Screening method for site-specific integration site, vector microparticle, site-specific integration method, and microparticle

The method of incorporating recognition sequences and marker genes into vector microparticles for monoclonal screening and subsequent marker removal addresses the inefficiencies of current cell line construction methods, achieving rapid and stable recombinant protein production.

JP2026507849APending Publication Date: 2026-03-06SHENZHEN TAILI BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-11
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Current methods for constructing mammalian cell lines for recombinant protein production are time-consuming and labor-intensive, and the use of marker genes affects the stability of the final cell line, necessitating a two-step process and prolonged development times.

Method used

A method involving the incorporation of an exogenous gene with recognition sequences and a marker gene into vector microparticles, followed by monoclonal screening and simultaneous evaluation of expression levels, allowing for one-step screening and subsequent removal of the marker gene to ensure high and stable protein expression.

Benefits of technology

This approach significantly shortens the development time for expression vectors by enabling one-step high-throughput screening and ensures the stability and performance of the final cell line, improving adaptability and expression levels.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026507849000001_ABST
    Figure 2026507849000001_ABST
Patent Text Reader

Abstract

A method for screening for site-specific integration sites, vector microparticles, a site-specific integration method, and microparticles are provided. The purpose of this is to incorporate a marker gene with upstream and downstream recognition sequences into vector microparticles, thereby simultaneously conducting monoclonal screening and protein expression screening. After obtaining a monoclonal vector with good performance in a single screening step, the marker gene is then replaced when expressing an exogenous target gene, significantly ensuring the stability of the entire microparticle. This significantly shortens the development period for expression microparticles while ensuring the overall expression performance and stability of the expression microparticles. This solves the technical problems of long development periods or poor performance for expression vectors in conventional technologies. The provided method for screening for site-specific integration sites can effectively shorten the development period for expression vectors with high expression levels and overall stability. The provided vector microparticles have good adaptability and excellent expression levels and passage stability.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention belongs to the field of biotechnology, and more specifically relates to a method for screening a site-specific integration site, a vector microparticle, a site-specific integration method, and a microparticle. [Background technology]

[0002] Since the U.S. FDA approved the marketing of Genetech's recombinant insulin in 1982, recombinant proteins have been effectively used in scientific research, the diagnosis, treatment, and prevention of various diseases. Currently, recombinant proteins are primarily produced and expressed using exogenous protein expression systems. Recombinant protein production using mammalian cells has become the mainstream technology for biopharmaceutical expression and production. Commercially available biopharmaceuticals currently undergoing clinical trials and preclinical studies include, but are not limited to, polypeptides and protein-based drugs, most of which can be expressed in mammalian cells. Among these, Chinese hamster ovary (CHO) cells are the most widely used host cell for recombinant protein production. There are several CHO cell lines. The CHO cell lines currently used for industrial production include CHO-K1, CHO-DG44, CHO-DXB11 (also known as CHO-DUKX), CHO-S, and CHOZN (a CHOZN ZFN-modified CHO cell line), with CHO-MK under development.

[0003] A Chinese invention patent (granted publication number CN100381573C) discloses a method for constructing a cell line containing an amplifiable transcriptionally active site in its genome. This method involves inserting a marker into the amplifiable transcriptionally active site in the mammalian genome using an integration marker vector. Subsequently, a dual plasmid consisting of a target expression vector and a recombinase expression vector is co-transfected into mammalian cells, allowing the exogenous target gene to be integrated into the marker site in the genome under the action of a site-specific recombination system. Gene amplification rapidly increases gene copy number, achieving high gene expression. This patented solution uses a recombinase to recognize and cleave a pair of recombination signal sequences, such as attP and attB, and the selected cell line is CHO-dhfr-.

[0004] A Chinese invention patent (granted publication number CN114107380A) discloses a method for constructing cell lines using the phage Bxb1 site-specific recombinase system, which can significantly reduce the time required for cell line development. First, a random integration method is used to randomly integrate the site-specific integration site, attP, into the CHO-S cell genome. Antibiotic screening is then performed to obtain a CHO-S.attP recombinant cell model. Using the CHO-S.attp recombinant cell line as the host, Bxb1 recombinase is used to site-specifically integrate DNA containing the attB site and the target protein gene into the CHO-S.attp cell line. Antibiotic pressure screening is then performed to achieve stable and high-level expression of the target protein.

[0005] Currently, high gene expression is achieved by inserting an exogenous target gene into a specific site and rapidly increasing the gene copy number through gene amplification. Existing screening methods for known sites include constructing a mother cell line, screening for the stability of the mother cell line, screening for site-specific integration of the exogenous target gene, and screening for the stability of the target cell line. While constructing a mother cell line is a single step, traditional mother cell line construction requires a two-step process (construction of a mother cell line + screening) to select mother cell lines with a marker gene inserted into the site. This method is time-consuming and labor-intensive.

[0006] Furthermore, screening of the parent cell line requires the use of a marker gene, but the marker gene cannot be removed from the genome of the final integrated target cell line, which affects the stability of the entire target cell line. Summary of the Invention [Problem to be solved by the invention]

[0007] To address the above-mentioned deficiencies and needs for improvement in the prior art, the present invention provides a method for screening site-specific integration sites, vector microparticles, a site-specific integration method, and microparticles. The purpose is to incorporate a marker gene with upstream and downstream recognition sequences into vector microparticles, thereby performing protein expression screening simultaneously with monoclonal screening, thereby obtaining a monoclonal vector with good performance in one-step screening, and then replacing the marker gene when expressing an exogenous target gene, thereby significantly ensuring the stability of the entire microparticles, shortening the development period of expression microparticles while ensuring the expression performance and stability of the entire expression microparticles, thereby solving the technical problems of the prior art, such as the long development period of expression vectors or poor performance. [Means for solving the problem]

[0008] In order to achieve the above object, according to one aspect of the present invention, (1) A step of randomly incorporating an exogenous gene containing two recognition sequences and a marker gene located between the two recognition sequences into an endogenous gene of a vector microparticle to obtain a vector microparticle having a marker gene; Step (2) amplifying and culturing the vector microparticles carrying the marker gene obtained in step (1) to form a pool of vector microparticles to be screened; Step (3) of performing monoclonal screening on the pool of vector microparticles to be screened obtained in step (2), and simultaneously with the monoclonal screening, retaining monoclonal vector microparticles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a predetermined threshold value according to the expression levels of the marker genes and / or exogenous target genes, thereby obtaining monoclonal vector microparticles with high protein expression levels; A method for screening for site-specific integration sites is provided, which includes step (4) of subculturing the monoclonal vector microparticles with high protein expression levels obtained in step (3), determining the subculturing stability of the monoclonal vector microparticles from the expression levels of the marker gene in the vector microparticles over multiple generations, obtaining monoclonal vector microparticles with high expression levels that are stable over time, and designating the insertion position of the exogenous gene in the endogenous gene as the site-specific integration site.

[0009] Preferably, in the method for screening for a site-specific integration site, the marker gene has a length equivalent to that of the exogenous target gene to be integrated; The marker gene has several optional lengths, preferably 0.75k, 1k, 3k, 15k; Preferably, marker genes of 3k or less are employed to predict the expression levels of exogenous target genes of other lengths through intelligent learning algorithms.

[0010] Preferably, in the method for screening for a site-specific integration site, the marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene; and / or The vector microparticle is used to express one or more of an amino acid, a polypeptide, a protein, a nucleotide, a nucleic acid, a secretory product, and is selected from a cell, a bacterium, a virus, and is generally a vector cell, the vector cell being a eukaryotic cell, optionally the eukaryotic cell being a mammalian cell, optionally the mammalian cell comprising a Chinese hamster ovary CHO cell, a human embryonic kidney HEK293 cell, and / or The recognition sequences are independently one or more selected from the group consisting of a LoxP sequence, a LoxPL3 sequence, a LoxP 2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence.

[0011] Preferably, in the method for screening site-specific integration sites, step (3) employs image processing-based technology to screen monoclonal vector microparticles, and specific solutions include, but are not limited to, deep learning of the YOLO (You Only Look Once) series of target detection models and the SSD (Single Shot MultiBox Detector) series of algorithm models.

[0012] Preferably, in the method for screening for a site-specific integration site, in step (3), the expression levels of the marker gene and / or exogenous target gene are predicted by an intelligent algorithm based on a cell image, specifically by: Step (3-1) of imaging the pool of vector microparticles to be screened obtained in step (2) to obtain an image of the vector microparticles to be screened, preferably using high-throughput scanning, and if the marker gene is a fluorescent protein, preferably using high-throughput fluorescent scanning; A step of image processing the vector particle images to be screened obtained in step (3-1) to obtain images of each vector particle, and predicting the expression levels of the marker genes and / or exogenous target genes of the vector particles using an intelligent algorithm according to the image features, preferably the image features used include morphological and / or optical features of the cells, including but not limited to roundness, size, and grayscale of specific cell regions; Preferably, the expression levels of the marker genes and / or exogenous target genes of the vector microparticles predicted by a plurality of intelligent algorithms are evaluated using a sorting algorithm to evaluate the normalized discounted cumulative gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the normalized discounted cumulative gain, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows:

number

[0013] Preferably, in the method for screening for a site-specific integration site, in step (3), the monoclonal vector microparticles are screened using a semi-solid medium.

[0014] Preferably, in the method for screening site-specific integration sites, in step (4), the passage stability of the monoclonal vector microparticles is determined by an intelligent algorithm, and the specific steps are as follows: (4-1) Obtaining the expression level of the marker gene of the monoclonal vector microparticles of multiple generations; (4-2) Based on the expression levels of the marker genes of the monoclonal vector microparticles of the multiple generations obtained in step (4-1), using an intelligent algorithm to evaluate the difference in the expression levels of the marker genes of the monoclonal vector microparticles of the multiple generations; (4-3) Based on the difference in the expression level of the marker gene of the monoclonal vector microparticles of multiple generations obtained in step (4-2), it is determined whether the monoclonal vector microparticles have passage stability, according to the principle that the smaller the difference in expression level, the greater the probability of having passage stability.

[0015] According to another aspect of the present invention, there is provided a site-specific integration vector microparticle to be screened by the method for screening a site-specific integration site, wherein an exogenous gene is inserted into an endogenous gene of the vector microparticle, and the exogenous gene comprises two first recognition sequences and a marker gene expression fragment, which is provided between the two first recognition sequences and into which a marker protein for expression has been incorporated; the expression level of the marker gene of the site-specific integration vector microparticle is higher than the predetermined threshold value, The site-specific integration vector microparticles are passage stable.

[0016] According to another aspect of the present invention, there is provided a site-specific integration site screening system, said system being an electronic device and / or a non-transitory computer-readable storage medium, comprising: The electronic device includes a memory, a processor, and a computer program stored in the memory and operable on the processor, wherein when the processor executes the program, it performs steps of the method for screening for site-specific integration sites provided by the present invention, The non-transitory computer-readable storage medium has stored therein a computer program which, when executed by a processor, implements the steps of the method for screening for site-specific integration sites provided by the present invention.

[0017] According to another aspect of the present invention, The present invention provides a method for site-specific integration of an exogenous target gene, which comprises the steps of obtaining the site-specific integration vector microparticles provided by the present invention, performing homologous recombination using a first recognition sequence in an exogenous gene within the site-specific integration vector microparticles, recombining an exogenous target gene expression fragment into the gene of the site-specific integration vector microparticles, and removing the marker gene expression fragment.

[0018] Preferably, in the method for site-specific integration of an exogenous target gene, the exogenous target gene expression fragment is provided within a recombinant vector, and the exogenous target gene is site-specifically integrated into the site of the site-specific integration vector microparticle by the recombinant vector, and the recombinant vector is a lentivirus vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papovavirus vector, integrative phage vector, non-viral vector, transposon, transposase, integrase substrate or plasmid.

[0019] Preferably, in the method for site-specific integration of an exogenous target gene, the marker gene expression fragment of the site-specific integration vector microparticle has a length equivalent to that of the exogenous target gene expression fragment.

[0020] Preferably, in the method for site-specific integration of an exogenous target gene, the step of performing homologous recombination using the first recognition sequence of the site-specific integration fragment of the site-specific integration vector microparticle is specifically constructing an exogenous target gene recombination fragment containing an exogenous target gene, wherein the exogenous target gene recombination fragment contains two second recognition sequences and an exogenous target gene expression fragment, the exogenous target gene expression fragment being located between the two second recognition sequences, and the exogenous target gene expression fragment comprising a promoter that regulates and controls expression of the exogenous target gene, and an exogenous target gene sequence; The exogenous gene is integrated into the site of the site-specific integration vector microparticle, and the two first recognition sequences on either side of the marker gene become a third recognition sequence and a fourth recognition sequence, respectively, the third recognition sequence being formed by the reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence being formed by the reaction of the first recognition sequence and the second recognition sequence, and the sequences of the third recognition sequence and the fourth recognition sequence are different.

