Flow cell and method

Abstract

An example of a flow cell includes a substrate having recesses separated by gap regions, a polymer hydrogel located within each of the recesses, and a plurality of transposome complexes immobilized within each of the recesses by biotin-containing linkers. In this example, each of the plurality of transposome complexes is of a single type, comprising a transposon end in which a portion of the transferred strand hybridizes to a portion of the non-transferred strand, and the transferred strand comprises a first amplification domain and does not comprise an index sequence.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 601,655, filed November 21, 2023, U.S. Provisional Patent Application No. 63 / 586,716, filed September 29, 2023, U.S. Provisional Patent Application No. 63 / 476,585, filed December 21, 2022, and U.S. Provisional Patent Application No. 63 / 387,874, filed December 16, 2022, the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference The Sequence Listing submitted herewith is incorporated by reference in its entirety. The file is named "ILI256BPCT_IP-2542-PCT_Sequence_Listing.xml", the file size is 14,888 bytes, and the file creation date is December 14, 2023. [Background technology]

[0003] Double-stranded DNA (dsDNA) target molecules can be fragmented and tagged to generate libraries of smaller single-stranded DNA (ssDNA) molecules. These smaller single-stranded DNA molecules can be used as templates in DNA sequencing reactions. The templates can allow for short read lengths to be obtained, and then, during data analysis, overlapping short sequence reads can be aligned to reconstruct longer nucleic acid sequences. Some methods for fragmenting and tagging double-stranded DNA generate excessive waste, require expensive equipment for fragmentation, and are time-consuming. Summary of the Invention

[0004] Some examples of flow cells disclosed herein include surface chemistries that allow for repurposing of flow cell function. For example, in a single workflow, a flow cell can be used for tagmentation and then for amplification and sequencing. As another example, a flow cell can be reused for multiple cycles of transposome complex binding and tagmentation. These exemplary flow cells can improve efficiency, enable indexing of tagmented fragments, and / or allow for enrichment.

[0005] Other examples of flow cells disclosed herein include photoactivated surface chemistries. These exemplary flow cells allow for spatial positioning control during surface preparation and / or methods performed on the flow cell surface. Thus, these exemplary flow cells can improve efficiency and / or enable flow cell (or spatial) indexing (as opposed to indexing of individual tagmented DNA fragments).

[0006] Other examples of flow cells disclosed herein utilize heat, light, or pH changes to activate transposome complexes at predetermined locations / zones of the flow cell. Through selective and sequential transposome complex activation, multiple DNA samples can be sequentially introduced into the flow cell and exposed to tagmentation at each predetermined location / zone. Thus, cluster generation for a particular sample is performed in a specific, predetermined zone. This allows samples to be spatially indexed, as each zone contains fragments or clusters of different DNA samples. [Brief explanation of the drawings]

[0007] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numbers correspond to similar, if not identical, components, and for the sake of brevity, reference numbers or features having a previously mentioned function may or may not be described with reference to other drawings in which they appear. [Figure 1] FIG. 2 is a top view of the flow cell. [Figure 2A] 2 is a cross-sectional view of one of the flow channel architectures of the flow cell of FIG. 1, including recesses separated by gap regions. [Figure 2B] 1. FIG. 2 is a cross-sectional view of an alternative flow path architecture of the flow cell of FIG. 1, including single lanes that do not include recesses separated by gap regions. [Figure 3A] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3B] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3C] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3D] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3E] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3F] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3G] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 3H] 1 is a chemical flow diagram or chemical structure illustrating a visible light component pair. [Figure 4] FIG. 1 is a schematic flow diagram showing an example of a method involving repurposing a flow cell surface for multiple uses, including tagmentation and amplification. [Figure 5] FIG. 1 is a schematic flow diagram showing another example of a method involving repurposing a flow cell surface for multiple uses, including tagmentation and amplification. [Figure 6] FIG. 10 is a schematic flow diagram illustrating yet another example of a method involving repurposing a flow cell surface for multiple uses, including tagmentation, enrichment, and amplification. [Figure 7] FIG. 10 is a schematic flow diagram illustrating yet another example of a method involving repurposing a flow cell surface for multiple uses, including tagmentation, enrichment, and amplification. [Figure 8]FIG. 1 is a schematic flow diagram illustrating yet another example of a method involving repurposing a flow cell surface for multiple uses, including enrichment of methylated bacterial DNA. [Figure 9A] 9A and 9B are schematic diagrams illustrating a method of utilizing light-activated surface chemistry to selectively attach tagmented entities (e.g., transposome complexes) to predetermined areas of a flow cell, where FIG. 9A shows selective attachment of a transposome complex in a first predetermined area upon exposure to light, FIG. 9B shows introduction of a first DNA sample and tagmentation of the first DNA sample in the first predetermined area, FIG. 9C shows removal of a transposase enzyme from a transposome complex in the first predetermined area, and FIG. 9D shows selective attachment of a transposome complex in a second predetermined area upon exposure to light. [Figure 9B] 9A and 9B are schematic diagrams illustrating a method of utilizing light-activated surface chemistry to selectively attach tagmented entities (e.g., transposome complexes) to predetermined areas of a flow cell, where FIG. 9A shows selective attachment of a transposome complex in a first predetermined area upon exposure to light, FIG. 9B shows introduction of a first DNA sample and tagmentation of the first DNA sample in the first predetermined area, FIG. 9C shows removal of a transposase enzyme from a transposome complex in the first predetermined area, and FIG. 9D shows selective attachment of a transposome complex in a second predetermined area upon exposure to light. [Figure 9C] 9A and 9B are schematic diagrams illustrating a method of utilizing light-activated surface chemistry to selectively attach tagmented entities (e.g., transposome complexes) to predetermined areas of a flow cell, where FIG. 9A shows selective attachment of a transposome complex in a first predetermined area upon exposure to light, FIG. 9B shows introduction of a first DNA sample and tagmentation of the first DNA sample in the first predetermined area, FIG. 9C shows removal of a transposase enzyme from a transposome complex in the first predetermined area, and FIG. 9D shows selective attachment of a transposome complex in a second predetermined area upon exposure to light. [Figure 9D]9A and 9B are schematic diagrams illustrating a method of utilizing light-activated surface chemistry to selectively attach tagmented entities (e.g., transposome complexes) to predetermined areas of a flow cell, where FIG. 9A shows selective attachment of a transposome complex in a first predetermined area upon exposure to light, FIG. 9B shows introduction of a first DNA sample and tagmentation of the first DNA sample in the first predetermined area, FIG. 9C shows removal of a transposase enzyme from a transposome complex in the first predetermined area, and FIG. 9D shows selective attachment of a transposome complex in a second predetermined area upon exposure to light. [Figure 10A] 1 shows a flow cell with different areas for performing different applications, at least one of which is photoactivated. [Figure 10B] 1 shows another flow cell with different areas for performing different applications, at least one of which is photoactivated. [Figure 10C] 1 shows yet another flow cell having different areas for performing different applications, at least one of which is photoactivated. [Figure 11A] 11A and 11B are schematic diagrams illustrating a method for utilizing a removable coating to selectively access tagmented entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 11A shows the introduction of a first DNA sample into a flow cell having a removable coating that overlaps with the transposome complexes, FIG. 11B shows the selective removal of the removable coating from the first predetermined area and tagmentation of the first DNA sample in the first predetermined area, FIG. 11C shows the removal of the transposase enzyme from the transposome complexes in the first predetermined area, and FIG. 11D shows the introduction of a second DNA sample into the flow cell, the selective removal of the removable coating from the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 11B]11A and 11B are schematic diagrams generally illustrating a method of utilizing a removable coating to selectively access tagmented entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 11A shows the introduction of a first DNA sample into a flow cell having a removable coating that overlaps with the transposome complexes, FIG. 11B shows the selective removal of the removable coating from the first predetermined area and tagmentation of the first DNA sample in the first predetermined area, FIG. 11C shows the removal of the transposase enzyme from the transposome complexes in the first predetermined area, and FIG. 11D shows the introduction of a second DNA sample into the flow cell, the selective removal of the removable coating from the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 11C] 11A and 11B are schematic diagrams generally illustrating a method of utilizing a removable coating to selectively access tagmented entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 11A shows the introduction of a first DNA sample into a flow cell having a removable coating that overlaps with the transposome complexes, FIG. 11B shows the selective removal of the removable coating from the first predetermined area and tagmentation of the first DNA sample in the first predetermined area, FIG. 11C shows the removal of the transposase enzyme from the transposome complexes in the first predetermined area, and FIG. 11D shows the introduction of a second DNA sample into the flow cell, the selective removal of the removable coating from the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 11D]11A and 11B are schematic diagrams generally illustrating a method of utilizing a removable coating to selectively access tagmented entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 11A shows the introduction of a first DNA sample into a flow cell having a removable coating that overlaps with the transposome complexes, FIG. 11B shows the selective removal of the removable coating from the first predetermined area and tagmentation of the first DNA sample in the first predetermined area, FIG. 11C shows the removal of the transposase enzyme from the transposome complexes in the first predetermined area, and FIG. 11D shows the introduction of a second DNA sample into the flow cell, the selective removal of the removable coating from the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 12A] 12A and 12B show a schematic diagram illustrating a method for selectively releasing a tagmented entity (e.g., a catalytic metal) in a predetermined area of ​​a flow cell. FIG. 12A shows the introduction of a first DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the first predetermined area, and tagmentation of the first DNA sample in the first predetermined area. FIG. 12B shows the removal of an untagged portion of the first DNA sample and a transposase enzyme from a transposome complex across the flow cell. FIG. 12C shows the introduction of new transposase enzyme to reform a transposome complex. FIG. 12D shows the introduction of a second DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 12B]12A and 12B show a schematic diagram illustrating a method for selectively releasing a tagmented entity (e.g., a catalytic metal) in a predetermined area of ​​a flow cell. FIG. 12A shows the introduction of a first DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the first predetermined area, and tagmentation of the first DNA sample in the first predetermined area. FIG. 12B shows the removal of an untagged portion of the first DNA sample and a transposase enzyme from a transposome complex across the flow cell. FIG. 12C shows the introduction of new transposase enzyme to reform a transposome complex. FIG. 12D shows the introduction of a second DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 12C] 12A and 12B show a schematic diagram illustrating a method for selectively releasing a tagmented entity (e.g., a catalytic metal) in a predetermined area of ​​a flow cell. FIG. 12A shows the introduction of a first DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the first predetermined area, and tagmentation of the first DNA sample in the first predetermined area. FIG. 12B shows the removal of an untagged portion of the first DNA sample and a transposase enzyme from a transposome complex across the flow cell. FIG. 12C shows the introduction of new transposase enzyme to reform a transposome complex. FIG. 12D shows the introduction of a second DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 12D]12A and 12B show a schematic diagram illustrating a method for selectively releasing a tagmented entity (e.g., a catalytic metal) in a predetermined area of ​​a flow cell. FIG. 12A shows the introduction of a first DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the first predetermined area, and tagmentation of the first DNA sample in the first predetermined area. FIG. 12B shows the removal of an untagged portion of the first DNA sample and a transposase enzyme from a transposome complex across the flow cell. FIG. 12C shows the introduction of new transposase enzyme to reform a transposome complex. FIG. 12D shows the introduction of a second DNA sample and an encapsulated complex into the flow cell, the selective release of the tagmented entity from the encapsulated complex in the second predetermined area, and tagmentation of the second DNA sample in the second predetermined area. [Figure 13A] 13A shows a schematic diagram illustrating a method of using heat to selectively activate tagmentation entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 13A shows tagmentation of a first DNA sample in a first predetermined area upon introduction of the first DNA sample into the flow cell and exposure to heat, FIG. 13B shows removal of transposase enzyme from transposome complexes across the flow cell, FIG. 13C shows introduction of new transposase enzyme to reform transposome complexes, and FIG. 13D shows tagmentation of a second DNA sample in a second predetermined area upon introduction of the second DNA sample into the flow cell and exposure to heat. [Figure 13B]13A shows a schematic diagram illustrating a method of using heat to selectively activate tagmentation entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 13A shows tagmentation of a first DNA sample in a first predetermined area upon introduction of the first DNA sample into the flow cell and exposure to heat, FIG. 13B shows removal of transposase enzyme from transposome complexes across the flow cell, FIG. 13C shows introduction of new transposase enzyme to reform transposome complexes, and FIG. 13D shows tagmentation of a second DNA sample in a second predetermined area upon introduction of the second DNA sample into the flow cell and exposure to heat. [Figure 13C] 13A shows a schematic diagram illustrating a method of using heat to selectively activate tagmentation entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 13A shows tagmentation of a first DNA sample in a first predetermined area upon introduction of the first DNA sample into the flow cell and exposure to heat, FIG. 13B shows removal of transposase enzyme from transposome complexes across the flow cell, FIG. 13C shows introduction of new transposase enzyme to reform transposome complexes, and FIG. 13D shows tagmentation of a second DNA sample in a second predetermined area upon introduction of the second DNA sample into the flow cell and exposure to heat. [Figure 13D] 13A shows a schematic diagram illustrating a method of using heat to selectively activate tagmentation entities (e.g., transposome complexes) in predetermined areas of a flow cell, where FIG. 13A shows tagmentation of a first DNA sample in a first predetermined area upon introduction of the first DNA sample into the flow cell and exposure to heat, FIG. 13B shows removal of transposase enzyme from transposome complexes across the flow cell, FIG. 13C shows introduction of new transposase enzyme to reform transposome complexes, and FIG. 13D shows tagmentation of a second DNA sample in a second predetermined area upon introduction of the second DNA sample into the flow cell and exposure to heat. [Figure 14A]1A-1D show different examples of transposome complexes that can be used in different examples of the methods disclosed herein. [Figure 14B] 1A-1D show different examples of transposome complexes that can be used in different examples of the methods disclosed herein. [Figure 14C] 1A-1D show different examples of transposome complexes that can be used in different examples of the methods disclosed herein. [Figure 14D] 1A-1D show different examples of transposome complexes that can be used in different examples of the methods disclosed herein. [Figure 15A] FIG. 1 is a schematic top view of a lane of a flow cell with different target primers patterned at different regions along the lane. [Figure 15B] FIG. 15B is an enlarged cross-sectional and perspective view of a portion of one of the flow cell lane regions of FIG. 15A, in which a target primer is attached within a recess in the flow cell lane and a transposome complex containing a complementary spatial tag is shown in one of the recesses. [Figure 16A] 1 shows a binding complex comprising a DNA sample bound to a transposome complex containing a spatial tag, passivated by a hydrophobic polymer. [Figure 16B] 1 shows a bonded complex passivated by an antifouling agent. DETAILED DESCRIPTION OF THE INVENTION

[0008] Some exemplary flow cells disclosed herein include surface chemistries for immobilizing transposome complexes and primers on the surface of the flow cell. By incorporating this surface chemistry, the flow cell can be repurposed for specific applications. In the flow cell, tagmentation generates DNA sample fragments (i.e., library fragments of a larger DNA sample) on the same surface where fragment amplification and sequencing are performed. This eliminates the need for off-flow cell DNA sample preparation to generate library fragments, thus providing a more streamlined and efficient process. Some methods using these exemplary flow cells also allow for indexing and / or enrichment of library fragments.

[0009] Other examples of flow cells disclosed herein include photoactivated surface chemistries, which allow for spatial location / position control for surface chemistry activation, which in turn allows for selective surface preparation and / or reaction initiation.

[0010] Yet other examples of flow cells disclosed herein include the use of heat, light, or pH changes to activate transposome complexes in predetermined areas of the flow cell, allowing control over where samples are plated and amplified, thus allowing multiple samples to be used and distinguished by spatial indexing.

[0011] definition Terms used herein will be understood to take their ordinary meaning in the relevant art unless otherwise specified. Some terms used herein and their meanings are set forth below.

[0012] As used herein, the singular forms "a," "an," and "the" refer to both the singular and the plural unless the context clearly dictates otherwise. As used herein, the term "comprising" is synonymous with "including," "containing," or "characterized by" and is inclusive or open-ended and does not exclude further, unrecited elements or method steps.

[0013] References throughout this specification to "one example," "another example," "an example," etc. mean that a particular element (e.g., a feature, structure, composition, configuration, and / or characteristic) described in connection with an example is included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0014] As used throughout this disclosure, including the claims, the terms "substantially" and "about" are used to describe and account for small variations, such as those due to variations in processing. For example, these terms can refer to ±5% or less from the stated value, e.g., ±2% or less from the stated value, ±1% or less from the stated value, ±0.5% or less from the stated value, ±0.2% or less from the stated value, ±0.1% or less from the stated value, or ±0.05% or less from the stated value.

[0015] Adapter: An oligonucleotide sequence that can be fused to a nucleic acid molecule, for example, by ligation or tagmentation. Suitable adapter lengths can range from about 10 nucleotides to about 100 nucleotides, or from about 12 nucleotides to about 60 nucleotides, or from about 15 nucleotides to about 50 nucleotides. Adapters can comprise any combination of nucleotides and / or nucleic acids. In some examples, adapters can include an amplification domain having a universal nucleotide sequence, such as a P5 or P7 sequence, that can serve as a starting point for template amplification and cluster generation. In other examples, adapters can include a sequence complementary to at least a portion of a flow cell surface-bound primer (including a universal nucleotide sequence). In the latter example, the adapter sequence can hybridize to a complementary flow cell surface-bound primer during amplification and cluster generation. In some examples, adapters can also include a sequencing primer sequence (i.e., a sequencing binding site) or a sequencing sample index (i.e., a barcode sequence). Combinations of different adapters can be incorporated into nucleic acid molecules, such as DNA fragments generated via tagmentation.

[0016] Amplification domain: A portion of an adapter that has a universal nucleotide sequence, such as the P5 or P7 sequence or their complement, that can serve as a starting point for template amplification and cluster generation.

[0017] Corresponding to: When a primer "corresponds" to an amplification domain, the primer and amplification domain can have identical sequences, such that a copy of the amplification domain generates a sequence complementary to the primer, or, if the amplification domain is introduced as part of an adapter, they can have complementary sequences.

[0018] Deposition: Any suitable application technique, which may be manual or automated, and which in some cases results in the modification of surface properties. Generally, deposition can be carried out using deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, etc.

[0019] Depression: A discrete, concave feature in a substrate or layer of a substrate (e.g., a patterned resin) having a surface opening at least partially surrounded by a void region of the substrate or layer. The depression can take any of a variety of shapes at the surface opening, such as, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross section of the depression taken perpendicular to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The depression may also have a more complex architecture, such as ridges, steps, etc.

[0020] DNA sample: A polymeric form of nucleotides of any length, including deoxyribonucleotides, deoxyribonucleotide analogs, or complementary deoxyribonucleotides, derived from an RNA (ribonucleic acid) sample. DNA samples are double-stranded. DNA samples may include naturally occurring DNA containing nitrogenous heterocyclic bases (nucleobases such as adenine, thymine, cytosine, and / or guanine), sugars (specifically, deoxyribose, i.e., sugars lacking the hydroxyl group at the 2' position of ribose), and a backbone containing phosphodiester bonds. Analog structures may have alternative backbone linkages, including any of a variety known in the art.

[0021] The DNA sample may be genomic DNA (gDNA), which can be isolated from one or more cells, bodily fluids (e.g., whole blood, blood spots, saliva), or tissues. gDNA can be prepared by lysing cells containing DNA. Cells may be lysed under conditions that substantially preserve the integrity of the cellular gDNA. In one specific example, heat lysis may be used to lyse cells. In another specific example, exposure of cells to an alkaline pH can be used to lyse cells while causing relatively little damage to the gDNA. Any of a variety of basic compounds, including, for example, potassium hydroxide and sodium hydroxide, can be used for lysis. Additionally, relatively undamaged gDNA can be obtained from cells lysed with enzymes that degrade the cell wall. Cells lacking a cell wall, either native or due to enzymatic removal, can also be lysed by exposure to osmotic stress. Other conditions that can be used to lyse cells include exposure to detergents, mechanical disruption, sonication, heat, pressure differentials such as in a French press apparatus, or Dounce homogenization. Agents that stabilize gDNA can be included in the cell lysate or isolated gDNA sample, including, for example, nuclease inhibitors, chelating agents, salts, and buffers. In some instances, crude cell lysates containing gDNA can be used directly without further isolation of the gDNA. In one example, a whole blood sample can be lysed using a lysis buffer that does not contain inorganic salts, and the crude lysate can be subjected to specific processing steps to generate a complex crude lysate. This complexed crude lysate can also be used as a DNA sample without further isolation or purification.

[0022] Each: When used in reference to a collection of items, each identifies an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur where explicit disclosure or context clearly dictates otherwise.

[0023] Flow cell: A vessel with an enclosed flow path in which a reaction can occur, or a vessel with a channel that is open to the ambient environment and in which a reaction can occur. A vessel with an open flow path may be referred to herein as an open wafer flow cell. Any example of a flow cell may include an inlet for delivering reagents to the channel and an outlet for removing reagents from the channel. In some examples, the flow cell allows for detection of reactions occurring therein. For example, the flow cell may include one or more transparent surfaces that allow for optical detection of arrays, optically labeled molecules, etc.

[0024] Flow path: An area defined between two bonded or otherwise attached components, or an area defined within a lane so as to be open to the surrounding environment. A flow path can selectively receive a liquid sample. In some examples, a flow path can be defined between two patterned sequencing surfaces or one patterned sequencing surface and a lid, and thus can be in fluid communication with one or more components of the sequencing surface.

[0025] Fragment: A portion or piece of a DNA sample. A "partially matched fragment" is a portion or piece of a DNA sample that has been tagmented and therefore contains an adapter ligated to the 5' end of the DNA fragment. A "fully matched fragment" is a portion or piece of a DNA sample that has adapters incorporated at both the 3' and 5' ends of the DNA fragment.

[0026] Primer: A single-stranded nucleic acid molecule that can hybridize to a target sequence, such as an adapter attached to a fragment. In one example, a flow cell surface-bound primer can serve as the starting point for fragment amplification and cluster generation. In another example, a flow cell surface-bound primer can serve as a hybridization point for spatial tags and, therefore, for target attachment of specific transposome complexes and DNA samples. As yet another example, a primer (e.g., a sequencing primer) can be introduced that can hybridize to a fragment or fragment amplicon to prime the synthesis of a new strand complementary to the fragment or fragment amplicon. Any primer can contain any combination of nucleotides or their analogs. In some examples, a primer is a single-stranded oligonucleotide or polynucleotide. The length of a primer can be any number of bases. In examples, the flow cell surface-bound primer and the sequencing primer are each single-stranded, ranging from 10 to 60 bases or 20 to 40 bases.

[0027] Tagmentation entity: Any component involved in the process of tagmentation. This term may refer to a transposome complex, a transposase enzyme, a reagent, etc.

[0028] Tagmentation: The process by which a DNA sample is cleaved / fragmented and tagged (e.g., with adapters) for analysis. Tagmentation is an in vitro transposition reaction.

[0029] Transferred Strand and Non-Transferred Strand: The term "transferred strand" refers to a sequence that includes the transferred portion of a transposon end. Similarly, the term "non-transferred strand" refers to a sequence that includes the non-transferred portion of a transposon end. The 3' end of the transferred strand is joined or transferred to a double-stranded fragment during tagmentation. The non-transferred strand is not joined or transferred to a double-stranded fragment during tagmentation. In examples, the transferred strand and non-transferred strand include at least partially complementary portions that are covalently linked to each other.

