Low molecular weight collagen with a triple helix structure of 164.88°

A low molecular weight collagen with a flexible triple helix structure addresses skin absorption challenges by achieving high penetration and efficacy in skin rejuvenation.

JP2026508493APending Publication Date: 2026-03-11SHANXI JINBO BIO PHARMACEUTICAL CO LTD
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2026-03-11

AI Technical Summary

Technical Problem

Current high molecular weight collagen supplements face challenges in skin absorption due to their molecular size, limiting their effectiveness in replenishing dermal collagen and addressing skin aging issues.

Method used

Development of a low molecular weight collagen with a molecular weight of approximately 2814.07 Da, featuring a flexible triple helix structure and high sequence identity to human collagen, designed for enhanced transdermal absorption and biological activity.

Benefits of technology

The collagen demonstrates over 85% skin penetration rate within 12 hours, offering superior transdermal absorption and biological activity, including anti-wrinkle, sebum control, repair, and soothing effects, surpassing commercially available high molecular weight collagen.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026508493000006
    Figure 2026508493000006
  • Figure 2026508493000007
    Figure 2026508493000007
  • Figure 2026508493000008
    Figure 2026508493000008
Patent Text Reader

Abstract

Low molecular weight collagen having a triple helix structure of 164.88° is provided. The present invention relates to low molecular weight collagen, its production method, and use. The collagen of the present application comprises the amino acid sequence shown in SEQ ID NO: 1 or a variant amino acid sequence obtained by mutating the amino acid sequence, and the variant amino acid sequence retains the function of the amino acid sequence shown in SEQ ID NO: 1. The collagen of the present application has a short amino acid sequence and good transdermal absorption properties.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This application claims priority to the following Chinese patent application, filed on March 16, 2023, bearing application number 202310268735.1 and entitled "Low Molecular Weight Collagen with a 164.88° Triple Helix Structure": the following Chinese patent application, filed on May 16, 2023, bearing application number 202310553965.2 and entitled "Low Molecular Weight Collagen with a 164.88° Triple Helix Structure": the following PCT patent application, filed on August 1, 2023, bearing application number PCT / CN2023 / 110578 and entitled "Low Molecular Weight Collagen with a 164.88° Triple Helix Structure": all of which are incorporated herein by reference.

[0002] This application relates to the field of collagen, and in particular to low molecular weight collagen, its production methods and uses. [Background technology]

[0003] Collagen is a type of protein widely distributed in the connective tissues of the human body and is the most abundant protein in the human body, accounting for 25% to 35% of the total protein content. Its main functions include maintaining the extracellular environment, maintaining the normal physiological functions of tissues and organs, and repairing physical damage. Collagen is a natural biological resource and has biotissue compatibility, cell-supporting elasticity, and degradability not found in other polymeric materials, making it widely used in industries such as pharmaceuticals and cosmetics.

[0004] Natural collagen molecules can form a unique superhelical structure, a left-handed helix with a basic repeat of three amino acid residues, typically Gly-X-Pro. Gly is essential for the formation of hydrogen bonds in collagen, and because it lacks side chains that allow collagen to pack tightly, it maintains skin tension and elasticity. As people age, collagen in the dermis degrades and ages, leading to dry skin and wrinkles. To prevent skin aging, some scholars have studied collagen supplementation as a way to delay skin aging. Currently, collagen is a high-molecular-weight protein, and due to its molecular weight, it is difficult for the skin to absorb. It can only enter the dermis through microscopic wounds in damaged skin, hair follicles, and sweat gland pores to replenish collagen. For this reason, previous research has focused on how to promote collagen percutaneous absorption.

[0005] In recent years, with the widespread application of genetic engineering technology, researchers have been able to create various types of recombinant collagen, for example, by selecting short amino acid sequences derived from natural human collagen, and recombinant collagens constructed in this way have advantages such as low immunogenicity, high biological activity, and good stability. Theoretically, the shorter the amino acid sequence of such recombinant collagen, the better the transdermal absorption performance, but the shorter the amino acid sequence, the better it is. In the prior art, there is no theory that can serve as a guide for how to design short amino acid sequences so that the constructed recombinant collagen has better transdermal absorption performance.

[0006] There is a need in the art for new low molecular weight collagens. Summary of the Invention [Problem to be solved by the invention]

[0007] In response to current demand, the inventors have discovered a new collagen with a molecular weight of approximately 2814.07 Da, which can penetrate the dermis layer of the skin and reach the subcutaneous tissue. Research results show that the collagen of this application has a skin penetration rate of over 85% 12 hours after application to the skin, demonstrating excellent collagen transdermal absorption, which is significantly better than commercially available high molecular weight collagen. [Means for solving the problem]

[0008] In one aspect, the present disclosure provides a method for producing a pharmaceutical composition comprising: (1) the amino acid sequence shown in SEQ ID NO: 1; (2) an amino acid sequence having 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1; or (3) A collagen comprising an amino acid sequence in which one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1 have been mutated is provided.

[0009] In one embodiment, the mutation is a substitution, insertion, deletion or addition, hi one embodiment, the substitution is a conservative amino acid substitution.

[0010] In one embodiment, the collagen is of human origin. In one embodiment, the collagen has a triple helix structure. In one embodiment, the collagen has a flexible triple helix structure. In one embodiment, the collagen is in the form of a trimer.

[0011] In one embodiment, the collagen has one or more of the following activities or effects: cell adhesion activity, cell migration promoting activity, transdermal absorption, anti-wrinkle effect, skin sebum control effect, skin repair effect, and skin soothing effect.

[0012] In another aspect, the description provides a nucleic acid encoding a collagen described herein. In one embodiment, the nucleic acid has the nucleotide sequence set forth in SEQ ID NO:2.

[0013] In one aspect, the description provides a vector comprising a nucleic acid described herein. In one embodiment, the vector comprises nucleotides encoding a purification tag, nucleotides encoding a leader, and / or regulatory elements.

[0014] In one embodiment, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag, or a NusA tag.

[0015] In one embodiment, the regulatory element is selected from a promoter, a terminator and / or an enhancer.

[0016] In one aspect, the description provides a host cell comprising a nucleic acid or vector described herein. In one embodiment, the host cell is a eukaryotic cell or a prokaryotic cell. In one embodiment, the eukaryotic cell is a yeast cell, an animal cell, and / or an insect cell. In one embodiment, the prokaryotic cell is an E. coli cell. In one embodiment, the prokaryotic cell is E. coli BL21.