[0021] Preferably, in the method for site-specific integration of an exogenous target gene, neither the third recognition sequence nor the fourth recognition sequence becomes the second recognition sequence or the first recognition sequence in the same reaction system.

[0022] Preferably, in the method for site-specific integration of an exogenous target gene, the third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase; and / or the second recognition sequence is independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence; and / or The third recognition sequence and the recognition sequence are independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, an attL sequence, and an attR sequence.

[0023] Preferably, in the method for site-specific integration of an exogenous target gene, Step S1: obtaining a plurality of site-specific integration vector microparticles provided by the present invention, and performing homologous recombination using a first recognition sequence in an exogenous gene in the site-specific integration vector microparticles to recombine an exogenous target gene expression fragment into a gene of the site-specific integration vector microparticles and remove a marker gene expression fragment, thereby obtaining a plurality of candidate exogenous target gene expression vector microparticles; Step S2 of amplifying and subculturing the multiple exogenous target gene expression vector candidates obtained in step S1; S21: According to the expression level of the exogenous target gene, retain the monoclonal exogenous target gene expression vector microparticles whose expression level of the corresponding exogenous target gene is higher than a predetermined threshold; S22: Determine the passage stability of the exogenous target gene expression vector microparticles based on the expression level of the exogenous target gene in the monoclonal exogenous target gene expression vector microparticles over multiple generations; An exogenous target gene expression vector microparticle that expresses a high amount of protein and has passage stability is obtained.

[0024] Preferably, in the method for site-specific integration of an exogenous target gene, in step S21, the expression level of the exogenous target gene is predicted through an intelligent learning algorithm; The expression level of the exogenous target gene is maintained by an intelligent algorithm prediction according to the cell image, specifically, Step S211: imaging the monoclonal exogenous target gene expression vector microparticles obtained in step S21 to obtain candidate monoclonal exogenous target gene expression vector microparticle images, preferably using high-throughput scanning; Step S212: predicting the expression level of the exogenous target gene in the monoclonal exogenous target gene expression vector microparticles using an intelligent algorithm according to image features, preferably the image features used include morphological and / or optical features of the cells, including but not limited to roundness, size, and gray scale of specific cell regions; Preferably, the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles predicted by a plurality of intelligent algorithms are evaluated using a sorting algorithm to evaluate the normalized discounted cumulative gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the normalized discounted cumulative gain, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows:

number

[0025] Preferably, in the method for site-specific integration of an exogenous target gene, in step S22, the determination is made using an intelligent algorithm for the passage stability of the monoclonal exogenous target gene expression vector microparticles, and the specific steps are as follows: S221: Obtaining the expression level of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles of multiple generations; S222: Using an intelligent algorithm based on the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles of the multiple generations obtained in step S221, evaluate the difference in the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles of the multiple generations; S223: Based on the difference in the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles obtained in step S222 over multiple generations, determine whether the monoclonal exogenous target gene expression vector microparticles have transgenesis stability, according to the principle that the smaller the difference in expression level, the greater the probability of having transgenesis stability.

[0026] According to another aspect of the present invention, there is provided an exogenous target gene expression vector microparticle to be screened by the site-specific integration method of an exogenous target gene, wherein an exogenous target gene is inserted into an endogenous gene of a vector microparticle, and the exogenous gene comprises a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression fragment for expressing a target protein, the exogenous gene being provided between the third recognition sequence and the fourth recognition sequence; the expression level of the target gene in the exogenous target gene expression vector microparticle is higher than the preset threshold value; The exogenous target gene expression vector microparticles are passage stable.

[0027] According to another aspect of the present invention, there is provided a system for site-specific integration of an exogenous target gene, the system being an electronic device and / or a non-transitory computer-readable storage medium, The electronic device includes a memory, a processor, and a computer program stored in the memory and operable on the processor, wherein the processor, when executing the program, performs steps of the method for site-specific integration of an exogenous target gene provided by the invention, The non-transitory computer-readable storage medium stores a computer program, which, when executed by a processor, implements the steps of the method for site-specific integration of an exogenous target gene provided by the present invention. [Effects of the Invention]

[0028] In summary, the above technical solution devised by the present invention can achieve the following beneficial effects compared with the prior art:

[0029] The present invention achieves two functions by constructing an exogenous gene containing two recognition sequences and a marker gene located between the two recognition sequences into the endogenous gene of a vector microparticle. First, monoclonal screening and expression level screening can be completed simultaneously, allowing for the production of a monoclonal vector with high expression levels in a single step. Second, when expressing an exogenous target gene, the marker gene is directly replaced without the need to include it in the final protein expression vector, thereby improving overall cellular stability. By combining these two functions, the site-specific integration site screening method of the present invention can effectively shorten the development time for expression vectors with high expression levels and overall stability.

[0030] The vector microparticles provided by the present invention have good adaptability, expression level, and good passage stability for various exogenous target genes.

[0031] The present invention covers the entire process of cell line selection, from constructing the target protein plasmid to finally determining the cell line that produces the protein stably and in high yields, and the entire process is standardized, highly reproducible, and easy to operate.

[0032] A preferred solution is to use an artificial intelligence algorithm to evaluate and predict the performance of monoclonal expression vectors, thereby increasing the probability of screening monoclonal expression vectors with good performance in a single culture and further shortening the overall development time of expression vectors with site-specific integration sites.

[0033] As a preferred solution, the present invention uses high-throughput microscopic scanning of cell imaging data to screen for monoclonal cell lines that highly express a target protein. A robotic arm semi-automatically aspirates and transports the screened cell lines, and finally, an image recognition algorithm is used to screen for stable expression cell lines. Compared with other techniques for screening monoclonal cell lines, the present invention has the advantages of higher accuracy and reduced time and labor. [Brief explanation of the drawings]

[0034] [Figure 1] FIG. 1 is a schematic diagram showing the structure of the recombinant plasmid containing RMCE constructed in Example 1 of the present invention. [Figure 2] FIG. 1 is a schematic structural diagram of a marker gene expression fragment contained in a recombinant plasmid provided in Example 1 of the present invention. [Figure 3] 1 is a flowchart of the method for screening site-specific integration sites provided in Example 1 of the present invention. [Figure 4] FIG. 4 is a diagram illustrating the detection effect of the target detection algorithm provided in the first embodiment of the present invention. [Figure 5] 1 is a flowchart of the operation provided in Example 2 of the present invention. [Figure 6] 1 is a recombinant plasmid of target genes 1, 2, 4, and 5 provided in Example 2 of the present invention. [Figure 7] 1 is a recombinant plasmid of target gene 3 provided in Example 2 of the present invention. [Figure 8] FIG. 1 shows the results of comparing the expression levels of expression vectors on day 14 in Example 2. [Figure 9] FIG. 1 shows the results of the expression level of the batch of expression vector on the 7th day in Example 2. [Figure 10] 1 is an electrophoresis photograph of GBB003-2D8 cells into which target gene 1 was introduced in Example 2. [Figure 11] 1 is an electrophoresis photograph of GBB003-1G2 cells into which target gene 2 was introduced in Example 2. [Figure 12] 1 is an electrophoresis photograph of GBB003-1D6 cells into which target gene 3 was introduced in Example 2. [Figure 13] FIG. 1 shows the results of a stability test of cell viability when Y5E6 and Y6F10 are passaged as exogenous target gene expression vector microparticles in Example 2. [Figure 14] FIG. 1 shows the results of a growth rate stability test in Example 2 when Y5E6 and Y6F10 are used as exogenous target gene expression vector microparticles. [Figure 15] FIG. 1 shows the results of glycoforms in product quality characteristics of Y5E6 cells and Y6F10 cells in Example 2. [Figure 16] FIG. 1 shows the results of comparing the charge heterogeneity of proteins expressed in Y5E6 cells and Y6F10 cells in Example 2. [Figure 17] FIG. 1 shows the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of Y5E6 cells and Y6F10 cells in Example 2. [Figure 18] FIG. 10 shows the concentration results of antibodies that express target gene 5 in GBB003 cells into which target gene 5 has been introduced in Example 2. [Figure 19] FIG. 1 shows the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of GBB003 cells into which target gene 5 was introduced in Example 2. [Figure 20] FIG. 1 shows the growth stability results of GBB-01 cells after 90 days of passaging as provided in Example 3. [Figure 21]FIG. 1 is a schematic diagram of the structure of the target gene 6 fragment cloned into the exogenous target gene 6 expression fragment in Example 3. [Figure 22] FIG. 1 is a schematic diagram of the structure of the Bxb1 integrase plasmid provided in Example 3. [Figure 23] FIG. 10 shows the results of expression levels in GBB-01-H8 cells using expression vector microparticles incorporating exogenous target gene 6 provided in Example 3. [Figure 24] FIG. 1 shows the results of expression levels of a batch of GBB-01-H8 cells provided in Example 3. [Figure 25] FIG. 1 shows the specific yield results of batches of GBB-01-H8 cells provided in Example 3. [Figure 26] FIG. 1 shows the results of comparing the glycan profiles of GBB-01-H8 cells provided in Example 3. [Figure 27] 1 shows the results of comparing the charge heterogeneity of GBB-01-H8 cells provided in Example 3. FIG. [Figure 28] FIG. 1 shows the results of genome electrophoresis detection of GBB-01-H8 cells provided in Example 3. [Figure 29] FIG. 10 shows the results of comparing the expression levels in GBBc001 cells into which exogenous target gene 3 provided in Example 4 has been introduced. [Figure 30] FIG. 10 shows the results of comparing the expression levels in GBBc001 cells into which exogenous target gene 1 provided in Example 4 has been introduced. [Figure 31] FIG. 10 shows the results of comparing the expression levels in GBBc001-14 cells into which exogenous target gene 3 provided in Example 4 has been introduced. [Figure 32] FIG. 1 shows the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis detection of GBBc001-14 cells provided in Example 4. [Figure 33] FIG. 1 shows the sodium dodecyl sulfate-polyacrylamide gel electrophoresis detection results for GBBc001-3 cells provided in Example 4. [Figure 34]FIG. 1 is a structural schematic diagram of the site-specific integration site screening system provided in Example 5. DETAILED DESCRIPTION OF THE INVENTION

[0035] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be described in more detail below with reference to examples. It should be understood that the specific examples described herein are for the purpose of illustrating the present invention, and do not limit the present invention. Furthermore, the technical features according to each embodiment of the present invention described below may be combined as long as they are not inconsistent with each other.

[0036] In this specification, a preset threshold refers to a fixed value, or a ranking range value that is greater than a ranking range value that ranks values ​​from highest to lowest within an existing numerical range, or a ranking value that is greater than a ranking value that ranks values ​​from highest to lowest within an existing numerical range.

[0037] As used herein, recognition sequences include, but are not limited to, homologous arm sequences, other sequences that can be recognized, or other homologous recombination sequences.

[0038] As used herein, "simultaneously with monoclonal screening, monoclonal vector microparticles in which the expression level of the corresponding marker gene and / or exogenous target gene is higher than a predetermined threshold, depending on the expression level of the marker gene and / or exogenous target gene" refers to "simultaneously with monoclonal screening, monoclonal vector microparticles in which the expression level of the marker gene is higher than a predetermined threshold, depending on the expression level of the marker gene" or "simultaneously with monoclonal screening, monoclonal vector microparticles in which the expression level of the exogenous target gene is higher than a predetermined threshold, depending on the expression level of the exogenous target gene."

[0039] The method for screening for a site-specific integration site provided by the present invention comprises the following steps.

[0040] (1) An exogenous gene containing two recognition sequences and a marker gene located between the two recognition sequences is randomly integrated into the endogenous gene of a vector microparticle to obtain a vector microparticle carrying the marker gene.

[0041] Recognition sequences include, but are not limited to, homologous arm sequences, other sequences that can be recognized, or other homologous recombination sequences. In this example, the recognition sequence refers to the homologous arm sequence.

[0042] Because the protein expression level and stability of vector microparticles incorporating exogenous target genes are strongly correlated with the size and integration site of the exogenous target gene, the marker gene should be equivalent in length to the exogenous target gene to be integrated to ensure that the expression level and stability of the exogenous target gene in the constructed vector microparticles incorporating an exogenous target gene meets screening expectations. If there is no clear exogenous target gene, multiple marker genes with representative lengths can be selected for screening. Typical marker gene lengths are 0.75k, 1k, 3k, and 15k. Preferably, shorter marker genes (3k or less), such as a 0.75k marker gene, can be used to predict the expression levels of exogenous target genes of other lengths using an intelligent learning algorithm, significantly reducing costs.

