In vitro cell-free protein synthesis systems, methods and applications for inserting unnatural amino acids

The described reaction system improves in vitro protein synthesis efficiency by using Lactobacillus Kluyveromyces yeast cells and bioorthogonal translation systems to introduce unnatural amino acids, achieving high insertion efficiency and enabling click chemistry modifications, addressing stability and efficiency issues in existing technologies.

JP2026501629APending Publication Date: 2026-01-16KANGMA (SHANGHAI) BIOTECH LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025538714
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-01-02
Filing Date
2023-12-29
Publication Date
2026-01-16

AI Technical Summary

Technical Problem

Current in vitro protein synthesis systems face challenges such as reversibility, instability, leakage, inactivation, and enzyme recycling, and lack stable enzymes and enzyme complexes, particularly when incorporating unnatural amino acids, limiting their efficiency and stability.

Method used

A reaction system comprising a cell extract, an unnatural amino acid, an exogenous orthogonal aminoacyl-tRNA synthetase/tRNA pair, and a template with mutated stop codons, specifically using Lactobacillus Kluyveromyces yeast cells and bioorthogonal translation systems to site-specifically introduce unnatural amino acids into proteins.

Benefits of technology

The system achieves high efficiency in synthesizing proteins with unnatural amino acids, with insertion efficiencies up to 99.81% and enables post-translational modifications using click chemistry, enhancing protein stability and functionality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026501629000001_ABST
    Figure 2026501629000001_ABST
Patent Text Reader

Abstract

The present invention provides an in vitro cell-free protein synthesis system for inserting an unnatural amino acid, the reaction system comprising (1) a yeast cell extract, (2) an unnatural amino acid, (3) an exogenous orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair, and (4) a template comprising a gene sequence of a target protein in which the codon for at least one encoded amino acid is mutated to a stop codon. Use of the reaction system of the present invention can improve the efficiency of inserting an unnatural amino acid and the expression level of an unnatural amino acid protein.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to the field of biotechnology, preferably to an in vitro cell-free protein synthesis system for inserting unnatural amino acids. [Background technology]

[0002] Proteins are important molecules in cells and are essentially involved in carrying out all cellular functions. Their functions are determined by their sequence and structure. Within cells, proteins can catalyze various biochemical reactions as enzymes, coordinate various biological activities as signaling molecules, support the morphology of living organisms, store energy, transport molecules, and even enable the movement of living organisms. In the biomedical field, protein antibodies are important tools for treating diseases such as cancer as targeted drugs.

[0003] In cells, protein synthesis involves two parts: gene transcription and mRNA translation.

[0004] Gene transcription refers to the process of synthesizing a single strand of RNA using a single strand of DNA as a template, catalyzed by DNA-dependent RNA polymerase (RNP or RNAP), and four NTPs (ATP, CTP, GTP, and UTP) according to the rules of complementary base pairing. For certain RNA viruses, RNA can direct RNA synthesis.

[0005] Translation of mRNA into protein refers to the process of assembling activated amino acids into a polypeptide chain in a ribosome (also called a nucleoprotein) using mRNA as a template, tRNA as a carrier, and associated enzymes and cofactors.

[0006] Regulation of protein synthesis includes transcriptional and translational control and plays an important role in many processes, such as responding to external stresses such as malnutrition, and cell growth and differentiation.

[0007] Transcriptional regulation refers to the regulation of RNA synthesis using DNA as a template. All cells possess a large number of sequence-specific DNA-binding proteins (trans-acting factors), which can precisely identify and bind to specific DNA sequences (cis-acting elements), acting as a switch at the transcriptional level. Transcriptional regulation is an important part of the regulation of eukaryotic gene expression. Depending on how eukaryotic gene expression is affected by the environment, it can be classified as developmental regulation or instantaneous regulation. Developmental regulation refers to the "predetermined" and "ordered" regulation of gene expression that eukaryotes undergo to ensure their own growth, development, differentiation, etc., and is an irreversible process. Instantaneous regulation refers to adaptive transcriptional regulation that eukaryotes undergo in response to stimuli from their internal and external environments, and is a reversible process.

[0008] Translation control involves four processes: translation initiation, translation elongation, translation termination, and ribosome recycling, of which translation initiation is the most highly regulated process. During translation initiation, the ribosomal small subunit (40S) binds to (tRNA)iMet and, under the action of translation initiation factors, identifies the 5' end of mRNA. The small subunit moves downstream and binds to the ribosomal large subunit (60S) at the initiation codon (AUG), forming a complete ribosome before proceeding to the translation elongation phase.

[0009] Currently, the most commonly used biosynthetic systems are in vivo biosynthetic systems and in vitro biosynthetic systems. In vivo biosynthetic systems refer to the enzyme-catalyzed synthesis of various compounds in biological in vivo systems. This refers to the anabolic reactions that occur in living organisms, including photosynthesis, gluconeogenesis, and the biosynthesis of nucleotides, nucleic acids, and proteins. Protein synthesis is the most important step in cellular biosynthesis. Protein biosynthesis, also known as translation, is the process of converting the order of base sequences in mRNA molecules into the order of amino acids in a protein or polypeptide chain. Protein biosynthesis can be divided into five stages: amino acid activation, initiation of polypeptide chain synthesis, peptide chain elongation, peptide chain termination and release, and post-protein synthesis processing and modification.

[0010] An in vitro biosynthesis system refers to a bacterial, fungal, plant, or animal cell dissociation system that adds exogenous coding nucleic acid DNA or RNA, substrates, and an energy source to achieve high-efficiency in vitro synthesis of specific chemical molecules or biological macromolecules (DNA, RNA, or protein). A common in vitro biosynthesis system is an in vitro protein synthesis system, i.e., a cell-free protein synthesis system that uses cell dissociation products to achieve rapid and highly efficient translation of exogenous recombinant proteins using exogenous mRNA or DNA templates.

[0011] The development of cell-free systems can be traced back to the first in vitro biosynthesis proposed by Buchner in 1897. He demonstrated the generation of bioethanol using a yeast cell-free system. However, due to an imbalance of adenosine triphosphate (ATP), the system was not suitable for large-scale application. Welch and Scopes solved this problem through trial and error in 1985, obtaining high yields of ethanol. However, the system had two drawbacks: the need for additional, costly enzymes and its inability to withstand temperature changes.

