3' end, or at least four types of primers that recognize the base sequences or their complementary sequences. These are called the forward inner primer (FIP), backward inner primer (BIP), forward outer primer (F3), and backward outer primer (B3), respectively. The complementary sequences of F1, F2, and F3 are called F1c, F2c, and F3c, respectively, and the complementary strands of B1c, B2c, and B3c are called B1, B2, and B3.
[0034] An inner primer is an oligonucleotide that recognizes a specific nucleotide sequence region on a target base sequence and has a base sequence at its 3' end that provides a starting point for synthesis, while simultaneously having a base sequence at its 5' end that is complementary to any region of the nucleic acid synthesis reaction product originating from this primer. A forward inner primer (FIP) contains an F1c-corresponding region and an F2-corresponding region, starting from the 5' end. A backward inner primer (BIP) contains a B1c-corresponding region and a B2-corresponding region, starting from the 5' end.
[0035] On the other hand, an outer primer is an oligonucleotide that recognizes a specific nucleotide sequence region located at the 3' end of a particular nucleotide sequence region on the target base sequence, and has a base sequence that provides a starting point for synthesis. A forward outer primer (F3) contains an F3-corresponding region. A backward outer primer (B3) contains a B3-corresponding region.
[0036] The F1c, F2, B1c, B2, F3, and B3 regions do not need to have the same base sequence as the F1c, F2, B1c, B2, F3, and B3 regions, and may contain mutations, as long as they can hybridize with the target base sequence in the Lip b 1 gene, preferably under stringent conditions. The number of mutated bases is, for example, 0 to 5, preferably 0 to 3, more preferably 0 to 2, even more preferably 0 to 1, and particularly preferably 0.
[0037] In this specification, "stringent conditions" refers to salt concentrations and / or temperature conditions that cause only specific hybridization and no nonspecific hybridization. For example, this may be conditions in which an amplified reaction solution containing 5-15 mM each of KCl, MgSO4, and / or (NH4)2SO4 is incubated at 55-70°C.
[0038] The base lengths of the F1c, F2, B1c, B2, F3, and B3 regions are preferably 15 to 30, more preferably 16 to 26, even more preferably 17 to 24, and even more preferably 18 to 23, from the viewpoint of specificity and LAMP reaction efficiency.
[0039] The bases that make up the primers are not particularly limited. The bases include not only typical bases found in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.), but also other bases, such as hypoxanthine (I) and modified bases. Examples of modified bases include pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5-bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 2-thiouracil, 4-thiouracil, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethylaminomethyluracil, 1-methyladenine, 1-methyl Examples include ruhypoxanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxyaminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, 2-thiocytosine, purines, 2,6-diaminopurines, 2-aminopurines, isoguanine, indole, imidazole, xanthine, etc.
[0040] The forward inner primer preferably has a direct link between the F1c-corresponding region and the F2-corresponding region, but a linker may be included between them. Similarly, the backward inner primer preferably has a direct link between the B1c-corresponding region and the B2-corresponding region, but a linker may be included between them. The linker sequence is not particularly limited as long as it is a nucleotide sequence that can be used as a linker sequence in FIP used in the LAMP method. The number of nucleotides in the linker sequence is, for example, 1 to 50, 1 to 20, 1 to 10, or 1 to 5.
[0041] The forward inner primer, backward inner primer, forward outer primer, and backward outer primer may have other sequences appended to either or both of their 5' and 3' ends, provided that they are hybridizable to the target base sequence, preferably under stringent conditions, and are capable of extension. For each primer, the base length of the other sequence is, for example, 0 to 5, preferably 0 to 3, more preferably 0 to 2, even more preferably 0 to 1, and particularly preferably 0.
[0042] In one particularly preferred embodiment from the viewpoint of specificity, detection sensitivity, etc., the forward inner primer, backward inner primer, forward outer primer, and backward outer primer are as follows: The forward inner primer includes, in order from the 5' side, an F1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 1, and an F2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 2; The backward inner primer includes, in order from the 5' side, a B1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 4, and a B2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 5; The forward outer primer includes an F3 corresponding region consisting of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 7; The backward outer primer contains a B3 corresponding region consisting of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 8.