[0043] The marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene.

[0044] The vector microparticle is used to express one or more of an amino acid, a polypeptide, a protein, a nucleotide, a nucleic acid, or a secretory product, and is selected from a cell, a bacterium, or a virus, and is generally a vector cell, the vector cell being a eukaryotic cell, optionally the eukaryotic cell being a mammalian cell, optionally the mammalian cell being a Chinese hamster ovary CHO cell, or a human embryonic kidney HEK293 cell.

[0045] (2) The vector microparticles carrying the marker gene obtained in step (1) are amplified and cultured to form a pool of vector microparticles to be screened.

[0046] (3) Monoclonal screening is performed on the pool of vector microparticles to be screened obtained in step (2), and simultaneously with the monoclonal screening, according to the expression levels of the marker genes and / or exogenous target genes, monoclonal vector microparticles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a predetermined threshold are retained to obtain monoclonal vector microparticles with high protein expression levels. Preferably, as a solution, image processing-based technology is used to screen the monoclonal vector microparticles. Specific solutions include, but are not limited to, deep learning of the YOLO (You Only Look Once) series of target detection models and the SSD (Single Shot MultiBox Detector) series algorithm model.

[0047] Preferably, the solution involves predicting the expression levels of the marker genes and / or exogenous target genes based on cell images using an intelligent algorithm, specifically: Step (3-1) of imaging the pool of vector microparticles to be screened obtained in step (2) to obtain an image of the vector microparticles to be screened, preferably using high-throughput scanning, and if the marker gene is a fluorescent protein, preferably using high-throughput fluorescent scanning; A step of image processing the vector particle images to be screened obtained in step (3-1) to obtain images of each vector particle, and predicting the expression levels of the marker genes and / or exogenous target genes of the vector particles using an intelligent algorithm according to the image features, preferably the image features used include morphological and / or optical features of the cells, including but not limited to roundness, size, and grayscale of specific cell regions; Preferably, the expression levels of the marker genes and / or exogenous target genes of the vector microparticles predicted by a plurality of intelligent algorithms are evaluated using a sorting algorithm to evaluate the normalized standard discounted cumulative gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the standard discounted cumulative gain, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows:

number

[0048] Because there are differences in the performance of the sequences of marker genes and exogenous target genes, an intelligent algorithm can be used to learn and train the differences between the two and predict the expression level of the exogenous target gene, thereby improving the adaptability of the expression of the exogenous target gene at the screened integration site to a certain extent, shortening the overall development period and reducing development costs.

[0049] Screening of monoclonal cell vector microparticles is generally performed using limiting dilution, flow cytometry, and semi-solid medium screening. Limiting dilution requires a large number of experiments, and flow cytometry operates using pressure, resulting in low vector microparticle survival rates and a high risk of contamination. In the present invention, semi-solid medium is preferably used to screen monoclonal vector microparticles, allowing for automated screening.

[0050] The preset threshold of the expression level of the marker gene and / or exogenous target gene can be determined according to the experimental requirements for the protein expression level. For example, if the target protein expression level is to exceed a certain value, the specific value can be used as the preset threshold. Alternatively, it can be determined based on the relative protein expression level, for example, by ranking the expression levels of the marker gene and / or exogenous target gene in descending order of expression level into the top fixed percentage or top fixed rank.

[0051] (4) The monoclonal vector microparticles with high protein expression levels obtained in step (3) are subcultured, and the subgenerational stability of the monoclonal vector microparticles is determined from the expression levels of the marker gene in the vector microparticles over multiple generations to obtain monoclonal vector microparticles with high expression levels and subgenerational stability, and the insertion position of the exogenous gene in the endogenous gene is designated as the site-specific integration site.

[0052] Preferably, the solution is to use an intelligent algorithm for determining the passage stability of monoclonal vector microparticles, and the specific steps are as follows: (4-1) Obtaining the expression level of the marker gene of the monoclonal vector microparticles of multiple generations; (4-2) Based on the expression levels of the marker genes of the monoclonal vector microparticles of the multiple generations obtained in step (4-1), using an intelligent algorithm to evaluate the difference in the expression levels of the marker genes of the monoclonal vector microparticles of the multiple generations; (4-3) Based on the difference in the expression level of the marker gene of the monoclonal vector microparticles of multiple generations obtained in step (4-2), it is determined whether the monoclonal vector microparticles have passage stability, according to the principle that the smaller the difference in expression level, the greater the probability of having passage stability.

[0053] In the site-specific integration vector microparticles provided by the present invention, an exogenous gene is inserted into an endogenous gene of the vector microparticle, and the exogenous gene comprises two first recognition sequences and a marker gene expression fragment, which is provided between the two first recognition sequences and into which a marker protein for expression has been incorporated; the expression level of the marker gene of the site-specific integration vector microparticle is higher than the predetermined threshold value, The site-specific integration vector microparticles are passage stable.

[0054] In this example, the first recognition sequence refers to the first homology arm sequence.

[0055] The marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene.

[0056] The exogenous gene contains a marker gene expression fragment that contains two recognition sequences and a marker gene located between the two recognition sequences. The marker gene expression fragment has a promoter, which is selected from the group consisting of a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, an HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter, and an Endothelin-1 promoter.

[0057] The first recognition sequence is independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP 2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence.

[0058] The present invention provides a site-specific integration site screening system, wherein the system is an electronic device and / or a non-transitory computer-readable storage medium, The electronic device includes a memory, a processor, and a computer program stored in the memory and operable on the processor, wherein the processor, when executing the program, performs steps of the method for screening for site-specific integration sites; The non-transitory computer-readable storage medium has stored therein a computer program that, when executed by a processor, implements the steps of the method for screening for site-specific integration sites.

[0059] The method for site-specific integration of an exogenous target gene provided by the present invention comprises: The method includes the steps of obtaining the site-specific integration vector microparticles provided by the present invention, performing homologous recombination using the first recognition sequence in the exogenous gene within the site-specific integration vector microparticles, recombining the expression fragment into the gene of the site-specific integration vector microparticles, and removing the exogenous target gene expression fragment in front of the marker gene.

[0060] As a preferred solution, all site-specific integration vectors are screened for exogenous target genes, and the specific method is as follows:

[0061] S1: Obtain multiple site-specific integration vector particles provided by the present invention, and perform homologous recombination using the first recognition sequence in the exogenous gene within the site-specific integration vector particles to recombine the exogenous target gene expression fragment into the gene of the site-specific integration vector particles and remove the marker gene expression fragment to obtain multiple candidate exogenous target gene expression vector particles.

[0062] S2: The multiple exogenous target gene expression vector candidates obtained in step S1 are amplified and subcultured.

[0063] S21: According to the expression level of the exogenous target gene, monoclonal exogenous target gene expression vector microparticles whose expression level of the corresponding exogenous target gene is higher than a predetermined threshold are retained. Preferably, the retention of the expression level of the exogenous target gene is performed by an intelligent algorithm prediction according to the cell image, and specifically includes the following steps S211 and S212.

[0064] S211: The monoclonal exogenous target gene expression vector microparticles acquired in step S21 are imaged to acquire candidate monoclonal exogenous target gene expression vector microparticle images, preferably using high-throughput scanning.

[0065] S212: Predicting the expression level of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles using an intelligent algorithm according to image features, preferably the image features used include morphological and / or optical features of the cells, including but not limited to roundness, size, and grayscale of specific cell regions; Preferably, the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles predicted by a plurality of intelligent algorithms are evaluated using a sorting algorithm to evaluate the normalized discounted cumulative gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the normalized discounted cumulative gain, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows:

number

[0066] S22: The passage stability of the exogenous target gene expression vector is determined based on the expression level of the exogenous target gene in the monoclonal exogenous target gene expression vector microparticles over multiple generations.

[0067] The passage stability of the monoclonal exogenous target gene expression vector microparticles is determined using an intelligent algorithm, and the specific steps are as follows: S221: Obtain the expression level of the exogenous target gene in the monoclonal exogenous target gene expression vector microparticles of multiple generations.

[0068] S222: Based on the expression levels of the exogenous target genes of the multiple generations of monoclonal exogenous target gene expression vector microparticles obtained in step S221, an intelligent algorithm is used to evaluate the differences in the expression levels of the exogenous target genes of the multiple generations of monoclonal exogenous target gene expression vector microparticles.

[0069] S223: Based on the difference in the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles obtained in step S222 over multiple generations, determine whether the monoclonal exogenous target gene expression vector microparticles have transgenesis stability, according to the principle that the smaller the difference in expression level, the greater the probability of having transgenesis stability.

[0070] An exogenous target gene expression vector microparticle that expresses a high amount of protein and has passage stability is obtained.

[0071] The exogenous target gene expression fragment is provided within a recombinant vector, and the exogenous target gene is site-specifically integrated into the site of the site-specific integration vector microparticle by the recombinant vector, and the recombinant vector is a lentivirus vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papovavirus vector, integrating phage vector, non-viral vector, transposon, transposase, integrase substrate or plasmid.

[0072] The marker gene expression segment of the site-specific integration vector microparticle is equivalent in length to the exogenous target gene expression segment.

[0073] Specifically, the step of performing homologous recombination using the first recognition sequence of the site-specific integration fragment of the site-specific integration vector microparticle is as follows.

[0074] constructing an exogenous target gene recombination fragment containing an exogenous target gene, wherein the exogenous target gene recombination fragment contains two second recognition sequences and an exogenous target gene expression fragment, the exogenous target gene expression fragment being located between the two second recognition sequences, and the exogenous target gene expression fragment comprising a promoter that regulates and controls expression of the exogenous target gene, and an exogenous target gene sequence; The exogenous gene is integrated into the site of the site-specific integration vector microparticle, and the two first recognition sequences on either side of the marker gene become a third recognition sequence and a fourth recognition sequence, respectively, the third recognition sequence being formed by the reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence being formed by the reaction of the first recognition sequence and the second recognition sequence, and the sequences of the third recognition sequence and the fourth recognition sequence are different.

[0075] Preferably, as a means for solving the problem, neither the third recognition sequence nor the fourth recognition sequence becomes the second recognition sequence or the first recognition sequence in the same reaction system.

[0076] the third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase; and / or the second recognition sequence is independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence; and / or The third recognition sequence and the recognition sequence are independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, an attL sequence, and an attR sequence.

[0077] In this example, the first recognition sequence refers to the first homologous arm sequence, the second recognition sequence refers to the second homologous arm sequence, the third recognition sequence refers to the third homologous arm sequence, and the fourth recognition sequence refers to the fourth homologous arm sequence; the third recognition sequence is formed by the reaction of the first homologous arm located to the left of the marker gene in the marker gene expression fragment with the second homologous arm located to the left of the exogenous target gene in the exogenous target gene expression fragment; and the fourth recognition sequence is formed by the reaction of the first homologous arm located to the right of the marker gene in the marker gene expression fragment with the second homologous arm located to the right of the exogenous target gene in the exogenous target gene expression fragment.

[0078] In the exogenous target gene expression vector microparticles screened by the method for site-specific integration of an exogenous target gene provided by the present invention, an exogenous target gene is inserted into an endogenous gene of a vector microparticle, and the exogenous gene comprises a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression fragment for expressing a target protein, the exogenous gene being provided between the third recognition sequence and the fourth recognition sequence; the expression level of the target gene in the exogenous target gene expression vector microparticle is higher than the preset threshold value; The exogenous target gene expression vector microparticles are passage stable.

[0079] The exogenous target gene expression fragment has a promoter, and the promoter is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, a UBC promoter, an EF1a promoter, a ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, an HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, an SM22α promoter, or an Endothelin-1 promoter.

[0080] The third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase.

[0081] The third recognition sequence and the recognition sequence are independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, an attL sequence, and an attR sequence.

[0082] In this example, the first recognition sequence refers to the attP sequence, the second recognition sequence refers to the attB sequence, the third recognition sequence refers to the attL sequence, and the fourth recognition sequence refers to the attR sequence.

[0083] The present invention provides a system for site-specific integration of an exogenous target gene, wherein the system is an electronic device and / or a non-transitory computer-readable storage medium, The electronic device includes a memory, a processor, and a computer program stored in the memory and operable on the processor, wherein the processor, when executing the program, performs steps of the method for site-specific integration of an exogenous target gene; The non-transitory computer-readable storage medium has stored thereon a computer program that, when executed by a processor, implements the steps of the method for site-specific integration of an exogenous target gene.

[0084] The following is an example.

[0085] Example 1: Screening method for site-specific integration sites, preparation of site-specific integration vector microparticles, site-specific integration method for exogenous target gene, preparation of exogenous target gene expression vector microparticles The method for screening for site-specific integration sites provided in this Example 1 includes the following steps, as shown in FIG.

