FGF-7 production promoter and VEGF production promoter in hair follicle cells

Abstract

To provide an agent having an FGF-7 production promoting effect in dermal papilla cells, and to provide an agent having a VEGF production promoting effect in dermal papilla cells.SOLUTION: Provided are an agent having an FGF-7 production promoting effect in dermal papilla cells and an agent having a VEGF production promoting effect in dermal papilla cells, including as an effective ingredients: palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine; and palmitoyl dipeptide-5 diaminohydroxybutyric acid.SELECTED DRAWING: Figure 11

Description

[Technical field]

[0001] The present invention relates to a hair growth agent, and more particularly to a hair growth agent for external use that contains palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. [Background technology]

[0002] Demand for topical agents such as hair restorers that promote hair growth and improve hair type and quality is growing in mammals including humans. To promote hair growth and improve hair type and quality, active ingredients that contribute to regulating the hair cycle, which is the life cycle of hair, have been proposed and are being marketed as hair restorers.

[0003] For example, the use of minoxidil as an active ingredient in hair growth agents has been proposed (see Patent Documents 1 to 3, etc.), and after human clinical trials, hair growth agents containing minoxidil as an active ingredient have been marketed. However, in Japan, its medical use is limited to male male pattern baldness, and it does not fully meet the needs of a wide range of consumers who wish for hair growth effects and hair type / quality improvement effects.

[0004] In addition, the use of chiro-inositol as an active ingredient in hair growth agents has been proposed (see Patent Document 4). However, the hair growth agent described in Patent Document 4, which is an external preparation containing chiro-inositol, has only been shown to have hair growth effects in subjects who are not insulin resistant, and the subjects to which it is administered are limited. Therefore, it does not fully meet the needs of a wide range of consumers who wish for hair growth effects and hair type / quality improvement effects.

[0005] Palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid are known as cosmetic raw materials (see Patent Document 5). However, there have been no reports on the hair growth effects of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] U.S. Pat. No. 4,139,619 [Patent Document 2] Japanese Patent Application Publication No. 63-150211 [Patent Document 3] Japanese Patent Application Publication No. 63-145217 [Patent Document 4] International Publication No. 2017 / 188393 [Patent Document 5] Patent No. 5028474 Summary of the Invention [Problem to be solved by the invention]

[0007] An object of the present invention is to provide a hair growth agent having an excellent hair growth effect. [Means for solving the problem]

[0008] As a result of intensive research into solving the above problems, the present inventors discovered that by using palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as active ingredients, excellent hair growth activity is exhibited, and thus the present invention was completed.

[0009] The first means of the present invention for solving the above problems is a hair growth agent that is an external preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

[0010] A second aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to the first aspect of the present invention, in which the content of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid is 0.001 to 20% by weight based on the total weight.

[0011] A third aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to the first or second aspect of the present invention, in which the content of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid is 0.005 to 10% by weight based on the total weight.

[0012] A fourth aspect of the present invention for solving the above-mentioned problems is a hair growth agent according to any one of the first to third aspects of the present invention, which contains palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, and the mass ratio thereof (palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine / palmitoyl dipeptide-5 diaminohydroxybutyric acid) is 99 / 1 to 1 / 99.

[0013] A fifth aspect of the present invention for solving the above problems is a hair growth agent according to any one of the first to fourth aspects of the present invention, for use in promoting hair shaft growth or hair growth.

[0014] A sixth aspect of the present invention for solving the above problems is the hair growth agent according to any one of the first to fifth aspects of the present invention, which is used for improving the hair shaft elongation speed.

[0015] A seventh aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to any one of the first to fifth aspects of the present invention, which is used for improving the maximum hair shaft length.

[0016] An eighth aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to any one of the first to fifth aspects of the present invention, which is used for increasing the diameter of a hair shaft.

[0017] A ninth aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to any one of the first to fifth aspects of the present invention, which is used for increasing the number of hairs.

[0018] A tenth aspect of the present invention for solving the above-mentioned problems is the hair growth agent according to any one of the first to ninth aspects of the present invention, which is a solution.

[0019] An eleventh aspect of the present invention for solving the above-mentioned problems is a hair growth agent according to any one of the first to tenth aspects of the present invention, which is intended for hair, eyebrows and / or eyelashes.

[0020] A twelfth aspect of the present invention for solving the above-mentioned problems is a hair growth method comprising administering the hair growth agent according to any one of the first to eleventh aspects of the present invention to a subject.