[0012] However, currently, this technology has some inherent problems that are difficult to solve, such as reversibility, instability, leakage, inactivation, and enzyme recycling, and there is a lack of stable enzymes, enzyme complexes, and cofactors.

[0013] A commonly available in vitro protein synthesis system is the in vitro transcription-translation coupled system (IVTT), which uses a DNA template to transcribe mRNA intermediates via RNA polymerase, and then uses components such as amino acids and ATP to achieve highly efficient translation of the exogenous protein. Currently, commonly available in vitro protein expression systems include Escherichia coli extract (ECE), rabbit reticulocyte lysate (RRL), wheat germ extract (WGE), insect cell extract (ICE), and human systems.

[0014] Compared with conventional in vivo recombinant expression systems, in vitro cell-free protein synthesis systems have various advantages, such as the ability to express special proteins that are cytotoxic or contain unnatural amino acids (e.g., D-amino acids), the ability to directly synthesize multiple proteins in parallel using PCR products as templates, and the ability to perform high-throughput drug screening and proteomics studies.

[0015] As key sites for post-translational protein modification and key residues at the center of multiple enzymatic activities, unnatural amino acids play a crucial role in the physiological and pathological functions of multiple proteins. For proteins, especially polypeptide drugs, unnatural amino acid modifications can not only enhance the efficacy and reduce toxicity of polypeptide drugs, but also significantly reduce the immunogenicity of polypeptide drugs, alleviating immune rejection and preventing certain proteases from recognizing polypeptides containing unnatural amino acids, thereby enabling drugs to be maintained in vivo without degradation for a longer period of time, thereby extending the half-life of the drug and eliminating the drawbacks of frequent injections of polypeptide drugs. Furthermore, the incorporation of other chemical accessories into polypeptide drugs through modifications is expected to lead to new methods for treating diseases.

[0016] Post-translational protein modifications achieved by localized modification of unnatural amino acids are of great significance for the synthesis of specific polypeptides or proteins, and the influence of chemically modified amino acids on the structure and function of proteins.

[0017] At present, the relatively mature technology for artificially synthesizing proteinaceous substances with unnatural amino acid localized modifications is polypeptide chemical synthesis technology, which can achieve the synthesis of specific short fragments by liquid phase or solid phase synthesis, but such methods have obvious limitations: liquid phase synthesis mainly relies on the spontaneous binding of amino acids in the reaction system, so efficiency cannot be guaranteed, and it is necessary to finally separate the raw materials, activators, etc. in the reaction system, making it relatively difficult to obtain pure polypeptide products. Summary of the Invention

[0018] An object of the present invention is to provide a reaction system, a reagent kit, and a reaction method that improve the efficiency of protein synthesis containing unnatural amino acids.

[0019] In a first aspect of the present invention, the reaction system comprises: (1) a cell extract; (2) an unnatural amino acid; (3) an exogenous orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair; (4) a template containing a gene sequence of a target protein in which at least one codon for the encoded amino acid is mutated to a stop codon; and

[0020] In another preferred embodiment, the stop codon is mutated to TAG.

[0021] In another preferred embodiment, the codon for one amino acid in the target protein gene sequence is mutated to a stop codon.

[0022] In another preferred embodiment, two or more amino acid codons in the target protein gene sequence are mutated to stop codons.

[0023] In another preferred embodiment, the cell extract is preferably selected from any one of Escherichia coli, yeast cells, mammalian cells, plant cells, insect cells, or a combination thereof.

[0024] In another preferred embodiment, the cell extract is more preferably selected from any one of Escherichia coli, Lactobacillus kluyveromyces yeast, wheat germ cells, Spodoptera frugiperda insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof.

[0025] In another preferred embodiment, the yeast cells are preferably Pichia yeast, Pichia finlandica, trehalophilic Pichia yeast, Pichia koclamae, membrane-forming Pichia yeast, Pichia membranaefaciens, Pichia minuta (methanol-inducible Pichia yeast, Pichia lindneri), cactus Pichia yeast, thermotolerant Pichia yeast, Pichia salictaria, oak Pichia yeast, Pichia pijperi, tree Pichia yeast, methanol-inducible Pichia yeast, Pichia methanolica), Pichia yeast (Pichia sp.), Saccharomyces yeast (Saccharomyces cerevisiae), Saccharomyces sp., polymorphic Hansenula yeast (Hansenula polymorpha), Kluyveromyces yeast, lactic Kluyveromyces yeast (Kluyveromyces, K. lactis), Kluyveromyces marxianus, Kluyveromyces marxianus var. lactis, Kluyveromyces marxianus var. marxianus, Kluyveromyces marxianus var.vanudenii, Dobzhanskii Kluyveromyces yeast (Kluyveromyces dobzhanskii), Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yarowii yarrowii) or a combination thereof. In another preferred embodiment, the Kluyveromyces yeast is most preferably selected from Marcus Kluyveromyces yeast and / or Lactobacillus Kluyveromyces yeast.

[0026] In another preferred embodiment, the yeast cell extract is an aqueous extract of yeast cells.

[0027] In another preferred embodiment, the yeast cell extract does not contain endogenous long nucleic acid molecules of the yeast.

[0028] In another preferred embodiment, the yeast cell extract comprises: (i) providing yeast cells; (ii) performing a washing treatment on the yeast cells to obtain washed yeast cells; (iii) subjecting the washed yeast cells to cell disruption treatment to obtain a crude yeast extract; (iv) subjecting the crude yeast extract to solid-liquid separation, and obtaining the liquid portion as a yeast cell extract.

[0029] In another preferred embodiment, centrifugation is performed in a liquid.

[0030] In another preferred embodiment, the centrifugation conditions are 5,000-100,000 g, preferably 8,000-30,000 g.

[0031] In another preferred embodiment, the centrifugation time is 0.5 min-2 h, preferably 20-50 min.

[0032] In another preferred embodiment, the centrifugation is carried out at 1-10°C, preferably at 2-6°C.

[0033] In another preferred embodiment, the washing treatment is carried out using a washing solution at a pH value of 7-8 (preferably 7.4).

[0034] In another preferred embodiment, the cleaning solution is selected from the group consisting of potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0035] In another preferred example, the cell disruption treatment includes high-pressure disruption and freeze-thaw (for example, at liquid nitrogen low temperature) disruption.