[0086] (1) A marker gene having homologous arms at both ends is randomly integrated into the endogenous gene of a vector particle to obtain a vector particle carrying the marker gene.

[0087] In Example 1, the green fluorescent protein gene (EGFP) was used as a screening marker gene. As shown in Figure 1, a recombinant plasmid containing RMCE (recombinase-mediated cassette exchange) was constructed using attP sequences as homologous arms. The marker gene expression fragment contained in the recombinant plasmid used for random integration is shown in Figure 2.

[0088] The constructed plasmid was linearized, and the linear DNA was purified and collected. 6CHO-K1 cells were transferred to a 1.5 mL centrifuge tube and centrifuged at 1000 rpm at room temperature for 5 minutes, and the supernatant was discarded. The cells were resuspended in 100 μL of R buffer, a resuspension buffer specifically designed for the cell electroporation device. Electroporation conditions: 1575 V, 10 ms, 3 times. Number of cells: 3 × 10 6 Amount of plasmid used: 15 μg. A fluorescent protein gene with attP sequences at both ends was randomly integrated into the endogenous gene of the vector microparticle. The construction plasmid integrated into the endogenous gene is the exogenous gene, and the marker gene expression fragment shown in Figure 2 was integrated into the endogenous gene. The vector microparticle is a cell.

[0089] After two days, cells were seeded into a 96-well plate at a density of 10,000 cells / well using 800 μg / ml G418 as the pressure reagent, with at least 200 μl of medium per well. After 10 days, the plate was observed. If numerous fluorescent cell clusters were observed, the cells were ready for enrichment. Enrichment methods include, but are not limited to, manual enrichment. During enrichment, follow the one-well-to-one principle; do not concentrate cells from multiple wells into a single well.

[0090] (2) The vector microparticles carrying the marker gene obtained in step (1) are amplified and cultured to form a pool of vector microparticles to be screened. The specific steps are as follows:

[0091] After enrichment, cell growth was monitored periodically, and expansion was performed when cell coverage reached 50% or higher. Expansion was performed in two ways: 96-well plate, 24-well plate, and 6-well plate, or 96-well plate and 6-well plate. After expansion in shake flasks, the cells were subcultured two to three times to form a stable cell pool, which could then be used for monoclonal screening.

[0092] (3) Monoclonal screening is performed on the pool of vector microparticles to be screened obtained in step (2), and simultaneously with the monoclonal screening, monoclonal vector microparticles whose expression levels of the marker gene and / or exogenous target gene are higher than a predetermined threshold are retained depending on the expression levels of the marker gene and / or exogenous target gene, thereby obtaining monoclonal vector microparticles with high protein expression levels.

[0093] The formation of monoclonal cells and screening for stable fluorescence is achieved by artificial intelligence, as shown in Figure 3 below.

[0094] Specifically, the steps are as described in a to h.

[0095] (3-1) The pool of vector microparticles to be screened obtained in step (2) is imaged to obtain images of the vector microparticles to be screened, preferably using high-throughput scanning, and if the marker gene is a fluorescent protein, preferably using high-throughput fluorescent scanning.

[0096] a) The stable cell pool was diluted to a certain concentration and then inoculated into a culture dish containing semi-solid medium. During the inoculation process, the cells were distributed evenly across the dish. The dish was left undisturbed for approximately 30 minutes to allow the cells to settle to the bottom of the dish.

[0097] b) The culture dish was transferred to a microscope stage, and the cells in the culture dish were scanned with a microscope for high throughput.

[0098] (3-2) The images of the vector microparticles to be screened obtained in step (3-1) were subjected to image processing to obtain images of each vector microparticle, and the expression levels of the marker genes and / or exogenous target genes of the vector microparticles were predicted using an intelligent algorithm according to the image features.

[0099] c) The images scanned by the microscope were uploaded to a server for image analysis using artificial intelligence. The analysis process included detecting monoclonal cell lines, predicting protein expression levels in the monoclonal cell lines, sorting the protein expression levels, and coding and localizing the selected high-protein-expressing cell lines. The prediction of protein expression levels in the monoclonal cell lines may or may not be based on fluorescence. The next step c is to predict protein expression levels without fluorescence.

[0100] In step c, the monoclonal cell line target was detected using image processing techniques. In this example, the YOLOv8 target detection algorithm was used, resulting in an actual detection efficiency of mAP 94.2%, as shown in Figure 4.

[0101] In step c, the target detection model for monoclonal cell lines is consistent with general deep learning target detection models, so a detailed description is omitted. Specifically, since cell images need to be annotated in advance, bounding boxes for all monoclonal cell lines and adherent cell lines are annotated to improve the algorithm's prediction accuracy. These serve as the true target bounding boxes in the loss calculation for the model output. After training the algorithm, the model learns to extract bounding box information for monoclonal cell lines. In a practical application scenario, in step c, the trained model can predict the bounding boxes of monoclonal cell lines in images.

[0102] Because the screened sites can be used to insert and express exogenous genes of various lengths, and the length of the exogenous gene inserted into the site strongly correlates with the level of protein expression, several sets of fluorescent protein marker genes with various deoxyribonucleic acid lengths were selected. In this example, four exogenous gene expression fragments of approximately 0.75k, 1k, 3k, and 15k lengths were used. The exogenous genes included genes capable of expressing fluorescent proteins and / or genes capable of expressing other proteins. By testing the expression of fluorescent proteins and other proteins, images of cells expressing four exogenous genes of similar lengths (0.75k, 1k, 3k, and 15k) were selected for artificial intelligence image learning. The 0.75k exogenous gene length corresponds to a case where the exogenous gene is capable of expressing fluorescent proteins at a specific site in the target cell line and the length of the inserted exogenous gene expression fragment is approximately 0.75k. The case where the length of the inserted exogenous gene is 1K corresponds to the case where the target gene is double-stranded DNA at a specific site in the target cell line and the length of the exogenous gene expression fragment is approximately 1K. The case where the length of the inserted exogenous gene is 3K corresponds to the case where the target gene is a monoclonal antibody at a specific site in the target cell line and the length of the exogenous gene expression fragment is approximately 3K to 7K. The case where the length of the inserted gene is 15K corresponds to the case where the target gene is used to express a multivalent antibody or multiple insertion structures at a specific site in the target cell line and the length of the exogenous gene expression fragment is approximately 15K.

[0103] In step c, four sets of expression level prediction models with different lengths were provided, each corresponding to a set of fluorescence value labels. Artificial intelligence image learning was performed using historical images of CHO cells into which four exogenous target genes of different lengths had been inserted, generating four prediction models, and high expression prediction analysis was performed. When applying the site, the exogenous target gene expression fragment was replaced with an exogenous target gene expression fragment of similar length. When constructing the CHO cell as a historical image, exogenous genes of different lengths can be used as marker gene expression fragments to replace the exogenous gene at the high expression site. The prediction model can then be used to determine whether the site remains a high expression site even when proteins with genes of different lengths are expressed. If all inserted genes of different lengths are predicted to become high expression sites after replacement with marker genes, the site can be determined to be a protein expression site suitable for exogenous target gene expression fragments of different lengths. In this case, the marker gene may be a fluorescent protein or a different protein. The fluorescence value after expression or the actual protein expression level detected for the marker gene was used as the label. In step c, historical images of CHO cells in which the deoxyribonucleotide length of the inserted exogenous gene was the same as or similar to the length of the DNA sequence of the inserted exogenous gene of green fluorescent protein gene (EGFP) were used to perform high expression prediction analysis using a prediction model generated by artificial intelligence image learning.

[0104] Step c predicts the expression levels of fluorescent proteins based on the monoclonal cell images. In this example, we use the SqueezeNet deep learning network and the MSE loss function to predict the expression levels of exogenous genes or marker genes in the monoclonal cell images as labels in the regression algorithm.

[0105] For the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles predicted by a plurality of intelligent algorithms, a normalized discounted cumulative gain (NDCG) is evaluated using a sorting algorithm to evaluate the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms, and an intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used according to the rule that the larger the normalized discounted cumulative gain, the better the sorting accuracy of the protein expression levels; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows:

number

[0106] Specifically, in this example, the expression level was predicted based on cell images, and the cells were sorted according to the predicted expression levels. The NDCG was 0.89 when compared with the sorting results based on actual fluorescence values. The expression level prediction model in this invention is described in the Chinese patent document "Cell screening method and apparatus based on convolutional neural network."

[0107] (3-3) Vector microparticles whose expression levels of marker genes and / or exogenous target genes exceed a predetermined threshold are identified and acquired according to the image, and then transferred to and retained at a predetermined position in the culture medium, where the predetermined threshold refers to a fixed ratio of the expression levels of the marker genes and / or exogenous target genes before sorting in descending order of expression levels.

[0108] d) The coding information and localization information of the screened protein-high expressing cell lines were returned to the robot control software.

[0109] In this example, the cell codes and positions returned in step d were the top 100 cells based on predicted expression levels. The codes ranged from 1 to 100. The position information included coordinates in a plane coordinate system based on the center of the microscope (since all selected cells sink to the bottom of the dish, the depth of the culture medium was not taken into account. Also, during the photography process, cells that do not sink to the bottom of the dish will be out of focus and will appear blurry, and cells with blurry images will also be excluded as candidate cells).

[0110] e) The robot control software automatically (or manually) operated the robotic arm to aspirate the screened monoclonal cell lines and transfer them to the designated well plate. This process was repeated until all high-expressing cell lines were transferred.

[0111] Step e is a process in which the robotic arm aspirates the monoclonal cell line of interest and transfers it to a well plate.

[0112] Chinese patent documents: Publication number CN113821287B "Robot-based cell manipulation task processing method, device, equipment and medium", publication number CN113821287B "Robot-based cell liquid collection control method, device, equipment and storage medium", publication number CN113771030A "Cell manipulation robot control method, device, equipment and storage medium", publication number CN113733087B "Cell manipulation robot control method, device, equipment and storage medium" are described in detail.

[0113] f) After culturing a certain number of cell clones in the well plate, they were transferred to a larger well plate and finally expanded to a shake flask, and the cell expression level was detected, confirming that the cell line selected by artificial intelligence was a high-yield cell line.

[0114] In this example, step f is to transfer the cells to 96-well plates for expansion and then to shake flasks for culture.

[0115] (4) The monoclonal vector microparticles with high protein expression levels obtained in step (3) were subcultured, and the subgenerational stability of the monoclonal vector microparticles was determined from the expression levels of the marker genes of the vector microparticles over multiple generations. High-expression monoclonal vector microparticles with subgenerational stability were obtained, and the insertion position of the exogenous gene in the endogenous gene was designated as the site-specific integration site.

[0116] (4-1) The expression levels of the marker genes in the monoclonal vector microparticles of multiple generations were obtained.

[0117] g) The selected high-yield cell lines were subcultured. Before each generation of the cell lines, diluted samples were placed on culture dishes and images were taken using a microscope. Images of the cell lines were continuously taken over several generations. Currently, the expression of the selected cells can be predicted using a model learned from cell morphology using photography, and the expression of the selected cells can also be predicted using fluorescent labeling.

[0118] In step g, in this example, imaging of the monoclonal cells was performed using a Thermo Fisher Scientific M7000 microscope.

[0119] (4-2) Based on the expression levels of the marker genes of the multiple generations of monoclonal vector microparticles obtained in step (4-1), an intelligent algorithm was used to evaluate the differences in the expression levels of the marker genes of the multiple generations of monoclonal vector microparticles.

[0120] (4-3) Based on the difference in the expression level of the marker gene in the monoclonal vector microparticles of multiple generations obtained in step (4-2), it was determined whether the monoclonal vector microparticles had passage stability.

[0121] h) The collected images of cell lines from multiple generations were input into an artificial intelligence algorithm to predict the cell line's passage stability based on fluorescence intensity and / or protein expression, and cell lines with high protein expression and stable passage characteristics were selected as final candidate cell lines. The passage stability of the cell line can be predicted based on fluorescence or cell morphology rather than fluorescence. The next step h is to predict protein expression based on cell morphology rather than fluorescence. The final candidate cell line is a site-specific integration vector microparticle.

[0122] In step h, the passage stability of the cell lines was predicted. This includes, but is not limited to, traditional image recognition algorithms that use histograms to extract image features and make predictions, algorithms that automatically extract image features and make predictions using deep learning neural networks, and other image-based techniques. In this example, a deep learning-based method was used to automatically extract image features of stable and unstable cell lines and predict their stability. This achieved an accuracy rate of 84% for predicting different cell lines. This is described in detail in the Chinese patent document "Method, Apparatus, Computer Device, and Storage Medium for Predicting Cell Line Stability."