[0017] In one aspect, the description provides a method of producing the collagen described herein, said method comprising: (1) culturing a host cell described herein under appropriate culture conditions; (2) harvesting the host cells and / or medium containing collagen; (3) purifying the fusion protein.

[0018] In one embodiment, the method includes (1) crude purification of collagen on a Ni affinity chromatography column, (2) addition of a collagen tool to perform enzymatic cleavage, and / or (3) fine purification of collagen on an ion exchange column.

[0019] In one aspect, the description provides a composition comprising a collagen described herein, a nucleic acid described herein, a vector described herein, and / or a host cell described herein.

[0020] In one embodiment, the composition is a pharmaceutical composition, a food composition or a cosmetic composition.

[0021] In one embodiment, the composition is one or more of bio-covering materials, human biomimetic materials, cosmetic materials, organoid culture materials, cardiovascular stents, coating materials, tissue injection filling materials, ophthalmic materials, obstetrics and gynecology biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, 3D printing artificial organ biomaterials, cosmetic raw materials, pharmaceutical auxiliary materials and food additives.In one embodiment, the composition is in the form of a solution, a lyophilized powder, a gel, a sponge or a fiber.

[0022] In one embodiment, the cosmetic composition is a cosmetic composition having an anti-wrinkle effect, a skin sebum control effect, a skin repair effect and / or a skin soothing effect, hi one embodiment, the skin sebum control effect is a facial skin sebum control effect.

[0023] In one embodiment, the composition comprises a pharmaceutically, cosmetically, and / or food acceptable carrier.

[0024] In one embodiment, the composition is a solid, liquid or gel composition.

[0025] In one embodiment, the composition is a composition for oral and / or topical administration. In one embodiment, the topical administration is topical administration to the skin. In one embodiment, the composition is a transdermal composition. In one embodiment, the composition is a kit.

[0026] In one embodiment, the composition is a liquid formulation comprising a collagen described herein and a pharmaceutically, cosmetically, and / or food-acceptable carrier. In one embodiment, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

[0027] In one aspect, the description provides a method of adhering or attaching cells, the method comprising contacting cells with a collagen, composition and / or liquid formulation described herein.

[0028] In one aspect, the description provides a method of promoting cell migration, the method comprising contacting a cell with collagen and / or a composition described herein.

[0029] In another aspect, the present disclosure provides a cosmetic or beauty method, the method comprising administering to the skin the collagen and / or compositions described herein. In one embodiment, the cosmetic or beauty method comprises applying to the skin other cosmetic and / or beauty products.

[0030] In one embodiment, the cosmetic or cosmetic method is a method for anti-wrinkle, sebum control, repair and / or soothing of the skin. In one embodiment, administration is topical. In one embodiment, administration is transdermal.

[0031] In another aspect, the description provides the use of the collagen, nucleic acid, vector and / or host cell described herein in a pharmaceutical, cosmetic or beauty product.

[0032] In one embodiment, the product is an external use product. In one embodiment, the cosmetic or beauty product is a skin anti-wrinkle, sebum control, repair and / or soothing product. In one embodiment, the product is selected from bio-dressing materials, human biomimetic materials, cosmetic plasticity materials, organoid culture materials, cardiovascular stents, coating materials, tissue injection filling materials, ophthalmic materials, gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, and 3D printing artificial organ biomaterials.

[0033] In another aspect, the description provides use of the collagen, nucleic acid, vector, and / or host cell described herein in the manufacture of a medicament or kit for anti-inflammatory or reducing inflammatory cytokines. In one embodiment, the inflammatory cytokine is TNF-α. In one embodiment, the inflammation is caused by an inflammatory cytokine such as TNF-α.

[0034] In another aspect, the present specification provides a method for reducing the level of inflammatory cytokines in a cell, the method comprising contacting the cell with a collagen, composition and / or liquid formulation described herein. [Effects of the Invention]

[0035] Advantages of the present invention include the following:

[0036] 1) The collagen described herein is produced by synthetic biology technology, and is the only small protein whose amino acid sequence is 100% identical to the amino acid sequence of the core functional region of human collagen and has a flexible triple helix structure at 164.88°.

[0037] 2) The collagen used in this specification is a low molecular weight collagen with a molecular weight of approximately 2814.07 Da, which can pass through the dermis layer of the skin and reach the subcutaneous tissue. Research has shown that the skin penetration rate reaches over 85% 12 hours after application to the skin, demonstrating excellent collagen transdermal absorption effects that are significantly superior to commercially available high molecular weight collagen.

[0038] 3) The structure of the collagen of this specification is clear. The triple helix structure of the collagen of this specification has been successfully analyzed using internationally advanced X-ray crystal diffraction technology, and the related data has been registered in the International Protein Data Bank (PDB: 6A0A and 6A0C). This is the only low molecular weight collagen with a triple helix structure currently available commercially.

[0039] 4) The collagen of the present invention has high activity and high hydrophilicity, and has high cell adhesion activity that is superior to that of human collagen (twice that of human type I collagen).

[0040] 5) The collagen herein has anti-wrinkle, sebum control, repair, soothing and / or anti-inflammatory effects on the skin. [Brief explanation of the drawings]

[0041] [Figure 1] The expression vector map is shown. [Figure 2] The electrophoretic detection results during collagen purification are shown. The first is a marker, the second is a purified sample, the third is collagen after liquid exchange, and the fourth is collagen after enzymatic digestion. [Figure 3] 1 shows the results of mass spectrometry detection of the low molecular weight collagen C3T1 of the present invention. [Figure 4] 1 shows the purity detection of the low molecular weight collagen C3T1 of the present invention. [Figure 5] The figure shows the effect of collagen on cell adhesion. Compared to the control group, the samples show * (P<0.05), ** (P<0.01), and *** (P<0.001). As can be seen from the results in the figure, the collagen of the present invention has better adhesive activity than bovine type I collagen. [Figure 6] The results of observation using a fluorescence microscope are shown. [Figure 7] Column graphs of the effect of collagen on cell migration are shown. [Figure 8] The actual diffusion rate of the collagen sample is shown in the figure. As can be seen, the collagen penetration rate gradually increases over time, reaching 86% at 12 hours. [Figure 9] This figure shows a qualitative analysis of the actual diffusion of the collagen sample. The blue color represents the DAPI fluorescence of the cell nuclei, and the green color represents the fluorescence of the FITC-labeled sample. As can be seen, at 2 hours the sample remains primarily in the skin, and after 4, 8, and 12 hours, the sample penetrates through the epidermal layer and into the dermal layer. [Figure 10] The vertical bar graph shows the type I collagen content of each group. Error bars show 95% confidence intervals. As can be seen from the graph, when the sample concentration was between 25% and 100%, the type I collagen protein content was significantly improved (p<0.05), demonstrating that the sample had the ability to promote type I collagen synthesis and had a clear anti-wrinkle effect. [Figure 11] A vertical bar graph shows the relative expression level of filaggrin (FLG) in each group. Error bars: 95% confidence interval. [Figure 12] A vertical bar graph shows the relative expression level of TGM1 in each group. Error bars show 95% confidence intervals. [Figure 13] A vertical bar graph of the TNF-α content in each group is shown. Error bars: 95% confidence interval. DETAILED DESCRIPTION OF THE INVENTION