[0030] Transposase or transposase enzyme: An enzyme that forms a functional complex containing a transposon end-containing composition (e.g., a transposon, a transposon end, a transposon end composition) and can catalyze the insertion or transposition of the transposon end-containing composition into a double-stranded DNA sample with which it is incubated, for example, in an in vitro transposition reaction (i.e., tagmentation). Transposases provided herein can also include integrases from retrotransposons and retroviruses. While many examples described herein refer to Tn5 transposase and / or hyperactive Tn5 transposase, it is understood that any transposase capable of inserting transposon ends with sufficient efficiency to 5' tag and fragment a DNA sample for the intended purpose can be used.

[0031] Transposome complex: An entity formed between a transposase and a double-stranded nucleic acid containing a transposase integration recognition site. For example, a transposome complex can be a transposase enzyme pre-incubated with double-stranded transposon DNA under conditions that support non-covalent complex formation. The double-stranded transposon DNA can include, for example, Tn5 DNA, a portion of Tn5 DNA, a transposon end composition, a mixture of transposon end compositions, or other double-stranded DNA that can interact with a transposase, such as a hyperactive Tn5 transposase.

[0032] Transposon end: A double-stranded nucleic acid strand that exhibits only the nucleotide sequence ("transposon end sequence") necessary to form a complex with a transposase that functions in tagmentation. The double-stranded nucleic acid strand at the transposon end can comprise any nucleic acid or nucleic acid analog suitable for forming a functional complex with a transposase. For example, the transposon end can comprise natural DNA or a DNA analog (including modified bases or backbones), and can contain a nick in one or both strands.

[0033] Flow cell Some examples of flow cells disclosed herein include a biotin-containing linker that allows the flow cell to be repurposed for different uses. Other examples of flow cells disclosed herein include a visible light responsive element that allows the flow cell to be selectively activated.

[0034] An example flow cell 10 is shown in top view in FIG. 1, and different examples of flow cell architectures are shown in FIGS. 2A and 2B.

[0035] A top view of an example flow cell 10 is shown in Figure 1. As discussed with reference to Figures 2A and 2B, some examples of flow cells 10 include two opposing substrates 12 and 12', or substrates 14 and 14', each of which may be configured with a biotin-containing linker 16, 16' or a visible light-responsive member 18, 18'. Other exemplary flow cells 10 include one substrate 12 or 14 that may be configured with a biotin-containing linker 16 or a visible light-responsive member 18, and a lid attached to a portion of the substrate 12 or 14. Still other exemplary flow cells 10 include one substrate 12 or 14 that may be configured with a biotin-containing linker 16 or a visible light-responsive member 18, and that is not attached to another component but rather is open to the surrounding environment.

[0036] 2A and 2B, the flow path 20 is defined between two opposing substrates 12 and 12', or 14 and 14'. In other examples, the flow cell 10 includes one substrate 12 or 12' or 14 or 14' and a lid (not shown) attached to the substrate 12 or 12' or 14 or 14'. In these examples, the flow path 20 is defined between the substrate 12 or 12' or 14 or 14' and the lid. In open wafer versions, the flow path 20 may be defined by lanes 36 (see FIG. 2B).

[0037] Different substrates 12 or 12' or 14 or 14' are shown in Figures 2A and 2B.

[0038] 2B, the substrate 14, 14' is a single layer structure. Examples of suitable single layer base structures for the substrate 14, 14' include epoxy siloxane, glass, modified or functionalized glass, plastic materials (including acrylic, polystyrene, copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefins / cycloolefin polymers (COP) (such as ZEONOR® from Zeon), polyimides, nylon (polyamide), etc.), ceramic / ceramic oxide, silica, fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, etc. In any of the examples disclosed herein, the substrate 14, 14' may be selected to be transparent to visible light.

[0039] 2A, the substrate 12 or 12' is a multilayer structure. The multilayer structure of the substrate 12, 12' includes a base support 22, 22' and a patterned material 24, 24' on the base support 22, 22'. In any of the examples disclosed herein, the components of the substrate 12, 12' may be selected to be transparent to visible light.

[0040] The base support 22, 22' can be any of the examples described herein for the single layer structure of the substrate 14, 14'. The patterned material 24 or 24' can be any material that can be patterned with recesses 26, 26'.

[0041] In an example, the patterning material 24, 24′ can be an inorganic oxide that is selectively applied to the base support 22, 22′ in a desired pattern, for example, via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., TaO), aluminum oxide (e.g., AlO), silicon oxide (e.g., SiO), hafnium oxide (e.g., HfO), and the like. In another example, the patterning material 24, 24′ can be a resin matrix material that is applied to the base support 22, 22′ and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, dunk coating, spin coating, spray coating, droplet dispensing, ultrasonic spray coating, doctor blade coating, aerosol printing, screen printing, microcontact printing, and the like. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping techniques, embossing techniques, molding techniques, microetching techniques, printing techniques, and the like. Some examples of suitable resins include polyhedral oligomeric silsesquioxane-based resins, non-polyhedral oligomeric silsesquioxane epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opened epoxies), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0042] In an example, substrate 12, 12', or 14, 14' may be circular and have a diameter ranging from about 2 mm to about 300 mm, or may be a rectangular sheet or panel with a maximum dimension of up to about 10 feet (about 3 meters). In an example, substrate 12, 12', or 14, 14' is a wafer having a diameter ranging from about 200 mm to about 300 mm. The wafer may then be diced to form individual flow cell substrates. In another example, substrate 12, 12', or 14, 14' is a die having a width ranging from about 0.1 mm to about 10 mm. While exemplary dimensions are shown, it should be understood that substrate 12, 12' or 14, 14' having any suitable dimensions may be used. As another example, a panel may be used that is a rectangular support having a surface area greater than a 300 mm round wafer. The panel may then be diced to form individual flow cells.

[0043] The flow cell 10 also includes flow channels 20. While several flow channels 20 are shown in FIG. 1, it should be understood that any number of flow channels 20 (e.g., a single channel 20, four channels 20, etc.) may be included in the flow cell 10. Each flow channel 20 may be isolated within the flow cell 10 such that fluid introduced into any particular flow channel 20 does not flow into any adjacent flow channels 20.

[0044] At least a portion of the flow channel 20 may be defined within the substrate 12, 12' or 14, 14' using any suitable technique, depending in part on the material of the substrate 12, 12' or 14, 14'. In an open wafer flow cell, the entire flow channel 20 may be defined by lanes 36 defined within the substrate 12 or 14. In one example, at least a portion of the flow channel 20 is etched into a glass substrate, such as the substrate 14, 14'. In another example, a portion of the flow channel 20 may be patterned into a multilayered resin matrix material using photolithography, nanoimprint lithography, or the like. In a closed version of the flow cell 10, a separate material (e.g., material 28) may be applied to the substrate 12, 12' or 14, 14', such that the separate material 28 defines at least a portion of the walls of the flow channel 20.

[0045] In an example, the channels 20 have a substantially rectangular configuration with rounded ends. The length and width of the channels 20 may be smaller than the length and width of the substrate 12, 12′ or 14, 14′, respectively, so that a portion of the substrate surface surrounding the channels 20 is available for attachment to another substrate 12, 12′ or 14, 14′ or a lid, or for defining the perimeter of the open channels 20. In some cases, the width of each channel 20 may be at least about 1 mm, at least about 2.5 mm, at least about 5 mm, at least about 7 mm, at least about 10 mm, or more. In some cases, the length of each channel 54 may be at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 100 mm, or more. The width and / or length of each channel 20 may be greater than, less than, or somewhere in between the values ​​specified above. In another example, the channels 20 are square (e.g., 10 mm by 10 mm).

[0046] The depth / height of each channel 20 may be as thin as a few monolayers, for example, when microcontact, aerosol, or inkjet printing is used to deposit a separate material 28 that partially defines the walls of the channel. In other examples, the depth / height of each channel 20 may be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or greater. In examples, the depth / height may range from about 10 μm to about 100 μm. In other examples, the depth / height is about 5 μm or less. It should be understood that the depth / height of each channel 20 may also be greater than, less than, or between the values ​​specified above. The depth / height of the channel 20 may also vary along the length and width of the flow cell 10, for example, when recesses 26, 26′ are used.

[0047] The exemplary flow cell architecture of FIG. 2A includes recesses 26, 26′ separated by gap regions 34, 34′. Many different layouts of the recesses 26, 26′ can be envisioned, including regular, repeating, and irregular patterns. In an example, the recesses 26, 26′ are arranged in a hexagonal grid for close packing and improved density. Other layouts may include, for example, rectangular layouts, triangular layouts, etc. In some examples, the layout or pattern may be in an xy format with rows and columns. In some other examples, the layout or pattern may be a repeating arrangement of recesses 26, 26′ and gap regions 34, 34′. In yet other examples, the layout or pattern may be a random arrangement of recesses 26, 26′ and gap regions 34, 34′.

[0048] The layout or pattern can be characterized in terms of the density (number) of recesses 26, 26' within a defined area. For example, recesses 26, 26' may be spaced apart from each other by 1 mm 2 They can exist at a density of approximately 2 million per mm. 2 Approximately 100, 1mm per 2 Approximately 1,000 per 1mm 2 Approximately 100,000 per 1mm 2 Approximately 1 million per 1mm 2 Approximately 2 million per 1mm 2 Approximately 5 million per 1mm 2 Approximately 10 million per mm 2 The density can be adjusted to different densities, including densities of about 50 million per unit area, or higher or lower. It should be further understood that the density can be between one of the lower limit values ​​and one of the upper limit values ​​selected from the ranges above, or other densities (outside of the given ranges) can be used. By way of example, a high-density array can be characterized as having recesses 26, 26' separated by less than about 100 nm, a medium-density array can be characterized as having recesses 26, 26' separated by about 400 nm to about 1 μm, and a low-density array can be characterized as having recesses 26, 26' separated by more than about 1 μm.

[0049] The layout or pattern of the recesses 26, 26' may also, or alternatively, be characterized in terms of the average pitch, or the spacing from the center of one recess 26, 26' to the center of an adjacent recess 26, 26' (center-to-center spacing), or the spacing from the right edge of one recess 26, 26' to the left edge of an adjacent recess 26, 26' (edge-to-edge spacing). The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, or about 100 μm. The average pitch of a particular pattern may be between one of the lower and upper values ​​selected from the ranges above. In an example, the recesses 26, 26' have a pitch (center-to-center spacing) of about 1.5 μm. Although examples of mean pitch values ​​have been provided, it should be understood that other mean pitch values ​​may also be used.

[0050] The size of each of the recesses 26, 26' may be characterized by its volume, open area, depth, and / or diameter. For example, the volume may be about 1×10 -3 μm 3 ~about 100μm 3 ranges from about 1 × 10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 In another example, the opening area may be about 1×10 3 μm 2 ~about 100μm 2 ranges from about 1 × 10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , at least about 10 μm 2In yet another example, the depth may range from about 0.1 μm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more or less. In yet another example, the diameter or length and width may range from about 0.1 μm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or more or less.

[0051] 2A includes recesses 26, 26′ defined within respective lanes 36, 36′. This architecture may be desirable for substrate 12 when used to form open wafer flow cell 10. Although not shown, it should be further understood that recesses 26, 26′ may be defined across a substantially planar substrate surface (i.e., not within lanes 36, 36′) and material 28 may completely define the sidewalls of enclosed flow cell 10.

[0052] The exemplary flow cell architecture of Figure 2B also includes lanes 36, 36' that do not include recesses 26, 26'. In this example, lanes 36, 36' extend just short of the entire length and width of substrate 14, 14' such that interstitial regions 34, 34' are formed around lanes 36, 36'. The flow cell architecture of Figure 2B may be desirable for methods disclosed herein that allow selective attachment of tagmented entities (see Figures 9A-9D) or methods that allow selective activation of transposome complexes (see the series of Figures 11, 12, and 13).

[0053] In one example, the flow cell architecture shown in Figure 2A or 2B includes a polymer hydrogel 32, 32' having a visible light responsive member 18, 18' attached thereto.

[0054] The polymer hydrogels 32, 32′ may be made of poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM) or another acrylamide copolymer disclosed herein (e.g., poly(N-N′-dimethylacrylamide), polyethylene glycol (PEG)-acrylate, PEG-diacrylate, PEG-amine, PEG-carboxylate, PEG-dithiol, PEG-epoxide, PEG-isocyanate, PEG-maleimide, crosslinked poly(methyl methacrylate) (PMMA), polyvinylpyrrolidone (PVPON), polyvinyl alcohol (PVA), polyethylene oxide-polypropylene oxide block copolymer (PEO-PPO), poly(hydroxyethyl methacrylate) (poly(hydroxyethyl methacrylate)), poly ... The hydrogel may be based on one or more of: poly(N-isopropylacrylamide) (PHEMA), poly(N-isopropylacrylamide) (PNIPAAm), poly(lactic acid)-poly(ethylene glycol) block copolymer, poly(ethylene glycol)-poly(lactic acid-co-glycolic acid) block copolymer, poly(acrylic-co-vinylsulfonic acid), poly(acrylamide-co-vinylsulfonic acid), poly(L-aspartic acid), poly(aspartamide), adipic acid dihydrazide- or aldehyde-modified poly(L-glutamic acid), bisacrylamide, or polylysine, starch, agar, agarose, heparin, alginate, alginate sulfate, dextran sulfate, hyaluronan, pectin, carrageenan, gelatin, chitosan, cellulose, and collagen, or a combination or mixture thereof.

[0055] In one example, the polymer hydrogel 32, 32′ comprises an acrylamide copolymer. In this example, the acrylamide copolymer has the following structure (I):

[0056] [ka] During the ceremony, R A is an azide or tetrazine, or any other functional group that can be attached to an alkyne, amino, alkenyl, alkyne, halogen, hydraarea, hydrazine, carboxyl, hydroxy, tetrazole, nitrone, sulfate, or thiol; R B is H or optionally substituted alkyl; R C , R D , and R E are each independently selected from the group consisting of H and optionally substituted alkyl; -(CH2) p - may be optionally substituted, p is an integer ranging from 1 to 50; n is an integer ranging from 1 to 50,000, and m is an integer ranging from 1 to 100,000.

[0057] One specific example of an acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM).

[0058] Those skilled in the art will recognize that the arrangement of the "n" and "m" repeating features in structure (I) is representative and that the monomer subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or combinations thereof).

[0059] The molecular weight of the acrylamide copolymer can range from about 5 kDa to about 1500 kDa, or from about 10 kDa to about 10 MDa, or in a particular example, can be about 312 kDa.

[0060] In some instances, the acrylamide copolymer is a linear polymer. In other instances, the acrylamide copolymer is a lightly crosslinked polymer.

[0061] In some examples, the gel material can be a variation of structure (I). In one example, the acrylamide unit is N,N-dimethylacrylamide.

[0062] [ka] In another embodiment, the acrylamide unit in structure (I) can be replaced by:

[0063] [ka] where R D , R E , and R F are each H or C1-C6 alkyl, and R G , and R H are each C1-C6 alkyl (rather than H as in acrylamide). In this example, q may be an integer ranging from 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide may be used. In this example, structure (I) contains, in addition to the repeated "n" and "m" features,

[0064] [ka] wherein R D , R E , and R F are each H or C1-C6 alkyl, and R G and R H are each C1-C6 alkyl. In this example, q can be an integer ranging from 1 to 100,000.

[0065] As another example of the polymer hydrogel 32, 32′, the repeating feature “n” in structure (I) may be replaced with a heterocyclic azide group-containing monomer having structure (II):

[0066] [ka] In the formula, R 1 is H or C1-C6 alkyl, R2 is H or C1-C6 alkyl, L is a linker comprising a linear chain of 2-20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including 10 optional substituents on the carbon and any nitrogen atoms in the chain, E is a linear chain of 1-4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and including optional substituents on the carbon and any nitrogen atoms in the chain, A is an N-substituted amide with H or C1-C4 alkyl attached to the N, and Z is a nitrogen-containing heterocycle. Examples of Z include 5-10 carbon-containing ring members present as single ring structures or fused structures. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.

[0067] As yet another example, the gel material may include repeat units of each of structures (III) and (IV):

[0068] [ka] In the formula, R 1a , R 2a , R 1b and R 2b each independently selected from hydrogen, optionally substituted alkyl, or optionally substituted phenyl; R 3a and R 3b each is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl, or optionally substituted C7-C14 aralkyl; 1 and L 2 are each independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0069] As mentioned above, in some examples, the polymer hydrogels 32, 32′ have one of the members of a visible light-responsive pair 18, 18′ attached thereto. A “visible light-responsive pair” refers to two or three reagents that undergo a coupling reaction when exposed to visible light. When a pair includes two reagents, one is attached to the polymer hydrogel 32, 32′, and the other is attached to a tagmentation entity (e.g., a transposome complex), a primer, or another entity introduced to the flow cell surface. When a pair includes three reagents, one is attached to the polymer hydrogel 32, 32′, another is attached to an entity introduced to the flow cell surface, and the third is present in a formulation introduced when the coupling reagent is performed.

[0070] Examples of visible light-responsive pairs are shown in Figures 3A-3H. In each of these figures, R and R1, or R1 and R2, or bold font, represent moieties that bind upon light activation. Either of these groups can be attached to the polymer hydrogel 32, 32' or to an entity introduced to the flow cell surface. If a third entity is used in the coupling reaction, the third entity can be introduced along with the entity introduced to the flow cell surface.

[0071] The first visible light responsive member 18, 18' may be attached to the polymer hydrogel 32, 32' via covalent or non-covalent bonds. By way of example, the first visible light responsive member 18, 18' may be R A Non-covalent bonds (e.g., biotin-streptavidin) can be used as long as neither member of the non-covalent pair is capable of binding to the other member of the visible light responsive pair.

[0072] In another example, the flow cell architecture shown in FIG. 2A includes a biotinylated polymer hydrogel 30, 30′ that includes a biotin-containing linker 16, 16′. In these examples, biotin is ABiotin is attached to the surface of the polymer hydrogel (e.g., 32, 32') via some of the functional groups (i.e., azide, tetrazine, or other functional groups capable of binding to alkynes). A The biotin-containing linker 16, 16' is linked to a linker such as bicyclo[6.1.0]nonyne (BCN), which can be covalently attached to a portion of the group. The combination of biotin and a linker is an example of a biotin-containing linker 16, 16'. In another example, streptavidin is linked to a linker such as R A The biotin-containing linker 16, 16' is attached to biotin, which is attached to a linker that can covalently bond to a portion of the group. In this example, the biotin-containing linker 16, 16' includes a linker, biotin, and streptavidin. The biotin-containing linker 16, 16' can be added to the polymer hydrogel (e.g., 32, 32') before or after the polymer hydrogel (e.g., 32, 32') is applied to the recess 26, 26' to form the biotinylated polymer hydrogel 30, 30'. The streptavidin can be part of the linker 16, 16' or can be added to the flow cell 10 before or simultaneously with the biotinylated transposome complex or biotinylated primer linked to the linker 16, 16'.

[0073] In yet another example, the flow cell 10 does not include either the visible light responsive member 18, 18' or the biotin-containing linker 16, 16'.

[0074] In some of these examples, the transposome complexes shown in Figure 14C or Figure 14D are formed by the R A The groups can be directly attached to these exemplary flow cells. These exemplary flow cells can contain transposome complexes attached to them or can have them introduced as part of the method.

[0075] In other of these examples, the flow cell 10 includes a target primer that can hybridize to a portion of the transposome complex, as further described with reference to Figures 15A and 15B.

[0076] Repurposing the flow cell surface Some of the flow cells 10 can be repurposed for various uses. An exemplary method (shown and described with reference to FIGS. 4 and 5) includes generating at least partially adapted DNA sample fragments on the flow cell 10 using multiple transposome complexes 38A (FIGS. 4 and 14A) or 38B (FIGS. 5 or 14B) attached to the surface of the flow cell 10 within the flow path 20 by biotin-containing linkers 16, cleaving the at least partially adapted DNA sample fragments so that the biotin-containing linkers 16 remain attached to the surface, and one of the following: using the flow cell 10 for a subsequent cycle to generate at least partially adapted DNA sample fragments, or using the flow cell 10 to amplify at least some of the previously cleaved and at least partially adapted DNA sample fragments.

[0077] These exemplary methods are carried out using a flow cell 10 including the architecture shown in Figure 2A. More specifically, these flow cells 10 include a substrate 12 having recesses 26 separated by gap regions 34, a polymer hydrogel (specifically, biotinylated polymer hydrogels 30, 30') disposed within each of the recesses 26, and a plurality of transposome complexes 38A or 38B immobilized within each of the recesses 26 by biotin-containing linkers 16. In one example, each of the plurality of transposome complexes 38A, 38B is of a single type including a transposon end 40 having a portion of a transferred strand 42 hybridized to a portion of a non-transferred strand 44 or 44', where the transferred strand 42 includes a first amplification domain 45 and does not include an index sequence. In another example, each of the multiple transposome complexes 38A, 38B is of a single type, comprising a transposon end 40 having a portion of the transferred strand 42 hybridized to a portion of the non-transferred strand 44 or 44', the transferred strand 42 comprising a first amplification domain 45 and also comprising an index sequence (not shown in Figure 4 or Figure 5). During repurposing, newly added transposome complexes 38A or 38B comprise different index sequences such that each sample is uniquely indexed.

[0078] In the examples shown in Figures 4 and 5, the biotin-containing linker 16 is a graftable group (e.g., BCN or R A As mentioned above, streptavidin 60 may be part of the linker 16 or may be added to the flow cell 10 before or simultaneously with the transposome complexes 38A, 38B.

[0079] In each of Figures 4, 14A, 5, and 14B, a single transposome complex 38A, 38B is shown. However, it should be understood that the transposome complexes 38A, 38B form dimers in solution and when attached to the flow cell surface. For simplicity, it should be understood that a single transposome complex is shown in Figures 4 and 5. Several dimeric forms of the transposome complexes 38A, 38B are shown, for example, in Figure 6.

[0080] 4 and 14A, each transposome complex 38A includes a transposase enzyme 46 non-covalently bound to a transposon end 40. Each transposon end 40 is a double-stranded nucleic acid strand, one strand ME of which is part of the transferred strand 42 and the other strand ME' of which is part of the non-transferred strand 44. In other words, transposon end 40 includes a portion of the transferred strand 42 that hybridizes to the non-transferred strand 44.

[0081] The transferred strand 42 includes a 5'-end functional group 48. In this example, the 5'-end functional group 48 is biotin. The transferred strand 42 also includes a first amplification domain 45 and a sequencing primer sequence 47 attached to one strand ME of the transposon end 40. The strand ME of the transposon end 40 is located at the 3' end of the transferred strand 42.

[0082] In this example, the first amplification domain 45 has a different sequence from the second amplification domain 49 (e.g., P5') of the subsequently introduced adapter 50 (which forms a forked adapter 50' when hybridized to the transferred strand 42 as shown in FIG. 4D), but has the same sequence as one primer 55 (e.g., P7) that is introduced into the flow cell 10 (e.g., at FIG. 4G). The first amplification domain 45 and primer 55, together with the second amplification domain 49 and another primer 57 (e.g., P5 or P15) that is introduced onto the flow cell surface, enable amplification of the DNA sample fragments generated during tagmentation.

[0083] The P5 primer sequence is one of the following: P5#1:5'→3' AATGATACGGCGACCACCGAGAUCTACAC (SEQ ID NO: 1), P5#2:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 2) where "n" is inosine in SEQ ID NO:2, or P5#3:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 3) where "n" is alkene-thymidine (i.e., alkene-dT) in SEQ ID NO:3.

[0084] The P5' sequence is the complement of any of the examples of P5.

[0085] The P7 primer sequence can be any of the following: P7#1:5'→3' CAAGCAGAAGACGGCATACGAnAT (SEQ ID NO: 4) P7#2:5'→3' CAAGCAGAAGACGGCATACnAGAT (SEQ ID NO: 5) P7#3:5'→3' CAAGCAGAAGACGGCATACnAnAT (SEQ ID NO: 6) Here, "n" is 8-oxoguanine in each of SEQ ID NOs: 4 to 6.