[0123] (5) The stable cell lines screened by AI were expanded in shaker flasks and their growth curves were monitored for 14 days using CHO-K1 cells as a control. The inoculation density was 5 × 10 5 / ml, and the inoculation volume was 30 ml, and the cell number was measured on the day of inoculation and on days 3, 5, 7, 9, 11, 13, and 14 of culture. By screening and eliminating single clones that grew slower than CHO-K1, we obtained a site-specific integration vector that had high expression and greater passage stability than the CHO-K1 cell line.

[0124] (6) The site-specific integration vector, which showed high expression and higher passage stability than the CHO-K1 cell line, was stably passaged every 3 or 4 days. The cell density on the 4th day of passage was 3 × 10 5 / ml, the cell density on the third day of passage was 5 × 10 5 The fluorescence intensity of the cell line was monitored periodically during the passage. A passage stability study was conducted for the above-mentioned high-fluorescence cell line using passage medium for approximately 90 days. Cells with relatively small changes in fluorescence and stable growth were confirmed to be stable high-fluorescence cells. The copy number and integration site of the stable high-fluorescence cells were verified. The stable high-fluorescence cells used here represent a site-specific integration vector with high passage stability and high expression levels.

[0125] Using the above-mentioned site-specific integration vector as an example, we screened for exogenous target gene expression vector microparticles that integrate an exogenous target gene, have high target gene expression levels, and have high passage stability. The method for site-specific integration of an exogenous target gene provided by the present invention includes the following steps:

[0126] The site-specific integration vector microparticles provided by the present invention are obtained, and homologous recombination is performed using the first homologous arm in the exogenous gene within the site-specific integration vector microparticles, thereby recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector microparticles and removing the marker gene expression fragment.

[0127] The specific steps are as follows:

[0128] (7) Stable, highly fluorescent cells were electroporated with a plasmid containing an exogenous target gene and co-transfected with Bxb1 integrase. The exogenous target gene-containing plasmid contains two attB sequences and a target gene sequence located between the two attB sequences. This exogenous gene contains an exogenous target gene expression fragment that can replace the marker gene expression fragment inserted into the endogenous gene. This exogenous target gene expression fragment contains two attB sequences and a target gene sequence located between the two attB sequences. Through the action of Bxb1 integrase, the attP on the left side of the marker gene EGFP and the attB on the left side of the target gene form attL, and the attP on the right side of the marker gene EGFP and the attB on the right side of the target gene form attR. The exogenous target gene expression fragment then completes the replacement of the marker gene expression fragment.

[0129] Two days after electroporation, the plates were inspected and the electroporation efficiency was recorded. Hygromycin was then added at a concentration of 250 μg / ml. The cells were then distributed in 96-well plates at 6,000–10,000 cells per well.

[0130] The 96-well plate was placed in a CO2 incubator (37°C, 80% humidity) and cultured for 1-2 weeks. The percentage of non-fluorescent cells in the minipool was counted, and the non-fluorescent cells were manually enriched and monoclonalized by limiting dilution.

[0131] (8) The monoclonalized 96-well plate was placed in a CO2 incubator (37°C, 80% humidity) and cultured for 14 days. During this period, photographs of the single clones were taken on the day of inoculation, and on days 1, 2, 3, 7, and 14 of culture to confirm the status of the single clones and their fluorescence.

[0132] The method for generating monoclonal cells and screening for stable high-expressing cell lines can also be achieved using artificial intelligence. The specific steps for achieving this using artificial intelligence are similar to processes a to h in step 5 above, with the following differences: In step c, high-expression prediction analysis is performed using a prediction model generated by performing artificial intelligence image learning using historical images of CHO cells containing a marker gene expression fragment with a DNA sequence length similar to that of the exogenous target gene expression fragment inserted into the target cell line, and exogenous target gene expression vector microparticles are obtained.

[0133] (9) After 14 days, single clones confirmed to be non-fluorescent and growing normally were expanded in 24-well plates and cultured in a constant-temperature incubator (37°C, 80% humidity) for further amplification, followed by expansion into shake flasks. Approximately one month later, the cell lines were transferred to the feed stage and cultured in a fed-batch culture (Advance + 1% Glutamax for the first three days). On days 3 and 5 of culture, 3% (v / v) Cell Boost 7a and 0.3% (v / v) Cell Boost 7b (cytiva) were simultaneously added. On days 7, 9, 11, and 13 of culture, 5% (v / v) Cell Boost 7a and 0.5% (v / v) Cell Boost 7b (cytiva) were simultaneously added daily. Sugars were replenished according to the cells' sugar consumption on days 3, 5, 7, 9, 11, and 13 of culture, and expression levels were evaluated.

[0134] (10) Monoclonal cells with relatively high expression were confirmed by continuous subculture for approximately 90 days. During this period, 5 × 10 6 Individual cells were retained and their genomes were extracted to verify the site substitution and detect remaining genes. Then, batch cultures were performed for 7 days at passages 1, 13, and 26 to confirm the expression level and QP stability. "QP stability" refers to the stability of daily production by individual cells.

[0135] Steps 1 through 6 of the above process completed the "mother cell line construction + screening" process, completing the construction and screening of the mother cell line in a single step, yielding site-specific integration vector microparticles. Steps 7 and 8 of the above process completed the "target cell line construction + first screening" process, achieving site-specific integration of the exogenous target gene and completing the initial screening of the target cell line. The target cell line obtained through the initial screening was then subjected to second and third screenings via steps 9 and 10 to screen for exogenous target gene expression vector microparticles with higher expression levels and better stability. The exogenous gene insertion position of the exogenous target gene expression fragment in the exogenous target gene expression vector microparticles is the same as the exogenous gene insertion position of the marker gene expression fragment in the site-specific integration vector microparticles. When the same site-specific integration vector microparticles are used, the exogenous gene insertion position of the exogenous target gene expression fragment in the exogenous target gene expression vector microparticles obtained using the above-mentioned exogenous target gene integration method is the same, thereby achieving site-specific integration of the target gene.

[0136] The conventional two-step screening method of "mother cell line construction + screening" takes 12 months. By adopting steps 1 to 6 of the above process, the one-step screening method of "mother cell line construction + screening" only takes 6 months, a 50% reduction from the previous method. Furthermore, the mother cell line has high stability and expression levels. The main reasons for this significant time reduction are the adoption of the one-step method of "mother cell line construction + screening" and the use of artificial intelligence to efficiently and quickly screen monoclonal cell lines.

[0137] Using conventional technology, it takes 12 months to complete the "target cell line construction + screening" process. However, by adopting steps 7 to 10 of the above process, the "target cell line construction + screening" process can be completed in just 6 months, a 50% reduction. Furthermore, the target cell line is highly stable and exhibits high expression levels of the exogenous target gene. This significant time reduction is primarily due to the high stability and expression levels of the mother cell line, and the site-specific integration method for inserting the exogenous target gene into a specific site within the mother cell line, shortening the "target cell line construction + screening" process. The resulting target cell line is highly stable and exhibits high expression levels of the exogenous target gene.

[0138] Furthermore, when predicting expression levels, training was performed using images of cells into which an exogenous gene had been inserted. When predicting mother cells, training was performed using historical cell images of the original cells into which an exogenous gene with a DNA sequence length similar to that of the exogenous gene inserted into the mother cells was inserted. This enabled early prediction of expression levels, which were then used for screening of mother cell lines. When predicting target cell lines, training was performed using images of cells into which an exogenous gene with a DNA sequence length similar to that of the exogenous gene inserted into the target cells was inserted. This enabled early prediction of expression levels, which were then used for screening of product cell lines, thereby increasing the likelihood of obtaining a site capable of high expression of the exogenous target gene. In this way, the possibility of not achieving high expression of the exogenous target gene due to the length of the exogenous target gene expression fragment containing the exogenous target gene that needs to be site-specifically integrated into a specific site being significantly different from the length of the marker gene expression fragment inserted during mother cell screening can be reduced.

[0139] Example 2: Screening of S6C7 sites and preparation of site-specific integration vector microparticles and exogenous target gene expression vector microparticles In this example, the site-specific integration vector microparticles and exogenous target gene expression vector microparticles prepared using the method described in Example 1 differ from those in Example 1 in the following respects.

[0140] The specific steps that differ are as follows:

[0141] (1) The operation flow of this Example 2 is shown in Figure 5. Specific consumables are as follows: Neon Resuspension Buffer R (ThermoFisher), which is a resuspension buffer for cell electroporation; E1 Buffer (ThermoFisher), which is an electric shock solution; recovery medium: 80% (v / v) EX-CELL CHO Cloning Medium (Sigma-Aldrich) and 20% (v / v) EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich) supplemented with 1% GlutaMAX (ThermoFisher); amplification medium and subculture medium: EX-CELL Advanced CHO Fed-batch Pressure medium 1: Passage medium supplemented with G418 at a final concentration of 800 μg / ml; Pressure medium 2: Passage medium supplemented with hygromycin at a final concentration of 250 μg / ml; Conditioned medium: CHO-K1 cells inoculated into the passage medium and cultured for one day, followed by sterile filtration of the supernatant; Cloning medium: 75% (v / v) EX-CELL CHO Cloning Medium, 20% (v / v) conditioned medium, and 5% (v / v) ClonaCell-CHO ACF Supplement supplemented with 1% GlutaMAX; Fed-batch medium: EX-CELL Advanced CHO Fed-batch Medium supplemented with 1% GlutaMAX; Feed medium: Cell Boost 7a / 7b (HyClone).

[0142] (2) The site-specific integration vector microparticles obtained in step 6 were named GBB003 mother cells.

[0143] (3) The target genes in step 8 are target gene 1 (monoclonal antibody), target gene 2 (monoclonal antibody), target gene 3 (fusion protein), target gene 4 (bispecific antibody; IgG-SCFV), and target gene 5 (bispecific antibody; KiH-Crossmab), respectively. Target genes 1 to 5 were each cloned into different plasmids by enzymatic digestion and ligation to construct recombinant plasmids containing RMCE. The recombinant plasmids for target gene 1, target gene 2, target gene 4, and target gene 5 are shown in Figure 6, and the recombinant plasmid for target gene 3 is shown in Figure 7.

[0144] The exogenous fragment inserted into the endogenous gene in GBB003 mother cells was 7545 bp long, the marker gene expression fragment was 3815 bp long, and the remaining fragments were 3730 bp long. The exogenous target gene expression fragment corresponding to target gene 1 was 6817 bp long, the exogenous target gene expression fragment corresponding to target gene 2 was 6866 bp long, the exogenous target gene expression fragment corresponding to target gene 3 was 2548 bp long, the exogenous target gene expression fragment corresponding to target gene 4 was 7688 bp long, and the exogenous target gene expression fragment corresponding to target gene 5 was 12256 bp long. Insertion of gene fragments of different lengths was used to verify the stability of the site and / or the editable length of the gene fragment.

[0145] exogenous target gene 1 has a light chain sequence shown in SEQ ID No. 2 and exogenous target gene 1 has a heavy chain sequence shown in SEQ ID No. 3; exogenous target gene 2 has a light chain sequence shown in SEQ ID No. 4 and exogenous target gene 2 has a heavy chain sequence shown in SEQ ID No. 5; exogenous target gene 3 has the sequence shown in SEQ ID No. 24; exogenous target gene 4 has a light chain sequence shown in SEQ ID No. 25 and exogenous target gene 4 has a heavy chain sequence shown in SEQ ID No. 26; The exogenous target gene 5 has a target gene 5 light chain 1 sequence shown in SEQ ID No. 27, a target gene 5 heavy chain 1 sequence shown in SEQ ID No. 28, a target gene 5 light chain 2 sequence shown in SEQ ID No. 29, and a target gene 5 heavy chain 2 sequence shown in SEQ ID No. 30.

[0146] (4) In step 9, the expression levels of the site-specific integration product minipool cell pool (GBB003-minipool), the exogenous target gene 1 expression vector microparticles (denoted as GBB003-2D8 cells), the random integration minipool cell pool (random minipool) cultured under the same conditions, and the single copy cell line (random single clone) are compared as shown in Figure 8.

[0147] (5) In step 10, the 1st, 13th, and 26th generations were batch cultured for 7 days, and sugar was replenished on days 3, 5, and 7 depending on the sugar consumption of the cells. The expression levels are shown in Figure 9, which indicates that the monoclonal cells are stable and have a high yield.

[0148] Next-generation whole-genome sequencing of the mother cell line GBB003, which corresponds to a cell line that overexpresses both the fluorescent gene and the target gene, revealed that the mother cell line GBB003 was a single copy, and the annotation information for the integration site in CHO-K1 was NW_003616785.1:83044. This integration site, which is the insertion site of the exogenous gene into the endogenous gene, was designated S6C7.