[0042] In order to clarify the purpose, technical means and advantages of the present invention, the following will clearly and completely describe the technical means in the embodiments of the present invention with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only some of the embodiments of the present invention, and not all of the embodiments. All other embodiments that can be obtained by those skilled in the art based on the embodiments of the present invention without any creative work fall within the protection scope of the present invention.

[0043] As used herein, a peptide or polypeptide is a plurality of amino acid residues joined via peptide bonds. Collagen is also referred to herein as a collagen peptide or polypeptide.

[0044] As used herein, a "nucleic acid" refers to a plurality of nucleotides linked via an internucleotide bond. The internucleotide bond may be, for example, a phosphodiester bond. The nucleic acid herein may include a polynucleotide encoding a collagen of the present invention. To facilitate subsequent processing of the collagen, the nucleic acid of the present invention may further include nucleotides encoding a purification tag, such as a His tag, a GST tag, an MBP tag, a SUMO tag, or a NusA tag, and, if necessary, a nucleotide sequence encoding a leader sequence.

[0045] As used herein, the term "vector" refers to a nucleic acid delivery tool into which a polynucleotide can be inserted. A vector is called an expression vector if it can express a protein encoded by the inserted polynucleotide. A vector can be introduced into a host cell by transformation, transduction, or transfection, allowing the genetic material elements carried therein to be expressed in the host cell. Vectors are known to those skilled in the art and include, but are not limited to, plasmids, phagemids, cosmids, yeast artificial chromosomes (YACs), artificial chromosomes such as bacterial artificial chromosomes (BACs) or P1-derived artificial chromosomes (PACs), phages such as λ phage or M13 phage, and animal viruses. A vector may contain various expression control elements, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. A vector may further contain an origin of replication. A vector may contain a nucleic acid of the present invention for introduction into a cell and expression. The vector may comprise expression control elements, such as a promoter, terminator and / or enhancer, operably linked to the nucleic acid.

[0046] As used herein, the term "recombinant human collagen" refers to the full-length amino acid sequence encoded by a specific gene of human collagen produced by DNA recombinant technology, and has a triple helix structure. As used herein, the term "recombinant humanized collagen" refers to a fragment of the full-length or partial amino acid sequence encoded by a specific gene of human collagen produced by DNA recombinant technology, or a combination of functional fragments containing human collagen.

[0047] As used herein, the term "host cell" refers to a cell into which a nucleic acid molecule is introduced by molecular biological techniques. These techniques include transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA accelerated by electroporation, lipid transfection, and particle guns. Host cells may be eukaryotic or prokaryotic cells. For example, eukaryotic cells are yeast cells, animal cells, and / or insect cells. Prokaryotic cells may be E. coli cells.

[0048] As used herein, the relatedness between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence identity." For purposes of the present invention, sequence identity between two amino acid sequences is determined using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), as implemented by the Needle program in the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite; Rice et al., 2000, Trends Genet. 16:276-277), preferably version 5.0.0 or later. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The Needle output labeled "Longest Identity" (obtained using the -nobrief option) is used as the percentage identity, calculated as (identical residues x 100) / (alignment length - total number of gaps in the alignment).

[0049] For the purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented by the Needle program in the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version in NCBI NUC4.4) substitution matrix. The output of Needle labeled "Longest Identity" (obtained using the -nobrief option) is used as the percentage of identity, calculated as (identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment).

[0050] In the context of the present invention, conservative amino acid substitutions or conservative substitutions may be defined by substitutions within one or more of the amino acids reflected in the table below.

[0051] [Table 1]

[0052] [Table 2]

[0053] collagen As used herein, the collagen of the present invention may contain certain mutations. For example, the amino acid sequence of one or more of these portions may contain substitutions, deletions, additions, or insertions of amino acid residues. In other words, the present invention allows for the use of variants as long as they retain the activity of promoting cell adhesion and / or proliferation. Specifically, variants may have a certain percentage of identity with a specific sequence, for example, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The specific sequence may be any sequence of the present invention, such as SEQ ID NO: 1, but it is preferable that these variants retain the function of the collagen of the present invention. The collagen of the present invention has good transdermal properties and can reach the dermis layer. The collagen of the present invention may have one or more of the following functions: anti-wrinkle effect, skin sebum control effect, skin repair effect, skin soothing effect, and anti-inflammatory effect.

[0054] The collagen of the present invention can be produced in any suitable manner, for example, synthetically produced. Preferably, the collagen of the present invention can be produced recombinantly.

[0055] The collagen of the present invention can have a triple helix structure region. For example, collagen has a flexible triple helix structure region. The collagen of the present invention can form a triple helix structure. Measurements have shown that the low molecular weight collagen C3T1 of the present invention can form a triple helix structure with an angle of 164.88°.

[0056] composition The collagen of the present invention can be prepared into a composition. The composition may comprise the collagen, nucleic acid, vector, and / or host cell described herein. The composition may further comprise a pharmaceutically, cosmetically, and / or food-acceptable carrier or solvent. The composition may be a pharmaceutical composition, food composition, or cosmetic composition used in medicine, food, and / or cosmetics. For example, the composition may be one or more of a bio-dressing material, a human biomimetic material, a cosmetic cosmetic material, an organoid culture material, a cardiovascular stent, a coating material, a tissue injection filling material, an ophthalmic material, an obstetric and gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material, and a vascular repair and regeneration material, a 3D-printed artificial organ biomaterial, a cosmetic ingredient, a pharmaceutical auxiliary material, and a food additive.

[0057] The cosmetic composition may be a cosmetic composition having an anti-wrinkle effect, a skin sebum control effect, a skin repair effect, and / or a skin soothing effect. The area to which the cosmetic composition is applied is not particularly limited, and may be the face, hands, legs, trunk, etc. For example, the skin sebum control effect is a sebum control effect on facial skin.