[0086] It should be understood that other sequences can be used for amplification domains 45, 49 (e.g., P7, P5') and primers 55, 57 (e.g., P7, P5), so long as the combination allows for the desired amplification. Thus, the names P5, P5', and P7 are provided as examples, and the corresponding domains 45, 49 and / or primers 55, 57 are not limited to the specific sequences described herein. By way of example, P15, PA, PB, PC, or PD primers can be used.

[0087] The P15 primer sequence is as follows: P15:5'→3' AATGATACGGCGACCACCGAGAnCTACAC (SEQ ID NO: 7) where "n" is allyl-T (i.e., a thymine nucleotide analogue bearing an allyl functional group).

[0088] Other primers (PA-PD) mentioned above include: PA 5'→3' GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG (SEQ ID NO: 8) PB 5'→3' CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT (SEQ ID NO: 9) PC 5'→3' ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT (SEQ ID NO: 10) PD 5'→3' GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC (SEQ ID NO: 11)

[0089] Although not shown in the exemplary sequence for PA-PD, it should be understood that any of these sequences may include a cleavage site 52 (e.g., uracil, 8-oxoguanine, allyl-T, etc.) at any point in the strand. The sequences of the first amplification domain 45 / primer 55 and the second amplification domain 49 / primer 57 may be selected to have orthogonal cleavage sites (i.e., one cleavage site is not sensitive to the cleavage agent used at the other cleavage site), so that after amplification, either the forward or reverse strand can be cleaved, leaving the other of the reverse or forward strand for sequencing.

[0090] Primers 55 and 57 may also contain a poly-T sequence at the 5' end of the primer sequence. In some examples, the poly-T region contains 2 to 20 T bases. As specific examples, the poly-T region may contain 3, 4, 5, 6, 7, or 10 T bases.

[0091] Sequencing primer sequences 47, 53 (the latter of which is part of adapter 50) have different sequences that each bind to a sequencing primer introduced into flow cell 10 after tagmentation and amplification. By way of example, sequencing primer sequence 47 may bind to a sequencing primer that primes the synthesis of a new strand complementary to the forward strand fragment / fragment amplicon, and sequencing primer sequence 53 may bind to a sequencing primer that primes the synthesis of a new strand complementary to the reverse strand fragment / fragment amplicon.

[0092] Transposon end 40 of each transposome complex 38A includes strand ME hybridized to strand ME', respectively. Strands ME and ME' are thus complementary. Double-stranded transposon end 40 can form a complex with transposase 46. By way of example, strands ME and ME' of transposon end 40 can be related but non-identical 19 base pair (bp) outer end (e.g., strand ME) and inner end (e.g., strand ME') sequences that function as substrates for Tn5 transposase activity, or mosaic ends recognized by wild-type or mutant Tn5 transposase, or R1 ends (e.g., strand ME) and R2 ends (strand ME') recognized by MuA transposase.

[0093] 4A, the transposome complex 38A is first attached to the biotinylated polymer hydrogel 30 in the recess 26. Avidin or streptavidin 60 can be used to attach the 5′-end functional group 48 (biotin in this example) to the biotinylated polymer hydrogel 30. As examples, avidin or streptavidin 60 may be pre-attached to the 5′-end functional group 48 before complex 38A is introduced into flow cell 10 and incubated; avidin or streptavidin 60 may be introduced into flow cell 10 with 5′-biotinylated transposome complex 38A and incubated; avidin or streptavidin 60 may be introduced into flow cell 10 and incubated with biotinylated polymer hydrogel 30, and then 5′-biotinylated transposome complex 38A may be added and incubated; or avidin or streptavidin 60 and biotin may be pre-bound to each other and then introduced into flow cell 10, where biotin is bound to R A The 5' biotinylated transposome complex 38A may be bound to the surface of a polymer hydrogel via some of the groups (directly or via a linker), and then the 5' biotinylated transposome complex 38A may be introduced into a flow cell 10 containing a streptavidin-biotin binding linker 16 as part of the biotinylated hydrogel 30.

[0094] In this exemplary method, perfectly matched DNA fragments are generated by introducing a DNA sample 54 and a tagmentation buffer into the flow cell 10 (see B); performing tagmentation of the DNA sample 54 using a plurality of transposome complexes 38A (see B); removing the transposase enzyme 46 of each of the plurality of transposome complexes 38A (see C); and replacing the non-transferred strand 44 of each of the plurality of transposome complexes 38A with an adaptor 50, wherein the adaptor comprises a sequence complementary to the ME portion of the transferred strand 42, e.g., ME″, a sequencing primer sequence 53, an I sequence, a nucleotide ... and replacing the non-transferred strand 44 with a second amplification domain 49 that is complementary to the index sequence 51 and a primer 47 that is immobilized or will be immobilized in each of the recesses 26 of the flow cell 10, thereby dehybridizing the non-transferred strand 44 and hybridizing the adapter 50 to a portion ME of the transferred strand 42 of each of the multiple transposome complexes 38A (thus forming a forked adapter 50', see D), and performing gap-fill ligation to attach the DNA sample fragment to each forked adapter 50' (see D).

[0095] As shown in FIG. 4B, a DNA sample (shown fragmented at reference numeral 54) is introduced into flow cell 10 for tagmentation. DNA sample 54 may be introduced along with a tagmentation buffer, which may include water, an optional cosolvent (e.g., dimethylformamide), a metal cofactor for the transposase (e.g., magnesium acetate), and a buffer salt (e.g., tris(hydroxymethyl)aminomethane (Tris or TRIS) acetate, pH 7.6). In an example, the optional cosolvent may be present in an amount up to about 11%, the metal cofactor may be present at a concentration ranging from about 3 mM to about 10 mM, and the buffer salt may be present at a concentration ranging from about 7 mM to about 12 mM.

[0096] When the DNA sample 54 is introduced into the flow cell 10 containing the transposome complex 38A, the DNA sample 54 is fragmented, and the 5' ends of both double-stranded fragments 58, 58' are ligated to the 3' ends of the respective transferred strands 42 of the transposome complex 38A. The fragmentation and ligation can occur at a temperature of 30°C or higher. In one example, the temperature can be in the range of about 30°C to about 55°C. In another example, the temperature can be in the range of about 35°C to about 45°C. The 3' ends of the double-stranded fragments 58, 58' are not ligated to the 5' ends of the non-transferred strands 44. Thus, a gap G (shown as B in FIG. 4 ) exists between the 3' end of each DNA fragment strand 58, 58' and the 5' end of the corresponding non-transferred strand 44. In one example, each gap G is 9 base pairs long.

[0097] As shown in FIG. 4C, transposase 46 is then removed from complex 38A, where complex 38A is attached to fragments 58, 58′, respectively, via transferred strand 42. Removal of transposase 46 can be achieved, for example, using sodium dodecyl sulfate (SDS) or proteinase, or by heating the flow cell to about 60°C. If heat is used, some exemplary methods involve introducing a wash solution into flow cell 10 and heating flow cell 10 containing the wash solution to about 60°C. An exemplary wash solution is an aqueous solution containing a buffer (e.g., Tris), a salt (e.g., sodium chloride, sodium citrate, etc.), a surfactant (e.g., TWEEN polysorbate), and / or a chelating agent (e.g., EDTA). In one example, the wash solution includes water, a salt concentration ranging from about 25 mM to about 50 mM, a surfactant in an amount ranging from about 0.01% to about 0.1% by weight, and optionally, a chelating agent. The wash solution may have a relatively high pH (e.g., ranging from about 7 to about 10).

[0098] The non-transferred strand 44 of each of the multiple transposome complexes 38A is replaced with an adapter 50, thereby generating a forked adapter 50' shown in FIG. 4D. As shown between C and D, the adapter 50 includes a sequence ME" complementary to the ME portion of the transferred strand 42, a sequencing primer sequence 53, an index sequence 51, and a second amplification domain 49, e.g., P5', complementary to a primer 47 (e.g., P5) that is immobilized or will be immobilized in each of the recesses 26 of the flow cell 10. The index sequence 51 is a unique barcode sequence that can be used to identify and index DNA sample fragments. The non-transferred strand 44 is dehybridized, and the adapter 50 is hybridized to a portion ME of the transferred strand 42 to generate a forked adapter 50'.

[0099] Gap-fill ligation is then performed to attach the DNA sample fragments 58, 58' to the sequence ME" of each forked adapter 50' (see FIG. 4D). Gap-fill ligation can be performed using any suitable gap-fill ligation enzyme (e.g., tTaq608 polymerase, T7 exo minus polymerase, etc.) and any suitable ligase (e.g., E. coli DNA ligase, T4 DNA ligase, etc.) in combination with a solution of nucleotides. Gap-fill ligation can be performed at a temperature ranging from about 37°C to about 50°C for about 5 minutes.

[0100] As a result of gap-fill ligation, a perfectly matched DNA fragment is attached to the flow cell 10. The perfectly matched fragment is designated D and comprises a first amplification domain 45 (e.g., P7) at one end and a second amplification domain 49 (e.g., P5') at the other end, with respective DNA fragments 58, 58' between them.

[0101] The perfectly matched DNA fragment is then cleaved by introducing a suitable cleavage agent at the cleavage site 52. By way of example, uracil can be cleaved by uracil-DNA glycosylase (UDG), inosine can be cleaved by Endo IV, 8-oxoguanine can be cleaved by 8-oxoguanine DNA glycosylase, and vicinal diol bonds can be cleaved by oxidation, such as by treatment with periodate reagent.

[0102] By cleaving the perfectly matched DNA sample fragment at cleavage site 52, the biotin-containing linker 16 remains attached to the surface, as shown at F in FIG.

[0103] The cleaved, perfectly matched DNA fragments are transferred into holding receptacle 26″. This is shown in FIG. 4E. In one example, holding receptacle 26″ is a well or chamber patterned in substrate 12 or 14. In this example, holding receptacle 26″ is in fluid communication with, but separated from, flow path 20. Holding receptacle 26″ does not include polymer hydrogel 30. Alternatively, the holding receptacle may be separate from the flow cell, such as in a cartridge on an instrument that receives the flow cell. Within holding receptacle 26″, the cleaved, perfectly matched DNA fragments are denatured to form single-stranded, perfectly matched DNA fragments 56A, 56B. In an example, denaturation is performed in NaOH or Tris-HCl and heat (e.g., about 90° C.).

[0104] After cleaving the fully matched DNA sample fragments, and prior to using the flow cell 10, the method further includes removing streptavidin 60 from the biotin-containing linker 16 so that the biotin-containing linker 16 remains attached to the flow cell surface. Removal of streptavidin (or avidin) 60 is shown in FIG. 4F.

[0105] To remove streptavidin 60, a biotin-streptavidin cleaving composition can be introduced into the flow cell 10. Examples of biotin-streptavidin cleaving compositions include about 95% formamide and about 10 mM ethylenediaminetetraacetic acid (EDTA), or about 10% to about 50% by volume of formamide reagent, with the remainder being buffer salts. At suitable reaction temperatures, these cleaving compositions disrupt the biotin-streptavidin interaction, thus releasing the bound biotin-containing linker 16 (e.g., streptavidin, 5'-terminal functional group 48 (biotin)). Alternatively, a thermal wash with biotin and / or desthiobiotin allows newly added biotin and / or desthiobiotin to compete with the already bound biotin. Disrupting the biotin-streptavidin interaction removes the streptavidin 60 and the 5′ terminal functional group 48 (biotin), leaving biotin-BCN (ie, an example of a biotin-containing linker 16 ) attached to the polymer hydrogel 30 .

[0106] The flow cell 10 can then be used for a subsequent cycle (e.g., from F back to A in FIG. 4) to generate new perfectly matched DNA sample fragments, or to amplify at least a portion of the pre-cleaved and perfectly matched DNA sample fragments (e.g., single-stranded perfectly matched sample fragments 56A, 56B).

[0107] When the flow cell 10 is used for a subsequent cycle to generate new, perfectly adapted DNA sample fragments, the subsequent cycle to generate the perfectly adapted DNA sample fragments includes introducing new transposome complexes 38A into the flow path 20, thereby attaching at least some of the new transposome complexes 38A to at least some of the biotin-containing linkers 16 in the flow path 20; introducing a new DNA sample 54 and a new tagmentation buffer into the flow path 20; and repeating tagmentation, transposase enzyme 46 removal, replacement of the non-transferred strand 44 with an adapter 50, and gap-fill ligation with the new DNA sample 54. The repeating steps can be performed in the same manner as described herein. For example, streptavidin 60 can be added with the transposome complexes 38A (which contain biotin as their 5'-terminal group 48) to attach them to the biotin-containing linkers 16. The flow cell 10 may be used multiple times to prepare single-stranded perfectly matched fragments 56A, 56B from several different DNA samples.

[0108] When the flow cell 10 is used for amplifying at least a portion of the pre-cut and fully adapted DNA sample fragments, the method includes attaching first and second primers 55, 57 (e.g., P7, P5) to at least a portion of the biotin-containing linker 16 in the flow path 20 (see FIG. 4G) and introducing the pre-cut and fully adapted DNA sample fragments 56A, 56B in single-stranded form into the flow cell 10.

[0109] Although reference is made to P5 and P7 primers, it should be understood that other sequences can be used for primers 55, 57 so long as the combination allows for the desired amplification of single-stranded, perfectly matched DNA sample fragments 56A, 56B. Primers 55, 57 include a 5'-end group 48' (biotin in this example) so that they can be attached to biotin-containing linker 16 via streptavidin 60. Primers 55, 57 can be attached using any of the avidin / streptavidin techniques described herein for attaching transposome complexes 38A to biotinylated polymer hydrogel 30.

[0110] Once primers 55, 57 are attached, the single-stranded, perfectly matched sample fragments 56A, 56B may be transported back to the flow path 20, each seeded into a recess 26 and subjected to amplification. The second amplification domain 49 (e.g., P5') of the single-stranded, perfectly matched sample fragments 56A, 56B hybridizes to the primer 57 in the recess 26. The sample fragments 56A, 56B are copied from the hybridized primer 57 (e.g., P5) by 3' extension using a high-fidelity DNA polymerase. The original sample fragments 56A, 56B are denatured, leaving the copies immobilized around the recess 26. Isothermal bridge amplification or some other form of amplification can be used to amplify the immobilized copies. For example, the copied template loops over and hybridizes to an adjacent complementary primer 55 (e.g., P7), and the polymerase copies the copied template to form a double-stranded bridge structure, which is denatured to form two single strands. These two strands loop over and hybridize to adjacent complementary primers and are extended again to form two new double-stranded loops. This process is repeated for each template copy through cycles of isothermal denaturation and amplification, creating dense clonal clusters of amplicons in recess 26. Each cluster of double-stranded bridge structures is denatured. In the example, the reverse strand is removed by specific base cleavage, leaving the forward template strand. This example of clustering is referred to as bridge amplification, and is one example of amplification that can be performed. It should be understood that other amplification techniques can be used.

[0111] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by the introduction of an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0112] After sequencing, the biotin-streptavidin cleavage composition can be reintroduced to remove primers 55, 57 and the amplicons and nascent strands attached thereto, leaving biotin-containing linkers 16 in recesses 26 ready for another cycle (similar to FIG. 4F).

[0113] In the examples of Figures 5 and 14B, each transposome complex 38B includes a transposase enzyme 46 non-covalently bound to a transposon end 40. Each transposon end 40 is a double-stranded nucleic acid strand, one strand ME, which is part of the transferred strand 42, and the other strand ME', which is part of the non-transferred strand 44'. In other words, the transposon end 40 includes a portion of the transferred strand 42 hybridized to a portion of the non-transferred strand 44'. Thus, the strands ME, ME' are complementary. Any of the strands ME, ME' described herein may be used.

[0114] The transferred strand 42 includes a 5'-end functional group 48. In this example, the 5'-end functional group 48 is biotin. The transferred strand 42 also includes a sequencing primer sequence 47 and a first amplification domain 45 bound to one strand ME of the transposon end 40. Although not shown, the transferred strand 42 may also include an index sequence between the sequencing primer sequence 47 and the first amplification domain 45. The strand ME of the transposon end 40 is located at the 3' end of the transferred strand 42.

[0115] In this example, the non-transferred strand 44' is an adapter that further includes a sequencing primer sequence 53 (attached to strand ME'), an index sequence 51, and a second amplification domain 49 (e.g., P5') complementary to a primer 57 (e.g., P5) immobilized in each of the recesses 26 of the flow cell 10 (see Figure 5G).

[0116] The first amplification domain 45 has a different sequence from the second amplification domain 49, but has the same sequence as one primer 55 (e.g., G in FIG. 5) that is introduced into the flow cell 10. The second amplification domain 49 is the complement of another primer 57 that is attached to the flow cell 10. The first amplification domain 45 and primer 55, together with the second amplification domain 49 and primer 57, enable amplification of the DNA sample fragment 54 generated during tagmentation. Either of the amplification domains 45, 49 can be used in this example as long as they generate single-stranded, perfectly matched DNA fragments 56A, 56B, and either of the primers 55, 57 can be used in this example as long as they can amplify the generated single-stranded, perfectly matched DNA fragments 56A, 56B.

[0117] The sequencing primer sequences 47, 53 have different sequences that each bind to a sequencing primer introduced into the flow cell 10 after tagmentation and amplification.

[0118] The index sequence 51 is a unique barcode sequence that can be used to identify and index DNA sample fragments. In another example, the index sequence is a unique molecular index (UMI).

[0119] 5A, the transposome complex 38B is first attached to the biotinylated polymer hydrogel 30 in the recess 26. Avidin or streptavidin 60 can be used to attach the 5′-terminal functional group 48 (biotin in this example) to the biotinylated polymer hydrogel 30. For example, avidin or streptavidin 60 may be pre-attached to the 5′-end functional group 48 before complex 38B is introduced into flow cell 10 and incubated; avidin or streptavidin 60 may be introduced into flow cell 10 with 5′-biotinylated transposome complex 38B and incubated; avidin or streptavidin 60 may be introduced into flow cell 10 and incubated with biotinylated polymer hydrogel 30, and then 5′-biotinylated transposome complex 38B may be added and incubated; or avidin or streptavidin 60 and biotin may be pre-attached to each other and then introduced into flow cell 10, where biotin is attached to R A The 5' biotinylated transposome complex 38B may then be attached to the surface of a polymer hydrogel via some of the groups (directly or via a linker), and the 5' biotinylated transposome complex 38B may then be introduced into a flow cell 10 containing a streptavidin-biotin binding linker 16 as part of the biotinylated hydrogel 30.

[0120] In this exemplary method, perfectly matched DNA fragments are generated by introducing a DNA sample 54 and tagmentation buffer into the flow path 10 (see B), performing tagmentation of the DNA sample 54 using multiple transposome complexes 38B (see B), removing the transposase enzyme 46 from each of the multiple transposome complexes 38B (see C), and performing gap-fill ligation to attach the DNA sample fragments to their respective non-transferred strands 44' (e.g., forked adapters 50', see D).

[0121] As shown in Figure 5B, a DNA sample 54 (shown as fragments 58, 58') is introduced into flow cell 10 for tagmentation. DNA sample 54 can be introduced with a tagmentation buffer, as described with reference to Figure 4.

[0122] When DNA sample 54 is introduced into flow cell 10 containing transposome complex 38B, DNA sample 54 is fragmented, and the 5' ends of both double-stranded fragments 58, 58' are ligated to the respective 3' ends of the transferred strand 42 of transposome complex 38B. Fragmentation and ligation can be performed as described with reference to Figure 4. The 3' ends of fragments 58, 58' are not attached to the non-transferred strand 44', thus forming respective gaps G.

[0123] As shown in Figure 5C, transposase 46 is then removed from complex 38B, which now attaches to fragments 58, 58', respectively, via transferred strand 42. Removal of transposase 46 can be accomplished as described in Figure 4.

[0124] Gap-fill ligation is then performed to attach DNA sample fragments 58, 58' to the non-transferred strand 44' (see FIG. 5D). As a result of gap-fill ligation, a perfectly matched DNA fragment (having a first amplification domain 45 at one end and a second amplification domain 49 at the other end) is attached to the flow cell 10.

[0125] The perfectly matched DNA fragments are then cleaved by introducing a suitable cleaving agent at cleavage site 52. Any of the exemplary cleaving agents disclosed herein can be used. By cleaving the perfectly matched DNA sample fragments at cleavage site 52, the biotin-containing linkers 16 remain attached to the surface, as shown at F in FIG. 5 .

[0126] The cleaved, perfectly matched DNA fragments are transferred into holding receptacle 26'', which is shown in Figure 5E. Within holding receptacle 26'', the cleaved, perfectly matched DNA fragments are denatured to form single-stranded, perfectly matched DNA fragments 56A, 56B. In examples, denaturation is performed in NaOH or Tris-HCl and heat.

[0127] After cleaving the fully matched DNA sample fragments, and prior to using the flow cell 10, the method further includes removing the streptavidin 60 from the biotin-containing linker 16 so that the biotin-containing linker 16 remains attached to the flow cell surface. Removal of the streptavidin 60 is shown in Figure 5F. The streptavidin 60 and the 5'-terminal functional group 48 (biotin) of the transferred strand 42 can be removed using a biotin-streptavidin cleavage composition, as described with reference to Figure 4.

[0128] The flow cell 10 can then be used for a subsequent cycle (e.g., from F back to A in FIG. 5) to generate new perfectly matched DNA sample fragments, or to amplify at least a portion of the pre-cleaved and perfectly matched DNA sample fragments (e.g., single-stranded perfectly matched sample fragments 56A, 56B).

[0129] If the flow cell 10 is used in a subsequent cycle to generate new, fully adapted DNA sample fragments, the subsequent cycle includes introducing new transposome complexes 38B into the flow path 20, thereby attaching at least some of the new transposome complexes 38B to at least some of the biotin-containing linkers 16 in the flow path 20; introducing a new DNA sample 54 and a new tagmentation buffer into the flow path 20; and repeating tagmentation, transposase enzyme 46 removal, and gap-fill ligation with the new DNA sample 54. The repeated steps may be performed in the same manner as described herein. For example, streptavidin 60 may be added along with the transposome complexes 38B to attach them to the biotin-containing linkers 16. The flow cell 10 may be used multiple times to prepare fully adapted fragments 56A, 56B from several different DNA samples. In these examples, perfectly matched fragments 56A, 56B from several different DNA samples may be stored in holding receptacle 26'' and then introduced when desired to perform amplification of all of the fragments.

[0130] When the flow cell 10 is used for amplifying at least a portion of the pre-cut and fully adapted DNA sample fragments, the method includes attaching first and second primers 55, 57 to at least a portion of the biotin-containing linker 16 in the flow path 20 (see G) and introducing the pre-cut and fully adapted DNA sample fragments 56A, 56B in single-stranded form into the flow cell 10.

[0131] Although reference is made to P5 and P7 primers, it should be understood that other sequences can be used for primers 55, 57 so long as the combination allows for the desired amplification of single-stranded, perfectly matched DNA sample fragments 56A, 56B. Primers 55, 57 contain biotin at their 5' ends so that they can be attached to biotin-containing linker 16 via streptavidin 60. Primers 55, 57 can be attached using any of the avidin / streptavidin techniques described herein for attaching transposome complexes 38B to biotinylated polymer hydrogel 30.

[0132] Once primers 55, 57 are attached, the single-stranded, perfectly matched sample fragments 56A, 56B may be transported back into the flow path 20, each seeded into recess 26 and subjected to amplification, as described with reference to FIG. 4. Sequencing may then be performed. After sequencing, a biotin-streptavidin cleavage composition can be reintroduced to remove primers 55, 57 and their attached amplicons and nascent strands. This leaves biotin-containing linkers 16 in recess 26, ready for another cycle.