[0043] Furthermore, in the above embodiment, it is preferable that the forward inner primer consists of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 3, and / or the backward inner primer consists of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 6.
[0044] The identity in the above embodiments is more preferably 80% or more, even more preferably 90% or more, even more preferably 95% or more, and particularly preferably 98% or more.
[0045] Each of the forward inner primer, backward inner primer, forward outer primer, and backward outer primer may be used individually or in combination of two or more types.
[0046] The primer set of this disclosure preferably further includes a forward-loop primer and a backward-loop primer. The forward-loop primer and the backward-loop primer are primers having a nucleotide sequence complementary to the nucleotide sequence of the single-stranded portion of the loop structure at the 5' end of the dumbbell structure. Using these primers increases the starting points for nucleic acid synthesis, enabling a reduction in reaction time and an increase in detection sensitivity. The nucleotide sequence of the loop primer may be selected from the nucleotide sequence of the target gene or its complementary strand, or from other nucleotide sequences, as long as it is complementary to the nucleotide sequence of the single-stranded portion of the loop structure at the 5' end of the dumbbell structure as described above.
[0047] In one particularly preferred embodiment from the viewpoint of specificity, detection sensitivity, etc., the forward loop primer consists of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 9, and / or the backward loop primer consists of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 10. The identity in this embodiment is more preferably 80% or more, even more preferably 90% or more, even more preferably 95% or more, and especially preferably 98% or more.
[0048] Each of the forward loop primer and backward loop primer may be a single type or a combination of two or more types.
[0049] The polynucleotides constituting each primer in the primer set of this disclosure are usually DNA, but may be subjected to known chemical modifications as long as they can hybridize with the target base sequence, preferably as long as they can hybridize under stringent conditions. The phosphate residue of each nucleotide can be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate. The hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide may also be replaced with -OR (where R represents, for example, CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at position 5 of the pyrimidine base, or by substituting the carbonyl group at position 2 with a thiocarbonyl group. Furthermore, examples include, but are not limited to, those in which the phosphate or hydroxyl portion is modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group. In addition, BNA (LNA), in which the conformation of the sugar portion of the nucleotide is fixed to the N-type by cross-linking the 2' oxygen and 4' carbon atoms of the sugar portion, can also be preferably used.
[0050] Each primer in the primer set of this disclosure may be labeled with at least one nucleotide, to the extent that it can hybridize with the target base sequence, preferably to the extent that it can hybridize under stringent conditions. The polynucleotide can be labeled, for example, with a labeling substance, according to known methods.
[0051] The labeling substance is not particularly limited as long as it is a known labeling substance for nucleic acids. Examples of labeling substances include fluorescent labels. From the viewpoint of suitability for the melting temperature analysis described later, fluorescent labels are preferably those that emit fluorescence when the fluorescently labeled polynucleotide is single-stranded and decrease fluorescence (e.g., quench) when it is double-stranded. Examples of fluorescent labels include fluorescein, phosphorescent substances, rhodamine, and polymethine dye derivatives. Examples of commercially available fluorescent labels include BODIPY FL (trademark, manufactured by Molecular Nucleic Acid Probes), FluorePrime (trademark, manufactured by Amersham Pharmacia), Fluoredite (trademark, manufactured by Millipore), FAM (manufactured by ABI), Cy3 and Cy5 (manufactured by Amersham Pharmacia), and TAMRA (manufactured by Molecular Nucleic Acid Probes).
[0052] The labeling site is not particularly limited as long as it is a known labeling site for nucleic acids. The labeling site can be, for example, the 3' and / or 5' terminal nucleotides.
[0053] One method for detecting nucleic acid amplification products from the LAMP reaction involves using a fluorescently labeled probe. For example, a probe with a fluorescent label at its 3' or 5' end, known as a quenching probe (Qprobe®), can detect or quantify the amplification product by reducing the luminescence of the fluorescent dye when hybridized with a target nucleic acid (Japanese Patent Publication No. 2001-286300). This probe is characterized by being designed so that the base pair for hybridization at the terminal portion forms a G (guanine) and C (cytosine) pair. Examples of fluorescent labels used here include BODIPY-FL, carboxyrhodamine 6G (CR6G), carboxytetramethylrhodamine (TAMRA), Pacific Blue, and fluorescein-4-isothiocyanate (FITC).