[0149] The sequence of the target gene 1 integrated fragment is shown in SEQ ID No. 6. The genome of the GBB003-2D8 cells was amplified using the breakpoint upstream primer F1 (SEQ ID No. 7): AGACCAGCCTCAGATGTCACAC and the target gene downstream primer R1 (SEQ ID No. 8): AGGCACACAACGGAGGCGGT in the integration plasmid. The target gene 1 downstream primer R1 is located in the light chain of target gene 1, and a fragment consistent with the theoretical size of 3403 bp was obtained, as shown in Figure 10 (the corresponding band in the GBB003-2D8 cell lane).

[0150] The sequence fragment incorporating target gene 1 contains attL, the nucleotide sequence of which is shown in SEQ ID No. 9:ATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACC. In the sequence fragment incorporating target gene 1, the portion before attL is an exogenous sequence, and the portion after attL is an endogenous sequence. The exogenous sequence includes a portion of the light chain reading frame of target gene 1, i.e., a sequence amplified from SEQ ID No. 8. Target gene 1 may encode a monoclonal antibody.

[0151] The amplified band was excised from the gel, purified, and recovered, and multiple primer pairs were designed for DNA sequencing. The spliced ​​sequence was shown in SEQ ID No. 6, which was consistent with the theoretical sequence, confirming that target gene 1 had been correctly integrated into the corresponding position of the marker gene expression fragment.

[0152] Furthermore, the vector microparticle CHO-K1 cells have the S6C7 site, which is located within the fragment represented by SEQ ID No. 1. Specifically, the annotation information for the integration site S6C7 in CHO-K1 is NW_003616785.1:83044.

[0153] Similarly, the sequence fragment that site-specifically integrated exogenous target gene 2 into GBB003 mother cells is shown in SEQ ID No. 10.

[0154] The genome of the cell line in which exogenous target gene 2 had been site-specifically integrated into the mother cell line GBB003 was amplified using the breakpoint upstream primer F1 (SEQ ID No. 7): AGACCAGCCTCAGATGTCACAC and the target gene 2 downstream primer R2 (SEQ ID No. 11): CCTTAGAATCCTGCTCGGTGA on the fragment into which exogenous target gene 2 had been inserted. As shown in Figure 11 (the corresponding band in the GBB003-1G2 lane), a fragment of the theoretical size (3,486 bp) was obtained.

[0155] The amplified band was excised from the gel, purified, and recovered, and multiple primer pairs were designed for DNA sequencing. The spliced ​​sequence, shown in SEQ ID No. 10, matched the theoretical sequence (SEQ ID No. 10), confirming that exogenous target gene 2 was correctly integrated into the corresponding position of the marker gene expression fragment. The sequence fragment incorporating exogenous target gene 2 contains attL. In the sequence fragment incorporating exogenous target gene 2, the portion before attL is the exogenous sequence, and the portion after attL is the endogenous sequence. The exogenous sequence includes target gene 2.

[0156] Similarly, the sequence fragment containing site-specific integration of exogenous target gene 3 into GBB003 mother cells is shown in SEQ ID No. 31. The genome of the cell line containing site-specific integration of exogenous target gene 3 into GBB003 mother cells was amplified using the breakpoint upstream primer F1 (SEQ ID No. 7): AGACCAGCCTCAGATGTCACAC and target gene 3 downstream primer R2 (SEQ ID No. 32): CTCGACGCCATCCACGTACCAG. As shown in Figure 12 (the corresponding band in lane GBB003-1D6), a fragment with the theoretical size (2713 bp) was obtained. This confirmed that exogenous target gene 3 was correctly integrated into the corresponding position of the marker gene expression fragment. The sequence fragment containing exogenous target gene 3 includes attL. In the sequence fragment containing exogenous target gene 3, the portion before attL is the exogenous sequence, and the portion after attL is the endogenous sequence. The exogenous sequence includes target gene 3.

[0157] Similarly, target gene 4 was introduced into GBB003 parent cells, and then two cell lines, Y5E6 and Y6F10, were subcultured for 90 days using the exogenous target gene expression vector microparticles based on AI prediction. The stability of cell viability after subculture is shown in Figure 13, and the stability of cell proliferation rate is shown in Figure 14.

[0158] The glycoforms formed by integration, which are quality characteristics of the products from Y5E6 and Y6F10 cells, are shown in Figure 15, the comparative results of charge heterogeneity are shown in Figure 16, and the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis detection are shown in Figure 17. These results demonstrate that GBB003 mother cells can integrate the 7688-bp exogenous target gene expression fragment and stably express the target gene contained in the 7688-bp exogenous target gene expression fragment.

[0159] Similarly, the concentration of target gene 5-expressing antibody in a 6-well batch culture of a cell pool after integration of target gene 5 into GBB003 mother cells is shown in Figure 18, and the sodium dodecyl sulfate-polyacrylamide gel electrophoresis detection results are shown in Figure 19. These results indicate that the GBB003 mother cell line can integrate the 12,256-bp long exogenous target gene expression fragment and stably express the target gene within the 12,256-bp long exogenous target gene expression fragment.

[0160] Combined with the expression and passage stability of target gene 1, target gene 2, target gene 3, target gene 4, or target gene 5 integrated into the GBB003 parent cell line, the site-specific integration vector microparticles screened by the method of this example were found to be usable for integrating exogenous target gene expression fragments of various lengths.

[0161] Example 3: Screening of S4F6 sites and preparation of site-specific integration vector microparticles and exogenous target gene expression vector microparticles In this example, the S4F6 site was screened by referring to the technical means of Example 2, and site-specific integration vector microparticles and exogenous target gene expression vector microparticles were prepared, but the differences from Example 2 are as follows.

[0162] The specific steps that differ are as follows:

[0163] (1) The consumables used in the specific examples are as follows: Neon Resuspension Buffer R (ThermoFisher), which is a resuspension buffer for electroporation; electroshock solution E (ThermoFisher); recovery medium: EX-CELLAdvanced CHO Fed-batch Medium (Sigma-Aldrich); amplification medium: EX-CELLAdvanced CHO Fed-batch Medium supplemented with 200 μg / ml hygromycin (ThermoFisher) and 1% GlutaMAX (ThermoFisher); shake flask medium: EX-CELLAdvanced CHO Fed-batch Medium supplemented with 1% GlutaMAX; basal medium for fed-batch medium: 100% EX-CELLAdvanced CHO Fed-batch Medium; and feed medium: 4% Cell Boost 7a / 7b (HyClone).

[0164] (2) In step 6, the highly fluorescent cell line was subcultured for 90 days to study its stability. Subcultures were performed every 3 or 4 days. The cell density on day 4 of subculture was 3 × 10 5 / ml, the cell density on the third day of passage was 5 × 10 5 The fluorescence intensity of the cell line was monitored during passage, and cells with relatively small changes in fluorescence intensity and stable growth were confirmed to be stable, highly fluorescent cells. This cell line was designated GBB-01 cells. GBB-01 cells were the parent cell line and were used as the preferred site-specific integration vector microparticles. As shown in Figure 19, GBB-01 cells maintained stable growth even after 90 days of passage, and as shown in Table 1, protein expression in GBB-01 cells was stable.

[0165] [Table 1]

[0166] (3) In step 7, the target gene 6 recombination plasmid contains the exogenous target gene 6 expression fragment of target gene 6 between attB. The target gene 6 fragment was cloned into the exogenous target gene 6 expression fragment (see Figure 21) and verified by electroporation, and then co-transfected with the Bxb1 integrase plasmid (see Figure 22) into the mother cell line. The prokaryotic resistance gene was used for constructing and screening the prokaryotic plasmid, homology arm 1 (attP in the marker gene expression fragment in the mother cell GBB-01) and homology arm 2 (attB in the exogenous target gene expression fragment) were used to generate recombination replacement with the screened mother cell line, promoter 1 was used to drive expression of the hygromycin gene after recombination with the mother cell, and promoter 3 was used to drive expression of the target gene, which was inserted by BamH I and Xho I enzyme digestion. The structure of the Bxb1 integrase plasmid is shown in Figure 22. Here, the prokaryotic resistance gene is used in the construction and screening of the prokaryotic plasmid, Promoter 1 drives the expression of the Bxb1 recombinase gene, and Promoter 2 drives the expression of the prokaryotic resistance gene.

[0167] The length of the exogenous gene fragment inserted into the endogenous gene in the GBB-01 mother cell was 7545 bp, the length of the marker gene expression fragment in the exogenous gene was 3815 bp, and the length of the remaining exogenous gene fragment was 3730 bp. The length of the exogenous target gene expression fragment containing target gene 6 was 2227 bp.

[0168] The target gene 6 fragment has the sequence shown in SEQ ID No.13.

[0169] (4) In step 9, non-fluorescent cells in the monoclonal cells (i.e., expression vector microparticles of exogenous target gene 6) were further amplified (using amplification medium), expanded to the shake flask stage (using shake flask medium), and expression levels were assessed by fed-batch culture (using fed-batch medium). Figure 23 shows a comparison of the expression levels of site-specifically integrated expression vector microparticles of exogenous target gene 6 (referred to as GBB-01-H8 cells) with a randomly integrated three-copy cell line of target gene 6 cultured under the same conditions. Here, "targeted integration single copy" refers to GBB-01-H8 cells.

[0170] (5) In step 10, GBB-01-H8 cells were passaged continuously for approximately 90 days to evaluate stability, followed by 7 days of batch culture (cultured in basal medium only). As a result, GBB-01-H8 cells demonstrated passage stability and high expression levels in both expression level (Figure 24) and specific yield (Figure 25).

[0171] The quality characteristics of GBB-01-H8 cells were investigated and compared with the expression products of cell lines obtained by random integration method in several aspects:

[0172] The comparison of sugar spectra in Figure 26 and charge heterogeneity in Figure 27 showed that the quality characteristics of the targeted integration cell product (GBB-01-H8 cells) and the control cell product (i.e., the cell line expression product obtained by the random integration method) were similar and not significantly different.

[0173] Next-generation whole-genome sequencing of GBB-01 cells, which correspond to GBB-01-H8 cells that overexpress both the fluorescent protein EGFP and target gene 6, identified the integration site in CHO-K1 as NC_048596:34375010, located in the intergenic region. This integration site, which corresponds to the location of the exogenous gene relative to the endogenous gene, was designated S4F6.

[0174] The sequence fragment of NC_048596 after integration of target gene 6 is shown in SEQ ID No. 14.

[0175] The GBB-01-H8 cell genome was amplified using the above breakpoint upstream primer F (SEQ ID No. 15): tgcagccacactaagatgg and the target gene 6 downstream primer R (SEQ ID No. 16): ccagagacaggctcaaggac on the exogenous target gene 6 expression fragment, resulting in a fragment consistent with the theoretical size (2876 bp), as shown in Figure 28 (corresponding band in the GBB-01-H8 lane).

[0176] The amplified band was excised from the gel, purified, and recovered, and multiple primer pairs were designed for DNA sequencing. The spliced ​​sequence was shown in SEQ ID No. 14, which was consistent with the theoretical sequence, confirming that target gene 6 had been correctly integrated into the corresponding position of the marker gene expression fragment.

[0177] Comparative Example 1. Comparison of the performance of exogenous target gene expression vector microparticles prepared by the method of the present application and exogenous target gene expression vector microparticles constructed with CRISPR / Cas9 (1) Construction of Cas9 editing plasmid:

[0178] A highly efficient cleavage sequence capable of targeting the 1678-1744 base section of the nucleic acid fragment represented by SEQ ID No. 12, such as the sgRNA represented by SEQ ID No. 17 (SEQ ID No. 17: gatagtcacccacaccagaggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc; GC=55%, no secondary fragments), was designed and the two strands were fused and annealed. The reaction system consisted of 5 μL each of forward and reverse oligos, 5 μL of 10x NEB Buffer 2, and water to a total volume of 50 μL. The system was incubated at 95°C (measured by a thermometer) for 5 minutes and then cooled to 25°C. The resulting product plasmid was ligated with the pDonor CRISPR / Cas9 vector digested with PvuI enzyme. The ligation product was transformed into DH5α competent cells and plated on ampicillin-resistant LB plates. The next day, single clones were selected and the plasmids were extracted. Finally, next-generation sequencing confirmed that the correct Cas9-encoding plasmid had been obtained.

[0179] (2) Construction of donor plasmid: The donor plasmid consists of a 5' homology arm, a gene encoding an anti-PD1 monoclonal antibody, a gene encoding hygromycin, and a 3' homology arm connected in tandem on a pUC19 plasmid.