[0133] In the examples shown in Figures 4 and 5, single-stranded, perfectly matched DNA sample fragments 56A, 56B can alternatively be prepared as described herein and then introduced into another type of flow cell with primers 55, 57 attached to non-biotinylated polymer hydrogel 32 in recess 26. This is a single-use flow cell; the surface is not repurposed after amplification and sequencing. In these examples, the 5'-terminal functional groups 48 of transposome complexes 38A, 38B are attached to the R A It may be any functional group that can be attached to a group.

[0134] The flow cell 10 containing the biotinylated polymer hydrogel 30 can also be used for enrichment. Enrichment allows for the isolation and analysis of a target portion of a DNA sample 54, e.g., a specific genetic variant in a given sample. In this type of analysis, a target portion or region of interest can be enriched, e.g., this serves to separate the target portion from the rest of the DNA sample 54, thereby enabling sequencing reads dedicated to the target portion. The enrichment techniques disclosed herein utilize on-flow cell hybridization and capture of tagmented DNA fragments 58, 58' corresponding to the target portion. Examples are shown in Figures 6, 7, and 8.

[0135] In each of the examples shown in Figures 6 and 8, the multiple transposome complexes can include a first transposome complex 38C that includes a first amplification domain 45C, e.g., P7, and a second transposome complex 38D that includes a second amplification domain 49D, e.g., P5. These transposome complexes 38C, 38D are shown in more detail in Figure 14C. In Figure 14C, one of each complex 38C, 38D forms a dimer, while in Figures 6 and 8, two of the same complexes 38C or 38D form a dimer.

[0136] As shown in Figure 14C, each of the first and second transposome complexes 38C, 38D includes a transposase enzyme 46 non-covalently bound to a transposon end 40C, 40D. In this example, each transposon end 40C, 40D is a double-stranded nucleic acid strand, one strand (e.g., ME) of which is part of the transferred strand 42C or 42D, and the other strand (e.g., ME') of which is part of the non-transferred strand 44C or 44D. Any of the exemplary strands of transposon end 40 (e.g., ME and ME') described herein can be used.

[0137] In the example shown in Figure 14C, transferred strand 42C comprises a 5'-end functional group 48C (in this case, biotin) that can non-covalently bind to avidin / streptavidin (designated by reference number 60 in Figure 6), a first amplification domain 45C, and a sequencing primer sequence 47C attached to one strand of transposon end 40C (located at the 3' end of transferred strand 42C). In some examples, transferred strand 42C comprises an index sequence between first amplification domain 45C and sequencing primer sequence 47C. Similar to transferred strand 42C, transferred strand 42D comprises a 5'-end functional group 48D (in this case, biotin) that can covalently bind to avidin / streptavidin, a second amplification domain 49D, and a sequencing primer sequence 47D attached to one strand (ME) of transposon end 40D (located at the 3' end of transferred strand 40D).

[0138] The first and second amplification domains 45C, 49D of transposome complexes 38C, 38D have different sequences (e.g., P7 and P5) from each other but have the same sequences as the first and second primers (shown as 55 and 57 in FIG. 6I) introduced into the biotinylated polymer hydrogel 30. The first amplification domain 45C, transposome complex 38C, and primer 55, together with the second amplification domain 49D, transposome complex 38D, and primer 57, enable amplification of DNA sample fragments 58, 58′ generated during tagmentation. Examples of suitable sequences for the first amplification domain 45C / primer 55 and the second amplification domain 49D / primer 57 include any of the examples described herein.

[0139] Although not shown, in each of the examples shown in Figures 6 and 8, it should be understood that the multiple transposome complexes could alternatively include a first transposome complex 38E including a first amplification domain 45E, e.g., P7, and a second transposome complex 38F including a second amplification domain 49F, e.g., P5. These transposome complexes 38E, 38F are shown in more detail in Figure 14D. In Figure 14D, one of each complex 38E, 38F forms a dimer, but it should be understood that two of the same complexes 38E or 38F could form a dimer.

[0140] As shown in Figure 14D, each of the first and second transposome complexes 38E, 38F includes a transposase enzyme 46 non-covalently bound to a transposon end 40E, 40F. In this example, each transposon end 40E, 40F is a double-stranded nucleic acid strand, one strand (e.g., ME) of which is part of the transferred strand 42E or 42F, and the other strand (e.g., ME') of which is part of the non-transferred strand 44E or 44F. Any of the exemplary strands of transposon ends 40 (e.g., ME and ME') described herein can be used.

[0141] In transposome complex 38E, transferred strand 42E comprises a first amplification domain 45E and a sequencing primer sequence 47E attached to one strand ME of transposon end 40E. In some examples, transferred strand 42F comprises an index sequence between first amplification domain 45E and sequencing primer sequence 47E. Strand ME of transposon end 40E is located at the 3' end of transferred strand 42E. Similar to transferred strand 42E, transferred strand 42F of transposome complex 38F comprises a second amplification domain 49F and a sequencing primer sequence 47F attached to one strand ME' of transposon end 40F. Strand ME of transposon end 40F is located at the 3' end of transferred strand 42F.

[0142] The first and second amplification domains 45E, 49F of transposome complexes 38E, 38F have different sequences (e.g., P7 and P5) from each other but identical to the first and second primers (shown as 55 and 57 in FIG. 6I) introduced into the biotinylated polymer hydrogel 30. The first amplification domain 45E, transposome complex 38E, and primer 55, together with the second amplification domain 49F, transposome complex 38F, and primer 57, enable amplification of DNA sample fragments 58, 58′ generated during tagmentation. Examples of suitable sequences are: i) for the first amplification domain 45E, the same as those described herein for the first amplification domain 45C / primer 55; and ii) for the second amplification domain 49F, the same as those described herein for the second amplification domain 49D / primer 57.

[0143] Similar to sequencing primer sequences 47C and 47D, sequencing primer sequences 47E and 47F have different sequences that each bind to a sequencing primer introduced into the flow cell after tagmentation and amplification.

[0144] Transposome complexes 38E and 38F are configured for asymmetric attachment to the flow cell surface (as shown in FIG. 11A). Thus, one of the complexes, e.g., complex 38E, includes a 3'-end group 48E for attachment to the flow cell surface, and the other of the complexes, e.g., complex 38F, includes a 5'-end group 48F for attachment to the flow cell surface. Thus, as shown in FIG. 14D, the non-transferred strand 44E of complex 38E includes a 3'-end group 48E, and the transferred strand 42F of complex 38F includes a 5'-end group 48F. The 3'-end group 48E and the 5'-end group 48F may be any functional group capable of covalently or non-covalently binding, directly or indirectly, to the surface functional groups of the polymer hydrogels 30 and 32, and thus depend on the surface functional groups of the polymer hydrogels 30 and 32. In one example, the polymer hydrogel 32 comprises azide or tetrazine surface groups, and the 3'- and 5'-terminal groups 48E and 48F each comprise a terminal alkyne (e.g., hexynyl) or an internal alkyne, where the alkyne is part of a cyclic compound (e.g., bicyclo[6.1.0]nonyne (BCN)). In another example, the biotinylated polymer hydrogel 30' resides within the recess 26 of the flow cell 10, and the 3'- and 5'-terminal groups 48E and 48F each are biotin. In these examples, additional streptavidin or avidin 60 is added to indirectly attach the biotin groups to one another, as described herein. Still other reactive pairs (e.g., R of the polymer hydrogel) can be used. A and 48) include tetrazine / TCO, amine / carboxylic acid, amine / alkyl halide, thiol / alkene, or thiol / carboxylic acid. Tagmentation involving transposome complexes 38E and 38F can be carried out in the same manner as described herein for transposome complexes 38C and 38D.

[0145] Referring back to Figure 6, in this exemplary method, generating perfectly adapted DNA sample fragments (e.g., 56C, 56D shown in Figure 6D) includes introducing a DNA sample 54 and a tagmentation buffer into the flow cell 10 (see Figure 6C), performing tagmentation of the DNA sample 54 using multiple transposome complexes 38C, 38D (see Figure 6C), removing the transposase enzyme 46 (not shown) from each of the multiple transposome complexes 38C, 38D, and performing an extension reaction (see Figure 6C). Introduction of the DNA sample 54, tagmentation, and removal of the transposase enzyme 46 can be performed as described herein with reference to Figure 4.

[0146] If SDS or other chaotropic agents are used to remove the transposase, a wash solution can be flushed through the flow path before initiating the extension reaction to remove the chaotropic agent, which may interfere with downstream enzymatic activity.

[0147] To initiate the extension reaction, an extension amplification mix is ​​introduced into the flow cell 10. An example of an extension amplification mix includes nucleotides, a recombinase, a polymerase, and accessory proteins. The extension amplification mix may also include a buffer (e.g., Tris), enzymes, stabilizers, metal cofactors, surfactants (e.g., TWEEN polysorbate), and / or cosolvents (e.g., glycerol, dimethylformamide, etc.). The ExAmp reagent available from Illumina Inc. is an example of a suitable extension amplification mix.

[0148] The flow cell 10 can be at a maximum temperature of 60° C. (eg, about 38° C.) when the extension amplification mix is ​​introduced.

[0149] At the start of the extension reaction, non-transferred strands 44C, 44D are dehybridized. Additional sequences (adapters) are added to the 3' ends of the partially adapted fragments (fragments 58, 58') by an extension reaction using an extension amplification mix. The extension reaction involves the template-dependent addition of nucleotides from the 3' ends of DNA fragments 58, 58' using the respective transferred strands 42C, 42D as templates. This extension is represented by the arrows in Figure 6C. Thus, DNA fragment 58 is extended along transferred strand 42D to generate sequencing primer sequence 47D and the complementary section of second amplification domain 49D attached to DNA fragment 58, and DNA fragment 58' is extended along transferred strand 42C to generate sequencing primer sequence 47C and the complementary section of first amplification domain 45C attached to DNA fragment 58'. The sequences resulting from the extension reaction perfectly match the partially matched fragments 58, 58' (i.e., tagmented fragments that have not been ligated, extended, etc.). At least some of the perfectly matched fragments generated along transposome complex 38D contain a first amplification domain 45C (e.g., P7) at one end and the complement of a second amplification domain 49D (e.g., P5') at the other end. At least some of the perfectly matched fragments generated along transposome complex 38C contain a second amplification domain 49D (e.g., P5) at one end and the complement of a first amplification domain 45C (e.g., P7') at the other end.

[0150] The perfectly matched DNA fragments are then cleaved by introducing a suitable cleaving agent at cleavage site 52. Cleavage can be carried out as described herein with reference to Figure 4. The double-stranded perfectly matched DNA fragments are released from the flow cell surface.

[0151] The method shown in FIG. 6 then includes generating an enriched sample by denaturing the perfectly matched DNA sample fragments to generate single-stranded perfectly matched DNA sample fragments 56C, 56D (see D), where a portion of the single-stranded perfectly matched DNA sample fragments 56C, 56D include the targeted region (i.e., the region of interest for analysis); transferring the single-stranded perfectly matched DNA sample fragments 56C, 56D to a concentration receptacle 26'''; and introducing a biotinylated capture probe 62 into the concentration receptacle 26''', whereby a portion of the single-stranded perfectly matched DNA sample fragments 56C, 56D having the targeted region hybridize to the biotinylated capture probe 62, respectively, to form an enriched complex 64 (shown in D of FIG. 6), and another portion of the single-stranded perfectly matched DNA sample fragments 56 not including the targeted region remain unattached. The concentration receptacle 26''' may be a separate compartment on the flow cell 10 or may be separate from the flow cell 10, such as in a cartridge on an instrument that receives the flow cell 10.

[0152] Biotinylated capture probe 62 comprises i) one or more single-stranded deoxyribonucleic acid sequences complementary to a targeted region, and ii) a terminal biotin for subsequent attachment to avidin / streptavidin 60 on the flow cell surface. In its simplest form, biotinylated capture probe 62 comprises a single-stranded sequence complementary to a targeted region of a DNA sample, with a biotin at its end.

[0153] As shown in Figure 6, one example of a biotinylated capture probe 62 is a polynucleotide bottlebrush polymer structure. This polynucleotide bottlebrush polymer structure is described in International Publication No. 2022 / 220748, which is incorporated herein by reference in its entirety. Briefly, a polynucleotide bottlebrush polymer comprises a substantially linear polynucleotide backbone comprising a sequence of nucleotides linked to each other by phosphodiester bonds and polynucleotide side chains linked to the nucleobases of the nucleotides of the polynucleotide backbone by one or more covalent bonds or one or more non-covalent bonds. The sequence of the side chains may be complementary to the target region, and thus the side chains may be used as probes to hybridize only single-stranded, perfectly matched DNA sample fragments 56C, 56D containing the target region. In some examples, the side chains comprise coordinated complementary sequences to enhance enrichment strength. In other examples, the side chains may be interlocking probes. In still other examples, the side chains may be conjugated to peptides rather than the linear polynucleotide backbone.

[0154] The enrichment receptacle 26''' is heated, and the biotinylated capture probe 62 (e.g., one or more of its side chains) hybridizes to a target region of a portion of the single-stranded, perfectly matched DNA sample fragment 56C, 56D, thereby forming an enriched complex 64.

[0155] Although not shown in FIG. 6 , after cleaving the perfectly matched DNA sample fragments 56, 56C, 56D, the biotin-containing linkers 16 remain attached to the surface within the recesses 26. The 5′-terminal biotin 48 also remains attached via the streptavidin 60. Thus, after cleavage and prior to amplification of the enriched sample in the flow cell 10, the method further includes removing the streptavidin 60 from the biotin-containing linkers 16. Removal of the streptavidin 60 can be performed as described in FIG. 4 . The resulting surface resembles F in each of FIGS. 4 and 5 .

[0156] The method shown in FIG. 6 then includes replenishing streptavidin 60 into the flow channel 20 (see FIG. 6E), transferring the enriched sample (from the enrichment receptacle 26″) to the flow channel 20 containing the replenishing streptavidin 60, whereby enriched complexes 64 attach to the biotin-containing linkers 16 (via the biotin on the probes 62) and the single-stranded, perfectly matched DNA sample fragments 56 that do not contain the targeted region remain unattached, introducing a wash solution into the flow channel 20 to remove the single-stranded, perfectly matched DNA sample fragments 56 that do not contain the targeted region, releasing the single-stranded, perfectly matched DNA sample fragments 56C, 56D that have the targeted region from the biotinylated capture probes 62, and transferring the single-stranded, perfectly matched DNA sample fragments 56C, 56D that have the targeted region to the holding receptacle 26″ (see FIG. 6G).

[0157] In Figure 6F, the biotin of the enriched complex 64 attaches to the surface-bound avidin / streptavidin 60, while the uncomplexed fragments 56 remain free in solution. These free and uncomplexed fragments 56 are removed from the channel 20 by flowing a wash solution through the channel 20. The enriched complex 64, and thus the fragments 56C, 56D containing the target region, remain within the channel 20. By removing the fragments 56 that do not contain the target region, the remaining sample is enriched.

[0158] The bound single-stranded, perfectly matched DNA sample fragments 56C, 56D (with the targeted region) can then be released from the biotinylated capture probe 62 and transferred to the holding receptacle 26'' (see Figure 6G). Release involves dehybridization from the probe 62, which can be performed in the presence of NaOH or Tris-HCl and heat. The probe 62 remains attached to the surface-bound streptavidin 60 while the single-stranded, perfectly matched DNA sample fragments 56C, 56D are removed and transferred to the receptacle 26''.

[0159] While fragments 56C, 56D are within holding receptacle 26'', the method further includes removing streptavidin 60 from biotin-containing linker 16 within flow channel 20 (see FIG. 6H) and attaching first and second primers 55, 57 to at least a portion of biotin-containing linker 16 within flow channel 20 (see FIG. 6I). Both of these processes may be performed as described herein with reference to FIG. 4. It should be understood that primers 55, 57 are biotinylated for attachment to linker-bound avidin / streptavidin 60.

[0160] Fragments 56C, 56D are then transported from holding receptacle 26'' back to flow channel 20 where they hybridize to one of primers 55, 57 and undergo amplification as described herein. Two amplicons of one of the single-stranded perfectly matched DNA sample fragments 56C, 56D are shown in Figure 6J.

[0161] Referring now to Figure 7, another example of enrichment is shown, which may be desirable for blood, saliva, or small cancer panels.

[0162] In this example, biotinylated polymer hydrogel 30 (within biotin-containing linker 16) resides within recess 16 of flow cell 10 (see FIG. 7A). In this example, multiple transposome complexes 38A are each of a single type, comprising transposon end 40 in which a portion of transferred strand 42 is hybridized to non-transferred strand 44. Transposome complex 38A is as described with reference to FIG. 4 and can be immobilized on flow cell 10 using avidin / streptavidin 60, as described herein.

[0163] In this example, tagmentation forms partially adapted DNA sample fragments 58, 58', such that a gap G (shown as C in FIG. 7 ) exists between the 3' end of each DNA fragment strand 58, 58' and the 5' end of the corresponding non-transferred strand 44. Formation of these fragments 58, 58' involves introducing a DNA sample 54 and tagmentation buffer into the flow path 20, performing tagmentation of the DNA sample 54 using multiple transposome complexes 38A, and removing the transposase enzyme 46 of each of the multiple transposome complexes 38A. The resulting fragments are partially adapted to the first amplification domain 45 (e.g., P7) of the transferred strand 42 of the transposome complex 38A.

[0164] Without performing gap-fill ligation, the partially adapted fragments (with the non-transferred strand 42 still attached) can be cleaved at the cleavage site 52 using a cleavage agent disclosed herein. The method then includes denaturing the partially adapted DNA sample fragments with respect to one another and removing the non-transferred strand 44 to generate single-stranded partially adapted DNA sample fragments 68A, 68B (shown in FIG. 7D), where a portion of the single-stranded partially adapted DNA sample fragment 68A includes a targeted region (shown as an ROI (region of interest) in FIG. 7D), and transferring the single-stranded partially adapted DNA sample fragments 68A, 68B to a concentration receptacle 26''', where the concentration receptacle 26''' includes a second amplification domain 49 (e.g., P5) and a surface-bound adaptor 66 having a region complementary to the targeted region. and transferring (see D) a wash solution into the concentration receptacle 26''' to remove the single-stranded, partially adapted DNA sample fragments 68B that do not include the targeting region ROI, thereby hybridizing a portion of the single-stranded, partially adapted DNA sample fragments 68A that have the targeting region ROI to the surface-bound adapters 66, and leaving other portions of the single-stranded, partially adapted DNA sample fragments 68B that do not include the targeting region ROI unattached. The method further includes introducing a wash solution into the concentration receptacle 26''' to remove the single-stranded, partially adapted DNA sample fragments 68B that do not include the targeting region ROI, and performing an extension reaction along the surface-bound adapters 66, thereby generating fully adapted DNA sample fragments (see bottom of D). The concentration receptacle 26''' may be on the flow cell 10, as described herein, or may be separate from the flow cell, for example, in a cartridge.

[0165] In this example, the second amplification domain 49 has a sequence identical to the primer 57 (e.g., P5) introduced into the flow cell 10, and the resulting perfectly matched fragments 56E, 56F contain the complement 45' of the first amplification domain 45 (e.g., P7) of the transposome complex 38A. Thus, the perfectly matched fragments 56E, 56F shown at the bottom of D contain 45' (e.g., P7'), which can hybridize to the flow cell primer 55 (e.g., P7) to initiate amplification. In the concentration receptacle 26''', an extension reaction can be carried out as described herein. The resulting perfectly matched fragments 56E, 56F can then be cleaved from the receptacle 26'".

[0166] While fragments 56E, 56F are in concentration receptacle 26''', the method further includes removing streptavidin 60 from biotin-containing linker 16 in flow channel 20 and attaching first and second primers 55, 57 (e.g., P7, P5) to at least a portion of biotin-containing linker 16 in flow channel 20 (see FIG. 7F). Both of these processes may be performed as described herein with reference to FIG. 4. In particular, streptavidin 60 is first removed to also remove 5'-terminal biotin remaining after cleavage of the partially adapted DNA fragments. Streptavidin 60 is then replenished prior to attachment of primers 55, 57 (see FIG. 7E). It should be understood that primers 55, 57 are biotinylated for attachment to linker-bound avidin / streptavidin 60.

[0167] After concentration (D in Figure 7) and attachment of primers 55, 57 (F in Figure 7), fragments 56E, 56F are then transported from concentration receptacle 26''' back to flow path 20, where they hybridize to one of primers P7, P5 and undergo amplification as described herein.

[0168] The exemplary method shown in FIG. 8 includes capturing a plurality of biotinylated dDpn1 70 on a plurality of biotin-containing linkers 16 attached to a surface within a flow channel 20 of a flow cell 10 (FIG. 8A and B), introducing a DNA sample into the flow cell 10, whereby methylated bacterial DNA 72 in the DNA sample is captured by the biotinylated dDpn1 70 (FIG. 8C), introducing a wash solution into the flow channel 20 to remove uncaptured DNA sample from the flow channel (not shown), and then cleaving the biotinylated dDpn1 70 so that the biotin-containing linkers 16 remain attached to the surface. 8C, 8D), releasing the methylated bacterial DNA 72 from the biotin-containing linker 16 (FIG. 8E), transferring the released methylated bacterial DNA 72 to the holding receptacle 26″ (FIG. 8D), and while the released methylated bacterial DNA 72 is in the holding receptacle 26″, replenishing streptavidin 60 from the biotin-containing linker 16 (replacing or removing and replacing the streptavidin used in A-C), and introducing the plurality of biotinylated transposome complexes 38C, 38D into the flow channel 20, thereby transferring the plurality of biotinylated transposome complexes 38C, 38D. The method includes attaching methylated transposome complexes 38C, 38D to a portion of the biotin-containing linker 16 (FIG. 8F), introducing multiple biotinylated primers 55, 57 into the flow channel 20, thereby attaching multiple biotinylated primers 55, 57 to another portion of the biotin-containing linker 16, and transporting the released methylated bacterial DNA 72 back to the flow channel 20 containing the transposome complexes 38C, 38D and the biotinylated primers 55, 57 for tagmentation and amplification (FIG. 8G and H).

[0169] Biotinylated dDpn1 70 is attached to the flow cell surface via streptavidin 60 and a biotin-containing linker 16. When a DNA sample is introduced into the flow cell 10, methylated bacterial DNA 72 within the DNA sample is captured by the biotinylated dDpn1 70.

[0170] After capture of the methylated bacterial DNA 72, any of the wash solutions disclosed herein can be used to remove uncaptured DNA sample from the flow cell 10.

[0171] Once the uncaptured DNA sample and washing solution are removed, the methylated bacterial DNA is then transported to the chromatin containing the Mg 2+ Biotinylated dDpn1 70 can be released from the methylated bacterial DNA 72 using a solution containing ATP, proteinase K, or SDS. Proteinase K or SDS will likely release the biotinylated dDpn1 70 and the methylated bacterial DNA 72. In the latter case, the biotinylated dDpn1 70 is separated from the methylated bacterial DNA 72.

[0172] In one particular example, Mg was used to release trapped methylated bacterial DNA. 2+ is used. In this example, after the methylated bacterial DNA 72 is released, it is transferred to a retention receptacle 26'' while the biotinylated dDpn1 70 is removed. In one example, the biotinylated dDpn1 70 is removed with streptavidin 60. In this example, a biotin-streptavidin cleavage composition can be introduced into the flow cell 10, which disrupts the biotin-streptavidin interaction, thus releasing the biotinylated dDpn1 70 from the streptavidin 60 and releasing the streptavidin from the biotin-containing linker 16. In another example, the biotinylated dDpn1 70 can include another cleavable group, and a cleavage agent for that group can be used to remove the biotinylated dDpn1 70. By way of example, the cleavage agent can be an enzymatic cleavage agent or an acid. Proteinase K or SDS can be used to remove biotinylated dDpn1 70.