[0036] In another preferred embodiment, the structural formula of the unnatural amino acid is: [ka] wherein n is selected from a natural number of 1 to 20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl group, a substituted or unsubstituted C1-C20 alkyl group, a substituted or unsubstituted C2-C20 alkenyl group, or a substituted or unsubstituted C2-C20 alkynyl group, and A is selected from O or -CH2-.

[0037] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0038] In another preferred embodiment, n is a natural number selected from 1-10.

[0039] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0040] In another preferred embodiment, n is a natural number selected from 1-6.

[0041] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, or 6.

[0042] In another preferred example, R1 is selected from a substituted or unsubstituted C5-C30 aryl group or heteroaryl group.

[0043] In another preferred example, R1 is selected from substituted or unsubstituted phenyl groups.

[0044] In another preferred example, R1 is selected from substituted or unsubstituted C2-C20 alkenyl groups.

[0045] In another preferred example, R1 is selected from substituted or unsubstituted C2-C10 alkenyl groups.

[0046] In another preferred example, R1 is selected from substituted or unsubstituted C2-C6 alkenyl groups.

[0047] In another preferred example, R1 is selected from substituted or unsubstituted C2-C20 alkynyl groups.

[0048] In another preferred example, R1 is selected from substituted or unsubstituted C2-C10 alkynyl groups.

[0049] In another preferred example, R1 is selected from substituted or unsubstituted C2-C6 alkynyl groups.

[0050] In another preferred embodiment, A is selected from O.

[0051] In another preferred embodiment, A is selected from -CH2-.

[0052] In another preferred example, the substituent is a common substituent functional group in this field, such as an aryl group, a heteroaryl group, an alkyl group, a cycloalkyl group, an aryloxy group, a heteroaryloxy group, an alkoxy group, a cycloalkoxy group, a hydroxyl group, a sulfhydryl group, an ester group, a carboxy group, a cyano group, a halogen, a nitro group, a sulfo group, an azide group, an alkenyl group, an alkynyl group, or a phosphate group.

[0053] In another preferred embodiment, the structural formula of the unnatural amino acid is: [ka] or a combination thereof.

[0054] In another preferred example, the concentration of the unnatural amino acid in the reaction system ranges from 0.1 to 1000 mmol / L, preferably from 0.5 to 500 mmol / L, and more preferably from 5 to 100 mmol / L.

[0055] In another preferred embodiment, the exogenous orthogonal aminoacyl-tRNA synthetase is selected from naturally occurring or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS), or TrP-tRNA synthetase (TrpRS), and the tRNA is selected from naturally occurring or mutant tRNAPyl, tRNALeu, tRNATyr, tRNAPhe, or tRNATrp.

[0056] In another preferred embodiment, the exogenous orthogonal aminoacyl-tRNA synthetase is selected from naturally occurring or mutated MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, and BsTrpRS, and is preferably MaPylRS.

[0057] In another preferred example, the concentration range of the enzyme in the reaction system is 0.001 to 1 mmol / L, preferably 0.005 to 0.1 mmol / L, and more preferably 0.005 to 0.05 mmol / L.

[0058] In another preferred example, the concentration of the tRNA in the reaction system ranges from 0.001 to 1 mmol / L, preferably from 0.005 to 0.1 mmol / L, and more preferably from 0.02 to 0.1 mmol / L.

[0059] In another preferred embodiment, the target protein is selected from luciferin, luciferase, green fluorescent protein, yellow fluorescent protein, red fluorescent protein, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, antibody variable regions, luciferase mutants, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

[0060] In another preferred embodiment, the system further comprises one or more of the following components: a buffering agent, potassium ions, magnesium ions, polyethylene glycol, an optional aqueous solvent, and a phosphate salt.

[0061] In another preferred embodiment, the buffer is selected from the group consisting of Tris-HCl, Tris base, HEPES, Tris-citrate, citric acid-citrate, Tris-citrate, or a combination thereof.

[0062] In another preferred embodiment, the potassium ions are derived from a potassium ion source, which is not particularly limited, and the potassium ion source is selected from the group consisting of potassium acetate, potassium glutamate, potassium citrate, or a combination thereof.

[0063] In another preferred embodiment, the concentration of the potassium ions is 30-210 mM, preferably 30-150 mM, and most preferably 30-80 mM.

[0064] In another preferred example, the magnesium ions are derived from a magnesium ion source, including but not limited to, magnesium acetate, magnesium glutamate, magnesium citrate, magnesium aspartate, or a combination thereof.

[0065] In another preferred embodiment, the polyethylene glycol is selected from the group consisting of PEG3000, PEG8000, PEG6000, PEG3350, or a combination thereof.

[0066] In another preferred embodiment, the phosphate is selected from orthophosphate, dihydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, or a combination thereof, preferably orthophosphate.

[0067] In another preferred example, the concentration of the cell extract v / v is 20 to 80%.

[0068] In another preferred embodiment, the concentration (w / v) of the polyethylene glycol is 0.1-8%, preferably 0.5-4%, and most preferably 1-2%.

[0069] A second aspect of the present invention provides a reagent kit comprising: (a) a container; and (b) a synthesis system according to any one of the first aspects of the present invention located within the container.

[0070] A third aspect of the present invention provides a method for synthesizing a protein comprising an unnatural amino acid in a cell-free system, the method being produced using the synthesis system described in any one of the first aspect of the present invention or the reagent kit described in the second aspect of the present invention.

[0071] A fourth aspect of the present invention provides an application of the system according to the first aspect of the present invention or the reagent kit provided by the second aspect of the present invention in the synthesis of proteins containing unnatural amino acids.

[0072] A fifth aspect of the present invention provides a protein comprising an unnatural amino acid, produced by the synthesis system according to any one of the first aspect of the present invention, the reagent kit according to the second aspect of the present invention, or the method according to the third aspect of the present invention.

[0073] A sixth aspect of the invention provides the application of the unnatural amino acids provided by the fifth aspect of the invention in the click chemistry modification of proteins.