[0180] (3) Electroporation transfection of Cas9-encoding plasmid and anti-PD1 donor plasmid: Suspended Chinese hamster ovary carcinoma cells, i.e., CHO-K1 cell line, were used. The cell density was adjusted to 5 × 10 on the day before transfection. 5 The next day, transfection was performed using electroporation under the conditions of a voltage of 1575 V, a pulse width of 10 ms, and three pulses. A 6-well cell culture plate was used for transfection, and 3 × 10 cells were transfected per well. 6The transfection was performed in a volume of 2 mL with 15 μg of the required plasmid. After transfection was complete, the cells were incubated at 37°C in 5% CO. 2 The cells were then cultured in an incubator. Co-transfection of the Cas9-encoding plasmid and the anti-PD1 donor plasmid yielded a pool of cells with site-specific integration, whereas transfection of the anti-PD1 donor plasmid alone yielded a pool of cells with random integration that expressed anti-PD1.

[0181] (4) Pressure screening and enrichment of cell pools by site-specific integration.

[0182] (5) The site-specific integration cell pool was preliminarily identified by 5' / 3' junction PCR, and the amplified target fragment was sequenced. Once the site-specific integration cell pool was confirmed, the supernatant was collected.

[0183] (6) Western blot analysis of anti-PD1 antibody expression in the site-specific integration cell pool confirmed the formation of a site-specific integration cell pool. Three weeks after drug addition and screening, anti-PD1 antibody expression in the random integration cell pool was almost undetectable by Western blot analysis, whereas the expression level of anti-PD1 antibody in the site-specific integration cell pool was relatively high.

[0184] (7) Obtaining monoclonal cell lines by limiting dilution: Using the previous site-specific integration cell pool, monoclonal cell lines were obtained by limiting dilution. Specifically, the cell pool was seeded into a 96-well plate at a cell density of 0.8 cells / well. On the same day, the plate was observed to confirm a single clone. After the cells were grown for approximately 5 weeks, a monoclonal cell line of 1 × 10 6Monoclonal cells were aspirated, genomic DNA was extracted, and 5' / 3' junction PCR detection was performed again using the same method as in step (5). For the positive cell lines obtained by junction PCR detection, Western blot detection was further performed to determine whether the anti-PD1 antibody was correctly expressed.

[0185] (8) Evaluation of the expression level of anti-PD1 antibodies in site-specific integration cell lines: The expression level of anti-PD1 antibodies in site-specific integration cell lines was approximately 2.3 times higher than that in random integration cell lines. Site-specific integration cell lines can also be considered targeted integration cell lines that target a fixed site.

[0186] [Table 2]

[0187] Following the steps in Example 3, exogenous target gene expression vector microparticles for GBB-01 cells were constructed using an anti-PD1 antibody editing gene as the target gene and the S4F6 site (NC_048596:34375010) as the site-specific integration site. A cell line with one copy of the anti-PD1 antibody editing gene randomly integrated was used as a control. Expression levels in basal medium in 6-well plate batch culture are shown in Table 2. In 6-well plate batch culture, the expression level of anti-PD1 antibody in the cell line with one copy of random integration was 285 mg / L, whereas the expression level of the exogenous target gene expression vector microparticles for GBB-01 cells with the anti-PD1 antibody editing gene as the target gene and the S4F6 site as the site-specific integration site was 705 mg / L, 2.47-fold higher than that of the cell line with one copy of random integration, demonstrating superiority over the exogenous target gene expression vector microparticles constructed using CRISPR / Cas9.

[0188] Example 4: Screening of S2C4 sites and preparation of site-specific integration vector microparticles and exogenous target gene expression vector microparticles

[0189] In this example, the S2C4 site was screened and site-specific integration vector microparticles and exogenous target gene expression vector microparticles were prepared by referring to the solution in Example 2. The differences from Example 2 are as follows:

[0190] The specific steps that differ are as follows:

[0191] (1) The consumables used in the specific examples are as follows: Neon Resuspension Buffer R (ThermoFisher), which is a resuspension buffer for electroporation; electroshock solution E (ThermoFisher); recovery medium: EX-CELLAdvanced CHO Fed-batch Medium (Sigma-Aldrich); amplification medium: EX-CELLAdvanced CHO Fed-batch Medium supplemented with 200 μg / ml hygromycin (ThermoFisher) and 1% GlutaMAX (ThermoFisher); shake flask medium: EX-CELLAdvanced CHO Fed-batch Medium supplemented with 1% GlutaMAX; basal medium for fed-batch medium: 100% EX-CELLAdvanced CHO Fed-batch Medium supplemented with 1% GlutaMAX; and feed medium: 4% Cell Boost 7a / 7b (HyClone).

[0192] (2) In step 1, highly fluorescent cells were screened from the stable cell pool, and 1% of the cells showing the highest fluorescence were obtained.

[0193] (3) In step 2, the growth of the cells after enrichment was monitored from time to time, and when the coverage rate reached 50% or more, expansion was performed. The expansion method was a 96-well plate and a 6-well plate.

[0194] (4) In step 6, fluorescent site-specific integration vector microparticles in which a single clone of the marker gene expression fragment was inserted into the endogenous gene were amplified and cultured for stable passage. Passage was performed every 3 or 4 days. The cell density after 4 days of passage was 3 x 10 5 / ml, the cell density at 3-day passage was 5 × 10 5 The fluorescence intensity of the cell lines was monitored during passage for a total of 90 days. Highly fluorescent cell lines were retained as the preferred site-specific integration vector microparticles and designated GBBc001 cells, which were subsequently used as mother cells for site-specific integration of exogenous target genes.

[0195] (5) In step 7, target gene 3 (fusion protein) or target gene 1 (monoclonal antibody) fragments were cloned into plasmids to construct the target gene 3 recombinant plasmid containing RMCE (shown in Figure 7) and the target gene 1 recombinant plasmid containing RMCE (shown in Figure 6). The target gene 3 recombinant plasmid contains an exogenous target gene 3 expression fragment with target gene 3 between attB. The target gene 1 recombinant plasmid contains an exogenous target gene 1 expression fragment with target gene 1 between attB.

[0196] (6) In step 8, the percentage of non-fluorescent cells in the cell pool was counted, and after cell viability recovered to 90% or more, the cells were enriched and expanded. After viability recovered to 90%, the cells were seeded using limiting dilution to monoclonalize the cell pool.

[0197] (7) In step 9, after 14 days, the monoclonal exogenous target gene expression vector microparticles (i.e., monoclonal cells) that were confirmed to be non-fluorescent and growing normally were expanded to 24-well plates (Advanced + 1% Glutamax) for further amplification and then expanded to shake flasks (Advanced + 1% Glutamax). Approximately one month later, the cell lines were placed in the feed stage and cultured in a fed-batch culture medium (Advanced + 1% Glutamax for the first three days, 3% 7a and 0.3% 7b (Cytiva) on days 3 and 5, and 5% 7a and 0.5% 7b (Cytiva) daily on days 7, 9, 11, and 13). Sugars were replenished according to the cells' sugar consumption on days 3, 5, 7, 9, 11, and 13, and expression levels were evaluated. The results of comparing the expression levels of exogenous target gene 3 expression vector microparticles, into which one copy of target gene 3 was site-specifically integrated, with those of a randomly integrated cell line cultured under the same conditions, are shown in Figure 29 (GBBc001 in the figure represents exogenous target gene 3 expression vector microparticles). The results of comparing the expression levels of exogenous target gene 1 expression vector microparticles, into which one copy of target gene 1 was site-specifically integrated, with those of a randomly integrated cell line cultured under the same conditions are shown in Figure 29 (GBBc001 in the figure represents exogenous target gene 1 expression vector microparticles).

[0198] (13) In step 10, to examine the stability of the cell product clones corresponding to the exogenous target gene 3 expression vector microparticles, the product clones were serially passaged for approximately 90 days and stability was evaluated. During serial passage, the 1st, 13th, and 26th generation exogenous target gene 3 expression vector microparticles were batch cultured (Advanced + 1% GlutaMAX) for 7 days each. Sugars were replenished according to the cellular sugar consumption on days 3, 5, and 7 of culture. As shown in Figure 31, the results indicate that the exogenous target gene 3 expression vector microparticles exhibited passage stability and high expression levels based on the expression level of target gene 3. The exogenous target gene 3 expression vector microparticles are referred to as GBBc001-14 cells, and the exogenous target gene 1 expression vector microparticles are referred to as GBBc001-3 cells.

[0199] Next-generation whole-genome sequencing of the mother cell GBBc001, corresponding to GBBc001-14 cells that highly express both the fluorescent gene EGFP and target gene 3, yielded an annotation of the integration site in CHO-K1: NC_048595:28250698, which is located in intron 3 of 11 of Mtf1. The insertion site into the exogenous gene in mother cell GBBc001 was identified as NC_048595:28250698, and this insertion site was designated the S2C4 site.

[0200] The sequence fragment incorporating target gene 3 is shown in SEQ ID No. 19.

[0201] The GBBc001-14 cell genome was amplified using the breakpoint upstream primer F1 (SEQ ID No. 20: gtctgggcatggtggttgca, 131 bp upstream of the breakpoint in the genome) and the target gene 3 downstream primer R1 (SEQ ID No. 21: gaggacactccacgcaaca, approximately 600 bp downstream of the translation start site of target gene 3) in the exogenous target gene expression fragment. As shown in Figure 32 (corresponding band in lane GBBc001-14), a fragment of the theoretical size (2113 bp) was obtained (131 bp genome, 696 bp original vector integrated into the genome, 1286 bp product sequence after site replacement).

[0202] The amplified band was excised from the gel, purified, and recovered, and multiple primer pairs were designed for DNA sequencing. The spliced ​​sequence was shown in SEQ ID No. 19, which was consistent with the theoretical sequence, confirming that target gene 3 had been correctly integrated into the corresponding position of the marker gene expression fragment.

[0203] Similarly, the sequence fragment in which target gene 1 was integrated into cell line GBBc001-3, which highly expresses both the fluorescent gene EGFP and target gene 1, is shown in SEQ ID No. 22.

[0204] The GBBc001-3 cell genome was amplified using the breakpoint upstream primer F3 (SEQ ID No. 20): gtctgggcatggtggttgca and the target gene 1 downstream primer R3 (SEQ ID No. 23): actcgcctctattgaagct on the exogenous target gene 1 expression fragment, resulting in a fragment consistent with the theoretical size (3198 bp), as shown in Figure 33 (corresponding band in lane GBBc001-3).

[0205] The amplified band was excised from the gel, purified, and recovered, and multiple primer pairs were designed for DNA sequencing. The spliced ​​sequence was shown in SEQ ID No. 22, which was consistent with the theoretical sequence, confirming that target gene 1 had been correctly integrated into the corresponding position of the marker gene expression fragment.

[0206] Example 5: Targeted integration site screening system The site-specific integration site screening system shown in Figure 34 is an electronic device and / or a non-transitory computer-readable storage medium.

[0207] The electronic device includes a display, a microscope, a robotic arm, a stage, a memory, a processor, and a computer program stored in the memory and operable on the processor, and when the processor executes the program, it realizes the steps of the method for screening site-specific integration sites described in Examples 1 to 4.

[0208] The non-transitory computer-readable storage medium stores a computer program, which, when executed by a processor, performs the steps of the method for screening for site-specific integration sites described in Examples 1 to 4.

[0209] Example 6: Site-specific integration system for exogenous target genes As shown in Figure 33, the system for site-specific integration of an exogenous target gene is an electronic device and / or a non-transitory computer-readable storage medium.

[0210] The electronic device includes a display, a microscope, a robotic arm, a stage, a memory, a processor, and a computer program stored in the memory and operable on the processor, and when the processor executes the program, it realizes the steps of the method for site-specific integration of an exogenous target gene described in Examples 1 to 4.

[0211] The non-transitory computer-readable storage medium stores a computer program, which, when executed by a processor, performs the steps of the method for site-specific integration of an exogenous target gene described in Examples 1 to 4. Those skilled in the art will easily understand that the above are only preferred embodiments of the present invention, and do not limit the present invention, and any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for screening for a site-specific integration site, comprising: A step (1) of randomly incorporating an exogenous gene containing two recognition sequences and a marker gene located between the two recognition sequences into an endogenous gene of a vector microparticle to obtain a vector microparticle having a marker gene; Step (2) amplifying and culturing the vector microparticles carrying the marker gene obtained in step (1) to form a pool of vector microparticles to be screened; Step (3) of performing monoclonal screening on the pool of vector microparticles to be screened obtained in step (2), and simultaneously with the monoclonal screening, retaining monoclonal vector microparticles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a preset threshold value according to the expression levels of the marker genes and / or exogenous target genes, thereby obtaining monoclonal vector microparticles with high protein expression levels; A method for screening for site-specific integration sites, comprising: a step (4) of subculturing the monoclonal vector microparticles with high protein expression levels obtained in step (3), determining the subgenerational stability of the monoclonal vector microparticles from the expression levels of the marker gene in the vector microparticles over multiple generations, obtaining monoclonal vector microparticles with high expression levels that are subgenerationally stable, and designating the insertion position of the exogenous gene in the endogenous gene as a site-specific integration site.