[0173] Recruitment of streptavidin 60, introduction of transposome complexes 38C, 38D and biotinylated primers 55, 57, tagmentation, and amplification can be performed as described herein.

[0174] Photoactivated Flow Cell Surface Other examples of flow cells 10 include visible light-responsive members 18, which allow at least a portion of the flow cell surface to be selectively activated for a desired reaction at a desired time. These flow cells 10 can be used in methods that include introducing a tagmentation entity (e.g., a transposome complex 38) having a first visible light-responsive member 18A attached to the flow cell 10 having a second visible light-responsive member 18B attached thereto, and exposing a predetermined area of ​​the flow cell 10 to visible light while the tagmentation entity is present within the flow cell 10, thereby binding the first and second visible light-responsive members 18A, 18B and attaching the tagmentation entity to the flow cell 10 at the predetermined area. Some exemplary methods are shown in Figures 9A-9D and 10A-10C.

[0175] In these examples, tagmentation entity 74 can be any of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F described herein. The process (e.g., gap-fill ligation, extension reaction, etc.) performed to generate perfectly matched DNA fragment 56 depends on the type of transposome complex 38A, 38B, 38C and 38D, or 38E and 38F used.

[0176] Also, in these examples, visible light-responsive members 18A and 18B may be any example of the visible light-responsive member 18 described herein with reference to Figures 3A-3H. It should be understood that visible light-responsive member 18A may be used in place of the 5'-terminal functional group 48 in conjugate 38A or 38B. Visible light-responsive member 18A may be used in place of the 5'-terminal functional groups 48C and 48D in conjugates 38C and 38D, respectively, or visible light-responsive member 18A may be used in place of the 5'-terminal functional group 48F of conjugate 38F and the 3'-terminal functional group 48E of conjugate 38E.

[0177] 9A-9D, the flow cell 10 is similar to that shown in FIG. 2A (although the base support 22 is not shown) and includes a visible light responsive member 18B attached to a polymer hydrogel 32 within the recesses 26. In this example, the flow cell 10 has the same surface chemistry in each of the recesses 26. Alternatively, the flow cell 10 shown in FIG. 2B could be used, with the visible light responsive member 18B positioned along the lanes 36. Although not shown, each flow cell recess 26 also has primers 55, 57 attached to the polymer hydrogel 32.

[0178] When tagmentation entity 74 is introduced into flow channel 20, specific regions of flow cell 10 (e.g., region 76A in FIG. 9A , region 76B in FIG. 9D ) are exposed to visible light (from light source 78), and the exposed visible light-responsive members 18A, 18B undergo a coupling reaction, attaching tagmentation entity 74 within recess 26. Any regions of flow cell 10 not exposed to visible light (e.g., 76B, 76C in FIG. 9A ) do not attach tagmentation entity 74 and can therefore be activated for subsequently introduced samples. This allows different DNA samples to be attached within different regions 76A, 76B, 76C of a single flow channel 20, thus enabling spatial indexing to be used for sample identification. Data generated during sequencing can be demultiplexed using analysis of the different regions 76A, 76B, 76C.

[0179] 10A-10C, the flow cell 10 is similar to that shown in FIG. 2A (except that the base support 22 is not shown) and includes a visible light responsive member 18B attached to the polymer hydrogel 32 in one of the recesses 26. Alternatively, the flow cell 10 shown in FIG. 2B can be used, with the visible light responsive member 18B positioned along the lane 36.

[0180] 9A, tagmented entity 74 includes transposome complexes 38E and 38F bearing visible light-responsive member 18A at the 5' end of transferred strand 49F and the 3' end of non-transferred strand 44E, instead of biotin or another hydrogel-linking functional group. Thus, transposome complexes 38E and 38F can be selectively attached to predetermined regions 76A, 76B, 76C of the flow cell surface that are exposed to visible light when transposome complexes 38E and 38F are introduced.

[0181] 9A, tagmented entity 74 is introduced into flow path 20. Tagmented entity 74 may be introduced into a suitable liquid (water, buffer, etc.) through an inlet. In one example, tagmented entity 74 may be transported into flow path 20 using a pump of a sequencing instrument in which flow cell 10 is operably disposed.

[0182] In the example shown in FIG. 9A, when tagmentation entity 74 is introduced into flow channel 20, a specific region 76A of flow cell 10 is exposed to visible light. Any suitable visible light source 78 can be used to illuminate the desired regions 76A, 76B, and 76C of flow cell 10. Visible light source 78 may be a laser, a light-emitting diode, an incandescent bulb, or the like. Visible light source 78 may be part of the sequencing instrument or a separate automated or manual light source. The wavelength of the emitted light is within the visible range, i.e., approximately 400 nm to approximately 700 nm. The exposed visible light-responsive elements 18A and 18B are activated and can undergo a coupling reaction to attach tagmentation entity 74 to a portion of recess 26 or lane 36. In FIG. 9A, transposome complexes 38E and 38F are asymmetrically attached (via their 3' and 5' ends, respectively).

[0183] The photoresponsive members 18A, 18B are not active unless exposed to visible light, and therefore, the photoresponsive members 18A, 18B present in any regions 76B, 76C of the flow cell 10 that are not exposed to visible light will not attach to the tagmented entity 74. In Figure 9A, the visible light source 78 is not used in regions 76B, 76C, and therefore, the photoresponsive members 18A, 18B in these regions 76B, 76C are not activated. Therefore, these regions 76B, 76C are available for subsequently introduced samples.

[0184] After binding of tagmented entities 74 in desired regions 76A, the remaining unbound tagmented entities 74 are removed from flow channel 20 using the example wash solutions described herein.

[0185] In the example shown in Figures 9A-9D, the attached tagmentation entity 74 (e.g., transposome complexes 38E, 38F) may undergo tagmentation (Figure 9B) and transposase 46 inactivation (Figure 9C) before any additional tagmentation entities 74 are introduced (Figure 9D).

[0186] 9B, a first DNA sample 54 is introduced into channel 20. While DNA sample 54 is in channel 20, the temperature is increased to initiate tagmentation. Because transposome complexes 38E, 38F are present only in region 76A, tagmentation occurs only in region 76A. Tagmentation can be performed as described herein.

[0187] 9C, inactivation of transposase 46 is performed. Inactivation of transposase 46 involves removing transposase 46 from each transpososome complex 38E, 38F using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or a proteinase, or another chaotropic agent, or by heating the flow cell to approximately 60° C.). This renders transpososome complex 38E, 38F (or other complexes that may be used as tagmented entities 74) inactive for association with subsequently introduced DNA sample 54.

[0188] In each zone / region 76A, 76B, 76C, tagmentation and transposase 46 inactivation may be performed before performing appropriate reactions to generate fully adapted DNA sample fragments, and ultimately single-stranded fully adapted DNA sample fragments 56 (not shown in Figures 9A-9D). Figure 9D illustrates the introduction of separate batches of tagmentation entities 74 (e.g., transposome complexes 38E, 38F). Because tagmentation entities 74 are introduced sequentially and are attached only to photoactivated regions 76A, 76B, or 76C, tagmentation entities 74 in a particular batch (in this example, any of the complexes 38 described herein) may contain index sequences 51 in the transferred strand 42 and / or in the adaptors 50 introduced into the flow cell. This allows for canonical indexing in addition to spatial indexing.

[0189] Once all of the desired regions 76A, 76B, 76C have the desired tagmentation entity 74 attached, the desired DNA sample 54 has been tagmented, and the transposase enzyme 46 has been removed, a gap-fill ligation or extension reaction can be used to generate perfectly matched DNA sample fragments, depending on the transposome complex 38A, or 38B, or 38C and 38D, or 38E and 38F. These processes can each be carried out as described herein.

[0190] As described above, each well 26 may be configured with primers 55, 57 for amplification and cluster generation of perfectly matched DNA sample fragments 56. These processes may be carried out as described herein.

[0191] If desired, denaturation may be performed after cleavage of the forward and / or reverse fully matched DNA sample fragments. If desired for a particular workflow, the cleaved single-stranded fully matched DNA sample fragments 56 may be transferred from the flow cell 10 to, for example, another zone on the flow cell 10 for concentration as described herein.

[0192] After amplification and cluster generation, sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by the introduction of an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0193] The examples shown in Figures 10A-10C illustrate different ways in which a visible light-activated surface can be used. Flow cell 10 is divided into different regions 80, 82, 84, etc., some of which are activated by visible light. In each of these figures, tagmented entity 74 is some example of transposome complex 38A or 38B, or 38C and 38D, or 38E and 38F, as disclosed herein.

[0194] 10A, different regions of flow cell channel 20 include tagmentation region 80, denaturation region 82, and clustered region 84. In this example, some or all of recesses 26 or some or all of lanes 36 may be functionalized with visible light responsive member 18B. Any region that exhibits binding of a tagmentation entity (e.g., transposome complex 38 or primers 55, 57) may include visible light responsive member 18B. In the example shown in FIG. 10A, both tagmentation region 80 and clustered region 84 include visible light responsive member 18B.

[0195] If transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F (including visible light-responsive element 18A) are to be attached to zone 80, a fluid containing the desired transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F may be introduced into flow cell 10, and tagmentation zone 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in FIG. 10A ). Visible light-responsive elements 18A, 18B exposed to visible light undergo a coupling reaction to attach transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F within recess 26 or within a portion of lane 36 within tagmentation zone 80. A DNA sample 54 (not shown in FIG. 10A ) may then be introduced for tagmentation and any other processes described herein to generate fully matched DNA fragments (not shown in FIG. 10A ).

[0196] When primers 55, 57 are attached to area 84, a fluid containing primers 55, 57 (having visible light responsive elements 18B at their 5' ends) may be introduced into flow cell 10, and clustered area 84 may be exposed to visible light. Visible light responsive elements 18A, 18B exposed to visible light undergo a coupling reaction to attach primers 55, 57 to portions of lanes 36 within recesses 26 or clustered area 84.

[0197] It should be understood that the attachment of the transposome complex 38 and the attachment of the primers 55, 57 can be performed in any order, as long as the attachment of the transposome complex 38 is performed before the introduction of the DNA sample 54.

[0198] Once perfectly matched fragments are generated in the tagmentation zone 80 and primers 55, 57 are attached in the clustering zone 84, a cleavage agent may be introduced into the flow path 20 to cleave the perfectly matched fragments. The flow may be directed to a denaturation zone 82 where the perfectly matched fragments are denatured to form single-stranded perfectly matched fragments (e.g., 56), which then migrate to the clustering zone 84 where they are seeded and amplified.

[0199] In FIG. 10B, the different regions of the flow cell channel 20 include a tagmentation region 80, a denaturation region 82, a concentration region 86, and a clustering region 84.

[0200] To attach transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F (which include visible light-responsive element 18A), a fluid containing transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F (which include visible light-responsive element 18A) may be introduced into flow cell 10, and tagmentation zone 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in FIG. 10B ). Visible light-responsive elements 18A, 18B exposed to visible light undergo a coupling reaction to attach transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F within recess 26 or within a portion of lane 36 (not shown in FIG. 10B ) within tagmentation zone 80. The DNA sample 54 (not shown in FIG. 10B) may then be subjected to tagmentation and any other processes described herein to generate perfectly matched DNA fragments (also not shown in FIG. 10B).

[0201] When probe 62' (similar to probe 62 except that visible light responsive element 18B is located at the end instead of biotin) is attached, a fluid containing probe 62' may be introduced into flow cell 10 and enrichment zone 86 may be exposed to visible light. Visible light responsive elements 18A, 18B exposed to visible light undergo a coupling reaction to attach probe 62' to a portion of lane 36 within well 26 or enrichment zone 86.

[0202] After perfectly matched fragments are generated in tagmentation zone 80 and probe 62' is attached to enrichment zone 86, but before primers 55, 57 are attached to clustering zone 84, a cleaving agent may be introduced into flow path 20 to cleave the perfectly matched fragments. Flow may be directed to denaturation zone 82, where the perfectly matched fragments are exposed to heat and denatured to form single-stranded perfectly matched fragments (e.g., 56A, 56B, etc.), which then migrate to enrichment zone 86, where fragments containing the target region hybridize to probe 62'. A wash solution may be introduced to wash away any fragments that do not contain the target region and therefore are not attached in enrichment zone 86.

[0203] Primers 55, 57 may be introduced into flow cell channel 20 while fragments containing the target region are hybridized to probe 62'. A fluid containing primers 55, 57 (having visible light responsive members 18B attached to their 5' ends) may be introduced into flow cell 10, and clustered zones 84 may be exposed to visible light. Visible light responsive members 18A, 18B exposed to visible light from light source 78 undergo a coupling reaction to attach primers 55, 57 to portions of lanes 36 within recesses 26 or clustered zones 84.

[0204] Once primers 55, 57 are attached, fragments containing the target region can be dehybridized from probe 62' and transported to clustering zone 84 where the fragments are seeded and amplified.

[0205] In Figure 10C, the different zones of flow cell channel 20 include tagmentation zone 80, denaturation zone 82, amplicon hybridization and extension zone 88, and clustering region 84. In the example shown in Figure 10C, transposome complexes 38A or 38C and 38D, or 38E and 38F can be used.

[0206] To attach transposome complexes 38A, 38C and 38D, or 38E and 38F (which include visible light-responsive element 18A), a fluid containing transposome complexes 38A, 38C and 38D, or 38E and 38F (which include visible light-responsive element 18A) may be introduced into flow cell 10, and tagmentation zone 80 may be exposed to visible light using any of the light sources 78 described herein (not shown in FIG. 10C ). Visible light-responsive elements 18A, 18B exposed to visible light undergo a coupling reaction to attach transposome complexes 38A, 38C and 38D, or 38E and 38F within recess 26 or within a portion of lane 36 within tagmentation zone 80. DNA sample 54 may then be introduced for tagmentation and any other processes described herein to generate fully matched DNA fragments (e.g., 58, 58′).

[0207] The amplicon hybridization and extension zone 88 is a zone where partially matched DNA fragments can be hybridized and extended to introduce suitable adapters for amplification. Specific sequences 90 are introduced onto the surface of the amplicon hybridization and extension zone 88. These sequences 90 have a portion that can hybridize to the partially matched fragments, a portion that is the complement of the adapter to be added, and a light-responsive element 18A at their 5' ends. A fluid containing the sequences 90 may be introduced into the flow cell 10, and the amplicon hybridization and extension zone 88 may be exposed to visible light. The visible light-responsive elements 18A, 18B undergo a coupling reaction to attach the sequences 90 to the recesses 26 or portions of the lanes 36 within the amplicon hybridization and extension zone 88.

[0208] After the partially matched fragments are generated in the tagmentation zone 80 and the sequence 90 is attached to the amplicon hybridization and extension zone 88, but before the primers 55, 57 are attached to the clustering zone 84, a cleaving agent may be introduced into the flow path 20 to cleave the partially matched fragments. The flow may be directed to the denaturation zone 82, where the partially matched fragments are heated and denatured to form single strands, and then move to the amplicon hybridization and extension zone 88, where the single stranded partially matched fragments are hybridized to the sequence 90. An extension mix may be introduced to add adapters and extend the partially matched fragments into fully matched fragments.

[0209] Primers 55, 57 may be introduced into flow cell channel 20 while perfectly matched fragments hybridize to sequence 90. A fluid containing primers 55, 57 (having visible light responsive elements 18A at their 5' ends) may be introduced into flow cell 10, and clustered area 84 may be exposed to visible light. The exposed visible light responsive elements 18A, 18B undergo a coupling reaction to attach primers 55, 57 to a portion of lane 36 within recess 26 or clustered area 84.

[0210] Once primers 55, 57 are attached, perfectly matched fragments can be dehybridized from sequence 90 and transferred to clustered region 84 where they are seeded and amplified.

[0211] The example shown in Figures 9A-9C allows for at least spatial separation of DNA samples (thus using a surface as an indexing strategy), and the example shown in Figures 10A-10C shows a series of workflow steps that can be performed along a single flow path 20 (e.g., tagmentation in one region / zone, enrichment in another region / zone, etc.).

[0212] Activation of the flow cell surface with a protective coating 11A-11D illustrate selective activation of flow cell surface chemistry to enable spatial indexing. The example shown in FIGS. 11A-11D utilizes a removable coating 92 for selective exposure of surface-bound transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F. In this example, any of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can be used, and transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can include biotin or another suitable linking functional group attached to polymer hydrogels 30 or 32 present within recesses 26. For ease of illustration, transposome complexes 38E and 38F are shown in FIGS. 11A-11D.

[0213] The flow cell 10 is similar to that shown in FIG. 2A (although the base support 22 is not shown) and contains transposome complexes 38E, 38F attached to polymer hydrogels 30, 32 within recesses 26. In this example, the flow cell 10 has identical surface chemistry in each of the recesses 26. Alternatively, the flow cell 10 shown in FIG. 2B may be used, with transposome complexes 38E, 38F arranged along the lane 36. Although not shown, each flow cell recess 26 also has primers 55, 57 attached to the polymer hydrogels 30, 32.

[0214] The removable coating 92 overlaps the recesses 26 (and any surface chemistry therein) and the interstitial regions 34. The removable coating 92 can be any material that melts, disintegrates, softens, solubilizes, or permeabilizes upon exposure to a predetermined stimulus (e.g., light, heat, or pH change).

[0215] The light-responsive removable coating 92 is made of a photocleavable material.

[0216] In some examples, the photoremovable coating is a hydrophilic polymer crosslinked with a photocleavable crosslinker, an acid-labile crosslinker, and / or a thermally labile crosslinker. In one particular example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer, and the photocleavable crosslinker is a coumarin or o-nitrobenzyl moiety. The coumarin or o-nitrobenzyl moiety can be covalently conjugated to the poly(ethylene glycol) of the polyvinyl alcohol / polyethylene glycol graft copolymer. The coumarin or o-nitrobenzyl is cleavable upon exposure to ultraviolet (UV) light (100 nm to 400 nm) or blue light (450 nm to 495 nm), which results in a decrease in the crosslink density of the coating. Thus, upon exposure, the cleaved polymer coating becomes hydrophilic and can be washed with an aqueous solution. In another example, the hydrophilic polymer is a polyvinyl alcohol / polyethylene glycol graft copolymer, and the photocleavable crosslinker is an acid-labile crosslinker. In this example, the acid-labile crosslinker is an acetal moiety. With acid-labile crosslinkers, acid species can be generated upon exposure to UV light in the presence of a photoacid generator (PAG), which changes the pH and cleaves the crosslinker, thus making the polymer coating more soluble (and easily removable by rinsing).

[0217] In another example, the photoremovable coating is a hydrophilic polymer capped with photocleavable hydrophobic or acid-labile groups. Photocleavable hydrophobic or acid-labile groups are protecting groups on polymer side chains that make the polymer more hydrophobic. These examples undergo a hydrophobic-to-hydrophilic phase transition upon exposure to light. In an example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with photocleavable hydrophobic groups such as coumarin or o-nitrobenzyl moieties. These photocleavable groups are generally hydrophobic, preventing the coating 92 from being removed and washed away by aqueous solutions. Upon exposure to UV or visible light, these hydrophobic groups are cleaved, returning the removable coating 92 to its hydrophilic form. In another example, the hydrophilic polymer is polymethacrylic acid, polyphenol, polyvinyl alcohol, or polyvinyl alcohol / polyethylene glycol graft copolymer, which is functionalized with acid-labile groups. Acid species can be generated upon exposure to UV light in the presence of a photoacid generator (PAG), which cleaves acid-labile groups. In one example, cleavage of the tert-butyl carbonate group results in a hydrophilic polyphenol coating that is washable and removable by aqueous solutions.

[0218] In yet another example, the photoremovable coating is a thermoresponsive polymer and a photothermal additive (or photothermal filler). The thermoresponsive polymer may be selected from the group consisting of polylactic acid, poly(lactic acid-co-glycolic acid), polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. The photothermal additive or photothermal filler contained in the composition may be a nano-sized or any micro-sized structure that absorbs light (e.g., photon) energy within a specific wavelength range and converts the absorbed energy into heat. The photothermal filler (or photothermal additive) may be selected from the group consisting of gold nanoparticles, silver nanoparticles, iron oxide nanoparticles, polypyrrole particles, graphene sheets, carbon nanotubes, carbon nanodots, black phosphorus particles, azobenzene particles, and combinations thereof. Upon exposure to UV or visible light, the energy absorbed by the photothermal additive is converted to heat, which induces a phase transition in the polymer matrix (due to the presence of the thermoresponsive polymer). This phase transition softens or dissolves the photoremovable coating. The softened or dissolved coating can then be removed using an aqueous solvent.

[0219] Still other photoremovable coatings are light and pH responsive. With these coatings, exposure to light induces proton release. Examples of these photoremovable coatings include 2-naphthol-6,8-disulfonic acid or 1,2-naphthoquinone-2-diazide-5-sulfonic acid.

[0220] The thermally removable coating is made of a thermally responsive material. For example, the thermally responsive material may be a polymer, wax, or myristic acid that melts upon reaching a specific temperature. As another example, the thermally responsive material may be a polymer such as poly(acrylamide-co-acrylonitrile) that transitions from a hydrophobic state to a hydrophilic state upon reaching a specific temperature, such as the UCST (upper critical solution temperature). As yet another example, the thermally responsive material may be a polymer such as poly(N-isopropylacrylamide) or PNIPAAm that transitions from a hydrophilic state to a hydrophobic state upon reaching a specific temperature, such as the LCST (lower critical solution temperature), which has a transition temperature of approximately 32°C to 44°C. In certain examples, the thermally removable coating may comprise a polymer selected from the group consisting of polylactic acid, poly(lactic acid-co-glycolic acid), polycaprolactone, agarose, wax, poly(acrylamide-co-acrylonitrile), poly(N-isopropylacrylamide), cyclodextrin, polyethylene glycol homopolymer, polyethylene glycol graft copolymer, polyethylene block copolymer, and combinations thereof. Another suitable thermally responsive material is composed of a hydrophilic polymer crosslinked with a thermally labile crosslinker. An example of a thermally labile crosslinker is disuccinimidyl adipate (DSA). DSA is a homobifunctional crosslinker with two NHS ester groups. The NHS ester reacts with primary amines to form stable amide bonds. DSA reacts with primary amines to generate covalent bonds via amide bond formation. DSA contains a linker that is susceptible to hydrolysis at elevated temperatures. As yet another example, the thermally responsive material may be a gel, such as hydroxypropyl methylcellulose, with a temperature-related viscosity.

[0221] The pH-change removable coating is made of or includes a pH-responsive material. Alternatively, the pH-responsive material may be adjacent to the removable coating. Examples of polymers that are soluble in aqueous solutions with different pH levels include chitosan, which is soluble under acidic conditions, and copolymers of water-insoluble monomers and amine-functional monomers, which can be adjusted to dissolve at different pH levels depending on the content of the amino-functional monomer. One example of a copolymer is dimethylaminoethyl methacrylate, which is soluble under basic conditions. Another example of a pH-responsive polymer is commercially available from Evonik under the trade name EUDRAGIT®. As described herein, light and / or heat may be used to induce localized pH changes.

[0222] The method shown in Figures 11A-11D involves introducing a DNA sample 54 into a flow cell 10 (Figure 11A), exposing a subset of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F in predetermined areas 76A, 76B, and 76C of the flow cell 10 by removing a portion of the removable coating 92 from the predetermined areas 76A, 76B, and 76C (Figure 11B), and initiating tagmentation of at least a portion of the DNA sample 54 in the predetermined areas 76A, 76B, and 76C (Figure 11B).