[0021] Another means of the present invention for solving the above problems is a scalp care agent that is an external preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

[0022] Another means of the present invention for solving the above problems is a method for improving scalp symptoms, which includes administering to a subject a scalp care agent that is an external preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. Effect of the Invention

[0023] According to the present invention, palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid are used as active ingredients in a hair growth agent for external application, thereby providing an excellent hair growth agent and scalp care agent that have the effects of promoting hair shaft growth in the hair, eyebrows and / or eyelashes, improving the hair shaft elongation rate, improving the maximum hair shaft length, and increasing the hair shaft diameter, as well as providing a scalp care effect. [Brief description of the drawings]

[0024] [Figure 1] Figure 1 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution. The vertical axis represents hair shaft length (mm) and the horizontal axis represents the number of days. Note that the first hair cycle shows standard data in which a drug-free 60% ethanol solution was applied. [Diagram 2] Figure 2 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution containing minoxidil (5%). The vertical axis represents hair shaft length (mm) and the horizontal axis represents the number of days. Note that the first hair cycle shows standard data for application of a 60% ethanol solution containing no drug. [Diagram 3] Figure 3 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution containing minoxidil (3%). The vertical axis represents hair shaft length (mm) and the horizontal axis represents the number of days. Note that the first hair cycle shows standard data for application of a 60% ethanol solution containing no drug. [Figure 4] Figure 4 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution containing minoxidil (1%). The vertical axis represents hair shaft length (mm) and the horizontal axis represents the number of days. Note that the first hair cycle shows standard data for application of a 60% ethanol solution containing no drug. [Diagram 5]Figure 5 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid (3%). The vertical axis represents hair shaft length (mm) and the horizontal axis represents days. The first hair cycle shows standard data for application of a 60% ethanol solution containing no drug. [Figure 6] Figure 6 is a plot showing the change in hair shaft length at the drug application site of a mouse after application of a 60% ethanol solution containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid (1%). The vertical axis represents hair shaft length (mm) and the horizontal axis represents days. The first hair cycle shows standard data for application of a 60% ethanol solution containing no drug. [Figure 7] 7 shows the evaluation of cell division activity using a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. Cells in which BrdU incorporation was confirmed are indicated by upward arrows. [Figure 8] FIG. 8 shows the cell division activity evaluation using a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid. [Figure 9] FIG. 9 shows the results of measuring the hair shaft diameter after application of the agent. [Figure 10] Fig. 10 is a graph showing changes in gene expression levels in human hair papilla cells after 24-hour stimulation with a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, Fig. 10(a) shows changes in FGF-7 gene expression levels, and Fig. 10(b) shows changes in VEGF gene expression levels. [Figure 11]Figure 11 is a graph showing changes in gene expression levels in human hair papilla cells after stimulation with a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid for 72 hours, where Figure 11(a) shows changes in FGF-7 gene expression levels, and Figure 11(b) shows changes in VEGF gene expression levels. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] The following describes the embodiments of the present invention. However, the present invention is not limited to these examples, and various modifications can be made without departing from the scope of the present invention.

[0026] The active ingredients of the hair growth agent and scalp care agent, which are topical agents according to the present invention, are palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine (Palm-Lys-Val-Dab-Thr-OH) and palmitoyl dipeptide-5 diaminohydroxybutyrate (Palm-Lys-Val-Dab-OH).

[0027] The concentration of the mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, which is an active ingredient in the hair growth agent and scalp care agent of the present invention, is 0.001 to 20% by weight, more specifically, 0.005 to 10% by weight, based on the total weight of the hair growth agent and scalp care agent.

[0028] The mass ratio (palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine / palmitoyl dipeptide-5 diaminohydroxybutyric acid) of the hair growth agent of the present invention containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid is 99 / 1 to 1 / 99.

[0029] The hair growth agent and scalp care agent of the present invention may be a medicine, a quasi-drug, a cosmetic including cosmetics for hair, eyebrows and / or eyelashes, and cosmetics for the scalp, and may be used in various forms of preparations such as ointments, poultices, liniments, lotions, external liquids, dusting agents, creams, gels, emulsions, hair tonics, hair sprays, etc., but are not limited to these.