2. the marker gene is equivalent in length to the exogenous target gene to be integrated; The marker gene has several optional lengths, preferably 0.75k, 1k, 3k, 15k; The method for screening site-specific integration sites according to claim 1, characterized in that a marker gene, preferably less than 3k, is employed to predict the expression level of exogenous target genes of other lengths through an intelligent learning algorithm.

3. the marker gene is one or more selected from a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene, and a fluorescent protein gene; and / or The vector microparticle is used to express one or more of an amino acid, a polypeptide, a protein, a nucleotide, a nucleic acid, a secreted product, and is selected from a cell, a bacterium, a virus, and is generally a vector cell, the vector cell is a eukaryotic cell, optionally the eukaryotic cell is a mammalian cell, optionally the mammalian cell comprises a Chinese hamster ovary CHO cell, a human embryonic kidney HEK293 cell, and / or 2. The method for screening a site-specific integration site according to claim 1, wherein the recognition sequences are independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP 2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence.

4. The method for screening site-specific integration sites according to claim 1, characterized in that in step (3), image processing-based technology is adopted to screen the monoclonal vector microparticles, and specific solutions include, but are not limited to, the YOLO series of target detection models and deep learning SSD series algorithm models.

5. In step (3), the expression levels of the marker genes and / or exogenous target genes are predicted by an intelligent algorithm based on the cell images, specifically, Step (3-1) of imaging the pool of vector microparticles to be screened obtained in step (2) to obtain an image of the vector microparticles to be screened, preferably using high-throughput scanning, and if the marker gene is a fluorescent protein, preferably using high-throughput fluorescent scanning; A step of image processing the vector particle image to be screened obtained in step (3-1) to obtain an image of each vector particle, and predicting the expression level of the marker gene and / or exogenous target gene of the vector particle using an intelligent algorithm according to the image features, preferably, the image features used include morphological features and / or optical features of the cell, including, but not limited to, roundness, size, and grayscale of specific cell parts; Preferably, for the expression levels of the marker genes and / or exogenous target genes of the vector microparticles predicted by a plurality of intelligent algorithms, a normalized discounted cumulative profit is evaluated using a sorting algorithm, and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the normalized discounted cumulative profit, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows: [Equation 1] where IDCG is the DCG value of the actual sort of protein expression level of the monoclonal vector microparticle sample, i represents the predicted sort number obtained according to the sort of protein expression level predicted by the intelligent algorithm for a certain monoclonal vector microparticle among the monoclonal vector microparticle samples, rel(i) represents the actual protein expression level of the i-th monoclonal vector microparticle, and k is the sample amount of the monoclonal vector microparticle sample; Step (3-2), where rel(i) represents the fluorescence value when the predicted protein is a fluorescent protein, and rel(i) represents the numerical value of the expression level of the protein, which can be tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc. when the predicted protein is a non-fluorescent protein; The method for screening site-specific integration sites according to claim 4, further comprising a step (3-3) of identifying and acquiring vector microparticles whose expression levels of marker genes and / or exogenous target genes exceed a predetermined threshold based on the image, and transferring and retaining them at a predetermined position in the culture medium.

6. 2. The method for screening a site-specific integration site according to claim 1, wherein in step (3), the monoclonal vector microparticles are screened using a semi-solid medium.

7. In step (4), the passage stability of the monoclonal vector microparticles is determined by an intelligent algorithm, and the specific steps are as follows: (4-1) Obtaining the expression level of the marker gene of the monoclonal vector microparticles of multiple generations; (4-2) using an intelligent algorithm to evaluate the difference in the expression levels of the marker genes of the monoclonal vector microparticles of the multiple generations obtained in step (4-1); (4-3) The method for screening site-specific integration sites described in claim 1, characterized in that whether the monoclonal vector microparticles have passage stability is determined based on the difference in expression level of the marker gene of multiple generations of monoclonal vector microparticles obtained in step (4-2), according to the principle that the smaller the difference in expression level, the greater the probability of passage stability.

8. A site-specific integration vector microparticle screened by the method for screening a site-specific integration site according to any one of claims 1 to 7, an exogenous gene is inserted into an endogenous gene of a vector microparticle, the exogenous gene comprising two first recognition sequences and a marker gene expression fragment, which is provided between the two first recognition sequences and into which a marker protein for expression is incorporated; the expression level of the marker gene of the site-specific integration vector microparticle is higher than the predetermined threshold value, The site-specific integration vector microparticles are characterized in that they have passage stability.

9. A site-specific integration site screening system, comprising: the system is an electronic device and / or a non-transitory computer-readable storage medium; The electronic device includes a memory, a processor, and a computer program stored in the memory and operable by the processor, and when the processor executes the program, the steps of the method for screening for site-specific integration sites according to any one of claims 1 to 7 are realized, The non-transitory computer-readable storage medium stores a computer program, which, when executed by a processor, realizes the steps of the method for screening for site-specific integration sites described in any one of claims 1 to 7.

10. A method for site-specific integration of an exogenous target gene, comprising: A method for site-specific integration of an exogenous target gene, characterized in that it includes the steps of obtaining the site-specific integration vector particle described in claim 8, performing homologous recombination using a first recognition sequence in an exogenous gene within the site-specific integration vector particle, recombining an exogenous target gene expression fragment into the gene of the site-specific integration vector particle, and removing a marker gene expression fragment.

11. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that the exogenous target gene expression fragment is provided within a recombinant vector, the exogenous target gene is site-specifically integrated into the site of the site-specific integration vector microparticle by the recombinant vector, and the recombinant vector is a lentivirus vector, adenovirus vector, adeno-associated virus vector, herpesvirus vector, poxvirus vector, baculovirus vector, papillomavirus vector, papovavirus vector, integrative phage vector, non-viral vector, transposon, transposase, integrase substrate or plasmid.

12. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that the marker gene expression fragment of the site-specific integration vector microparticle has a length equivalent to that of the exogenous target gene expression fragment.

13. Specifically, the step of performing homologous recombination using the first recognition sequence of the site-specific integration fragment of the site-specific integration vector microparticle includes: constructing an exogenous target gene recombination fragment containing an exogenous target gene, wherein the exogenous target gene recombination fragment contains two second recognition sequences and an exogenous target gene expression fragment, the exogenous target gene expression fragment being located between the two second recognition sequences, and the exogenous target gene expression fragment comprising a promoter that regulates and controls expression of the exogenous target gene, and an exogenous target gene sequence; The site-specific integration method for an exogenous target gene described in claim 10, characterized in that the exogenous gene is integrated into the site of the site-specific integration vector microparticle, and the two first recognition sequences on either side of the marker gene become a third recognition sequence and a fourth recognition sequence, respectively, the third recognition sequence is formed by reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence is formed by reaction of the first recognition sequence and the second recognition sequence, and the sequences of the third recognition sequence and the fourth recognition sequence are different.

14. The method for site-specific integration of an exogenous target gene described in claim 13, characterized in that neither the third recognition sequence nor the fourth recognition sequence becomes the second recognition sequence or the first recognition sequence in the same reaction system.

15. the third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase, or FLP recombinase; and / or the second recognition sequence is independently one or more selected from a LoxP sequence, a LoxPL3 sequence, a LoxP 2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, a Bxb1 attP sequence, a Bxb1 attB sequence, an attP sequence, an attB sequence, an attP-GA sequence, and an attB-GA sequence; and / or 14. The method for site-specific integration of an exogenous target gene according to claim 13, wherein the third recognition sequence and the recognition sequence are independently one or more selected from the group consisting of a LoxP sequence, a LoxPL3 sequence, a LoxP2L sequence, a LoxFas sequence, a Lox511 sequence, a Lox2272 sequence, a Lox2372 sequence, a Lox5171 sequence, a Loxm2 sequence, a Lox71 sequence, a Lox66 sequence, an FRT sequence, an attL sequence, and an attR sequence.

16. Step S1: obtaining a plurality of site-specific integration vector particles according to claim 8, performing homologous recombination using a first recognition sequence in an exogenous gene in the site-specific integration vector particles, recombining an exogenous target gene expression fragment into a gene of the site-specific integration vector particles, and removing a marker gene expression fragment, thereby obtaining a plurality of exogenous target gene expression vector particle candidates; Step S2 of amplifying and subculturing the multiple candidate exogenous target gene expression vectors obtained in step S1; S21: Retaining monoclonal exogenous target gene expression vector microparticles whose corresponding expression levels of exogenous target genes are higher than a predetermined threshold value according to the expression levels of the exogenous target genes; S22: Determining the passage stability of the exogenous target gene expression vector microparticles based on the expression level of the exogenous target gene in multiple generations of the monoclonal exogenous target gene expression vector microparticles; 11. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that an exogenous target gene expression vector microparticle that expresses a high amount of protein and has stable passage is obtained.

17. In step S21, the expression level of the exogenous target gene is predicted through an intelligent learning algorithm; The expression level of the exogenous target gene is maintained by an intelligent algorithm prediction according to the cell image, specifically, Step S211: imaging the monoclonal exogenous target gene expression vector microparticles obtained in step S21 to obtain candidate monoclonal exogenous target gene expression vector microparticle images, preferably using high-throughput scanning; Step S212: predicting the expression level of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles using an intelligent algorithm according to image features, preferably the image features used include morphological and / or optical features of the cells, including but not limited to roundness, size, and gray scale of specific cell regions; Preferably, for the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles predicted by a plurality of intelligent algorithms, a normalized discounted cumulative profit is evaluated using a sorting algorithm, and the sorting accuracy of the protein expression levels predicted by the plurality of intelligent algorithms is evaluated. According to the rule that the larger the normalized discounted cumulative profit, the better the sorting accuracy of the protein expression levels, the intelligent algorithm with the best sorting accuracy of the predicted protein expression levels is selected and used; For a specific intelligent algorithm that predicts protein expression levels, the formula for calculating its standard normalized discounted cumulative profit is as follows: [Equation 2] where IDCG is the DCG value of the actual sort of protein expression level of the monoclonal vector microparticle sample, i represents the predicted sort number obtained according to the sort of protein expression level predicted by the intelligent algorithm for a certain monoclonal vector microparticle among the monoclonal vector microparticle samples, rel(i) represents the actual protein expression level of the i-th monoclonal vector microparticle, and k is the sample amount of the monoclonal vector microparticle sample; The method for site-specific integration of an exogenous target gene according to claim 16, wherein rel(i) represents a fluorescence value when the predicted protein is a fluorescent protein, and rel(i) represents a numerical value of the expression level of the protein that can be tested by means of Western blot, Elisa, mass spectrometry, electrophoresis, etc. when the predicted protein is a non-fluorescent protein.

18. In step S22, the passage stability of the monoclonal exogenous target gene expression vector microparticles is judged using an intelligent algorithm, and the specific steps are as follows: S221: Obtaining the expression level of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles of multiple generations; S222: Using an intelligent algorithm based on the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles of the multiple generations obtained in step S221, evaluate the difference in the expression levels of the exogenous target genes of the monoclonal exogenous target gene expression vector microparticles of the multiple generations; S223: A method for site-specific integration of an exogenous target gene as described in claim 16, characterized in that based on the difference in expression level of the exogenous target gene of multiple generations of monoclonal exogenous target gene expression vector microparticles obtained in step S222, it is determined whether the monoclonal exogenous target gene expression vector microparticles have transgenesis stability, according to the principle that the smaller the difference in expression level, the greater the probability of having transgenesis stability.

19. An exogenous target gene expression vector microparticle to be screened by the method for site-specific integration of an exogenous target gene according to any one of claims 10 to 18, an exogenous target gene is inserted into an endogenous gene of a vector microparticle, the exogenous gene comprising a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression fragment for expressing a target protein, the exogenous gene being provided between the third recognition sequence and the fourth recognition sequence; the expression level of the target gene in the exogenous target gene expression vector microparticle is higher than the preset threshold value; The exogenous target gene expression vector microparticles are characterized in that they have passage stability.

20. A site-specific integration system for an exogenous target gene, comprising: the system is an electronic device and / or a non-transitory computer-readable storage medium; The electronic device includes a memory, a processor, and a computer program stored in the memory and operable on the processor, wherein when the processor executes the program, the steps of the method for site-specific integration of an exogenous target gene according to any one of claims 10 to 18 are realized, The non-transitory computer-readable storage medium stores a computer program, which, when executed by a processor, realizes the steps of the method for site-specific integration of an exogenous target gene described in any one of claims 10 to 18.

Citation Information

Patent Citations

  • Target cell strain screening method and system, server and storage medium

    CN111598029A

  • Platform for developing stable mammalian cell lines

    US20200123576A1