[0223] 11A, a first DNA sample 54 is introduced into the flow channel 20. The first DNA sample 54 may be introduced into a suitable liquid (water, buffer, etc.) that is introduced through an opening (inlet, outlet) so that it flows in a desired direction. In one example, a pump from a sequencing instrument in which the flow cell 10 is operably disposed can be used to transport the first DNA sample 54 into the flow channel 20. Because the removable coating 92 overlaps with the transposome complexes 38E and 38F, the DNA sample 54 cannot bind anywhere.

[0224] While the DNA sample 54 is present in the flow path 20, the predetermined area 76A of the flow cell 10 is exposed to a stimulus that melts, solubilizes, or permeabilizes the removable coating 92. This is shown in Figure 11B. As described herein, the removable coating 92 may be susceptible to light, heat, or pH changes.

[0225] If light is the stimulus, any suitable visible light source 78 can be used to illuminate the desired areas / regions 76A, 76B, 76C of the flow cell 10. While a light source 78 is shown in Figures 11B and 11D, it should be understood that this may be replaced by a heating mechanism.

[0226] If heat is the stimulus, any suitable heating mechanism can be used. The heating mechanism can be included in a complementary metal oxide semiconductor chip coupled to the flow cell substrate 12, 14, included as part of the lid of the flow cell 10, included / embedded in the flow cell substrate 12, 14, or deposited within the recess 26. An example of a heating mechanism can include one or more multiple electrode materials capable of converting electricity into a suitable amount of thermal energy to heat a desired portion of the removable coating 92. In another example, an external heating mechanism can be used, such as a heater in a sequencing instrument in which the flow cell 10 is placed.

[0227] In some examples where heat is the removal mechanism, other sections 76B, 76C of the flow path 20 may be actively cooled while section 76A is heated. Localized cooling may be performed using an active cooling system of an external heater (e.g., Peltier). While localized cooling may be used, it should be understood that localized cooling need not be used if the heating is localized to the desired section 76A. In other words, a heating mechanism may be used to locally heat the section where the coating 92 is to be removed, while other sections may remain unheated.

[0228] If a pH change is the stimulus, the pH change can be initiated by changing the temperature in the predetermined area 76A, 76B, 76C. In some examples, the pH level decreases with increasing temperature, and therefore, a heating mechanism can be used to induce a local change in pH. In an example, a buffer that decreases pH with increasing temperature, such as an acetate buffer, a citrate buffer, or a phosphate buffer, can be added to the flow cell 10 before localized heating. In another example, a buffer that increases pH with increasing temperature, such as a borate buffer, can be added to the flow cell 10 before localized heating. In yet another example, a buffer that can increase or decrease pH with increasing temperature, such as a glycine buffer, can be added to the flow cell 10 before localized heating. In another example, an acid (or another pH-reducing H+ ion source) can be generated near the electrode adjacent to the predetermined area 76A (e.g., the lid, substrates 12, 14, etc.), and the acid or pH-reducing H+ ion source decreases the pH. In yet another example, acid (or another source of H+ ions to lower the pH) may be generated when predetermined areas 76A are exposed to light. The exposure induces a photocatalytic reaction and thus proton release in the desired area for coating removal. Thus, the pH change can be coupled with a temperature change or exposure to light, thereby allowing spatial control.

[0229] Exposure of a portion of removable coating 92 to a stimulus melts, solubilizes, or permeabilizes the portion of removable coating 92 located in predetermined area 76A. Removal of the portion of removable coating 92 exposes transposome complexes 38E, 38F in area / region 76A, which allows DNA sample 54 to bind to these transposome complexes 38E, 38F. Tagmentation can then be initiated in area / region 76A. Tagmentation can be performed as described herein.

[0230] After tagmentation has been performed in the desired region 76A, the channel 20 may be washed using examples of washing solutions described herein to remove the dissolved, solubilized, or permeabilized portions of the removable coating 92 and the tagmentation reagent.

[0231] In Figure 11C, removal of transposase enzyme 46 is performed. Transposase 46 from each transposome complex 38E, 38F can be removed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or a proteinase, or another chaotropic agent, or by heating the flow cell to about 60°C). This renders transposome complexes 38E, 38F inactive for association with subsequently introduced DNA samples, such as second DNA sample 54B in Figure 11D.

[0232] The process of adding a DNA sample 54, triggering localized removal of the removable coating 92 in another predetermined area (e.g., 76B or 76C), tagmentation, and removal of the transposase enzyme 46 can then be repeated for as many desired and / or possible DNA samples 54 and areas as possible within a given channel 20. This allows multiple DNA samples 54, 54B to be tagmented in each area 76A, 76B, etc., which continues through clustering. The addition of a second DNA sample 54B, removal of a second portion of the removable coating 92 in predetermined area 76B, and tagmentation of the second DNA sample 54B is shown in FIG. 11D.

[0233] An iterative process is performed before performing the appropriate reactions to generate fully matched DNA sample fragments (not shown in Figures 11A-11D). Once all of the desired regions / areas 76A, 76B, 76C have the desired tagmented DNA sample 54 and the transposase enzyme 46 has been removed, gap-fill ligation or extension reactions can be used to generate fully matched DNA sample fragments, depending on the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F used. These processes can each be performed as described herein.

[0234] As described above, each recess 26 can be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation can be performed as described herein. Cleavage of either forward or reverse perfectly matched DNA sample fragments can then be performed. Denaturation releases the cleaved fragments, leaving the other (e.g., reverse or forward) single-stranded perfectly matched fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.

[0235] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0236] Activation of flow cell surfaces with encapsulated tagmented entities 12A-12D illustrate the selective release of tagmented entities 74 to enable spatial indexing. The example shown in FIGS. 12A-12D utilizes a removable coating 94 for selective exposure of surface-bound transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F to activation chemistry. In this example, any of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can be used, and transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can include biotin or another suitable linking functional group attached to polymer hydrogels 30 or 32 present within recesses 26. For ease of illustration, transposome complexes 38E and 38F are shown in FIGS. 12A-12D.

[0237] The flow cell 10 is similar to that shown in FIG. 2A (although the base support 22 is not shown) and contains transposome complexes 38E, 38F attached to polymer hydrogels 30, 32 within recesses 26. In this example, the flow cell 10 has identical surface chemistries (e.g., transposome complexes 38E, 38F) in each of the recesses 26. Alternatively, the flow cell 10 shown in FIG. 2B may be used, and the transposome complexes 38E, 38F may be arranged along the lane 36. Although not shown, each flow cell recess 26 also has primers 55, 57 attached to the polymer hydrogels 30, 32.

[0238] The encapsulated complex includes an example of tagmentation entity 74 surrounded by coating material 98. In this example, tagmentation entity 74 contains Mg, which catalyzes tagmentation. 2+ , Mn 2+ and other catalytic metal ions96.

[0239] Coating material 98 is removable upon exposure to a release mechanism / stimuli such as temperature, light, or pH. Any of the temperature, light, or pH responsive materials described herein with respect to removable coating 92 may be used for coating material 98. While light source 78 is shown in Figures 12A and 12D, it should be understood that this may be replaced with a heating mechanism.

[0240] Another example of a temperature-responsive coating material is a temperature-sensitive wax or fatty acid, and triggering the release of the catalytic metal ions 96 involves heating the predetermined areas 76A, 76B, and 76C above the melting temperature of the temperature-sensitive wax. Some examples of suitable temperature-sensitive waxes include myristic acid, palmitic acid, paraffin wax, whale wax, or soy wax, each of which melts at temperatures ranging from about 40°C to about 50°C. Other examples of suitable temperature-sensitive waxes include stearic acid, beeswax, microcrystalline polyethylene wax, or carnauba wax, each of which melts at temperatures ranging from about 60°C to about 80°C. In these examples, heating the predetermined areas 76A, 76B, and 76C to the desired temperature melts the wax and releases the catalytic metal ions 96. Yet another example of a temperature-responsive coating material is a temperature-sensitive polymer, and triggering the release of the catalytic metal ions 96 involves heating the flow cell 10 above the solubilization temperature of the temperature-sensitive polymer. Examples of suitable temperature-sensitive polymers include UCST polymers, i.e., poly(acrylamide-co-acrylonitrile), hydroxypropylmethylcellulose agarose, or gelatin, each of which solubilizes at temperatures above 30° C. Other examples of suitable temperature-sensitive polymers include LCST polymers, i.e., poly(N-isopropylacrylamide), methylcellulose, or poloxamer, each of which solubilizes at temperatures below 30° C. In these examples, predetermined areas 76A, 76B, 76C are heated to the desired temperature to solubilize the polymer and release catalytic metal ions 96.

[0241] Some specific examples of suitable pH-sensitive polymers for coating materials include EUDRAGIT® L100 (methacrylic acid copolymer, Type B from Evonik, Inc.) or KOLLICOAT® MAE-100 (methacrylic acid copolymer, Type A from BASF Corp.), each of which is soluble at a pH greater than 6. Other examples of suitable pH-sensitive polymers include EUDRAGIT® RL / RS 100 (methacrylic acid copolymer from Evonik, Inc.) or carboxymethyl cellulose, each of which is soluble at a pH greater than 8. Still other examples of suitable pH-sensitive polymers include EUDRAGIT® E (aminodimethyl methacrylate copolymer from Evonik, Inc.) or chitosan, each of which is soluble at a pH less than 3. In these examples, the pH of a given region 76A, 76B, 76C is adjusted to be below a pH to which the polymer is sensitive (e.g., if solubility is below pH X) or above a pH to which the polymer is sensitive (e.g., if solubility is above pH X), causing the polymer to solubilize. Solubilization of the polymer releases catalytic metal ions 96.

[0242] The encapsulated composite 94 may be formed by creating a dispersion of the coating material 98, spray-coating the dispersion onto the catalytic metal ions 96 in a fluidized bed, and drying the composite. Alternative forms of drying, such as freeze-drying, vacuum drying, or microwave-assisted drying, may be used. The dried product may then be powdered into small matrix particles containing a mixture of the trigger material and catalytic metal. Other suitable coating techniques, such as pan coating or spray drying, may be used to effectively form a film of the coating material 98 on the catalytic metal ions 96.

[0243] The method shown in Figures 12A-12D includes introducing a DNA sample 54 into a flow cell 10, thereby causing the DNA sample 54 to bind to transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F across the flow cell 10; introducing an encapsulated complex 94 into the flow cell 10, the encapsulated complex 94 including a catalytic metal ion 96 surrounded by a coating material 98; and selectively releasing the catalytic metal ion 96 from the encapsulated complex 94 in a predetermined area 76A of the flow cell 10 by exposing the encapsulated complex to a mechanism that initiates removal of the coating material 98, thereby initiating tagmentation of a portion of the DNA sample 54 in the predetermined area 76A while leaving another portion of the DNA sample 54 untagged in other areas 76B, 76C.

[0244] 12A, a first DNA sample 54 is introduced into the flow channel 20. The first DNA sample 54 may be introduced into a suitable liquid (water, buffer, etc.) through an inlet. In one example, a pump of a sequencing instrument in which the flow cell 10 is operably disposed may be used to transport the first DNA sample 54 into the flow channel 20. The DNA sample 54 may bind to transposome complexes 38E, 38F in each of the predetermined areas 76A, 76B, 76C, but tagmentation does not occur in each of the predetermined areas 76A, 76B, 76C.

[0245] While the DNA sample 54 is present in the flow path 20, the predetermined area 76A of the flow cell 10 is exposed to a stimulus that melts, solubilizes, or permeabilizes the coating material 98. Removal of the coating material 98 from the encapsulated complex 94 releases the catalytic material 96 in the predetermined area 76A. This is shown in FIG. 12A . As described herein, the coating material 98 may be susceptible to light, heat, or pH changes. These stimuli may be applied as described herein for the removable coating 92. Upon removal of the coating material 98, the release of the catalytic metal ions 96 is localized to catalyze tagmentation in the predetermined area 76A but not in the other areas 76B, 76C. Tagmentation may be performed as described herein. If heat is the trigger, the other areas 76B, 76C may be cooled to prevent premature release of the catalytic metal ions 96.

[0246] After tagmentation has been performed in the desired region 76A, the channel 20 may be washed using examples of washing solutions described herein to remove the melted, solubilized, or permeabilized portions of the coating material 98 and the tagmentation reagent.

[0247] In Figure 12B, removal of the transposase enzyme 46 is performed. The transposase enzyme 46 from each transposome complex 38E, 38F can be removed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or proteinase, or another chaotropic agent, or by heating the flow cell to approximately 60°C). This process releases the bound but untagmented DNA sample 54 from the inactive transposome complex 38E, 38F in zones 76B, 76C. The tagmented fragments 58, 58' remain attached to zone 76A because they are ligated to the 3' ends of the transferred strands 42E, 42F, respectively. The released transposase enzyme 46 and untagmented DNA sample 54 can then be removed from the flow cell 10.

[0248] This exemplary method then involves reintroducing transposase enzyme 46, which is shown in Figure 12C. Transposase enzyme 46 binds to transposon ends 40E, 40F to reform transposome complexes 38E, 38F. This prepares transposome complexes 38E, 38F in areas 76B, 76C for engagement with a subsequently introduced DNA sample, such as second DNA sample 54B in Figure 12D.

[0249] The process of adding a DNA sample 54 triggers the localized release of catalytic metal ions 96 in another predetermined area, e.g., 76B or 76C, and the removal of the transposase enzyme 46, catalytic metal ions 96, and any bound but untagmented DNA sample 54; the reintroduction of the transposase enzyme 46 can then be repeated for as many desired and / or possible DNA samples 54 and areas as possible within a given flow channel 20. This allows multiple DNA samples 54, 54B to be tagmented in their respective regions 76A, 76B, etc., which continues throughout clustering. The addition of a second DNA sample 54B, the localized release of catalytic metal ions 96 in predetermined area 76B, and the tagmentation of the second DNA sample 54B are shown in FIG. 12D.

[0250] An iterative process is performed before performing the appropriate reactions to generate fully matched DNA sample fragments (not shown in Figures 12A-12D). Once all of the desired regions / areas 76A, 76B, 76C have the desired tagmented DNA sample 54 and the transposase enzyme 46 has been removed a final time, gap-fill ligation or extension reactions can be used to generate fully matched DNA sample fragments, depending on the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F used. These processes can each be performed as described herein.

[0251] As described above, each recess 26 can be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation can be performed as described herein. Cleavage of either forward or reverse perfectly matched DNA sample fragments can then be performed. Denaturation releases the cleaved fragments, leaving the other (e.g., reverse or forward) single-stranded perfectly matched fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.

[0252] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0253] Heat-activated flow cell surface 13A-13D illustrate the selective activation of surface-bound tagmentation entities 74 to enable spatial indexing. The example shown in FIGS. 13A-13D utilizes heat to selectively activate surface-bound transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F. In this example, any of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can be used, and transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F can include biotin or another suitable linking functional group attached to polymer hydrogels 30 or 32 present within recesses 26. For ease of illustration, transposome complexes 38E and 38F are shown in FIGS. 13A-13D.

[0254] The flow cell 10 is similar to that shown in FIG. 2A (although the base support 22 is not shown) and contains transposome complexes 38E, 38F attached to polymer hydrogels 30, 32 within recesses 26. In this example, the flow cell 10 has identical surface chemistries (e.g., transposome complexes 38E, 38F) in each of the recesses 26. Alternatively, the flow cell 10 shown in FIG. 2B may be used, and the transposome complexes 38E, 38F may be arranged along the lane 36. Although not shown, each flow cell recess 26 also has primers 55, 57 attached to the polymer hydrogels 30, 32.

[0255] The method shown in Figures 13A-13D involves selectively activating a subset of transposome complexes 38E, 38F in predetermined areas 76A, 76B, 76C of a flow cell 10 by heating the predetermined area 76A to an activation temperature and cooling other areas 76B, 76C of the flow cell below the activation temperature, and introducing a DNA sample 54 into the flow cell 10, whereby a portion of the DNA sample 54 binds to and is tagmented by the subset of transposome complexes 38E, 38F in the predetermined area 76A, and another portion of the DNA sample 54 binds to but remains untagmented by the transposome complexes 38E, 38F in other areas 76B, 76C.

[0256] In Figure 13A, area 76A of flow cell 10, where tagmentation is initiated, is exposed to the activation temperature of transposome complexes 38E, 38F. In examples, the activation temperature ranges from about 20°C to about 55°C. Localized heating can be achieved using any of the heating mechanisms described herein.

[0257] While localized heating is being performed, localized cooling may also be performed in other regions 76B, 76C where tagmentation is not initiated. In an example, the cooling temperature is about 18°C ​​or less. Localized cooling can be achieved using any of the cooling mechanisms described herein. Cooling to lower temperatures inhibits transposome complex 38E, 38F activation and helps prevent tagmentation in areas 76B, 76C where tagmentation is not desired.

[0258] Once the desired zone 76A is heated and the other zones 76B and 76C are cooled (if desired), the first DNA sample 54 is introduced into the channel 20. The first DNA sample 54 may be introduced into a suitable liquid (water, buffer, etc.) through an inlet. In one example, the first DNA sample 54 may be transported into the channel 20 using a pump from a sequencing instrument in which the flow cell 10 is operably disposed. The DNA sample 54 may bind to the transposome complexes 38E and 38F in each of the predetermined zones 76A, 76B, and 76C, but tagmentation occurs only in the heated region where the transposome complexes 38E and 38F are activated, e.g., zone 76A in FIG. 13A . Tagmentation may be performed as described herein.

[0259] After tagmentation has been performed in the desired region 76A, the channel 20 may be washed using the example washing solutions described herein to remove the tagmentation reagent.

[0260] The method shown in Figures 13A-13D then further includes removing the transposase enzyme 46 of each of the transpososome complexes 38E, 38F, thereby releasing another portion of the DNA sample 54, whereby a portion of the DNA sample (e.g., tagmented fragments 58, 58') remains attached to the predetermined area 76A; washing the removed transposase enzyme 46 and the released DNA sample 54 from the flow cell 10; and introducing new transposase enzyme 46 into the flow cell 10, thereby reforming the transpososome complexes 38E, 38F in the other area 76B or 76C.

[0261] In Figure 13B, transposase removal is performed. The transposase enzyme 46 from each transposome complex 38E, 38F can be removed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or proteinase, or another chaotropic agent, or by heating the flow cell to approximately 60°C). This process releases the bound but untagmented DNA sample 54 from the inactive transposome complex 38E, 38F in the cooled zones 76B, 76C. The tagmented fragments 58, 58' remain attached to the heated region 76A because they are ligated to the 3' ends of the transferred strands 42E, 42F, respectively. The released transposase enzyme 46 and untagmented DNA sample 54 can be removed from the flow cell 10 using a wash solution.

[0262] As described above, this exemplary method then involves reintroducing transposase enzyme 46, as shown in Figure 13C. Transposase enzyme 46 binds to transposon ends 40E, 40F to reform transposome complexes 38E, 38F. This prepares transposome complexes 38E, 38F in areas 76B, 76C for engagement with a subsequently introduced DNA sample, such as second DNA sample 54B in Figure 13D.

[0263] The process of localized heating and cooling, addition of DNA sample 54, removal of transposase enzyme 46 and bound but untagmented DNA sample 54, and reintroduction of transposase enzyme 46 can then be repeated for as many desired and / or possible DNA samples 54 and regions within channel 20. This allows multiple DNA samples 54, 54B to be tagmented in their respective regions 76A, 76B, etc., which persists throughout clustering. The addition of a second DNA sample 54B and localized heating is shown in Figure 13D.

[0264] An iterative process is performed before performing the appropriate reactions to generate fully matched DNA sample fragments (not shown in Figures 13A-13D). Once all of the desired regions / areas 76A, 76B, 76C have the desired tagmented DNA sample 54 and the transposase enzyme 46 has been removed a final time, gap-fill ligation or extension reactions can be used to generate fully matched DNA sample fragments, depending on the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F used. These processes can each be performed as described herein.

[0265] As described above, each recess 26 can be configured with primers 55, 57 for amplification and cluster generation. Amplification and cluster generation can be performed as described herein. Cleavage of either forward or reverse perfectly matched DNA sample fragments can then be performed. Denaturation releases the cleaved fragments, leaving the other (e.g., reverse or forward) single-stranded perfectly matched fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.

[0266] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by the introduction of an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0267] Selective capture of DNA samples The top view portion of Figure 15A shows different regions / zones 76A, 76B, 76C, 76D, 76E, 76F of lane 36 of flow cell 10. As shown in Figure 15B, each region / zone 76A, 76B, 76C, 76D, 76E, and 76F contains a different type of target primer 100A, 100B, 100C, 100D, 100E, 100F that allows for at least spatial indexing.

[0268] The flow cell lane 36 is similar to that shown in FIG. 2A and may be the only lane of the flow cell 10 or may be one of multiple lanes 36 of the flow cell 10. Briefly, the flow cell lane 36 is formed in the multilayer substrate 12 and includes recesses 26 defined in the patterned layer 24. Each recess 26 contains therein a polymer hydrogel 32 and a set of amplification primers (i.e., primers 55 and 57) attached to the polymer hydrogel 30 or 32. Alternatively, the flow cell lane 36 shown in FIG. 2B may be used, with the primers 55, 57 attached to the polymer hydrogel 30 or 32 along the lane 36.

[0269] In these examples, the flow cell lane 36 is divided into at least two regions / zones 76A, 76B. The number of regions / zones 76A, 76B depends on the number of different samples introduced into the flow cell lane 36. The number of regions / zones 76A, 76B is also limited by the dimensions of the lane 36.

[0270] Regions / areas 76A, 76B, 76C, 76D, 76E, 76F are defined by particular types of target primers (see reference numbers 100A, 100B, 100C, 100D, 100E, 100F in FIG. 15B) that are attached to the polymer hydrogel 30 or 32 in regions / areas 76A, 76B, etc. As used herein, reference number 100 refers collectively to all of the target primers, and reference numbers 100A, 100B, 100C, 100D, 100E, 100F specifically refer to those in the corresponding regions / areas 76A, 76B, 76C, 76D, 76E, 76F. Similarly, reference number 102 refers collectively to all of the spatial tags, while reference numbers 102A, 102B, 102C, 102D, 102E, and 102F refer specifically to spatial tags complementary to corresponding target primers 100A, 100B, 100C, 100D, 100E, and 100F.

[0271] Each target primer 100 in a given region 76A, 76B, 76C, 76D, 76E, or 76F of the flow cell 10 has a sequence identical to each other target primer 100 in that region 76A, 76B, 76C, 76D, 76E, or 76F, which sequence is complementary to the sequence of the spatial tag 102 to which it is hybridized. Target primer 100D in one region 76D is orthogonal to target primers 100A, 100B, 100C, 100E, and 100F in each of the other regions 76A, 76B, 76C, 76E, and 76F. "Orthogonal," when used to describe target primer 100, means that target primer 100D in one region 76D has a different oligonucleotide sequence from target primers 100A, 100B, 100C, 100E, and 100F in each of the other regions 76A, 76B, 76C, 76E, and 76F, and therefore target primers 102A, 102B, 102C, 102D, 102E, and 102F in their respective regions 76A, 76B, 76C, 76D, 76E, and 76F can hybridize only to their respective complementary spatial tags 102A, 102B, 102C, 102D, 102E, and 102F.

[0272] The 5' end of the target primer 100 contains a functional group that attaches it to the polymer hydrogel 30 or 32. In methods utilizing a passivating component (see 104 and 106 in Figures 16A and 16B), it may not be desirable to use a biotinylated polymer hydrogel 30 because the passivating component may include biotin as its attachment molecule. In other cases where a biotinylated polymer 30 is used, the 5' end of each of the target primers 100 is biotin, and avidin or streptavidin 60 can be used to attach the target primers 100A, 100B, etc. to the desired areas 76A, 76B, etc. When a polymer hydrogel 32 is used, the 5' end of each of the target primers 100 is attached to the R A It may be any suitable functional group that is capable of covalently bonding to the group.