[0054] The form of the primer set of this disclosure is not particularly limited. The primer set of this disclosure may be, for example, a form in which each primer is contained in a single container (e.g., a composition), a form in which each primer is contained in multiple containers (e.g., a kit), or a form in which the primers are supported on a carrier. Examples of container types include those used in compound libraries, and more specifically, multi-well plates, microtubes, etc. The carrier is not particularly limited as long as it can hold the primers, and examples include fibrous carriers such as cellulose fibers (e.g., paper, filter paper). Each primer may be in a dry state or in a dissolved state (in solution). The primer set of this disclosure may also contain other components such as buffers.
[0055] The primer sets of this disclosure can be manufactured in accordance with or in accordance with known nucleic acid synthesis methods.
[0056] 2. Composition for LAMP reaction In one embodiment, the present invention relates to a LAMP reaction composition containing the primer set disclosed herein (which may also be referred to herein as "the LAMP reaction composition of the present disclosure"). This will be described below.
[0057] The LAMP reaction compositions of this disclosure are not particularly limited, as long as they contain the primer set of this disclosure and contain at least one component that may be included in the LAMP reaction solution.
[0058] Components that may be included in the LAMP reaction solution include, for example, nucleic acid synthase, reverse transcriptase, dNTPs, RNase inhibitors, nucleic acid detection reagents (indicators), stabilizers, buffers, ions or compounds that release ions in solution, surfactants, the test sample, and solvents (such as water).
[0059] The nucleic acid polymerase is not particularly limited as long as it is a template-dependent nucleic acid polymerase with chain substitution activity. Examples of such enzymes include Bst DNA polymerase (large fragment), Bca(exo-)DNA polymerase, Klenow fragment of E. coli DNA polymerase I, and Csa DNA polymerase, with Bst DNA polymerase (large fragment) being preferred.
[0060] The reverse transcriptase is not particularly limited as long as it is an enzyme that has the activity to synthesize DNA using RNA as a template. Examples of such enzymes include AMV, Cloned AMV, MMLV, Recombinant HIV reverse transcriptase, Superscript II / III / IV (Thermo Fisher Scientific), ReverTraAce (TOYOBO), Thermoscript (Thermo Fisher Scientific), Ominiscript (QIAGEN), Sensiscript (QIAGEN), etc. Preferably, AMV or Cloned AMV reverse transcriptase is used. Furthermore, if an enzyme that has both reverse transcriptase activity and DNA polymerase activity is used, such as Bca DNA polymerase, the RT-LAMP reaction can be performed with a single enzyme.
[0061] The enzymes and reverse transcriptases used in nucleic acid synthesis may be purified from viruses or bacteria, or they may be produced using genetic engineering techniques. Furthermore, these enzymes may be modified through fragmentation or amino acid substitution.
[0062] The nucleic acid detection reagent is not particularly limited as long as it can be used to detect the nucleic acid amplification product after the LAMP reaction, and known reagents can be used. For example, labeled oligonucleotides or fluorescent intercalators (Japanese Patent Publication No. 2001-242169) that specifically recognize the amplified base sequence can be used. In the LAMP method, a large amount of substrate is consumed by nucleic acid synthesis, and the byproduct pyrophosphate reacts with coexisting magnesium to form magnesium pyrophosphate. For this reason, a magnesium indicator (an indicator whose color changes depending on the magnesium concentration) can be used as a nucleic acid detection reagent.
[0063] The cushioning material is not particularly limited, and for example, Tris cushioning material can be used.
[0064] The ions used include those that can be used to adjust the stability of primer annealing, and those that function as cofactors for enzymes such as nucleic acid synthases. Examples of the former ions include potassium ions and magnesium ions. Examples of the latter ions include magnesium ions.