[0074] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (e.g., in the Examples) can be combined with each other to form new or preferred embodiments, which will not be described in detail here to avoid redundant text. [Brief explanation of the drawings]

[0075] [Figure 1] 1 shows a schematic diagram of the MaPylRSpET28a plasmid constructed according to the present invention. [Figure 2] 1 shows a schematic diagram of the pET28a-tRNAPylCUA plasmid constructed according to the present invention. [Figure 3] The constructed single-site transgenic reporter gene is shown. [Figure 4]1 shows a schematic diagram of a double fluorescent reporter gene according to the present invention. Its purpose is to detect the insertion efficiency and certainty of unnatural amino acids. OTS: orthogonal translation system: a bioorthogonal protein translation system. ncAA: noncanonical amino acid: a nonnatural amino acid. F: the natural amino acid Phe. X: noncanonical amino acid: a nonnatural amino acid. [Figure 5] The Proteinfactory unnatural amino acid insertion reporter gene and different OTS components of the present invention were shown, and the expression supernatant was purified using a nickel column. NC indicates ncaa alone, PC indicates the positive control, the ETC on the left indicates the ncaa reporter gene + OTS, ET indicates the ncaa reporter gene + o-aars + o-tRNA, EC indicates the ncaa reporter gene + o-aars + ncaa, and the ETC on the right indicates the repeatedly used ncaa reporter gene + OTS (o-aars + o-tRNA + ncaa). [Figure 6.1] This shows the predicted expression level of a target protein containing an unnatural amino acid based on proteinfactory-OTS. [Figure 6.2] After purifying the target protein, SDS-PAGE electrophoresis was performed. The expression level was predicted using ImageJ software. The gray value of the eGFP-ncaa-scarlet protein band was approximately 0.357-fold that of the input O-aaRs. The concentration of the input O-aaRs was 1.2 mg / ml. Therefore, the expression level of eGFP-ncaa-scarlet protein was calculated to be approximately 0.43 mg / ml. [Figure 7] Mass spectrometry analysis of proteins labeled with unnatural amino acids shows that the relative content of proteins labeled with unnatural amino acids is 99.81%. [Figure 8] Fluorescence values ​​of purified proteins labeled with unnatural amino acids are shown. [Figure 9]The concentration (mg / ml) of the purified protein was estimated using the BCA standard curve, and the total amount of expressed protein was estimated using the fluorescence value of the purified protein. [Figure 10] This figure shows the results of click chemistry labeling of a POCK-inserted reporter gene. A click chemistry experiment was performed using purified reporter gene protein and reacted with azide-CY5. The fluorescence image shows the target protein labeled with red fluorescence after the reaction. A is a CBB staining image, and B is a fluorescence image. 1 and 3 show denatured samples after labeling, 2 and 4 show undenatured samples after labeling, and 5 shows a denatured sample before labeling. The red light indicates CY5 protein (610 nm), and the blue light indicates GFP protein (435 nm). [Figure 11] The ncaa two-site insertion gene constructed according to the present invention shows the GFP151 site Y codon mutated to TAG to detect the insertion of an unnatural amino acid. The first insertion site is located between the two tags (8*Histag) and (3*Flag) at the N-terminus of the entire GFP protein, which has little effect on the structure and fluorescence intensity. The second insertion site is 151Tyr. Based on the structure of EGFP, 151Tyr is located outside the barrel structure, which is expected to have a relatively small effect on the structure. Sequencing results showed that the mutations were as expected. [Figure 12] 1 shows the structure and effect of the ncaa two-site insertion protein synthesized according to the present invention. [Figure 13] The ncaa three-site insertion gene constructed according to the present invention is shown, with two K sites selected for the third insertion site. The third unnatural amino acid insertion site, 105Tyr, was selected, which is also located outside the EGFP barrel structure and does not affect the fluorescent characteristics. Sequencing results demonstrated that the mutations were accurate and in line with the expected design. [Figure 14]Fluorescence images of proteins synthesized using the ncaa three-site insertion gene are shown. 1 shows the expression supernatant (MW = 35 KDa) of a GFP gene with three TAG sites (three sites) in a cell-free in vitro orthogonal translation system. 2 shows the expression supernatant (MW = 58.5 KDa) of a TEV enzyme-TEV cleavage site (with TAG mutation)-EGFP gene fusion. This construct contains an insertion site for one unnatural amino acid. GFP can be expressed and exhibits green fluorescence only when the unnatural amino acid is inserted into the synthesized polypeptide chain. At the same time, due to the unnatural amino acid mutation at the TEV cleavage site, it cannot be recognized by TEV. The molecular weight of the fusion protein is 58.5 KDa. 3 shows a sample of 1 purified using a Ni column. 4 shows a sample of 2 purified using a Ni column. This demonstrates that GFP genes with three TAG stop codons can also be expressed in a cell-free in vitro orthogonal translation system. Fusion proteins with TEV tags also demonstrate that TAG can introduce unnatural amino acids into protein polypeptide chains. DETAILED DESCRIPTION OF THE INVENTION

[0076] After extensive research, selection, and exploration, we unexpectedly discovered a reaction system that can improve the synthesis efficiency of proteins containing unnatural amino acids. In an in vitro synthesis system using Lactobacillus Kluyveromyces yeast cells, the insertion efficiency of a single unnatural amino acid (POCK, or Pock, or pock, i.e., the compound Proclys) into a standard protein (eGFP) reached 99.81%, and the protein expression level of the target protein reached 0.43 mg / ml after the introduction of the NACC. Furthermore, experiments further demonstrated that proteins containing unnatural amino acids can be modified using click chemistry.

[0077] The objective of the present invention is to construct a eukaryotic cell-based in vitro protein translation and site-specific modification system. The basic technical approach is to add a bioorthogonal translation system (OTS) to the ProteinFactory system. The OTS contains atypical aminoacyl-tRNA synthetases (O-aaRs) that use unnatural amino acids (ncaa) as substrates, and an O-tRNA that is recognized by the ncaaRS. The O-tRNA binds to the cell's native aminoacyl-tRNA synthetases, making it bioorthogonal and unavailable for aminoacylation as a substrate.

[0078] O-aaRs can specifically catalyze the aminoacylation reaction between o-tRNA and ncaa, and the anticodon of the o-tRNA is typically modified to pair with the amber stop codon (TAG), recognizing the mRNA signal that terminates naturally and translating it into an unnatural amino acid. The chemically reactive functional groups of these unnatural amino acids can then be covalently linked to probe molecules or other molecules via click chemistry to achieve specific modifications of target proteins.

[0079] In the following examples: [ka] (i.e., POCK) is selected as the ncaa, but the ncaa of the present application is not limited to POCK.