[0058] The form of the composition is not particularly limited as long as it can achieve the desired function. For example, the composition may be a solid, liquid, or gel composition.

[0059] The composition can be applied in any suitable manner, for example, as an oral and / or topical composition. Topical administration may be topical administration to the skin. Depending on the transdermal properties of the composition, the composition can be formulated into a transdermal product or transdermal cosmetic. The composition can also be formulated into a kit. The kit may contain other components, such as auxiliary components such as a buffer, and may include instructions. In particular, the composition can be formulated into a suitable formulation, for example, a liquid formulation. The formulation may include a buffer, such as D-PBS buffer or PBS buffer.

[0060] method The present specification provides methods for attaching or adhering cells, the methods comprising contacting cells with the collagen, compositions and / or liquid formulations described herein. The methods of the present invention may be performed in vitro to improve cell adhesion to a culture vessel. Alternatively, the methods of the present invention may be performed in vivo.

[0061] The present specification further provides a method for promoting cell migration, the method comprising contacting cells with collagen and / or a composition. The method of the present invention may be performed in vitro or in vivo.

[0062] The present specification further provides a cosmetic or beauty method, the method comprising administering to the skin the collagen and / or composition described herein. Administration to the skin may be topical, for example, administration to a skin area requiring anti-wrinkle, sebum control, repair, and / or soothing. The method may further comprise applying another cosmetic and / or beauty product to the skin. The type of the other cosmetic and / or beauty product is not particularly limited, and may be other cosmetics having anti-wrinkle, sebum control, repair, and / or soothing effects on the skin, such as collagen. These cosmetic or beauty methods may also be methods for anti-wrinkle, sebum control, repair, and / or soothing the skin. The collagen of the present invention has a good transdermal effect and can act transdermally on the inner layer of the skin after administration to the skin.

[0063] The present disclosure further provides a method of administering the collagen or compositions described herein to a subject in need thereof. The method may be used to treat or prevent conditions associated with collagen deficiency, and may be used to anti-wrinkle, control sebum, repair, and / or soothe the skin of the subject. The administration may be oral.

[0064] The present specification further provides a method for reducing the level of intracellular inflammatory cytokines, the method comprising contacting cells with the collagen, composition and / or liquid formulation described herein. The type of inflammatory cytokine is not particularly limited, but TNF-α is preferred.

[0065] use The present specification further provides the use of collagen, nucleic acid, vector, and / or host cell in pharmaceutical, cosmetic, or beauty products, or for anti-wrinkle, sebum control, repair, and / or soothing of skin. These products may be externally applied products, such as external cosmetic or beauty products. These cosmetic or beauty products may be products for anti-wrinkle, sebum control, repair, and / or soothing of skin. For example, the product may be selected from bio-dressing materials, human biomimetic materials, cosmetic and cosmetic materials, organoid culture materials, cardiovascular stents, coating materials, tissue injection and filling materials, ophthalmic materials, gynecological and obstetric biomaterials, nerve repair and regeneration materials, liver tissue materials, vascular repair and regeneration materials, and 3D-printed artificial organ biomaterials.

[0066] The present specification further provides the use of the collagen, nucleic acid, vector and / or host cell described herein in the manufacture of a medicament or kit for anti-inflammation or reducing inflammatory cytokines such as TNF-α.

[0067] Example The following examples illustrate the present invention. Those skilled in the art will understand that the examples are illustrative only and are not limiting. The present invention is limited only by the scope of the appended claims.

[0068] Example 1: Construction and expression of low molecular weight collagen C3T1 1. Construction of Genetically Engineered E. coli Strains The amino acid sequence corresponding to the low molecular weight collagen C3T1 is: GERGAPGFRGPAGPNGIPGEKGPAGERGAP (SEQ ID NO: 1). The nucleotide sequence corresponding to the amino acid sequence is: GGAGAAAGGGGGGCGCCAGGCTTCCGCGGTCCGGCGGGTCCGAACGGCATCCCGGGTGAGAAGGGTCCGGCTGGCGAACGTGGCGCACCG (SEQ ID NO: 2). The nucleotide sequence of the low molecular weight collagen C3T1 was cloned into an expression vector, and then the expression vector was introduced into an E. coli expression strain and screened to obtain a genetically engineered E. coli strain.

[0069] Specifically, based on the amino acid sequence of C3T1, the codons preferred by E. coli were optimized and selected for the gene SEQ ID NO: 2. The nucleotide sequence shown in SEQ ID NO: 2 was synthesized. As shown in Figure 1, the C3T1 gene fragment was inserted into the pET-32a expression vector (Beijing Shengyuan Keleung Biotechnology Co., Ltd.) via the Kpn I (NEB Co., Ltd., product number: R0136L) and Xho I (NEB Co., Ltd., product number: R0146L) enzyme cleavage sites to construct the pET-32a-C3T1 expression vector. The expression vector was then introduced into E. coli BL21 (DE3) and screened to obtain a genetically engineered E. coli strain. The above operations were outsourced to Beijing Shengyuan Keleung Biotechnology Co., Ltd.

[0070] 2. Fermentation of Genetically Engineered E. coli a. A single colony of the optimized and selected E. coli genetically engineered strain was selected and placed in 5 ml of LB medium and cultured overnight at 35–38°C, then the temperature was raised to 37°C. b. The bacterial suspension was inoculated at a 1:100 ratio and expanded, cultured at 37°C for 7 hours, induced by adding 0.5 mM IPTG, and cooled to 16°C for overnight induction. The expressed protein was C3T1, and the cells were harvested by centrifugation. c. The harvested cells were resuspended in equilibrated working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), cooled to ≤15°C, homogenized, and homogenized twice under high pressure. The culture was then harvested upon completion. The homogenized suspension was dispensed into centrifuge flasks and centrifuged at 17,000 rpm for 30 minutes at 4°C. The supernatant was collected, and the supernatant and precipitate were subjected to electrophoretic detection.