[0273] Different groups of target primers 100A, 100B, etc. may be sequentially dispersed into regions / areas 76A, 76B, etc. using a high-precision coating method. In one example, the high-precision coating is achieved using a precision gantry tool. In another example, the high-precision coating method is performed using stripe coating or patch coating with a slot-die coating tool. The high-precision coating method may also be used in conjunction with other coating methods, such as spray coating or jetting, for example, by inkjet. In an example, a first group of target primers 100A may be dispersed in region 76A and incubated to allow them to graft onto the polymer hydrogel 30 or 32. If biotin-avidin / streptavidin-biotin binding is used, avidin / streptavidin 60 may be attached or introduced according to any of the examples described herein.

[0274] Flow cell 10 including lane 36 shown in FIG. 15A may be part of a kit. The kit includes at least two fluids, each of which is specifically designed for use with target primers 100A, 100B, etc. in one of regions 76A, 76B, etc. The number of fluids in the kit corresponds to the number of regions 76A, 76B, etc. defined within lane 36. For example, a kit including flow cell 10 with lane 36 shown in FIG. 15 would include six different fluids (one for each of regions 76A, 76B, 76C, 76D, 76E, 76F).

[0275] Each fluid in the kit comprises a liquid carrier and a first plurality of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F dispersed in the liquid carrier, each of transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F comprising a spatial tag 102 complementary to target primer 100 attached to one of regions 76A, 76B, 76C, 76D, 76E, or 76F. For example, the fluid used in region 76D comprises transposome complexes 38E and 38F comprising a spatial tag 102D whose sequence is complementary to target primer 100D. As one particular example, a spatial tag 10D can be attached to each of the 3' end of the non-transferred strand (e.g., 48E in Figure 14D) and the 5' end of the transferred strand (48F in Figure 14D) such that these complexes 38E, 38F hybridize directly to the target primer 100D. In one example, the flow cell 10 has two regions 76A, 76B defined within the lane 36, and the kit includes a first fluid carrier and a first plurality of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F dispersed within the first fluid carrier, each of the first plurality of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F including a first spatial tag 102A complementary to a target primer 100A attached within a recess 26 located in the first region 76A of the flow cell 10. or 38E and 38F, and a second fluid carrier; and a second fluid comprising a second plurality of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F dispersed in the second fluid carrier, wherein each of the second plurality of transposome complexes 38A, or 38B, or 38C and 38D, or 38E and 38F includes a second spatial tag 102B complementary to a target primer 100B attached within a recess 26 located in a second region 76B of the flow cell 10.

[0276] The liquid carrier for each fluid may be water. A buffer and / or salt may be added to the carrier liquid. The buffer has a pH ranging from 5 to 12. Examples of neutral buffers include tris(hydroxymethyl)aminomethane (Tris or TRIS) buffers, such as Tris-HCl or Tris-EDTA, or carbonate buffers (e.g., 0.25 M to 1 M). Sodium sulfate (e.g., 1 M to 2 M) is a suitable salt that may be used. Transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F may be contained in the carrier liquid at a concentration ranging from about 0.1 μM to about 1 μM.

[0277] As mentioned above, any of the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F described herein can be used. In this example, each of the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F further includes one of spatial tags 102A, 102B, 102C, 102D, 102E, or 102F. The spatial tag 102 is an oligonucleotide primer complementary to a target primer 100 included in region 76A, 76B, etc. of the flow cell 10 used with the fluid (including the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F and the spatial tag 102). Thus, the spatial tag 102A, 102B etc. used in each fluid depends on the corresponding region 76A, 76B etc. and the target primer 100A, 100B etc. in that region 76A, 76B etc.

[0278] When transposome complex 38A (FIG. 14A) or transposome complex 38B (FIG. 14B) is used, spatial tag 102 is covalently or non-covalently attached to the 5' end of transferred strand 42. When transposome complexes 38C and 38D are used (FIG. 14C), spatial tag 102 is covalently or non-covalently attached to the 5' end of each of transferred strands 42C and 42D of complexes 38C and 38D, respectively. When transposome complexes 38E and 38F are used (FIG. 14D), spatial tag 102 is attached to the 3' end of non-transferred strand 44E of complex 38E and the 5' end of transferred strand 42F of complex 38F. In the example shown in Figure 15B, spatial tags 102A, 102B, 102C, 102D, 102E, 102F are attached to transposome complexes 38E and 38F via biotin-avidin / streptavidin-biotin interactions, where terminal groups 48E, 48F are both biotin, the 5' end of spatial tag 102 is biotin, and avidin / streptavidin 60' is attached to biotin. Alternatively, spatial tags 102A, 102B, 102C, 102D, 102E, 102F are attached to transposome complexes 38E and 38F via biotin-avidin / streptavidin interactions, where terminal groups 48E, 48F are both biotin and avidin / streptavidin 60' is covalently attached to a thiol-modified oligonucleotide at the 5' end of spatial tag 102A.

[0279] An exemplary method for creating lane 36 shown in Figures 15A and 15B includes attaching an amplification primer set (e.g., primers 55, 57) along flow cell lane 36 (e.g., to polymer hydrogel 30 or 32 within lane 36 or within recess 26) and sequentially attaching orthogonal target primers 100 (e.g., 100A, 100B, etc.) to at least two different regions 76A, 76B, etc. of flow cell lane 36.

[0280] Two exemplary methods for using the flow cell lanes 36 of Figures 15A and 15B are now described. At the beginning of each method, a flow cell 10 having regions 76A, 76B, etc. defined in lanes 36 is operably positioned within a sequencing instrument.

[0281] One exemplary method includes: i) introducing a first fluid (such as a first plurality of transposome complexes 38A or 38B) into the flow cell 10 at a hybridization temperature, whereby the first spatial tags 102A hybridize to the target primers 100A attached within the recesses 26 located in the first region 76A of the flow cell 10, i) introducing the first DNA sample 54 into the flow cell 10, whereby the first DNA sample 54 is tagmented by the first plurality of transposome complexes 38A or 38B, i) removing the transposase enzyme 46 of each of the first plurality of transposome complexes 38A or 38B, and ii) performing gap-fill ligation or ii) generating a perfectly matched second DNA sample fragment in a second region 76B of the flow cell 10 by performing an extension reaction; ii) introducing a second fluid into the flow cell 10 at a hybridization temperature, whereby the second spatial tags 102B hybridize to the target primers 100B attached within the recesses 26 located in the second region 76B of the flow cell 10, respectively; introducing a second DNA sample 54B into the flow cell 10, whereby the second DNA sample 54B is tagmented by a second plurality of transposome complexes 38A or 38B, etc.; removing the transposase enzyme 46 of each of the second plurality of transposome complexes 38A or 38B; and performing a gap-fill ligation or extension reaction.

[0282] At the beginning of this exemplary method, a first fluid (e.g., including a first plurality of transposome complexes 38A or 38B having first spatial tags 102A) is introduced into flow cell lane 36. The first fluid may be introduced through an inlet. In one example, a pump in a sequencing instrument can be used to transport the first fluid into lane 36.

[0283] The temperature of flow cell lane 36 is at or is brought to a hybridization temperature such that first spatial tag 102A hybridizes to complementary target primer 100A located in first region 76A, respectively. Target primers 100B, 100C, 100D, 100E, and 100F located in other regions 76B, 76C, 76D, 76E, and 76F are not complementary to first spatial tag 100A, and therefore first plurality of transposome complexes 38A or 38B, etc., do not bind in these regions 76B, 76C, 76D, 76E, and 76F.

[0284] The first DNA sample 54 is then introduced into the flow cell lane 36 as described herein (e.g., using a tagmentation buffer). The first DNA sample 54 is tagmented by the first plurality of transposome complexes 38A or 38B, etc., because the first plurality of transposome complexes 38A or 38B, etc., are the only group of transposome complexes 38A or 38B, etc., in the lane 36. Tagmentation may be performed as described herein.

[0285] In this exemplary method, the transposase enzyme 46, such as each of the first plurality of transposome complexes 38A or 38B, is then removed. The transposase enzyme 46 can be removed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or a proteinase, or another chaotropic agent, or by heating the flow cell to about 60° C.). The released transposase enzyme 46 can be removed from the flow cell 10 using a wash solution.

[0286] A perfectly matched DNA fragment 56 may be formed in the first region 76A using performing a gap-fill ligation or extension reaction as described herein, the process used depending on the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F used.

[0287] All of these processes can be performed with a second fluid (e.g., including a second plurality of transposome complexes 38A or 38B having second spatial tags 102B) and a second DNA sample 54B to generate perfectly matched second DNA sample fragments in the second region 76B. The process can then be repeated again for as many fluids, DNA samples, and zones / regions 76C, 76D, 76E, 76F as desired and / or possible within a given flow cell lane 36. This allows multiple DNA samples 54, 54B to be tagmented in their respective zones 76A, 76B, etc., which persists throughout clustering.

[0288] Because transposome complexes 38A or 38B, etc., are introduced sequentially and attach only to regions 76A, 76B, 76C, etc., to which they can hybridize, transposome complexes 38A or 38B, etc., in a particular fluid can contain index sequences in the transferred strands 42 and / or adapters 50 introduced into the flow cell 10. This allows for canonical indexing in addition to spatial indexing.

[0289] Once all of the perfectly matched DNA sample fragments 56 have been generated, amplification and cluster generation can be performed as described herein. Cleavage of either the forward or reverse perfectly matched DNA sample fragments can then be performed. Denaturation releases the cleaved fragments, leaving the other (e.g., reverse or forward) single-stranded perfectly matched fragments (e.g., 56A, 56B, etc.) attached to the flow cell surface.

[0290] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by the introduction of an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0291] Another exemplary method includes: i) generating partially adapted first DNA sample fragments into a first region 76A of the flow cell 10 by introducing a first fluid (such as a first plurality of transposome complexes 38A or 38B) into the flow cell 10 at a hybridization temperature, whereby first spatial tags 102A hybridize to target primers 100A attached within recesses 26 located in the first region 76A of the flow cell 10, respectively; introducing a first DNA sample 54 into the flow cell 10, whereby the first DNA sample 54 is tagmented by the first plurality of transposome complexes 38A or 38B; and removing the transposase enzyme 46 of each of the first plurality of transposome complexes 38A or 38B; and ii) introducing a partially adapted second DNA sample fragment into the flow cell 10 at a hybridization temperature, whereby first spatial tags 102A hybridize to target primers 100A attached within recesses 26 located in the first region 76A of the flow cell 10. the second region 76B of the flow cell 10 by introducing a second fluid into the flow cell 10 at a hybridization temperature, thereby hybridizing the second spatial tags 102B to the target primers 100B attached within the recesses 26 located in the second region 76B of the flow cell 10, respectively; introducing a second DNA sample 54B into the flow cell 10, thereby tagmenting the second DNA sample 54B with a second plurality of transposome complexes 38A or 38B, etc., and removing the transposase enzyme 46 of each of the second plurality of transposome complexes 38A or 38B, etc.; and performing a gap-fill ligation or extension reaction on each of the partially matched first and second DNA sample fragments to form fully matched first and second DNA sample fragments.

[0292] Another exemplary method involves solution-based binding to generate a binding complex in which DNA is bound to a transposome complex, such as 38A or 38B. The binding complex is shown in Figures 16A and 16B. The bound complex is introduced into flow cell lane 36 and attaches to the desired region, such as 76A or 76B, via hybridization of spatial tag 102 and complementary target primer 100. The binding complex is then passivated before additional binding complexes (formed with a different DNA sample) are added.

[0293] Generally, the method includes exposing a first plurality of transposome complexes 38A or 38B, etc., to a first DNA sample 54, whereby the first DNA sample 54 binds to at least a portion of the first plurality of transposome complexes 38A or 38B, etc., to form first binding complexes; introducing the first binding complexes into the flow cell 10, whereby the first spatial tags 102A hybridize to target primers 100A attached within recesses 26 located in a first region 76A of the flow cell 10; The method includes passivating the first binding complex; exposing a second plurality of transposome complexes 38A or 38B, etc. to a second DNA sample 54B, whereby the second DNA sample 54B binds to at least a portion of the second plurality of transposome complexes 38A or 38B, etc. to form a second binding complex; and introducing the second binding complex into the flow cell 10, whereby the second spatial tags 102B are hybridized to complementary target primers 100B attached within recesses 26 located in a second region 76B of the flow cell 10, respectively.

[0294] At the beginning of this exemplary method, a first fluid (e.g., including a first plurality of transposome complexes 38A or 38B having first spatial tags 102A) is mixed with a first DNA sample 54 outside of the flow cell 10. A tagmentation buffer is not included to prevent premature tagmentation. Thus, the first DNA sample 54 binds to the transposome complexes 38A or 38B, but is not tagmented. This results in the formation of a binding complex of the first DNA sample 54 bound to the first plurality of transposome complexes 38A or 38B, etc.

[0295] The bound complex is then introduced into flow cell lane 36 using any suitable technique.

[0296] The temperature of flow cell lane 36 is at or brought to a hybridization temperature such that first spatial tag 102A hybridizes to complementary target primer 100A located in first region 76A, respectively. Target primers 100B, 100C, 100D, 100E, and 100F located in other regions 76B, 76C, 76D, 76E, and 76F are not complementary to first spatial tag 100A, so binding complexes do not bind in these regions 76B, 76C, 76D, 76E, and 76F.

[0297] The bound complex can then be passivated by introducing a passivating component (e.g., a hydrophobic polymer or antifouling agent) into flow cell lane 36. The end group of the passivating component can include biotin, which can attach to avidin / streptavidin 60', such as transposome complex 38A or 38B containing spatial tag 102. Alternatively, the end group of the passivating component can include any functional group that is orthogonal, i.e., unreactive, to the dehybridization conditions used to separate spatial tag 102. In yet another example, the passivating component can have its own passivating tag (similar to spatial tag 102) that can attach to a passivated target primer located in a specific area of ​​the flow cell surface. The passivating tag or target primer can have a cleavage site that allows for their removal at a desired point in the workflow. As an example, hydrophobic polymer X carries oligo A, and region 76A carries the complementary oligo A'. After transposome complexes 38E, 38F are hybridized via the target primer within area 76A, hydrophobic polymer X is hybridized via AA' to passivate area 76A. If the passivation needs to be removed, oligo A or A' can be cleaved via chemistry such as vinyl dT or 8oxoG, which is orthogonal to the cleavage site of the primer and / or transposome complex.

[0298] Passivation may involve forming a hydrophobic polymer shell 104 over the first binding complex, as shown in Figure 16A. Alternatively, passivation may involve attaching an antifouling agent 106 to the first binding complex, as shown in Figure 16B.

[0299] Examples of suitable hydrophobic polymers that can be used to form shell 104 include polypropylene glycol, polycaprolactone, poly(lactic-co-glycolic acid) (PLGA), cellulose acetate, ethyl cellulose, polyalkyl(meth)acrylate, or polydimethylsiloxane (PDMS).

[0300] The antifouling agent 106 may be a phosphate, phosphonate, zwitterionic end group, amphoteric polymer end group, carboxylic acid, poly(ethylene glycol), perfluoro end group, hydroxyl, sulfonic acid, positively charged end group, alkoxy end group, or anionic polymer end group. An example of a zwitterionic end group is selected from the group consisting of phosphocholine, sulfobetaine, and carboxybetaine. An example of an amphoteric polymer end group is a polymer chain containing both carboxylic acid and amine functional groups, such as a copolymer of methacrylic acid and dimethylammonium ethyl methacrylate. Some examples of antifouling agents 106 having perfluorinated end groups are selected from the group consisting of (heptadecafluoro-1,1,2,2-tetrahydrodecyl)trimethoxysilane, 3-(heptafluoroisopropoxy)propyltrimethoxysilane, nonafluorohexyltrimethoxysilane, [perfluoro(polypropyleneoxy)]methoxypropyltrimethoxysilane, 1,3-bis(trifluoropropyl)-1,1,3,3-tetramethyldisilazane, and (tridecafluoro-1,1,2,2-tetrahydrooctyl)dimethylchlorosilane. Positively charged end groups include amines and ammonium. Examples of anionic polymer end groups include polyphosphates, polysulfonates, and polycarboxylates (e.g., poly(meth)acrylic acid).

[0301] The antifouling agent 106 may include a linker such as an ethylene or other short alkyl chain, poly(meth)acrylate, tetrazine, or azide, with a biotin or other terminal group for attachment to the binding complex (e.g., via avidin / streptavidin 60').

[0302] The second binding complex can be prepared (outside of the flow cell 10) by mixing the second DNA sample 54B with a second fluid (including the second plurality of transposome complexes 38A or 38B, etc., with spatial tags 102B). In this example, the second fluid also does not include tagmentation buffer. In the second fluid, the second DNA sample 54B binds to the transposome complexes 38A or 38B, etc., but is not tagmented. This forms a binding complex of the second DNA sample 54B bound to the second plurality of transposome complexes 38A or 38B, etc.

[0303] The second binding complex is then introduced into flow cell lane 36 (which contains the passivated first binding complex) using any suitable technique. The temperature of flow cell lane 36 is at or brought to a hybridization temperature such that second spatial tag 102B hybridizes to complementary target primer 100B located in second region 76B, respectively. Because target primers 100A, 100C, 100D, 100E, and 100F located in other regions 76A, 76C, 76D, 76E, and 76F are not complementary to second spatial tag 100B, binding complexes do not bind in these regions 76A, 76C, 76D, 76E, and 76F. Furthermore, the binding complexes in region 76A are passivated, so that any free DNA sample 54B (e.g., at the ends) does not bind to unused transposome complexes 38A or 38B, etc., in first region 76A. Passivation also prevents any free transposome complexes 38A or 38B, etc., from the second solution from further binding to first DNA sample 54A.

[0304] The second binding complex can then be passivated by introducing a passivating component (eg, a hydrophobic polymer or an antifouling agent) into flow cell lane 36 .

[0305] The process of forming binding complexes, introducing and attaching the binding complexes in the desired flow cell region, and passivating the newly introduced binding complexes can then be repeated again for as many binding complexes and zones / regions 76C, 76D, 76E, 76F as desired and / or possible within a given flow cell lane 36. This allows multiple binding complexes (each containing a different DNA) to be attached to respective regions 76A, 76B, etc. After all of the binding complexes have been introduced and bound to regions 76A, 76B, etc., the passivation component can be removed. If a biotin-avidin / streptavidin interaction is used, the passivation component can be released by introducing any example of a biotin-streptavidin cleavage composition disclosed herein into the flow cell 10. Alternatively, if the passivation tag or target primer has a cleavage site, a separate cleavage agent can be introduced to cleave and thus remove the passivation component from a particular zone 76A, 76B, etc.

[0306] Tagmentation can begin either before or after the passivating component is removed. This can be accomplished by introducing any example tagmentation buffer into flow cell lane 36 and ensuring that the temperature is above 30° C. Tagmentation can be carried out as described herein.

[0307] In this exemplary method, the transposase enzyme 46 of each transposome complex 38A or 38B, etc., is then removed. The transposase enzyme 46 can be removed using any of the methods described herein (e.g., using sodium dodecyl sulfate (SDS), or a proteinase, or another chaotropic agent). Heating may not be desirable to avoid dehybridization of the spatial tags 102 and target primers 100. The released transposase enzyme 46 can be removed from the flow cell 10 using a wash solution.

[0308] It should be understood that if not removed prior to tagmentation, the passivating component should be removed prior to generating the perfectly matched DNA fragment 56 and prior to cleaving the bond between the spatial tag 102 and the transposome complex 38E, 38F. The removal used depends on how the passivating component is attached (e.g., dehybridization, cleavage of the cleavage site, etc.).

[0309] Perfectly matched DNA fragments 56 may be formed in all of regions 76A, 76B, 76C, 76D, 76E, 76F using gap-fill ligation or extension reaction runs as described herein, the process used depending on the transposome complexes 38A, 38B, 38C and 38D, or 38E and 38F used.

[0310] Once all of the perfectly matched DNA sample fragments 56 are generated, they are subjected to amplification and cluster generation using primers 55, 57. Then, after denaturation, cleavage of the perfectly matched DNA sample fragments in either the forward or reverse direction can be carried out. These processes can occur simultaneously with amplification.

[0311] Sequencing can then be performed. In one example, sequencing by synthesis is performed by introducing a sequencing primer followed by the introduction of an incorporation mix containing labeled nucleotides. Optical imaging can be used to detect each instance of nucleotide incorporation.

[0312] Any of the examples described herein can be adapted for paired-end sequencing. In these cases, the amplification domains and primers can be based on the primers described in WO2020 / 005503 (incorporated herein by reference in its entirety).

[0313] Additional Notes 9A-13D each illustrate flow in a left-to-right direction across the flow cell. Various examples show the activated zone downstream of the inactive zone. However, it should be understood that the activated zone can be upstream of the inactive zone, or downstream of one or more inactive zones and upstream of one or more other inactive zones.

[0314] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (unless such concepts are mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms used explicitly herein, and which may also appear in any disclosures incorporated by reference, should be given the meaning most consistent with the particular concepts disclosed herein.

[0315] References throughout this specification to "one example," "another example," "an example," etc. mean that particular elements (e.g., features, structures, and / or characteristics) described in connection with an example are included in at least one example described herein and may or may not be present in other examples. Additionally, unless the context clearly dictates otherwise, it should be understood that the described elements with respect to any example may be combined in any suitable manner in the various examples.

[0316] Although several embodiments have been described in detail, it should be understood that the disclosed examples may be modified, and therefore the foregoing description should be considered non-limiting.

Claims

1. A flow cell, a substrate having recesses separated by gap regions; a polymer hydrogel located within each of the recesses; and a plurality of transposome complexes immobilized in each of the recesses by biotin-containing linkers, each of the plurality of transposome complexes being of a single type comprising a transposon end in which a portion of the transferred strand is hybridized to a portion of the non-transferred strand, the transferred strand comprising a first amplification domain and no index sequence.

2. 2. The flow cell of claim 1, wherein the non-transferred strand comprises said portion hybridized to said portion of the transferred strand.

3. a first primer and a second primer immobilized in each of the recesses by a respective second biotin-containing linker; the first primer corresponds to the first amplification domain; 3. The flow cell of claim 1, wherein the second primer has a sequence complementary to a second amplification domain of an adapter that hybridizes to a portion of the transferred strand.

4. the transferred strand and the non-transferred strand form a forked adapter; 10. The flow cell of claim 1, wherein the non-transferred strand further comprises a sequencing primer sequence, an index sequence, and a second amplification domain complementary to a primer immobilized in each of the recesses of the flow cell.

5. a first primer and a second primer immobilized in each of the recesses by a respective second biotin-containing linker; the first primer corresponds to the first amplification domain; the transferred strand and the non-transferred strand form a forked adapter; 10. The flow cell of claim 1, wherein the non-transferred strand further comprises a sequencing primer sequence, an index sequence, and a second amplification domain complementary to the second primer.

6. 1. A tagmentation kit comprising: A flow cell, a substrate having recesses separated by gap regions; a plurality of transposome complexes immobilized in each of the wells by biotin-containing linkers, each of the plurality of transposome complexes being of a single type comprising a transposon end in which a portion of the transferred strand is hybridized to a non-transferred strand, the transferred strand comprising a first amplification domain; and an adapter fluid, a carrier fluid; and An adapter, a sequence complementary to said portion of the transferred strand of each of said plurality of transposome complexes; sequencing primer sequences, index array, and an adapter fluid comprising: an adapter comprising a second amplification domain complementary to a primer immobilized in each of the recesses of the flow cell.