[0030] Furthermore, the composition may contain additives and other ingredients that are normally permitted to be contained in pharmaceuticals, quasi-drugs, cosmetics including cosmetics for the hair, eyebrows and / or eyelashes, and cosmetics for the scalp, to the extent that they do not interfere with the hair growth and scalp care effects of the present invention. Examples of the additives include, but are not limited to, excipients, stabilizers, odorants, bases, dispersants, diluents, anionic surfactants, amphoteric surfactants, nonionic surfactants, cationic surfactants, anionic polymers, nonionic polymers, ethylene oxide-propylene oxide block copolymers, alcohols, emulsifiers, transdermal absorption enhancers, pH adjusters, preservatives, colorants, oils and fats, mineral oils and other oils, moisturizers, thickeners, polymers, film-forming agents, UV absorbers, cell activators, moisturizers, inorganic salts, functional beads and capsules, silicones, metal chelating agents, antioxidants, preservatives, cooling agents, deodorants, pigments, dyes, fragrances, sugars, amino acids, vitamins, organic acids, organic amines, plant extracts, viscosity adjusters such as clay minerals and various polymers, and the like.

[0031] The hair growth agent and scalp care agent of the present invention may contain known components having effects such as hair growth, hair restoration, and hair care.

[0032] The dosage of the active ingredient per administration of the hair growth agent and scalp care agent of the present invention can be adjusted so that the effects of the hair growth agent and scalp care agent of the present invention are exhibited. The dosage can be, for example, 0.005 to 200 mg, specifically 0.05 to 100 mg, and more specifically 0.5 to 10 mg.

[0033] The administration frequency of the hair growth agent and scalp care agent of the present invention can be one or more times so that the effect of the hair growth agent and scalp care agent of the present invention can be achieved.The administration frequency of the hair growth agent and scalp care agent of the present invention can be, for example, 1 to 6 times per day.The administration frequency can be specifically 1 to 3 times per day, more specifically 1 to 2 times per day.

[0034] The hair growth agent and scalp care agent of the present invention are directed to promoting hair shaft growth, hair growth and preventing hair loss, and are preferably directed to promoting hair shaft growth and hair growth.

[0035] As used herein, the term "promoting hair shaft growth" means increasing the rate of hair shaft elongation, increasing the maximum hair shaft length, and / or increasing the hair shaft diameter.

[0036] As used herein, the term "hair growth" refers to increasing the number of hairs by promoting the growth of new hairs from hair follicles where hair growth has stopped or where hair growth capacity has decreased in areas where there is no hair (no hair shaft protruding outside the epidermis) or where there is a small amount of hair, and more specifically, refers to shortening the resting phase in the hair cycle and / or resuming an arrested hair cycle.

[0037] In this specification, "having a hair shaft growth promoting effect" means acting favorably on hair shaft growth promotion, and a property that exhibits a hair shaft growth promoting effect is referred to as "hair shaft growth promoting activity." Additionally, "having a hair growth effect" means acting favorably on hair growth, and a property that exhibits a hair growth effect is referred to as "hair growth promoting activity."

[0038] In this specification, the term "hair loss" refers to the phenomenon that hair shafts fall off from hair follicles, and more specifically, refers to the increase of inhibitory cytokines that inhibit cell proliferation and the death of those cells. The characteristic that shows the effect of preventing hair loss is called "hair loss prevention activity". In addition, "having the effect of preventing hair loss" means that the number of hair shafts that fall off from hair follicles is reduced through the inhibition or reduction of inhibitory cytokines and the suppression of cell death, which is a physiological phenomenon different from the characteristic that shows the effect of promoting hair shaft growth and hair growth.

[0039] In the present specification, "scalp symptoms" refers to symptoms such as dandruff, scalp roughness, scalp dryness, erythema, itchiness, pimples, etc. In addition, in the present specification, "improvement of scalp symptoms" refers to suppression or improvement of dandruff, scalp roughness, scalp dryness, erythema, itchiness, pimples, etc.

[0040] The hair growth agent of the present invention can be used to improve the hair shaft elongation speed or the maximum hair shaft length. The hair shaft elongation speed can be improved by, for example, up to about 110%, specifically, by about 25 to 110%, and more specifically, by about 33 to 110%, compared to the hair shaft elongation speed in the standard data of the hair cycle. The maximum hair shaft length can be improved by, for example, up to about 49%, specifically, by about 1 to 49%, and more specifically, by about 2 to 49%, compared to the hair shaft maximum length in the standard data of the hair cycle.

[0041] The hair growth agent of the present invention can be used to increase the diameter of the hair shaft.