[0080] The terms "expression system of the present invention," "in vitro expression system of the present invention," "in vitro cell-free expression system," and "in vitro cell-free expression system" can be used interchangeably and refer to the in vitro protein expression system of the present invention. Other terms, such as protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system), etc. may also be used. Depending on the reaction mechanism, in vitro translation system (abbreviated as IVT system, which is the mR2P system), in vitro transcription translation system (abbreviated as IVTT system, which is the D2P system), in vitro replication transcription translation system (abbreviated as IVDTT system, which is the D2P system), etc. are also included. In the present invention, the IVTT system is preferred. The in vitro protein synthesis system is also referred to as a "protein factory." The in vitro protein synthesis system provided by the present invention employs an open description method for its components.

[0081] The final concentrations of the components in the Protein Factory of the present invention were 80% (v / v) lactate Kluyveromyces yeast extract, 15 mM glucose, 320 mM maltodextrin (molar concentration measured in terms of glucose monomer), 24 mM potassium phosphate tripotassium, 1.8 mM nucleoside triphosphate mixture (a mixture of adenine nucleoside triphosphate, guanine nucleoside triphosphate, cytosine nucleoside triphosphate, and uracil nucleoside triphosphate, the final concentration of each nucleoside triphosphate being 1.8 mM), 0.7 mM amino acid mixture ( The extract contains glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, and histidine (final concentration of each amino acid is 0.7 mM), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM pH 8.0 Tris·HCl buffer, and 6% (w / v) trehalose. The extract contains endogenously expressed T7 RNA polymerase. The extract is prepared by conventional techniques according to the method described in CN109593656A. The manufacturing process involves providing an appropriate amount of fermented Kluyveromyces lactis yeast cells as raw material, flash-freezing the cells in liquid nitrogen, disrupting the cells, and collecting the supernatant by centrifugation to obtain a cell extract with a protein concentration of 20-40 mg / mL.

[0082] Example 1: Purification of MaPylRs protein 1.1 Construction of MaPylRSpET28a plasmid This PylRSs (pyrrolysyl-tRNA synthetase) is derived from Candidatus Methanomethylophilus alvus (a peritoneal anaerobic ammonoxidizing methanomethylophilus), and has the gene sequence number WP_015505008. It was synthesized by codon preference optimization (Synthesis) and then cloned into the NcoI / BamHI sites of the E. coli expression vector pET28a (see Figure 1).

[0083] 1.2 Inducible expression of MaPyLRs: The pET28a-MaPylRs plasmid was transformed into E. coli competent BL (DE3) cells.

[0084] Monoclonal cells were selected and cultured overnight in 100 ml of LB medium containing 50 mg / ml kanamycin for expansion. 1000 ul of the culture was added to 1 L of LB medium containing 50 mg / ml kanamycin and cultured overnight at 37°C. When the bacterial density (OD600) reached 0.6, IPTD was added to a final concentration of 0.2 mM, and the culture was transferred to 16°C and continued for 20 hours.

[0085] 1.3 Purification of MaPyLRs: The induced and expressed cells were collected by centrifugation, disrupted using a high-pressure homogenizer, and centrifuged at 12,000 rpm to remove the precipitate. The supernatant was purified using HisTrpFF (GE). Equilibration buffer A was 25 mM TrisHCl (pH 7.6), 20 mM imidazole, and 5% glycerol. Elution buffer B was 25 mM TrisHCl (pH 7.6), 250 mM imidazole, and 5% glycerol. Gradient elution was performed using the standard purification process.

[0086] 1.4 Concentration of MaPyLRs: The combined eluted proteins were concentrated in an ultrafiltration centrifuge concentration tube (Millipore). The concentrated sample was dialyzed overnight against Buffer A.

[0087] Protein concentration was quantified by the 1.5 BCA method.

[0088] MaPylRS was obtained.

[0089] Example 2: In vitro transcription of tRNAPylCUA 2.1 Construction of pET28a-tRNAPylCUA plasmid The tRNApylCUA gene sequence is Genebank number: CP017686.1. The target fragment was amplified by PCR, and GGGGGACGGTCCGGCGACCAGCGGGTCTCTAAAACCTAGCcAGCGGGGTTCGACACCCCGGTCTCTCGcca (SEQ ID No: 2) was ligated downstream of the T7 promoter in the PET28a vector (see Figure 2).

[0090] Example 3: Construction of a single-site transgenic reporter gene Using pD2P8His-EGFP as a template, we first inserted a stop codon, TAG, and a Flag tag between the 8His tag and the reporter gene by PCR. In the second step, we replaced the 8His tag in the original template with a Stag tag. Finally, we constructed a stable reporter gene, as shown in Figure 3.

[0091] Primer: Insert TAG-Flag tag: Primer1: ACCACCACCACGGTTAGGGTGGGGACTACAAGGATCACGACG(SEQ ID No:3) Primer2: ctccatggctGGATCCCTTATCGTCGTCATCCTTGTAATCG(SEQ ID No:4) Corresponding vector PCR primers: primer3: TTGTAGTCCCCACCCTAACCGTGGTGGTGGTGGTG(SEQ ID No:5) Primer4: TACAAGGATGACGACGATAAGGGATCCagccatggaggaag(SEQ ID No:6) Insert the stag tag to replace the 8His tag: Primer5: ACTCTGGTAAGaaggaaaccgctgctgctaaattcgaacgccagc(SEQ ID No:7) Primer 6: Vector PCR primer corresponding to CCCCACCCTAACCgctgtccatgtgctggcgttcgaatttagcagc (SEQ ID No: 8): Primer7: cagcggtttccttCTTACCAGAGTGAGAGAAGATAGATCTGAATGG(SEQ ID No:9) Primer8: cgccagcacatggacagcGGTTAGGGTGGGGACTACAAGGATCAC(SEQ ID No:10) The final reporter gene sequence is SEQ ID No:11.

[0092] Example 4: Insertion of an unnatural amino acid (Pock) into the EGFP polypeptide chain Cell-free in vitro translation conditions: Add ddH2O to Protein Factory and dissolve. 1ml protein factory 10ul 500mM pock (final concentration 5mM) 20uM MaPylRs (final concentration) 20uM tRNA pyl CUA (Final concentration) Target gene template PCR product 30 ul The reaction was carried out at 28°C overnight to obtain the target protein.

[0093] Example 5: Determination of the efficiency and certainty of insertion of unnatural amino acids To detect the efficiency and accuracy of the insertion of unnatural amino acids, two double fluorescent reporter genes were designed (Figure 4).