7. further comprising a grafting fluid, said grafting fluid comprising: a second carrier fluid; and a first primer; and and a second primer complementary to the second amplification domain, wherein each of the first and second primers has a second biotin-containing linker at its 5' end.

8. The flow cell a first primer; and 7. The tagmentation kit of claim 6, further comprising: a second primer complementary to the second amplification domain, wherein each of the first and second primers is immobilized in each of the recesses by a second biotin-containing linker at its 5' end.

9. 1. A tagmentation kit comprising: A flow cell, a substrate having recesses separated by gap regions; a flow cell comprising: a plurality of transposome complexes immobilized in each of the recesses by biotin-containing linkers, each of the plurality of transposome complexes being of a single type comprising a transposon end in which a portion of the transferred strand hybridizes to a portion of the non-transferred strand to form a forked adapter, the transferred strand comprising a first amplification domain, a sequencing primer sequence, an index sequence, and a second amplification domain complementary to a primer immobilized in each of the recesses of the flow cell; and 1. A grafted fluid comprising: a carrier fluid; and a first primer; and a second primer complementary to the second amplification domain, wherein each of the first and second primers has a second biotin-containing linker at its 5' end.

10. 1. A method comprising: generating at least partially adapted DNA sample fragments on a flow cell using a plurality of transposome complexes attached to the surface of the flow cell within a flow path by biotin-containing linkers; cleaving the at least partially adapted DNA sample fragments such that the biotin-containing linkers remain attached to the surface; One of the following: using the flow cell for a subsequent cycle to generate at least partially adapted DNA sample fragments; or and using the flow cell to amplify at least a portion of the pre-cleaved and at least partially adapted DNA sample fragments.

11. each of the plurality of transposome complexes is of a single type, comprising a transposon end in which a portion of the transferred strand hybridizes to a portion of the non-transferred strand to form a forked adapter, the transferred strand comprising a first amplification domain, and the non-transferred strand further comprising a sequencing primer sequence, an index sequence, and a second amplification domain complementary to a primer that is or will be immobilized in each of the wells of the flow cell; each of said at least partially matched DNA sample fragments is a fully matched DNA sample fragment; generating the perfectly matched DNA sample fragments, introducing a DNA sample and a tagmentation buffer into the flow cell; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme from each of the plurality of transposome complexes; and performing gap-fill ligation to attach the DNA sample fragments to their respective adaptors.

12. 12. The method of claim 11, wherein after cleaving the perfectly matched DNA sample fragments and before using the flow cell, the method further comprises removing streptavidin from the biotin-containing linkers such that the biotin-containing linkers remain attached to the surface.

13. the flow cell is used for a subsequent cycle to generate the at least partially adapted DNA sample fragments, the subsequent cycle to generate the at least partially adapted DNA sample fragments comprising: introducing a new plurality of the transposome complexes into the flow path, whereby at least some of the new plurality of the transposome complexes attach to at least some of the biotin-containing linkers in the flow path; introducing a new DNA sample and a new tagmentation buffer into the flow path; and repeating the tagmentation, transposase enzyme removal, and gap-fill ligation with the new DNA sample.

14. The flow cell is used for the amplification of the pre-cut and fully adapted DNA sample fragments, and the amplification of the pre-cut and fully adapted DNA sample fragments comprises: attaching first and second primers to at least a portion of the biotin-containing linker within the flow path; and introducing the pre-cut and perfectly matched DNA sample fragments in single-stranded form into the flow cell.

15. each of the plurality of transposome complexes is of a single type, comprising a transposon end in which a portion of the transferred strand is hybridized to the non-transferred strand; the transferred strand comprises a first amplification domain; each of said at least partially matched DNA sample fragments is a fully matched DNA sample fragment; generating the perfectly matched DNA sample fragments, introducing a DNA sample and a tagmentation buffer into the channel; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme from each of the plurality of transposome complexes; replacing the non-transferred strand of each of the plurality of transposome complexes with an adapter, wherein the adapter comprises: a sequence complementary to said portion of said transferred strand; sequencing primer sequences, index array, and a second amplification domain that is immobilized or complementary to a primer that is immobilized in each of the flow cell wells, thereby dehybridizing the non-transferred strand and hybridizing the adapter to the portion of the transferred strand of each of the plurality of transposome complexes; and performing gap-fill ligation to attach the DNA sample fragments to their respective adaptors.

16. 16. The method of claim 15, wherein after cleaving the perfectly matched DNA sample fragments and before using the flow cell, the method further comprises removing streptavidin from the biotin-containing linkers such that the biotin-containing linkers remain attached to the surface.

17. the flow cell is used for a subsequent cycle to generate the at least partially matched DNA sample fragments, and the subsequent cycle to generate the fully matched DNA sample fragments is introducing a new plurality of the transposome complexes into the flow path, whereby at least some of the new plurality of the transposome complexes attach to at least some of the biotin-containing linkers in the flow path; introducing a new DNA sample and a new tagmentation buffer into the flow path; and repeating the tagmentation, transposase enzyme removal, replacement of the non-transferred strand with the adapter, and gap-fill ligation with the new DNA sample.

18. The flow cell is used for the amplification of the pre-cut and fully adapted DNA sample fragments, and the amplification of the pre-cut and fully adapted DNA sample fragments comprises: attaching first and second primers to at least a portion of the biotin-containing linker within the flow path; and introducing the pre-cut and perfectly matched DNA sample fragments in single-stranded form into the flow cell.

19. the plurality of transposome complexes comprises a first transposome complex comprising a first amplification domain and a second transposome complex comprising a second amplification domain; each of said at least partially matched DNA sample fragments is a fully matched DNA sample fragment; generating the perfectly matched DNA sample fragments, introducing a DNA sample and a tagmentation buffer into the flow cell; performing tagmentation of the DNA sample using the plurality of transposome complexes; removing a transposase enzyme from each of the plurality of transposome complexes; and performing an extension reaction.

20. a portion of the perfectly matched DNA sample fragments comprising a targeted region, and after cleaving the perfectly matched DNA sample fragments, the method further comprises: denaturing the perfectly matched DNA sample fragments to generate single-stranded perfectly matched DNA sample fragments, a portion of the single-stranded perfectly matched DNA sample fragments comprising the targeted region; transferring the single-stranded, perfectly matched DNA sample fragments to a concentration receptacle on the flow cell; 20. The method of claim 19, further comprising introducing biotinylated capture probes into the concentration receptacle, whereby the portion of the single-stranded, perfectly matched DNA sample fragments that include the targeted region hybridize to the biotinylated capture probes to form concentrated complexes, and another portion of the single-stranded, perfectly matched DNA sample fragments that do not include the targeted region remain unattached.

21. replenishing the flow path with streptavidin; transferring the enriched sample into the flow path containing the supplemented streptavidin, whereby the enriched complexes attach to the biotin-containing linkers and the single-stranded perfectly matched DNA sample fragments that do not contain the targeting region remain unattached; introducing a wash solution into the flow path to remove the single-stranded perfectly matched DNA sample fragments that do not contain the targeted region; Releasing the portion of the single-stranded, perfectly matched DNA sample fragment that includes the targeted region from the biotinylated capture probe; 21. The method of claim 20, further comprising transferring the portion of the single-stranded, perfectly matched DNA sample fragment that includes the targeted region to a holding receptacle.

22. While the portion of the single-stranded, perfectly matched DNA sample fragment containing the targeted region is in the holding receptacle, the method includes removing streptavidin from the biotin-containing linker in the flow path; 22. The method of claim 21, further comprising attaching first and second primers to at least a portion of the biotin-containing linker within the flow path.

23. 23. The method of claim 21 or 22, wherein the flow cell is used for the amplification of the pre-cut and perfectly matched DNA sample fragments, and the amplification of the pre-cut and perfectly matched DNA sample fragments is initiated by transferring the portion of the single-stranded perfectly matched DNA sample fragment containing the targeted region from the holding receptacle to the flow path after the first and second primers have been attached.

24. each of the plurality of transposome complexes is of a single type, comprising a transposon end in which a portion of the transferred strand is hybridized to the non-transferred strand; the transferred strand comprises a first amplification domain; each of said at least partially adapted DNA sample fragments is a partially adapted DNA sample fragment; generating the partially adapted DNA sample fragments, introducing a DNA sample and a tagmentation buffer into the channel; performing tagmentation of the DNA sample using the plurality of transposome complexes; and removing the transposase enzyme of each of the plurality of transposome complexes.

25. After the partially adapted DNA sample fragments are cleaved, the method further comprises: denaturing the partially adapted DNA sample fragments to generate single-stranded partially adapted DNA sample fragments, a portion of the single-stranded partially adapted DNA sample fragments comprising a targeted region; transferring the single-stranded, partially adapted DNA sample fragments to a concentration receptacle on the flow cell, the concentration receptacle comprising surface-bound adapters having a second amplification domain and a region complementary to the targeting region, whereby the portions of the single-stranded, partially adapted DNA sample fragments that include the targeting region hybridize to the surface-bound adapters, respectively, and another portion of the single-stranded, partially adapted DNA sample fragments that do not include the targeting region remain unattached; introducing a wash solution into the concentration receptacle to remove the single-stranded, partially matched DNA sample fragments that do not contain the targeted region; 25. The method of claim 24, further comprising performing an extension reaction along the surface-bound adapters, thereby generating perfectly matched DNA sample fragments.

26. 1. A method comprising: capturing a plurality of biotinylated dDpn1 molecules on a plurality of biotin-containing linkers attached to a surface within a flow path of a flow cell; introducing a DNA sample into the flow cell, whereby methylated bacterial DNA in the DNA sample is captured by the biotinylated dDpn1; introducing a wash solution into the flow path to remove uncaptured DNA sample from the flow path; Releasing the methylated bacterial DNA from the biotinylated dDpn1 such that the biotin-containing linker remains attached to the surface; transferring the cleaved methylated bacterial DNA to a holding receptacle; While the cleaved methylated bacterial DNA is within the holding receptacle, recruiting streptavidin from said biotin-containing linker; introducing a plurality of biotinylated transposome complexes into the flow path, whereby the plurality of biotinylated transposome complexes attach to a portion of the biotin-containing linker; and introducing a plurality of biotinylated primers into the flow path, whereby the plurality of biotinylated primers attach to another portion of the biotin-containing linker; and transporting the cleaved methylated bacterial DNA back into the flow path containing the biotinylated transposome complex and the biotinylated primer.

27. 1. A method comprising: introducing a tagmented entity having a first visible light responsive member attached thereto into a flow cell having a second visible light responsive member attached thereto; exposing a predetermined area of ​​the flow cell to visible light while the tagmentation entity is present in the flow cell, thereby binding the first and second visible light responsive members and attaching the tagmentation entity to the flow cell at the predetermined area.

28. introducing a primer having the first visible light responsive member attached thereto into the flow cell; 28. The method of claim 27, further comprising exposing a second predetermined area of ​​the flow cell to visible light while the primer is present in the flow cell, thereby binding the first and second visible light responsive members and attaching the primer to the flow cell at the second predetermined area.

29. After the tagmentation entities are bound, the method further comprises: introducing a DNA sample into the flow cell; initiating tagmentation of the DNA sample using the bound tagmentation entity; removing the transposase enzyme of the tagmented entity; a second tagmentation entity having the first visible light responsive member attached thereto in a second predetermined area of ​​the flow cell; introducing the second tagmented entity into the flow cell; and 29. The method of claim 27 or 28, further comprising exposing the second predetermined area of ​​the flow cell to visible light while the second tagmented entity is present in the flow cell, thereby binding the first and second visible light responsive members and binding the second tagmented entity by attaching it to the flow cell at the second predetermined area.

30. 30. The method of claim 29, wherein the first and second tagmented entities have different index sequences.

31. A kit comprising: A flow cell, a substrate having recesses separated by gap regions; a biotinylated polymer hydrogel located within each of said wells; A transposome fluid comprising: a first carrier fluid; and a transposome fluid comprising a plurality of biotinylated transposome complexes; 1. A grafted fluid comprising: a second carrier fluid; and a grafting fluid comprising a plurality of biotinylated amplification primers; and A kit comprising streptavidin.

32. 32. The kit of claim 31, further comprising a biotinylated enrichment probe.

33. 33. The kit of claim 31 or 32, further comprising a biotin-streptavidin cleavage composition.

34. The kit according to any one of claims 31 to 33, further comprising a cleavage agent for cleaving the cleavage site of each biotinylated transposome complex.

35. each biotinylated transposome complex is of a single type, comprising a transposon end in which a portion of the transferred strand is hybridized to the non-transferred strand, the transferred strand comprising a first amplification domain; The kit comprises an adapter fluid, a third carrier fluid; and and an adapter fluid comprising an adapter, the adapter comprising: a sequence complementary to said portion of said transferred strand of each of a plurality of transposome complexes; sequencing primer sequences, index array, and A kit according to any one of claims 31 to 34, comprising a second amplification domain complementary to one type of the plurality of biotinylated amplification primers.

36. the plurality of biotinylated transposome complexes, a first transposome complex comprising a first amplification domain having a sequence identical to one type of the plurality of biotinylated amplification primers; and 35. The kit of any one of claims 31 to 34, comprising a second transposome complex comprising a second amplification domain having a sequence identical to a second type of the plurality of biotinylated amplification primers.

37. the plurality of biotinylated transposome complexes includes a first transposome complex that includes a first amplification domain having a sequence identical to one type of the plurality of biotinylated amplification primers; 35. The kit of any one of claims 31 to 34, wherein the flow cell further comprises a concentration chamber comprising a surface-bound adaptor having a second amplification domain with a sequence identical to a second type of the plurality of biotinylated amplification primers and a region complementary to a target sample region.

38. 1. A method comprising: Selectively activating a subset of transposome complexes in a predetermined area of ​​a flow cell by heating the predetermined area to an activation temperature and cooling other areas of the flow cell below the activation temperature, wherein the flow cell comprises: a substrate having recesses separated by gap regions; a polymer hydrogel located within each of the recesses; and the transposome complexes immobilized in each of the recesses; and introducing a DNA sample into the flow cell, whereby a portion of the DNA sample binds to and is tagmented by a subset of transposome complexes in the predetermined area, and another portion of the DNA sample binds to the transposome complexes in the other area but remains untagmented.

39. 39. The method of claim 38, wherein the activation temperature ranges from about 20°C to about 55°C.

40. removing the transposase enzyme of each of the transposome complexes, thereby releasing the other portion of the DNA sample, whereby the portion of the DNA sample remains attached to the predetermined area; and washing the removed transposase enzyme and the released DNA sample from the flow cell; 40. The method of claim 38 or 39, further comprising introducing new transposase enzyme into the flow cell, thereby reforming transposome complexes in the other zones.

41. a second predetermined area of ​​the flow cell corresponding to at least a portion of the other area; The method comprises: selectively activating a second subset of transposome complexes in the second predetermined area by heating the second predetermined area to the activation temperature and cooling at least the predetermined area of ​​the flow cell below the activation temperature; 41. The method of any one of claims 38-40, further comprising introducing a second DNA sample into the flow cell, whereby a portion of the second DNA sample binds to and is tagmented by the second subset of transposome complexes within the second predetermined area.

42. 1. A method comprising: introducing a DNA sample into a flow cell, said flow cell comprising: a substrate having recesses separated by gap regions; a polymer hydrogel located within each of the recesses; and a transposome complex immobilized in each of the recesses, introducing the DNA sample across the flow cell, whereby the DNA sample binds to the transposome complex; introducing an encapsulated composite into the flow cell, the encapsulated composite including a catalytic metal surrounded by a coating material; and selectively releasing the catalytic metal from the encapsulated complex in a predetermined area of ​​the flow cell by exposing the encapsulated complex to a mechanism that initiates removal of the coating material, thereby initiating tagmentation of a portion of the DNA sample in the predetermined area while leaving other portions of the DNA sample untagged in other areas.

43. 43. The method of claim 42, wherein the mechanism is heat, and the method further comprises cooling the other area of ​​the flow cell to prevent release of catalytic metal in the other area.

44. 43. The method of claim 42, wherein the mechanism is light.

45. 43. The method of claim 42, wherein the mechanism is a change in pH.

46. removing the transposase enzyme of each of the transposome complexes, thereby releasing the other portion of the DNA sample from the other area, whereby the portion of the DNA sample remains attached to the predetermined area; and washing the removed transposase enzyme and the other portion of the DNA sample released from the flow cell; 46. ​​The method of any one of claims 42 to 45, further comprising introducing a new transposase enzyme into the flow cell, thereby reforming transposome complexes in the other zones.

47. a second predetermined area of ​​the flow cell corresponding to at least a portion of the other area; The method comprises: introducing a second DNA sample into the flow cell, whereby the second DNA sample binds to the transposome complexes across the flow cell; introducing a second encapsulated composite into the flow cell, the second encapsulated composite including a second catalytic metal surrounded by a second coating material; 47. The method of claim 46, further comprising selectively releasing the second catalytic metal from the second encapsulated complex in the second predetermined area by exposing the second encapsulated complex to a second mechanism that initiates removal of the second coating material, thereby initiating tagmentation of a portion of the second DNA sample in the second predetermined area.

48. 1. A method comprising: introducing a DNA sample into a flow cell, said flow cell comprising: a substrate having recesses separated by gap regions; a polymer hydrogel located within each of the recesses; and a transposome complex immobilized in each of the recesses; and a removable coating overlying the transposome complex; exposing a subset of the transposome complexes at a predetermined area of ​​the flow cell by removing a portion of the removable coating from the predetermined area; and initiating tagmentation of at least a portion of said DNA sample at said predetermined area.

49. 49. The method of claim 48, wherein exposing the subset of transposome complexes involves heating the predetermined area, and the method further comprises cooling other areas of the flow cell to prevent removal of other portions of the removable coating from the other areas.

50. 49. The method of claim 48, wherein exposing the subset of transposome complexes involves exposing the predetermined area to visible light.

51. 49. The method of claim 48, wherein exposing the subset of transposome complexes involves changing the pH in the predetermined area.

52. removing a transposase enzyme from the transposome complexes in the subset; 52. The method of any one of claims 48-51, further comprising washing the transposase enzyme removed from the flow cell.

53. a second predetermined area of ​​the flow cell corresponding to at least a portion of the other area; The method comprises: introducing a second DNA sample into the flow cell; exposing a second subset of the transposome complexes at the second predetermined area of ​​the flow cell by removing a second portion of the removable coating from the second predetermined area; 53. The method of claim 52, further comprising: initiating tagmentation of at least a portion of said second DNA sample at said second predetermined area.

54. A kit comprising: A flow cell, a substrate having recesses separated by gap regions; a polymer hydrogel located within each of the recesses; and a set of amplification primers attached to the polymer hydrogel in each of the recesses; a flow cell comprising: a target primer attached to the polymer hydrogel in each of the wells, wherein the target primers attached in the wells located in a first region of the flow cell are orthogonal to the target primers attached in the wells located in a second region of the flow cell; a first fluid, A liquid carrier; a first fluid comprising a first plurality of transposome complexes dispersed in the liquid carrier, each of the first plurality of transposome complexes comprising a first spatial tag complementary to the target primer attached within the recess located in the first region of the flow cell; and a second fluid, A liquid carrier; a second fluid comprising a second plurality of transposome complexes dispersed in the liquid carrier, each of the second plurality of transposome complexes comprising a second spatial tag complementary to the target primer attached within the recess located in the second region of the flow cell.

55. each first spatial tag is attached to the 5' end of the transferred strand of each of the first plurality of transposome complexes; 55. The kit of claim 54, wherein each second spatial tag is attached to the 5' end of the transferred strand of each of the second plurality of transposome complexes.

56. a portion of the first spatial tag is attached to the 5' end of each transferred strand of a portion of the first plurality of transposome complexes; another portion of the first spatial tag is attached to the 3′ end of the non-transferred strand of another portion of the first plurality of transposome complexes, respectively; a portion of the second spatial tag is attached to the 5' end of each transferred strand of a portion of the second plurality of transposome complexes; 55. The kit of claim 54, wherein another portion of the second spatial tag is attached to the 3' end of a non-transferred strand of another portion of the second plurality of transposome complexes, respectively.

57. 55. A method for using the kit of claim 54, said method comprising: operably placing the flow cell within a sequencing instrument; a perfectly matched first DNA sample fragment in the first region of the flow cell; introducing the first fluid into the flow cell at a hybridization temperature, whereby the first spatial tags hybridize to the target primers attached within the recesses located in the first region of the flow cell, respectively; introducing a first DNA sample into the flow cell, whereby the first DNA sample is tagmented by the first plurality of transposome complexes; removing the transposase enzyme from each of the first plurality of transposome complexes; and performing a gap-fill ligation or extension reaction; a perfectly matched second DNA sample fragment in the second region of the flow cell; introducing the second fluid into the flow cell at a hybridization temperature, whereby the second spatial tags hybridize to the target primers attached within the recesses located in the second region of the flow cell, respectively; introducing a second DNA sample into the flow cell, whereby the second DNA sample is tagmented by the second plurality of transposome complexes; removing the transposase enzyme from each of the second plurality of transposome complexes; and and generating the fragment by performing a gap-fill ligation or extension reaction.

58. 55. A method for using the kit of claim 54, said method comprising: operably placing the flow cell within a sequencing instrument; exposing the first plurality of transposome complexes to a first DNA sample, whereby the first DNA sample binds to at least a portion of the first plurality of transposome complexes to form first bound complexes; introducing the first binding complex into the flow cell, whereby the first spatial tags hybridize to the target primers attached within the recesses located in the first region of the flow cell, respectively; passivating the first binding complex in the first region of the flow cell; exposing the second plurality of transposome complexes to a second DNA sample, whereby the second DNA sample binds to at least a portion of the second plurality of transposome complexes to form second bound complexes; introducing the second binding complex into the flow cell, whereby the second spatial tags each hybridize to the target primers attached within the recesses located in the second region of the flow cell.

59. 59. The method of claim 58, further comprising passivating the second binding complex in the second region of the flow cell.

60. 60. The method of claim 58 or 59, wherein passivating the first binding complex involves attaching an antifouling agent to the first binding complex.

61. 60. The method of claim 58 or 59, wherein passivating the first binding complex involves forming a hydrophobic polymer shell over the first binding complex.

62. depassivating the first binding complex in the first region of the flow cell; 62. The method of any one of claims 58-61, further comprising simultaneously initiating formation of a respective set of perfectly matched DNA fragments in each of the first and second regions of the flow cell.

63. 55. A method for using the kit of claim 54, said method comprising: operably placing the flow cell within a sequencing instrument; a partially adapted first DNA sample fragment in the first region of the flow cell; introducing the first fluid into the flow cell at a hybridization temperature, whereby the first spatial tags hybridize to the target primers attached within the recesses located in the first region of the flow cell, respectively; introducing a first DNA sample into the flow cell, whereby the first DNA sample is tagmented by the first plurality of transposome complexes; and generating each of the first plurality of transposome complexes by removing a transposase enzyme; a partially adapted second DNA sample fragment in the second region of the flow cell; introducing the second fluid into the flow cell at a hybridization temperature, whereby the second spatial tags hybridize to the target primers attached within the recesses located in the second region of the flow cell, respectively; introducing a second DNA sample into the flow cell, whereby the second DNA sample is tagmented by the second plurality of transposome complexes; and generating each of the second plurality of transposome complexes by removing a transposase enzyme; performing a gap-fill ligation or extension reaction, thereby generating perfectly matched first and second DNA sample fragments.

64. 1. A method comprising: depositing a set of amplification primers along a flow cell lane; sequentially attaching orthogonal target primers to at least two different regions of said flow cell lane.

Images