[0042] The hair growth agent of the present invention can be used to promote the growth of new hair from pores where hair growth has stopped or where hair growth capacity has decreased in areas where there is no hair (hair shafts have not protruded outside the epidermis) or where there is a small amount of hair, thereby increasing the number of hairs, and more specifically, can be used to shorten the resting phase in the hair cycle and / or resume an arrested hair cycle.

[0043] The hair growth agent and scalp care agent of the present invention can be used for animals such as livestock and pets as well as humans. In one aspect of the present invention, a hair growth method and a scalp symptom improving method are provided, which include administering an external preparation containing palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid to a subject including humans and animals such as livestock and pets. EXAMPLES

[0044] <Test Example 1: Evaluation of hair growth activity of a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid>

[0045] 1. Materials and Methods (1) Laboratory animals C57BL / 6N mice (male) and Balb / c nu / nu mice (female) were purchased from Japan SLC Co., Ltd. (Japan), and were used in the following experiments after breeding. Animal breeding and testing complied with the relevant laws, ministerial ordinances, and guidelines, and were approved by the RIKEN Experimental Ethics Committee.

[0046] (2) Reagents The following reagents were prepared: Comparative Example 1: 60% ethanol aqueous solution Comparative Example 2: Minoxidil 5% solution Comparative Example 3: Minoxidil 3% solution Comparative Example 4: Minoxidil 1% solution Example 1: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 3% Solution Example 2: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 1% Solution

[0047] (3) Preparation of skin specimens from mouse dorsal hairy skin

[0048] To collect anagen VI skin on the 12th to 14th day after hair removal as dorsal hair skin, hair was removed from the site of the dorsal hair skin of 7- to 8-week-old C57BL / 6N mice to be harvested, and the mice were raised for 12 to 14 days. After that, the hair-removed C57BL / 6N mice were euthanized by cervical dislocation, and an appropriate amount of dorsal hair skin was collected from the site to be harvested.

[0049] The collected skin was immersed in DMEM medium containing 10 mM HEPES, 10% fetal bovine serum, and 1% penicillin-streptomycin solution (hereafter referred to as "DMEM10"). The collected hairy dorsal skin was pinched with curved tweezers and immersed in a sterilizing solution for 10 seconds. Sterilization was performed using fresh solutions in the following order: 7% povidone-iodine solution treatment twice, PBS(-) treatment three times, and DMEM10 treatment twice. After sterilization, the skin was immersed in clean DMEM10.

[0050] After sterilization, the hairy skin on the back was cut into blocks. The transparent connective tissue attached to the panniculus carnosus layer of the skin was cut using curved scissors, and the hair group was cut into rectangular strips along the hair flow. At that time, the hair follicles were adjusted so that there were five rows of hair follicles on the short axis, and six rows of hair follicles on the long axis, and then cut into blocks.

[0051] (4) Transplantation of skin specimens into Balb / c nu / nu mice

[0052] The skin specimens derived from the dorsal hair skin prepared above were transplanted onto 4-6 week old Balb / c nu / nu mice. The mice were anesthetized with isoflurane gas according to a standard method. The backs of the mice were then disinfected with a 7% povidone-iodine solution and placed in a natural recumbent position. The backs of the mice were then punctured with a Mani ophthalmic knife (Mani Co., Ltd., Japan) to form graft wounds extending from the epidermis layer to the lower dermis layer.

[0053] A skin test piece derived from the dorsal hair skin was inserted into the formed graft wound so that the hair group faced the body surface side of the graft wound. The grafting depth of the skin test piece was adjusted so that the upper end of the hair group was exposed at the upper end of the graft wound. Next, the graft wound into which the skin test piece derived from the dorsal hair skin was grafted was covered with Nurseban (registered trademark) (Sunplanet Co., Ltd., Japan) and surgical tape (3M Japan Co., Ltd., Japan) as a protective tape to protect the graft wound.

[0054] Five to seven days after transplantation, the protective tape was removed, and the survival of the transplanted skin test pieces derived from the dorsal hair skin was determined visually or using a digital microscope (Keyence Corporation, Japan), and then the mice were observed.

[0055] (5) Applying drugs to the grafted skin test specimens During the first cycle of the hair growth cycle, a 60% ethanol solution was applied as a placebo. Using a micropipette, 25 μL of 60% ethanol was applied to the left and right backs of the Balb / c nu / nu mice to which the above-mentioned skin test pieces had been transplanted. The ethanol was then quickly dried using a hair dryer with cold air. This procedure was repeated four times on each of the left and right backs of the mice.