[0094] The read-through efficiency of the stop codon for introducing an unnatural amino acid is indicated by RRE (relative read-through efficiency). rfp(TAG+ncaa) and rfp(positive control) indicate the expression levels of the TAG reporter gene and the positive control group (natural amino acids) C-terminal fluorescent protein, respectively, when added to the orthogonal translation system. gfp(TAG+ncaa) and gfp(positive control) indicate the expression levels of the TAG reporter gene and the positive control group (natural amino acids) N-terminal fluorescent protein, respectively, when added to the orthogonal translation system.

[0095] An RRE closer to 1 indicates that the insertion efficiency of the unnatural amino acid is close to that of the natural amino acid. The maximum mistranslation frequency (MMF) is the frequency of misintroduction of the natural amino acid at the target site in the product.

[0096] Correspondingly, the ratio of unnatural amino acids at that position is 1-MMF.

[0097] In an ideal situation, when no unnatural amino acid is added, the expression of the C-terminal fluorescent protein is zero, i.e., RRE(TAG-ncaa) = 0. Therefore, when MMF approaches 0, the ratio of unnatural amino acids introduced is high, indicating that only the expected unnatural amino acid has been inserted into the specific site of the target protein.

[0098] Test Results: By adding OTS to the protein factory, read-through of the stop codon was achieved.

[0099] 1. The process is specific because only when the complete OTS is added can the scarlet (red) color following the ncaa-reporterTAG codon be translated and expressed, causing the cell supernatant to change color from green to red (ETC sample in Figure 5), as shown in Figure 5.

[0100] Based on Protein factory-OTS, the expression level of a target protein containing an unnatural amino acid was predicted (Figure 6.1). After purifying the target protein, SDS-PAGE electrophoresis was performed and the expression level was predicted using ImageJ software (Figure 6.2). The gray value of the eGFP-ncaa-scarlet protein band was approximately 0.357-fold that of the input O-aaRs. The concentration of the input O-aaRs was 1.2 mg / ml. Therefore, the expression level of the eGFP-ncaa-scarlet protein was approximately 0.43 mg / ml.

[0101] Mass spectrometry analysis of the proteins labeled with unnatural amino acids revealed that the relative content of proteins labeled with unnatural amino acids was 99.81% (Figure 7).

[0102] After the protein was purified, the yield of the unnatural amino acid-introduced protein was determined to be 278 μg / ml by the BCA method (FIGS. 8 and 9).

[0103] Example 5: Application in click chemistry modification of proteins containing unnatural amino acids (1) Preparation of preservative solution: 1.20 mM CuSO4: 31 mg CuSO4 was dissolved in 10 ml of sterile ddH2O, dispensed, and stored at -20°C. 2.50 mM THPTA: 1 mg THPTA (cas760952-88-3sigma) was dissolved in 46 μl ddH2O and stored at -20°C. 3. 100 mM BTTAA: 4.3 mg BTTAAHY-100486MCE was dissolved in 100 ul DMSO and stored at -20°C. 4.1 mM Cy5-azide, 1 mg Cy5-azide (Sigma-Aldrich 777323) was dissolved in 1 ml DMSO, and the solution was kept at -20°C in the dark. 5.100 m m aminoguaidin (CAS number: 1937-19-5 Sigma-Aldrich) 0.11 m m aminoguaidin was dissolved in 10 ml ddH2O, aliquoted, and stored at -20°C. 6. 0.198 g of 100 mM Sodium L-ascorbate (Sigma-Aldirich A7631) was dissolved in 10 ml of ddH2O, aliquoted, and stored at -20°C.

[0104] (2) Experimental Method 1: 1. Preparation of CuSO4-THPTA premix: 10ul 20mM CuSO4 Mixed with 20ul 50mM THPTA 2. Preparation of reaction solution: 200µl purified protein containing unnatural amino acids, concentration ≈30µM 120ul 1mM cy5-azide 9ul CuSO4-THPTA premix 30ul 100mM Aminoguaidin (cas1937-19-5 InnoChem) 220ul PBS 30ul 100m Sodium L-ascorbate(cas134-03-2 raw material) Add in the order above, mix gently and then seal.

[0105] The mixture was placed in a mixer at 4°C, shielded from light, and reacted overnight.

[0106] (3) Verification Click chemistry experiments were performed using purified proteins containing unnatural amino acids, reacting them with Cy5-azide. Fluorescence images show that the target proteins are labeled with red fluorescence after the reaction. However, in the undenatured sample, some of the proteins remain unlabeled (see Figure 10). This indicates that proteins containing unnatural amino acids undergo chemical modification by reacting with Cy5-azide via click chemistry.

[0107] Example 6 Construction of a two-site transgenic reporter gene Primer 9: TAG2F: (SEQ ID No: 12) ACCACCACCACCACGGTTAGGGTGGGGACTACAAGGATCACG Primer 10: TAG2R: (SEQ ID No: 13) TCCTTGTAGTCCCCACCCTAACCGTGGTGGTGGTGGTGGTG Primer 11: (SEQ ID No: 14) TAG151F:AACTCTCACAACGTTTAGATCACCGCTGACAAGCAAAAGAACG Primer 12: TAG151R: (SEQ ID No: 15) TGTCAGCGGTGATCTAAACGTTGTGAGAGTTGAAGTTGTATTCC Using the DNA sequence of pD2PeGFP (SEQ ID No: 16) as a template, PCR amplification was performed, and after ligation conversion, monoclonal clones were selected and sequenced.

[0108] First, a single-site insertion reporter gene was constructed: (1) PCR amplification was performed using VazymePhanta (registered trademark) Max Super-Fidelity DNA Polymerase Reagent Kit. PCR reaction system: 2*phanta Max Buffer 25μL dNTP mix (10mM each) 1μL DNA template 1μL Primer 9 and Primer 10 (10uM) 2μL each Phanta Max super-fidelity DNA polymerase1μL Supplemented with ddH2O to a final volume of 50 μL PCR reaction process: Pre-denaturation 95°C 3 min; Denaturation 95℃ 15s; Annealing at 60℃ for 15 seconds; Extension 72℃ 30s / Kb 35 cycles 72℃ 5min The accuracy of the molecular weight of the PCR product was detected by electrophoresis.

[0109] (2) Connection of PCR products: 10 μl of the vector and the PCR amplification product to be inserted were mixed, and 1 μl of DpnI (NEBR0176S) was added, followed by incubation at 37° C. for 15 minutes.