[0065] The final concentrations of the forward inner primer and backward inner primer are preferably 0.5 to 10 μM, more preferably 1.5 to 6.0 μM, and even more preferably 2.5 to 4.0 μM.
[0066] The final concentrations of the forward outer primer and backward outer primer are preferably 0.05 to 2.0 μM, more preferably 0.15 to 1.2 μM, and even more preferably 0.3 to 0.6 μM.
[0067] When loop primers are included, the final concentrations of the forward loop primer and backward loop primer are preferably 0.2 to 5.0 μM, more preferably 0.7 to 3.0 μM, and even more preferably 1.2 to 2.0 μM.
[0068] The LAMP reaction composition disclosed herein can be used as is, or with the addition of other components as necessary, as a LAMP reaction solution.
[0069] Insects of the genus Liposcelis can be allergens. For this reason, the LAMP reaction compositions of this disclosure are particularly suitable for allergen detection. The allergens are preferably indoor allergens and / or food allergens.
[0070] Indoor allergens are allergens present indoors. When used for indoor allergen detection, the test sample can be anything that may contain indoor allergens. Typical examples of such test samples include house dust or its aggregates (dust, etc.), but other materials that may be inhabited by Liposcelis insects, such as paper, tatami mats, wallpaper, and fabric products, can also be used as test samples.
[0071] Food allergens are allergens present in food. When used for detecting food allergens, there are no particular restrictions on the test sample as long as it is a food in which insects of the genus Liposcelis can live, such as grains, processed grain products, confectionery, and dairy products such as cheese.
[0072] The above test samples can be used as is, but from the viewpoint of sensitivity, it is preferable to use them after performing a nucleic acid extraction procedure. Furthermore, in a preferred embodiment, by performing a reverse transcription reaction after nucleic acid extraction, not only the Lip b 1 gene in the genomic DNA but also the transcript of the said gene can be used as a template for the LAMP method, thereby improving sensitivity.
[0073] The LAMP reaction composition of this disclosure may also be in the form of a kit. In this case, in addition to the composition containing at least the primer set of this disclosure, the kit may optionally include, separately from the composition, the above-mentioned components that may be included in the LAMP reaction solution, sample collection equipment, nucleic acid extraction reagents and equipment from the sample, etc.
[0074] The reaction temperature for the LAMP method is preferably 50-75°C, more preferably 55-70°C, and particularly preferably 60-70°C, from the viewpoint of sensitivity, specificity, etc.
[0075] The reaction time for the LAMP method is not particularly limited as long as amplification of the target base sequence occurs, and is, for example, 10 to 180 minutes, preferably 20 to 120 minutes, and more preferably 30 to 90 minutes.
[0076] Known techniques can be applied to detect nucleic acid amplification products after a LAMP reaction. If the reaction solution contains a nucleic acid detection reagent, the amplification product can be detected by detecting its signal. Alternatively, the reaction solution can be easily detected by subjecting it directly to agarose gel electrophoresis after the reaction is complete. In agarose gel electrophoresis, LAMP amplification products are detected as a ladder-like pattern of numerous bands with different base lengths. Furthermore, in the LAMP method, a large amount of substrate is consumed by nucleic acid synthesis, and the by-product pyrophosphate reacts with coexisting magnesium to form magnesium pyrophosphate, causing the reaction solution to become cloudy to the naked eye. Therefore, it is also possible to detect the nucleic acid amplification reaction by observing this cloudiness over time using a measuring instrument that can optically observe the increase in turbidity after or during the reaction, for example, by checking the change in absorbance at 400 nm using a standard spectrophotometer. [Examples]
[0077] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.
[0078] Test Example 1. Design of LAMP primers for Lip b 1 detection. Lip b 1 has two isoforms (Lip b 1.0101 and Lip b 1.0102), and draft sequencing of the Liposcelis bostrychophila genome revealed that these two are encoded as different genes on the genome. Lip b 1.0101 was selected as a target for specific detection of Liposcelis bostrychophila, and primers were designed for amplification using the LAMP method. The base sequence encoding the Lip b 1.0101 protein (from start codon to stop codon) consists of five exons separated by four introns on the genome (Table 1). In Table 1, the start and stop codons are shown in grid lines, exons are underlined, the donor and acceptor sequences at both ends of an intron are shown with a gray background, the third exon (the third exon from the 5' end) is shown in bold, and the six regions within the grid lines in the third exon represent, in order from the 5' end, F3, F2, F1, B1c, B2c, and B3c in the target nucleotide sequence of the LAMP primer set. Sequence ID 11 shows the sequence from the start codon (ATG) to the stop codon (TAA) of the sequence in Table 1 (Sequence ID 15). Sequence ID 12 shows the sequence of the third exon.