[0056] From the second hair cycle onwards, a mixed solution of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at various concentrations was applied to the Balb / c nu / nu mice to which hair groups had been transplanted, instead of the 60% aqueous ethanol solution, according to the method described above.

[0057] (6) Hair growth monitoring and histological analysis Three areas were selected from the transplantation site of the skin specimen of Balb / c nu / nu mice, and five hairs were selected from each area to confirm and record the state of hair growth. Observation and recording were performed visually and using a digital microscope (Keyence Corporation, Japan).

[0058] 2. Results

[0059] For each drug, the hair shaft length was measured every 1 to 3 days, and the average hair shaft length at each time point, which changed over time, was plotted as one dot on a graph, and similar plots were repeated for three mice. The results are shown in Tables 1 to 6 and Figures 1 to 6.

[0060] [Table 1]

[0061] [Table 2]

[0062] In Table 2 above, * indicates significance at p<0.05.

[0063] [Table 3]

[0064] In Table 3 above, * indicates significance at p<0.05, and ** indicates significance at p<0.01.

[0065] [Table 4]

[0066] In Table 4 above, ** indicates significance at p<0.01.

[0067] [Table 5]

[0068] In Table 5 above, * indicates significance at p<0.05, and ** indicates significance at p<0.01.

[0069] [Table 6]

[0070] In Table 6 above, * indicates significance at p<0.05.

[0071] When a 60% aqueous ethanol solution was applied to the transplant site of the mouse skin test specimen, no significant differences were observed in either the hair shaft growth rate or maximum hair shaft length compared to the standard data in which no solution was applied, and no hair growth activity was observed (see Table 1 and Figure 1).

[0072] When solutions containing 5%, 3%, or 1% minoxidil were applied to the transplant sites of mouse skin test specimens, both the hair shaft growth rate and maximum hair shaft length were significantly improved compared to the standard data, demonstrating hair growth activity (see Tables 2 to 4 and Figures 2 to 4).

[0073] On the other hand, when a solution containing a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at 3% was applied to the transplanted site of the mouse skin specimen, the hair shaft growth rate was significantly improved compared to the standard data. In addition, the maximum hair shaft length was improved, although there was no significant difference (see Table 5 and Figure 5). From these results, the solution containing a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at 3% was found to have hair growth activity.

[0074] On the other hand, when a solution containing a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at 1% was applied to the transplanted site of the mouse skin specimen, the hair shaft growth rate was not significantly different in the second hair cycle compared to the standard data, and the maximum hair shaft length was improved, although there was no significant difference in the third hair cycle (see Table 6 and Figure 6). From these results, the hair growth activity of the solution containing a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at 1% tended to be significant.

[0075] Therefore, it was suggested that the effective lower limit concentration for the hair growth activity of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid is between 1% and 3% as the content of the mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

[0076] <Test Example 2: Evaluation of cell division activity by a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid>

[0077] 1. Materials and Methods (1) Laboratory animals Dorsal hair skin was collected from 6- to 8-week-old C57BL / 6N mice (Japan SLC Co., Ltd., Japan). Animal care and experiments were performed in compliance with relevant laws, ministerial ordinances, and guidelines, and were approved by the RIKEN Experimental Ethics Committee.

[0078] (2) Drugs The following drugs were prepared: Example 1: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 3% Solution Example 2: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 1% Solution Comparative Example 1: 60% ethanol aqueous solution Comparative Example 5: RiUPX5PLUS (Taisho Pharmaceutical, Japan)

[0079] (3) Drug application The hair on the back of the C57BL / 6N mouse was removed. 25 μL of the drug was applied to the left and right back of the C57BL / 6N mouse using a micropipette. The drug was then quickly dried by applying cold air to the applied area using a hair dryer. This procedure was repeated four times on each side of the back. This drug application procedure was continued for seven days starting the day after the hair was removed.

[0080] (4) BrdU administration 24 and 48 hours before harvesting the dorsal hair skin from C57BL / 6N mice that had been treated with the drug for 7 days, 0.5 mL of 10 mg / mL BrdU / physiological saline was administered to the abdominal area of ​​the hind paw of each mouse using a syringe (Terumo Corporation, Japan).