[0071] 3. Purification of Low Molecular Weight Collagen C3T1 a. The column (Ni6FF, Cytiva) was washed with 5 column volumes (CV) of water. b. The column was equilibrated with 5 CV of equilibration solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole). c. Loading: The supernatant after centrifugation was added to the column until the liquid stopped flowing. d. Washing the hybrid protein: 25 mL of washing solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) was added until the liquid stopped flowing. e. Collection of the target protein: 25 mL of elution solution (200 mM sodium chloride, 25 mM Tris, 250 mM imidazole) was added, and the flow-through was collected to obtain the target polypeptide Trx-His-C3T1. F. Fluid exchange: Using a G-25 column (Cytiva), the collected target protein was exchanged into PBS (300 mM sodium chloride, 50 mM sodium dihydrogen phosphate, pH 7.3). If the Trx-His tagged target protein needed to be removed, an appropriate amount of collagenase was added and incubated at 16°C for 2 hours to obtain low molecular weight collagen C3T1 without the Trx-His tag. The electrophoretic detection results are shown in Figure 2 (1: Maker, 2: Collected target protein, 3: Target protein exchanged into PBS, 4: Sample after enzymatic digestion).

[0072] 4. Mass Spectrometric Detection of Low-molecular-weight Collagen C3T1 The theoretical molecular weight of low-molecular-weight collagen C3T1 is 2814.07 Da. It cannot be detected by standard SDS-PAGE and must be identified by mass spectrometry. A Biozen® 1.8 μm dSEC-2, 200 Å LC Column (150 × 4.6 mm) was used to analyze the enzymatically digested samples using an LC-MS system under conditions of mass spectrometry (MS) for molecular weight detection and liquid chromatography (LC).

[0073] As shown in FIG. 3, the actual molecular weight of the low-molecular-weight collagen C3T1 of the present invention was determined by mass spectrometry, and was found to be 2814 Da, which was consistent with the theoretical molecular weight.

[0074] 5. Purity detection of low molecular weight collagen C3T1 For the validation method, the protein samples were analyzed by molecular exclusion chromatography, referring to the Four General Rules of the Pharmacopoeia of the People's Republic of China (2020 edition) (0512 High-Performance Liquid Chromatography), and the results were further calculated by peak area normalization to determine the purity percentage of the main peak.

[0075] The sample blank and collagen C3T1 were placed in a sample pan and measured. The experimental parameters were as follows: [Table 3]

[0076] The detection results are as follows: [Table 4]

[0077] 4 shows the purity detection of the low molecular weight collagen C3T1 of the present invention. The purity of the low molecular weight collagen C3T1 reached 87.70%.

[0078] Example 2: Detection of cell adhesion activity of low molecular weight collagen C3T1 The reference standard for the detection of cell adhesion activity is the People's Republic of China Pharmaceutical Industry Standard YYT 1849-2022 Recombinant Collagen.

[0079] The specific implementation method is as follows:

[0080] The sample was dissolved in D-PBS, filtered through a 0.22 μm filter membrane, and then diluted to the working concentration for use. The positive control, bovine type I collagen (Hebei Kolisen Biotechnology Co., Ltd., product number: CSC113A), was diluted to 1 mg / ml in D-PBS for use. The negative control was D-PBS buffer.

[0081] Collagen C3T1 at different concentrations (0.5, 1 or 2 mg / mL), positive control and negative control were added to the ELISA plate, 100 μL per well, with five replicate wells for each group, and incubated overnight at 4°C.

[0082] Each well was filled with 10 well-cultured cells resuspended in D-PBS. 5 3T3 / NIH cells were added and incubated for 120 minutes at 37° C. Each well was washed three times with D-PBS solution.

[0083] The absorbance at OD 450 nm was measured using a CCK8 detection kit (Vazyme, product number: A311-01-AA) according to the manufacturer's instructions. The degree of cell attachment was calculated using the formula: cell attachment rate = (test wells - blank wells) x 100% / (positive wells - blank wells). The cell attachment rate reflects the collagen's cell adhesion ability. The higher the cell adhesion ability, the better the external environment provided to cells in a short period of time, helping cell attachment.

[0084] The results are shown in Figure 5. As can be seen from Figure 5, the collagen C3T1 herein has better adhesive activity than bovine type I collagen.

[0085] Example 3: Detection of cell migration promoting activity of low molecular weight collagen C3T1 A 0.4% serum-containing medium (ECM: 500 ml of basal medium + 25 ml of FBS serum + 5 ml of ECGS endothelial cell growth additive + 5 ml of P / S penicillin / streptomycin solution) was used as the negative control (NC), EGF was used as the positive control (PC), and collagen C3T1 was used as the test sample. The cultured cells were HUVEC cells. Collagen was dissolved in 0.4% serum-containing ECM medium to the working concentration, filtered through a 0.22 μm microporous filter membrane for sterilization, and serially diluted by half-dilution. The final concentrations of collagen C3T1 in the medium were 0.001, 0.002, 0.05, and 0.5 mg / mL. EGF was dissolved in 0.4% serum-containing ECM medium to a final concentration of 10 ng / mL and sterilized by filtration. The cells were digested, centrifuged to discard the culture medium, and washed once or twice with PBS. The cells were resuspended in serum-free medium and diluted to a cell density of 1 x 10 6 The cells were adjusted to 1 / ml. A two-chamber system (Nest, cell culture chamber) was used. 500 μl of sample was added to the lower chamber, and 200 μl of cell suspension was added to the upper chamber and cultured for 12–48 h. The upper chamber was carefully removed with tweezers, the liquid was completely aspirated, and the cells were transferred to a well containing approximately 800 μl of methanol. The cells were fixed at room temperature for 30 min and then washed twice with PBS. 100 μl of DAPI was added to the upper chamber and stained for 15 min. After that, the unmigrated cells in the upper layer were gently wiped with a cotton swab and washed three times with PBS. The cells were observed under a fluorescence microscope, photographed, and counted using Image J. The relative cell migration rate was calculated as follows: number of experimental groups / mean number of negative groups × 100%.

[0086] Figure 6 shows the results of fluorescence microscopy of the different test groups, and Figure 7 shows the relative cell migration rate (%) of the different test groups.

[0087] As shown in Figure 7, the positive control group can promote cell migration compared to the negative control group, and the difference is statistically significant. As the concentration of collagen C3T1 increases, the effect of promoting cell migration gradually becomes stronger. Cell migration activity is an indicator of collagen bioactivity, and a higher migration rate indicates higher collagen bioactivity. Compared to EGF, collagen C3T1 has higher cell migration activity.

[0088] Example 4: Transdermal absorption detection of low molecular weight collagen C3T1 For the detection of percutaneous absorption of low molecular weight collagen C3T1, refer to GB / T27818-2011, standard for in vitro test methods for dermal absorption of chemicals.