[0079] [Table 1]
[0080] The longest exon in this sequence, the third exon (226 bp), has the necessary length to design six LAMP primers, including a loop primer. Furthermore, a BLAST search using this sequence as a query under redundant conditions yielded no homologous genes other than the Lip b 1 gene. Therefore, considering appropriate length and GC content within the third exon, four primers (F3, B3, FIP, BIP) were designed, excluding the loop primer. Subsequently, based on these primer sequences and the template (third exon) base sequence, loop primers (LF, LB) were designed using the LAMP primer design software PrimerExplorer (Eiken Chemical) (https: / / primerexplorer.jp / lampv5e / index.html). It was hypothesized that using this LAMP primer set would amplify amplicons of equal length consisting of the same sequence not only with genomic DNA but also with its transcript RNA (and cDNA generated by reverse transcription from RNA).
[0081] The arrangement of the designed primer set is as follows: FIP (Sequence ID 3): F1c(gcatcagcttggggttggta:Sequence ID 1) + F2(CAACAAAGCTTTGGATGATCT:Sequence ID 2) BIP (Sequence ID 6): B1c(catcaaagccgttcttgacaca:Sequence ID 4) + B2(TATCGGCTTTGTGAGCATC:Sequence ID 5) F3 (Sequence No. 7): ACCACATCATTGAAGTCCT B3 (Sequence No. 8): CTTGTGAAAATCCAGCGAT LF (Sequence No. 9): ACATGGGTCGATAGCCAA LB (Sequence No. 10): GACAAAGTCCTCCACGGT.
[0082] Test Example 2. Detection of the Lip b 1 gene, a psocid-specific allergen protein gene, using the LAMP method. <2-1. DNA extraction from flat-bodied booklice> 5 mg of flat booklice (provided by FCG Research Institute Co., Ltd.), stored frozen (-80°C), was placed in a mortar containing a small amount of liquid nitrogen and ground with a pestle for approximately 5 minutes. Immediately after the liquid nitrogen evaporated, 500 μl of DNA extraction solution (composition: 10 mM Tris-HCl, pH 7.8, 5 mM EDTA, 400 μg / μl Proteinase K (Wako Pure Chemical Industries), RNase / DNase-free sterile water) was added to the crushed booklice in the mortar. Homogenization was performed using a Biomassher III (Nippi), and the extract was collected in a 2.0 ml tube. The tube was incubated at 56°C for 4 hours with shaking (1,000 rpm) using a heat block. Proteinase K was inactivated by standing at 100°C for 10 minutes using a heat block. The tube was then quickly transferred to ice. After centrifugation at 4°C and 15,000 rpm for 5 minutes, the supernatant was transferred to a separate new tube to obtain the crude DNA extract.
[0083] <2-2. LAMP reaction and analysis> The LAMP reaction was carried out using 2x LAMP Master Mix (Nippon Gene). The composition of the reaction solution (25 μl per well) is shown in Table 2. The reaction was carried out according to the instructions provided with the kit.
[0084] [Table 2]
[0085] A 0.2 ml tube containing the reaction solution was placed in a real-time PCR instrument TP900 (Takara Bio), and fluorescence was measured over time under constant temperature reaction conditions of 65°C.
[0086] <2-3.Results> The results are shown in Figure 1. Using an extract containing DNA obtained from 5 mg of flat bark louse as a sample, the Lip b 1 gene sequence was amplified by fluorescence detection using LAMP. Amplification was observed in approximately 20 minutes. However, no amplification was observed in ultrapure water, which served as the negative control.