[0081] (5) Collection and fixation of mouse skin tissue On the 8th day, C57BL / 6N mice were euthanized by cervical dislocation at the same time as administration, and skin tissue was collected without damaging the hair bulb. The collected skin tissue was immersed in SuperFix (Toyobo Co., Ltd., Japan) for 16 to 24 hours, washed four times with 1x PBS, and stored in fresh 1x PBS. The necessary parts of the skin tissue were excised and paraffin blocks were prepared using a paraffin liquid exchanger (Leica Microsystems GmbH, Germany).

[0082] (6) Sectioning Paraffinized skin tissue blocks were sectioned using a microtome (Leica Microsystems GmbH, Germany), and the sections were attached to platinum-coated glass slides (Platinum Pro (Matsunami Glass Industry Co., Ltd., Japan)) and left in warm steam at 40°C for 8–10 h to dry.

[0083] (7)BrdU immunostaining To deparaffinize the slides, the samples were immersed in xylene, xylene, 100% ethanol, 95% ethanol, and 70% ethanol, in that order, for 3 minutes each. The deparaffinized slides were then immersed in 2M HCl at room temperature for 30 minutes. The slides were placed in a Venta Discovery ULTRA (automatic stainer) and the program was started. The primary antibody, Anti-BrdU antibody-Proliferation Marker (Abcam, UK), was diluted 160-fold with dilution solution (1% BSA, 0.1% TX100 / PBS) and added at 100 μL per sample when the primary antibody was added. The secondary antibody Donkey Anti-Sheep IgG H&L (Alexa Flour 594) (Thermo Fisher Scientific, USA) and Hoechst (Hoechst33342) were diluted 500-fold with dilution solution (1% BSA, 0.1% TX100 / PBS) and added at 100 μL per sample. After the program was completed, the samples were washed with 0.1% TX100 / PBS and immersed in 1×PBS. After dropping 80 μL per sample of water-soluble mounting medium (0.5% gallic acid, 90% glycerol / PBS), a cover glass was placed on the sample, the air was pushed out with a yellow tip, and excess mounting medium was removed while correcting the position of the cover glass with an aspirator, and the four sides of the cover glass were sealed with top coat (for nail polish). After confirming that the top coat was dry, the images were scanned and analyzed with Axio Scan.

[0084] (8) Measurement method of BrdU A 5,000 μm line was drawn and the number of BrdU molecules in the epidermis, dermis, and hair follicles within that area was measured.

[0085] 2.Results In this test example, hairless C57BL / 6N mice were used, and palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid were dissolved in 60% ethanol at concentrations of 1% and 3% to prepare the test drug solution, which was applied daily. 60% ethanol was applied as a negative control, and RiUP (5% formulation) was applied as a positive control. These applications were performed once a day for 7 days with a total application volume of 100 μl. In addition, BrdU was administered from the abdomen at the same time on the 6th and 7th days, and skin tissue was collected the next day. The collected skin tissue was paraffinized, sections were prepared, immunostained for BrdU, and cell activity was observed by measuring the number of BrdU. The results are shown in Figures 7 and 8.

[0086] As is clear from Figure 7 and Figure 8, compared with negative control and positive control, the application of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, which are the active ingredients of the present invention, has a tendency to increase cell division activity, and palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid 3% improves the cell division activity at least in hair follicles, and the results suggest that the active ingredient of the present invention has hair growth activity.In addition, the application of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, which are the active ingredients of the present invention, has also confirmed the enhancement of cell division activity in the basal layer of the epidermis, and it has been confirmed that the active ingredient of the present invention can obtain scalp care effect. It has been revealed that the active ingredients of the present invention, palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, have excellent hair growth activity and also have excellent effects such as being able to simultaneously exert a scalp care effect on the application area.

[0087] <Test Example 3: Evaluation of hair thickening activity by a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid>

[0088] 1. Materials and Methods (1) Laboratory animals Using the same procedure as in Test Example 1 above, dorsal hair skin was collected from 7-8 week-old C57BL / 6N mice (SLC), and the hair groups derived from the dorsal hair skin were transferred to 4-6 week-old Balb / c. After transplantation into b / c nu / nu mice (SLC), drugs were applied. Animal care and experiments were carried out in compliance with relevant laws, ministerial ordinances, and guidelines, and were approved by the RIKEN Experimental Ethics Committee.