[0089] The specific implementation method is as follows:

[0090] Quantitative measurement of percutaneous absorption: Receptor fluid (physiological saline) was added to the receptor chamber, and a magnetic stirrer bar was placed inside. A piece of pigskin (with the test product placed on the surface of the pigskin) was fixed between the diffusion chamber and the receptor chamber of the Franz cell diffusion chamber. 1 ml of receptor fluid was added to the sampling tube, bringing the dermis layer of the pigskin into intimate contact with the receptor fluid. The Franz cell diffusion chamber was then attached to the transdermal absorption diffusion device. The magnetic stirrer was started and stirred at 300 rpm, ensuring no air bubbles were present in the middle layer of the water bath. After the temperature stabilized, 400 μl of sample was drawn and placed on the surface of the pigskin. At 2, 4, and 8 h, 1 ml of receptor fluid was extracted and placed in a 2 ml EP tube. An appropriate amount of saline solution was then added to the receptor chamber, and samples were collected at 12 h. Processing of the unpermeated portion of the skin: After 12 hours of (sample) permeation, the surface of the pigskin was washed with saline and the volume was adjusted to 2 ml. Processing of the remaining portion of the skin: After 12 hours of (sample) permeation, the pigskin was cut into small pieces, placed in an EP tube, and the volume was adjusted to 2 ml with saline, then sonicated for 30 minutes. Samples were taken at each time point using the Folin-Ciocalteu method, and the content of collagen C3T1 (the test sample was placed on the surface of the pigskin) was quantitatively analyzed.

[0091] Qualitative measurement of transdermal absorption: Receptor fluid was added to the receptor chamber, and a magnetic stirrer bar was placed inside. A piece of pig skin was fixed between the diffusion chamber and receptor chamber of the Franz cell diffusion chamber. 1 ml of receptor fluid was added to the sampling tube, bringing the dermis layer of the pig skin into intimate contact with the receptor fluid. The Franz cell diffusion chamber was then attached to the transdermal absorption diffusion device. The magnetic stirrer was started and stirred at 300 rpm, ensuring no air bubbles were present in the middle of the water bath. After the temperature stabilized, 400 μl of sample collagen C3T1 (fluorescently labeled with FITC (fluorescein isothiocyanate)) was aspirated and placed on the surface of the pig skin. Qualitative analysis: The pig skins from each group were collected, frozen, and double-stained with DAPI before being photographed under a fluorescent microscope. Three parallel groups were created according to the above method. Formula for calculating cumulative infiltration volume: Q=Cn×V+ΣCi×V0(i=1...n-1) In the formula, Q: Cumulative penetration amount V: Volume of receptor fluid in the receptor chamber V0: Volume per sampling Ci: Concentration of the target substance in the receptor fluid at the 1st to n-1th sampling times Cn: target concentration measured at the nth sampling point Diffusion rate calculation formula: P=Q / P0×100% In the formula, P: diffusivity Q: Cumulative permeation volume in the receptor chamber at each time point P0: Initial loading amount in the diffusion chamber

[0092] The results are shown in Figure 8. As can be seen from Figure 8, the penetration rate of collagen C3T1 gradually increases over time, reaching 86% at 12 hours. Figure 9 shows the results of qualitative analysis using a fluorescent microscope. As can be seen from Figure 9, the sample remained primarily in the skin at 2 hours, and after 4, 8, and 12 hours, the sample penetrated through the epidermis layer and into the dermis layer.

[0093] In summary, after excluding the blank group from the collagen test group, the sample remained primarily in the skin at 2 h; at 4 h, the penetration rate of collagen C3T1 was 33%, meaning that FITC-labeled collagen C3T1 had penetrated through the epidermis and into the dermis; at 8 h, the penetration rate of collagen was 70%, meaning that FITC-labeled collagen C3T1 had penetrated through the epidermis and into the dermis; and at 12 h, the penetration rate of collagen was 86%, meaning that FITC-labeled collagen C3T1 had penetrated through the epidermis and into the dermis. This indicates that collagen C3T1 is a true low-molecular-weight collagen with higher skin penetration rate, capable of directly reaching the dermis and playing a role in directly replenishing collagen.

[0094] Example 5: Cytotoxicity test of low molecular weight collagen C3T1 Human fibroblast cells (purchased from Guangdong Boxi Biotechnology Co., Ltd.) were used at 1 × 10 4 Cells were seeded into a 96-well plate at a seeding density of 100 cells / well and incubated overnight in an incubator (37°C, 5% CO2). Samples were administered when the cell seeding rate in the 96-well plate reached 40%-60%. For the zero-point adjustment group, no cells were seeded; only 200 μL of FbGrowth medium (supplier: Boxi Biological, product number: PY3091) was added to each well. For the solvent control group, 200 μL of FbGrowth medium was added to each cell-seeded well. For the positive control group, 200 μL of FbGrowth medium containing 10% DMSO (manufacturer: MACKLIN, product number: D806645) was added to each cell-seeded well. For the sample group, 200 μL of FbGrowth medium containing the corresponding concentration of collagen C3T1 was added to each cell-seeded well. After sample administration, the 96-well plate was placed in an incubator (37°C, 5% CO2) for incubation.

[0095] Detection: After incubating the cells for 24 hours, the supernatant was discarded, and MTT working solution (supplier: Gen Ye, product number: S19063) (0.5 mg / mL) was added. The cells were incubated at 37°C for 4 hours away from light. The supernatant was discarded, and 150 μL of DMSO was added to each well. The OD value was read at 490 nm, and the relative cell activity (%) was calculated as follows: (OD of sample well - OD of zero-point adjustment well) ÷ (OD of solvent control well - OD of zero-point adjustment well) × 100%.

[0096] Table 2 shows the cytotoxicity results.

[0097] [Table 5]

[0098] As can be seen from Table 2, collagen C3T1 has low cytotoxicity at the set concentration gradient, and the experimental results are reliable.

[0099] Example 6: Measurement of the in vitro anti-wrinkle effect of low molecular weight collagen C3T1 Collagen is the most important component of the extracellular matrix and contributes to improving skin firmness and elasticity. A decrease in collagen leads to the appearance of obvious wrinkles. Human dermal fibroblasts can synthesize type I procollagen in the body, secrete it extracellularly, and polymerize it extracellularly to form collagen fibers. Therefore, human dermal fibroblasts are used as a cell model to examine whether cosmetics promote the synthesis of type I collagen, and to evaluate whether test substances have the effect of promoting collagen synthesis, thereby evaluating the anti-wrinkle effects of cosmetics.

[0100] To measure the in vitro anti-wrinkle effect of collagen, the strength of the ability of in vitro fibrocytes to promote type I collagen synthesis is used to explain its anti-wrinkle effect.