[0110] (3) Conversion of ligation products 3 μL of the ligation product was added to 30 μL of competent DH5α cells (Weidi Biotechnology DL1001), placed in an ice bath for 30 minutes, and then incubated at 42°C for 45 seconds. 200 μL of LLB medium was added, and the cells were resuscitated at 37°C for 1 hour. The cells were then plated onto LB agar plates containing 1 μg / mL ampicillin resistance and incubated overnight at 37°C. Monoclonal clones were selected and sent to a biotech for sequencing. Primers T7 and T7 terminal were used for sequencing. The template plasmid pD2P-8his-egfp10 (SEQ ID No: 17) was obtained through this process.

[0111] Furthermore, using the plasmid with the correct sequence as a template, PCR amplification was performed using primers 11 and 12:TAG151R in the same manner, followed by ligation and transformation into Dh5α competent cells. Monoclonal clones were selected and sent to a biotech for sequencing. A two-site insertion reporter gene plasmid with the correct sequence was obtained.

[0112] Example 7 Synthesis of a target protein with a two-site transfected reporter gene 7.1 Amplifying the Plasmid Template and Ensuring Accurate Sequencing After overnight cultivation of bacteria, the plasmid was extracted using a microplasmid extraction reagent kit.

[0113] 7.2 Amplification of target genes Primer 13, PD2PF: GGTGATGTCGGCGATATAGGCGCC (SEQ ID No: 18) Primer 14, PD2PR: TGCTCAGCGGTGGCAGCAGCCAAC (SEQ ID No: 19) The PCR products can be amplified and then directly used for protein translation in a cell-free system without the need for purification and concentration.

[0114] 4.3 Insertion of unnatural amino acids (Pock) into two sites of the EGFP polypeptide chain in a cell-free system In vitro translation conditions: Add ddH2O to Protein Factory and dissolve. 1mL protein factory 10μL500mM pock (final concentration 5mM) 20uM MaPylRs (final concentration) 20uM tRNA pyl CUA (Final concentration) Target gene template PCR product 30 μL React overnight at 28°C. Obtain the target protein and refer to FIG.

[0115] Example 8 Construction of a three-site transgenic reporter gene The codons at the three sites of GFP were mutated.

[0116] Using the two-site insertion reporter gene as a template, the Thr mutation at the EGFP105 site resulted in a stop codon TAG.

[0117] Primer: Primer 15 105TAGF: CAAGGACGACGGTTAGTACAAGACCAGAGCTGAAGTTAAGTTCG (SEQ ID No:20) Primer 16105TAGR: (SEQ ID No: 21) CAGCTCTGGTCTTTGTACTAACCGTCGTCCTTGAAAGAGATG The PCR reaction and ligation product conversion procedures were the same as in Example 3, and a three-site mutation template sequence (SEQ ID No: 1) was obtained.

[0118] Example 9: Synthesis of a target protein with a three-site transgenic reporter gene 6.1 Unnatural amino acid insertion into three sites of GFP protein was achieved in a cell-free system.

[0119] In vitro translation conditions: Add ddH2O to Protein Factory and dissolve. 1ml protein factory 10μL 500mM pock (final concentration 5mM) 20μM MaPylRs (final concentration) 20 μM tRNA pyl CUA (Final concentration) Target gene template PCR product 30 μL The reaction is carried out overnight at 28°C to synthesize the target protein with the three-site introduced reporter gene (see Figure 13).

[0120] Example 10: Further validation experiments for the insertion of unnatural amino acids into proteins 1. The expression products (Examples 7 and 9) into which unnatural amino acids had been introduced were centrifuged at 15,000 rpm for 15 minutes, the supernatant was removed, 100 μl of His Monster Beads (HEALTHCODEPROTN_HMBN1V00001) was added, and the mixture was incubated at 4°C for 30 minutes. The magnetic beads were then adsorbed using a grid magnet and washed three times with wash buffer: 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 20 mM imidazole. Finally, the sample was eluted with 50 μL of elution buffer: 50 mM Tris-HCl pH 8.0, 500 mM NaCl, 250 mM imidazole.

[0121] The sample was divided into two halves, and one half was added with 1 / 10 volume of DNA loading buffer. The other half was added with 1 / 4 volume of 5*SDS-PAGE loading buffer and incubated at 95°C for 5 minutes to separate the denatured and non-denatured samples. Electrophoresis was performed on an 8-16% gradient pre-cast gel (WSHT, GSH2001-816T). After electrophoresis of the non-denatured sample, EGFP protein expression was confirmed using the Cy3 channel of the gel imaging system.

[0122] The denatured sample was subjected to electrophoresis, stained with CBB, and destained. The band with the correct molecular weight was excised and subjected to LC-MS / MS mass spectrometry detection, confirming the insertion of the unnatural amino acid (Figures 12 and 13).

[0123] 2. The effect of the three-site insertion was further verified. Figure 6 shows the fluorescence image of the protein synthesized by the ncaa three-site insertion gene. 1 is the expression supernatant (MW = 35 KDa) of a GFP gene with three TAG sites (3 sites) in a cell-free in vitro orthogonal translation system. 2 is the expression supernatant (MW = 58.5 KDa) of a TEV enzyme-TEV cleavage site (with TAG mutation)-EGFP gene fusion. This construct contains an insertion site for one unnatural amino acid. GFP can be expressed and exhibits green fluorescence only when the unnatural amino acid is inserted into the synthesized polypeptide chain. At the same time, due to the unnatural amino acid mutation at the TEV cleavage site, it cannot be recognized by TEV. The molecular weight of the fusion protein is 58.5 KDa. 3 is a sample of 1 purified through a Ni column. 4 is a sample of 2 purified through a Ni column. This demonstrates that a GFP gene with three TAG stop codons can also be expressed in a cell-free in vitro orthogonal translation system. Fusion proteins with TEV tags also demonstrate that TAG can introduce unnatural amino acids into protein polypeptide chains.

Claims

1. 1. An in vitro cell-free protein synthesis system for inserting an unnatural amino acid, comprising: The reaction system is: (1) a cell extract; (2) an unnatural amino acid; (3) an exogenous orthogonal aminoacyl-tRNA synthetase / orthogonal tRNA pair; and (4) a template containing a gene sequence of a target protein in which the codon for at least one encoded amino acid is mutated to a stop codon.