[0089] (2) Drugs The following drugs were used in the study: Example 1: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 3% Solution Example 2: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 1% Solution Comparative Example 1: 60% ethanol aqueous solution Comparative Example 5: RiUPX5PLUS (registered trademark) (Taisho Pharmaceutical, Japan) (3) How to measure hair thickening Hair thickening was measured using grown hair shafts that had completed the third cycle in Test Example 1. Two Zigzag hairs were used from the collected hair shafts. Three areas of a 100 μm square were selected from the thickened area in the center. Five areas were measured.

[0090] 2. Results The hair shaft diameter was measured using the hair after application of the agent, and the results are shown in Figure 9. In addition, the increase rate of the hair shaft diameter from that in Comparative Example 1, in which a 60% ethanol aqueous solution was applied as a control, was evaluated and the results are shown in Table 7.

[0091] [Table 7]

[0092] It was confirmed that application of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid, which are the active ingredients of the present invention, resulted in clear hair thickening compared to Comparative Example 1, in which a control 60% ethanol aqueous solution was applied. The degree of this hair thickening was equivalent to that of Comparative Example 5, and activity equivalent to that of RiUPX5PLUS, a hair growth agent on the market, was confirmed.

[0093] <Test Example 4: Evaluation of FGF-7 gene and VEGF gene expression in human hair papilla cells>

[0094] 1. Materials and Methods (1) Human dermal papilla cells and culture medium Human hair papilla cells (catalog number: CA60205a, derived from a Caucasian male aged 29 years, Toyobo Co., Ltd. (Japan)) were purchased, and the cells were maintained and cultured as described in the protocol, followed by test evaluation.

[0095] (2) Drugs As test drugs, drug solutions having the following concentrations (final concentrations) were prepared and used. Example 1: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 3% Solution Example 3: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 0.1% Solution Example 4: Mixture of Palmitoyl Dipeptide-5 Diaminobutyroyl Hydroxythreonine and Palmitoyl Dipeptide-5 Diaminohydroxybutyric Acid 0.025% Solution Minoxidil 30μM Adenosine 100μM

[0096] (3) Test method 5×10 human dermal papilla cells4 The cells were seeded in a 96-well plate so that the number of cells was 1 / well. After culturing for 1 day in a CO2 incubator (5% CO2, 37°C), the medium was replaced with a medium containing each test drug. The cell plate was then returned to the CO2 incubator and cultured for an additional 24 or 72 hours. After culturing, total RNA was extracted and collected from each well and reverse transcribed into cDNA. The expression of FGF-7 gene was measured by real-time PCR using the prepared cDNA. The GAPDH gene was used as an internal standard, and the expression level of FGF-7 gene was calculated as a relative value to the negative control group.

[0097] Total RNA was extracted from cells using the FastGene RNA Basic Kit (catalog number: FG-80250, Nippon Genetics Co., Ltd., Japan).

[0098] 100μL of lysis buffer RL was added per well, and the cells were lysed by pipetting. 100μL of 70% ethanol was added to the cell lysate, and mixed by pipetting. The sample solution was added to the FastGene RNA binding column, and centrifuged at 10,000g for 1 minute at room temperature. The filtrate that passed through the column was discarded from the collection tube, and the FastGene RNA binding column was returned to the original collection tube, after which 600μL of washing buffer RW1 was added to the FastGene RNA binding column, and centrifuged at 10,000g for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set, and 700μL of washing buffer RW2 was added to the FastGene RNA binding column, and centrifuged at 10,000g for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set, and centrifuged at 15,000rpm for 1 minute at room temperature. The FastGene RNA binding column was transferred to a new collection tube and set, and 50 μL of elution buffer RE was added to the center of the membrane of the FastGene RNA binding column, and the column was centrifuged at 10,000 g for 1 minute at room temperature to recover the purified RNA. The concentration of the recovered RNA was measured using NanoDrop Lite (catalog number: ND-LITE, Thermo Fisher Scientific Co., Ltd.) and stored at -80°C until the next cDNA extraction process.

[0099] FastGene scriptaseII cDNA synthesis 5x Ready Mix (catalog number: NE-LS64, Nippon Genetics Co., Ltd., Japan) was used for cDNA synthesis. The total RNA generated in a new tube was diluted with RNase Free Water to a concentration of 20ng / mL, and 4μL of FastGene scriptaseII cDNA synthesis 5x Ready Mix was added to 16μL of this sample solution and mixed with a vortex. cDNA was synthesized by incubating at 25℃ for 10 minutes, 42℃ for 60 minutes, and 85℃ for 5 minutes using a MiniAmp Thermal Cycler (Thermo Fisher Scientific Co., Ltd.).