[0101] The specific implementation method is as follows:

[0102] Cell culture: Harvest 1 x 10 human fibroblasts in logarithmic growth phase. 4 Cells were seeded into a 96-well plate at a density of 10 cells / well and incubated for 24 h in a 37°C, 5% CO2 incubator. Samples were administered when the cell seeding rate reached 40%–60%. For the blank control group, FbGrowth medium was added to the cell-seeded wells. For the positive control group, TGFβ1 (supplier: Absin, product number: ABS04204) was added to the cell-seeded wells (10 μg of TGFβ1 was weighed and dissolved in 200 μL of 10 mM citric acid solution to serve as the stock solution, and 2 μL of the TGFβ1 stock solution was aspirated and dissolved in 998 μL of FbGrowth medium to serve as the positive control working solution). For the sample group, various concentrations of collagen C3T1 in FbGrowth medium were added to the cell-seeded wells. After sample administration, the 96-well plate was placed in an incubator (37°C, 5% CO2) for 24 h of incubation.

[0103] After the culture was completed, the cells were collected in an EP tube, and type I collagen was detected using an ELISA kit for type I collagen (supplier: ELK Biotechnology, product number: ELK2377; for detailed procedures, refer to the instruction manual for the kit).

[0104] Detection results: As can be seen from Figure 10, when the sample concentration was 25%-100% (concentration was 0.075-0.3 μg / ml), the protein content of type I collagen could be significantly improved (p<0.05), which showed that it had the ability to promote the synthesis of type I collagen, and the collagen C3T1 sample had obvious anti-wrinkle effect.

[0105] Example 7: In vitro facial sebum control effect of low molecular weight collagen C3T1 Cell culture: KC human epidermal cells (purchased from Guangdong Boxi Biotechnology Co., Ltd.) in the logarithmic growth phase were collected and 1 × 10 cells were cultured. 4KC human epidermal cells were seeded into 96-well plates at a cell density of 100 cells / well and cultured for 24 h in a 5% CO2 incubator at 37°C. Treatment was initiated when the cell seeding rate reached 40%-60%. For the blank control, KcGrowth medium (supplier: Boxi Bio, product number: PY3011) was added to the wells. For the negative control, KcGrowth medium containing 0.2% SLS (supplier: Solarbio, product number: S8100) was added to the wells. For the positive control, KcGrowth medium containing 0.2% SLS and WY14643 (supplier: Biyuntian, product number: SD7189-25mg) was added to the wells. For the sample control, KcGrowth medium containing 0.2% SLS and various concentrations of collagen C3T1 was added to the wells. After administration, the 96-well plate was placed in an incubator (37°C, 5% CO2) and cultured for 24 hours.

[0106] Detection: After the culture was completed, the cells were collected in an EP tube, and the supernatant was taken and human filaggrin was detected using a human filaggrin ELISA kit (supplier: ELK Biotechnology, product number: ELK3513; for detailed procedures, refer to the kit's instruction manual).

[0107] The experimental results are shown in Figure 11. When the test sample concentration was 25% to 100% (concentration was 0.075 to 0.3 μg / ml), it was possible to promote a dose-dependent increase in the expression level of filaggrin (FLG) in human keratinocytes, and a significant difference was observed compared to the negative control (P<0.05). The test sample, collagen C3T1, has a sebum control effect.

[0108] Example 8: Detection of the in vitro repair effect of low molecular weight collagen C3T1 Cell culture: KC human epidermal cells (purchased from Guangdong Boxi Biotechnology Co., Ltd.) in the logarithmic growth phase were collected and 1 × 10 4KC human epidermal cells were seeded into a 96-well plate at a cell density of 100 cells / well and cultured for 24 hours in a 37°C, 5% CO2 incubator. Samples were administered when the cell seeding rate in the 96-well plate reached 40%-60%. For the blank control group, KcGrowth medium was added to the cell-seeded wells. For the negative control group, KcGrowth medium containing 0.2% SLS was added to the cell-seeded wells. For the positive control group, KcGrowth medium containing 0.2% SLS and WY14643 was added to the cell-seeded wells. For the sample group, KcGrowth medium containing 0.2% SLS and various concentrations of collagen C3T1 was added to the cell-seeded wells. After sample administration, the 96-well plate was placed in an incubator (37°C, 5% CO2) and cultured for 24 hours.

[0109] Detection: After the culture was completed, the cells were collected in EP tubes, and the supernatant was taken for TGM1 detection. Human TGM1 was detected using a human TGM1 ELISA kit (supplier: ELK Biotechnology, product number: ELK2193; for detailed procedures, refer to the kit's instruction manual).

[0110] The experimental results are shown in Figure 12. When the test sample concentration was 25% to 100% (0.075 to 0.3 μg / ml), it was possible to promote a dose-dependent increase in the expression level of TGM1 in human keratinocytes. The test sample, collagen C3T1, had a repair effect.

[0111] Example 9: Detection of the in vitro sedative effect of low molecular weight collagen C3T1 Cell culture: Murine macrophages RAW264.7 (purchased from Guangdong Boxi Biotechnology Co., Ltd.) in logarithmic growth phase were collected and 1 × 10 4Murine macrophages RAW264.7 were seeded into a 96-well plate at a cell density of 100 cells / well and cultured for 24 hours in a 37°C, 5% CO2 incubator. Samples were administered when the cell seeding rate in the 96-well plate reached 40%-60%. For the blank control group, 200 μL of cell culture medium (high-sugar DMEM culture medium (10% fetal bovine serum)) (supplier: Biosharp, product number: BL301A) was added to each well. For the negative control group, 200 μL of cell culture medium containing LPS (1 μg / ml) (manufacturer: absin, product number: ABS47014848) was added to each well. For the positive control group, 10 mg of dexamethasone (manufacturer: Solarbio, product number: BL301A) was added to each well. Dexamethasone (product number: D8040) was dissolved in 1 mL of DMSO to prepare a 10 mg / mL dexamethasone mother solution. The dexamethasone mother solution was then aspirated and diluted 1:100 with LPS-containing high-sugar DMEM medium to 100 μg / mL (positive control working solution). 200 μL of medium containing LPS was added to each well. For the sample group, 200 μL of medium containing a fixed concentration of collagen C3T1 and LPS was added to each well. After sample administration, the 96-well plate was placed in an incubator (37°C, 5% CO2) and incubated for 24 hours.