[0087] Furthermore, the same results were obtained when the LAMP reaction was performed without using loop primers (LF and LB in Table 2).
[0088] Test Example 3. Detection of flat bark contaminated in oats using the LAMP method. <3-1. DNA extraction from oats contaminated with flat bark> Two 200 mg samples each of oats contaminated with flat bark louse and new (unopened) oats contaminated with flat bark louse were used as samples and ground using a mortar and pestle (the samples were not frozen). DNA was extracted using the MonoFas® Food Allergen Detection DNA Extraction Kit 13 (Animos). The DNA extraction process was carried out according to the protocol provided with the kit (using Proteinase K). The yield and characteristics of the extracted DNA are shown in Table 3.
[0089] [Table 3]
[0090] <3-2. LAMP reaction and analysis> The LAMP reaction and analysis were performed in the same manner as in Test Example 2.
[0091] <3-3.Results> The results are shown in Figure 2. Using a crude extract of oats that were suspected to have been contaminated with flat bark louse during storage, amplification of the Lip b 1 gene DNA sequence was confirmed by fluorescence detection LAMP method.
[0092] Furthermore, the same results were obtained when the LAMP reaction was performed without using loop primers (LF and LB in Table 2).
[0093] Test Example 4. Detection of the Lip b 1 gene sequence using the LAMP method with added reverse transcription. In Lip b 1 gene sequence amplification using the LAMP method with the crude DNA extract obtained in Test Example 2, the results were compared with and without reverse transcription.
[0094] The reverse transcription reaction was performed using PrimeScript Reverse Transcriptase (Takara Bio) according to the instructions provided with the kit. A reaction solution with the same composition but without the reverse transcriptase (i.e., no cDNA synthesis using RNA as a template) was also prepared, and the differences in amplification when using both solutions as templates for the LAMP reaction were analyzed.
[0095] The reaction solution was used as a sample, and the LAMP reaction and analysis were performed in the same manner as in Test Example 2.
[0096] The results are shown in Figure 3. A faster amplification initiation was observed when the reverse transcription reaction was added.
[0097] Furthermore, the same results were obtained when the LAMP reaction was performed without using loop primers (LF and LB in Table 2).
Claims
1. A primer set for the LAMP method, comprising a forward inner primer, a backward inner primer, a forward outer primer, and a backward outer primer, wherein the target nucleotide sequence is a nucleotide sequence within the Lip b 1 gene of an insect of the genus Liposcelis.
2. The LAMP primer set according to claim 1, wherein the target base sequence is a base sequence within one exon of the Lip b 1 gene.
3. The LAMP primer set according to claim 2, wherein the exon is the third exon.
4. The primer set for the LAMP method according to claim 1, wherein the insect of the genus Liposcelis is Liposcelis bostrychophila.
5. The forward inner primer includes, in order from the 5' side, an F1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 1, and an F2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO:
2. The backward inner primer includes, in order from the 5' side, a B1c corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 4, and a B2 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO:
5. The forward outer primer includes an F3 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in SEQ ID NO: 7, and The backward outer primer includes a B3 corresponding region consisting of a nucleotide sequence having 70% or more identity with the nucleotide sequence shown in Sequence ID No.
8. A primer set for the LAMP method according to claim 1.
6. The forward inner primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 3, and The backward inner primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No.
6. Primer set for the LAMP method according to claim 5.
7. Furthermore, the primer set for the LAMP method according to claim 1 further includes a forward loop primer and a backward loop primer.
8. The forward loop primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No. 9, and The backward loop primer consists of a nucleotide sequence that has 70% or more identity with the nucleotide sequence shown in Sequence ID No.
10. A primer set for the LAMP method according to claim 7.
9. A composition for a LAMP reaction, comprising a primer set for the LAMP method according to any one of claims 1 to 8.
10. A composition for the LAMP reaction according to claim 9, for the detection of insects of the genus Liposcelis.
11. A LAMP reaction composition according to claim 10 for use in detecting insects of the genus Liposcelis as allergens.
12. The LAMP reaction composition according to claim 11, wherein the allergen is an indoor allergen and / or a food allergen.