[0100] The cDNA synthesized by the above method was used for real-time PCR. Each cDNA template dilution was added to a designated well of a 96-well plate, and THUNDERBIRD SYBR qPCR Mix (catalog number: QPS-201, Toyobo Co., Ltd. (Japan)) and primers were added and mixed, and gene expression was analyzed using a QuantStudio 7 Flex Real-Time PCR System (catalog number: 4485693, Thermo Fisher Scientific Co., Ltd.). The PCR reaction consisted of 40 cycles of 95°C for 5 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

[0101] The primers specific to the VEGF gene, the primers specific to the FGF-7 gene, and the primers specific to the GAPDH gene used as an internal standard are shown below. Primers for detecting FGF-7 gene expression Forward: tctgtcgaacacagtggtacctgag (SEQ ID NO: 1) Reverse: gccactgtcctgatttccatga (SEQ ID NO: 2) Primers for detecting VEGF gene expression Forward: atcttcaagccatcctgtgtgc (SEQ ID NO: 3) Reverse: caaggcccacagggattttc (SEQ ID NO: 4) Primers for detecting GAPDH gene expression Forward: catccctgcctctactggcgctgcc (SEQ ID NO: 5) Reverse: ccaggatgcccttgagggggccctc (SEQ ID NO: 6)

[0102] The relative expression level of each gene was calculated as follows. The Ct value (PCR cycle number) was calculated from the intersection of the amplification curve for each gene and the threshold line. The relative expression level was calculated by dividing the Ct value of the target gene by the Ct value of the internal standard GAPDH gene.

[0103] 2. Results The changes in the expression levels of the FGF-7 gene and the VEGF gene were measured after exposing human hair papilla cells to a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid for 24 hours and 72 hours, and the results are shown in Figure 10 (24 hours) and Figure 11 (72 hours), respectively.

[0104] As shown in FIG. 10, it was confirmed that in the group in which human hair papilla cells were treated with a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at a final concentration of 3% for 24 hours, the expression levels of FGF-7 gene and VEGF gene were significantly increased compared to the control group without any treatment.

[0105] Furthermore, the expression levels of the FGF-7 gene and the VEGF gene were both greater than those in the cases where minoxidil or adenosine was administered.

[0106] Furthermore, it was confirmed that in a group in which a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid was applied to human hair papilla cells at a final concentration of 0.1% for 24 hours, the expression levels of FGF-7 gene and VEGF gene were significantly increased compared to the control group in which no treatment was administered.

[0107] Furthermore, as shown in Figure 11, in a group in which a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid was applied to human hair papilla cells at a final concentration of 3% for 72 hours, the expression levels of FGF-7 gene and VEGF gene were significantly increased compared to a control group without addition. In addition, it was confirmed that the degree of increase in the expression levels of these genes was greater than that in the case of application for 24 hours.

[0108] Furthermore, the expression levels of the FGF-7 gene and the VEGF gene were both greater than those in the cases where minoxidil or adenosine was administered.

[0109] Furthermore, it was confirmed that in a group in which human hair papilla cells were treated with a mixture of palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid at a final concentration of 0.1% for 72 hours, the expression levels of FGF-7 gene and VEGF gene were significantly increased compared to the control group without treatment.

[0110] It is known that the expression of FGF-7 gene and the expression of VEGF gene in human hair papilla cells are both contributing to the enhancement of hair growth activity in humans.The above test results show that palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid enhance the expression levels of both FGF-7 gene and VEGF gene in human hair papilla cells, and that the expression levels of these genes are further enhanced by allowing them to act for a longer period of time.In this way, it has become clear that palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid are highly useful as active ingredients for enhancing hair growth activity in humans. [Industrial Applicability]

[0111] By using palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid as the active ingredients of the hair growth agent for external use according to the present invention, it is possible to provide a new hair growth agent and scalp care agent that have the effect of promoting the growth of the hair shaft in hair such as scalp hair, eyebrows and / or eyelashes, the effect of improving the hair shaft elongation rate, the effect of improving the maximum hair shaft length and the effect of increasing the hair shaft diameter, as well as a scalp care effect.

Claims

1. An agent for promoting FGF-7 production in hair papilla cells, comprising palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

2. A VEGF production promoter for hair papilla cells, comprising palmitoyl dipeptide-5 diaminobutyroyl hydroxythreonine and palmitoyl dipeptide-5 diaminohydroxybutyric acid.

Images