[0112] Detection: After the incubation, the cell culture medium was collected and the supernatant was collected by centrifugation for TNF-α detection. For specific steps, refer to the instruction manual of the TNF-α inflammatory factor ELISA kit (supplier: ELK Biotechnology, product number: ELK1190).

[0113] The experimental results are shown in Figure 13. When the concentration of collagen C3T1 was 25% to 100% (concentration was 0.075 to 0.3 μg / ml), the TNF-α content in each group was significantly reduced compared to the negative control (P<0.05), and the effect of suppressing TNF-α content was observed, providing a sedative or anti-inflammatory effect.

[0114] The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention are all equivalent substitution methods and fall within the protection scope of the present invention.

Claims

1. (1) the amino acid sequence shown in SEQ ID NO: 1; (2) an amino acid sequence having 70%, 75%, 80%, 85%, 90%, or 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1; or (3) A collagen comprising an amino acid sequence in which one or more amino acid residues in the amino acid sequence shown in SEQ ID NO: 1 are mutated, Preferably, the mutation is a substitution, insertion, deletion or addition, and preferably the substitution is a conservative amino acid substitution; Preferably, the collagen is of human origin; Preferably, said collagen has a triple helix structure, preferably a flexible triple helix structure, preferably a triple helix structure of 164.88°, preferably the collagen is in the form of a trimer, Preferably, the collagen has one or more of the following activities or effects: cell adhesion activity, cell migration promoting activity, transdermal absorption, anti-wrinkle effect, skin sebum control effect, skin repair effect, and skin soothing effect.

2. A nucleic acid encoding the collagen of claim 1, preferably having the nucleotide sequence shown in SEQ ID NO:

2.

3. 3. The nucleic acid of claim 2, optionally comprising nucleotides encoding a purification tag, nucleotides encoding a leader, and / or regulatory elements, Preferably, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag; Preferably, the regulatory element is selected from a promoter, a terminator and / or an enhancer.

4. A host cell comprising a nucleic acid according to claim 2 or a vector according to claim 3, preferably a eukaryotic or prokaryotic cell, preferably wherein the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell, and / or wherein the prokaryotic cell is an E. coli cell, e.g. E. coli BL21.

5. 2. A method for producing collagen according to claim 1, comprising: (1) culturing the host cell of claim 4 under appropriate culture conditions; (2) harvesting the host cells and / or medium containing collagen; (3) purifying the fusion protein, wherein purifying the fusion protein includes, for example, (1) crude purification of collagen on a Ni affinity chromatography column, (2) addition of a collagen tool and enzymatic cleavage, and / or (3) fine purification of collagen on an ion exchange column.

6. A composition comprising the collagen of claim 1, the nucleic acid of claim 2, the vector of claim 3 and / or the host cell of claim 4, Preferably, the composition is a pharmaceutical composition, a food composition or a cosmetic composition, Preferably, the composition is one or more of a bio-coating material, a human biomimetic material, a plastic cosmetic material, an organoid culture material, a cardiovascular stent, a coating material, a tissue injection filling material, an ophthalmic material, an obstetric and gynecological biomaterial, a nerve repair and regeneration material, a liver tissue material and a vascular repair and regeneration material, a 3D printing artificial organ biomaterial, a cosmetic raw material, a medicinal auxiliary material, and a food additive; Preferably, the cosmetic composition is a cosmetic composition having an anti-wrinkle effect, a skin sebum control effect, a skin repair effect and / or a skin soothing effect, and preferably, the skin sebum control effect is a sebum control effect on facial skin, Preferably, the composition comprises a pharmaceutically, cosmetically and / or food acceptable carrier; Preferably, the composition is a solid, liquid or gel composition; Preferably, the composition is in solution, lyophilized powder, gel, sponge or fiber form; Preferably, the composition is a composition for oral and / or topical administration, preferably, topical administration is topical administration to the skin, preferably, the composition is a transdermal composition; Preferably, the composition is a kit, Preferably, the composition is a liquid formulation comprising the collagen of claim 1 and a pharmaceutically, cosmetically and / or foodly acceptable carrier, preferably the carrier is a buffer, such as a D-PBS buffer or a PBS buffer.

7. A method for attaching or adhering cells, comprising: A method comprising contacting a cell with the collagen of claim 1 and / or the composition of claim 6.

8. 1. A method for promoting cell migration, comprising: A method comprising contacting a cell with the collagen of claim 1 and / or the composition of claim 6.

9. 10. A cosmetic or beauty method comprising administering to the skin the collagen of claim 1 and / or the composition of claim 6, and optionally applying other cosmetic and / or cosmetic products to the skin, Preferably, the cosmetic or cosmetic method is a method for anti-wrinkle, sebum control, repair and / or soothing the skin, Preferably, the administration is topical administration; Preferably, the cosmetic or beauty method, wherein the administration is transdermal administration.

10. 1. Use of collagen according to claim 1, of a nucleic acid according to claim 2, of a vector according to claim 3 and / or of a host cell according to claim 4 in a pharmaceutical, cosmetic or beauty product or in anti-wrinkle, sebum control, repair and / or soothing of the skin, Preferably, the product is a topical product, Preferably, the cosmetic or beauty product is an anti-wrinkle, sebum control, repair and / or soothing product for the skin, Preferably, the product is selected from bio-covering materials, human biomimetic materials, cosmetic and plastic materials, organoid culture materials, cardiovascular stents, coating materials, tissue injection filling materials, ophthalmic materials, gynecological biomaterials, nerve repair and regeneration materials, liver tissue materials and vascular repair and regeneration materials, and 3D printed artificial organ biomaterials.

11. Use of the collagen according to claim 1, the nucleic acid according to claim 2, the vector according to claim 3 and / or the host cell according to claim 4 in the manufacture of a drug or a kit, The drug or kit is for anti-inflammatory or reducing inflammatory cytokines such as TNF-α.

12. 1. A method for reducing intracellular levels of inflammatory cytokines, comprising: A method comprising contacting a cell with the collagen of claim 1 and / or the composition of claim 6.

Citation Information

Patent Citations

  • Free radical scavenger with anti-aging and anti-sugar effects and preparation method thereof

    CN111840127A

  • Anti-skin photoaging polypeptide compound and application thereof

    CN112321723A

  • Application of recombinant III-type humanized collagen in scalp care, and scalp care product containing recombinant III-type humanized collagen

    CN113440431A

  • Application of recombinant humanized collagen and related composition and preparation method thereof

    CN113476593A

  • Cosmetic composition containing recombinant III-type humanized collagen as well as preparation method and application of cosmetic composition

    CN114010529A