2. 2. The in vitro cell-free protein synthesis system for inserting an unnatural amino acid according to claim 1, wherein the stop codon is TAG.

3. The cell extract is preferably selected from any one of Escherichia coli, yeast cells, mammalian cells, plant cells, insect cells, or a combination thereof, and the yeast cells are preferably selected from Pichia yeast, Pichia finlandica, trehalophilic Pichia yeast, Pichia koclamae, membrane-forming Pichia yeast, Pichia membranaefaciens, Pichia minuta (methanol-inducible yeast, Pichia lindneri), Pichiaopuntiae, thermotolerant Pichia yeast, Pichia salictaria, Pichia guercuum, Pichia piperi Pichia, Pichia pijperi), trunk Pichia yeast (Pichia stiptis), methanol Pichia yeast (Pichia methanolica), Pichia yeast (Pichia sp.), Saccharomyces yeast (Saccharomyces cerevisiae), yeast (Saccharomyces sp.), polymorphic Hansenula yeast (Hansenula polymorpha), Kluyveromyces yeast, lactic Kluyveromyces yeast (Kluyveromyces, K. lactis), Marxianus Kluyveromyces yeast (Kluyveromyces marxianus var. lactis, Kluyveromyces marxianus var. marxianus, Kluyveromyces marxianus var.vanudenii, Dobzhanskii Kluyveromyces yeast (Kluyveromyces dobzhanskii), Kluyveromyces aestuarii, Nonfermenting Kluyveromyces yeast (Kluyveromyces nonfermentans), Wickerham Kluyveromyces yeast (Kluyveromyces wickerhamii), Thermotolerant Kluyveromyces yeast (Kluyveromyces thermotolerans), Fragile Kluyveromyces yeast (Kluyveromyces fragilis), Hubei Kluyveromyces yeast (Kluyveromyces hubeiensis), Polysporous Kluyveromyces yeast (Kluyveromyces polysporus), Siamese Kluyveromyces yeast (Kluyveromyces siamensis), Yarowi Kluyveromyces 3. An in vitro cell-free protein synthesis system for inserting the unnatural amino acid of claim 1 or 2, wherein the unnatural amino acid is selected from one or a combination of the following:

4. The structural formula of the unnatural amino acid is: 【Chemistry 1】 wherein n is a natural number selected from 1 to 20; R1 is a substituted or unsubstituted C5-C60 aryl or heteroaryl group, a substituted or unsubstituted C1-C20 alkyl group, a substituted or unsubstituted C2-C20 alkenyl group, or a substituted or unsubstituted C2-C20 alkynyl group; and A is O or -CH2-.

5. 5. The in vitro cell-free protein synthesis system for inserting an unnatural amino acid of claim 4, wherein n is selected from a natural number of 1 to 10, and R1 is selected from a substituted or unsubstituted C2-C20 alkenyl group or a substituted or unsubstituted C2-C20 alkynyl group, preferably n is selected from a natural number of 1 to 6, and R1 is selected from a substituted or unsubstituted C2-C10 alkenyl group or a substituted or unsubstituted C2-C10 alkynyl group, more preferably R1 is selected from a substituted or unsubstituted C2-C6 alkynyl group.

6. The structural formula of the unnatural amino acid is: 【Chemistry 2】 6. An in vitro cell-free protein synthesis system for inserting an unnatural amino acid according to claim 4 or 5, wherein the unnatural amino acid is selected from one of the following or a combination thereof:

7. 7. The in vitro cell-free protein synthesis system for inserting an unnatural amino acid of claim 1 , wherein the exogenous orthogonal aminoacyl-tRNA synthetase is selected from a natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS), or TrP-tRNA synthetase (TrpRS), and the tRNA is selected from a natural or mutant tRNAPyl, tRNALeu, tRNATyr, tRNAPhe, or tRNATrp.

8. The exogenous orthogonal aminoacyl-tRNA synthetase may be a native or mutant MaPylRS, 8. An in vitro cell-free protein synthesis system for inserting an unnatural amino acid according to any one of claims 1 to 7, wherein the unnatural amino acid is selected from MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, and BsTrpRS, and preferably MaPylRS.

9. 9. The in vitro cell-free protein synthesis system for inserting an unnatural amino acid of claim 1, wherein the target protein is selected from luciferin, luciferase, green fluorescent protein, yellow fluorescent protein, red fluorescent protein, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, an antibody variable region, a luciferase mutant, α-amylase, enterocin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, interleukin-1β, lysozyme, serum albumin, a single-chain antibody fragment (scFV), transthyretin, tyrosinase, xylanase, or a combination thereof.

10. 10. The in vitro cell-free protein synthesis system for inserting an unnatural amino acid of any one of claims 1-9, wherein the system further comprises one or more components of a buffer, potassium ions, magnesium ions, polyethylene glycol, an optional aqueous solvent, and a phosphate salt.

11. (1) the v / v ratio of the cell extract to the reaction system is 20-80%; (2) further comprising polyethylene glycol in an amount of 0.1-8% (w / v) of the reaction system, preferably 0.5-4%, and most preferably 1-2%; (3) The concentration range of the exogenous orthogonal aminoacyl-tRNA synthetase in the reaction system is 0.001 to 1 mmol / L, preferably 0.005 to 0.1 mmol / L, and more preferably 0.005 to 0.05 mmol / L; (4) The in vitro cell-free protein synthesis system for inserting an unnatural amino acid according to claim 10, further comprising one or more of the following characteristics: the orthogonal tRNA is present in a reaction system at a concentration ranging from 0.001 to 1 mmol / L, preferably from 0.005 to 0.1 mmol / L, and more preferably from 0.02 to 0.1 mmol / L.

12. A reagent kit comprising the reaction system according to any one of claims 1 to 11.

13. A method for synthesizing a protein containing an unnatural amino acid using an in vitro cell-free system, the method comprising producing the protein using the synthesis system of any one of claims 1 to 11 or the reagent kit of claim 12.

14. 13. The application of the system according to any one of claims 1 to 11 or the reagent kit according to claim 12 in the synthesis of proteins containing unnatural amino acids.

15. A protein comprising an unnatural amino acid, produced by the synthesis system of any one of claims 1 to 11, the reagent kit of claim 12, or the method of claim 13.

16. 16. Application in click chemistry modification of proteins containing the unnatural amino acid of claim 15.