Skin preparations for external and internal use

Abstract

To solve the problem in which: such a material has been desired that is safe and highly stable and is excellent in MMP inhibitory effect, collagen production-accelerating effect, hyaluronic acid production-accelerating effect, antioxidative effect and melanogenesis inhibitory effect, but a sufficiently satisfactory one has not yet been provided.SOLUTION: An extract from the fruit of Sorbus aucuparia has excellent MMP inhibitory effect, collagen production-accelerating effect, hyaluronic acid production-accelerating effect, antioxidative effect and melanogenesis inhibitory effect, and also has excellent stability. Furthermore, an external preparation and an internal preparation containing the fruit extract of Sorbus aucuparia of the present invention are particularly effective.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to an MMP inhibitor, a collagen production promoter, an anti-wrinkle agent, a hyaluronic acid production promoter, an antioxidant, a skin-whitening agent, a pharmaceutical product, and a food composition. [Background technology]

[0002] The skin is exposed to various physical and chemical stresses such as ultraviolet rays, dryness, cold, heat, and drugs every day. As a result, the skin's functions are reduced, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, and are temporary wrinkles that occur when the moisture content in the epidermal stratum corneum decreases due to dry skin. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanism of their formation includes a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and the promotion of collagen decomposition due to an increase in matrix proteinase (MMP).

[0003] Epidermal wrinkles caused by dryness and dermal wrinkles have different histological morphology, onset mechanisms, and treatment methods, and dermal wrinkles caused by ultraviolet rays and aging are difficult to improve with the use of cosmetics with moisturizing effects.

[0004] To date, agents have been reported that aim to improve dermal wrinkles caused by ultraviolet rays, such as an agent for preventing and improving skin wrinkle formation, which contains hydrolyzed almonds as an active ingredient (Patent Document 1), and an agent for improving wrinkles caused by ultraviolet radiation, which contains extracts of Jojoba Seed, Tallow Tree, and Christmas Candlelight as active ingredients (Patent Document 2).

[0005] Furthermore, fibroblasts and collagen are present in the dermis, with type I collagen accounting for 80% of the total. In addition to type I collagen, types III, V, XII, and XIV are known to exist. One of the causes of wrinkles and sagging skin is a decrease in type I collagen. Therefore, promoting the production of type I collagen is thought to be effective in preventing and improving wrinkles and sagging skin. Promoting the production of type I collagen is also effective in improving wound healing in the skin.

[0006] Collagen is the major structural protein that accounts for about one-third of mammalian tissues, and is an essential component of many matrix tissues, such as cartilage, bone, tendon, and skin. When collagenase (MMP-1), which belongs to MMPs, cleaves collagen molecules, which are stable in normal tissues, denatures into single-stranded gelatin and is then degraded by various other proteases. As a result, the structural integrity of the matrix tissue is lost.

[0007] Gelatinase (MMP-2), which belongs to MMP, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that are special components of elastic tissues such as arteries, bones, and skin). Therefore, substances that have inhibitory activity against gelatinase are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissues, and are considered to be useful in the prevention and treatment of cancer diseases. Furthermore, inhibition of MMP is useful not only for cancer diseases, but also for the prevention, treatment, and improvement of ulcer formation, chronic rheumatoid arthritis, osteoporosis, periodontal inflammation, and various diseases caused by the enhancement of MMP.

[0008] As materials having collagenase inhibitory activity, for example, cacao husk extract (Patent Document 3), which is the skin of the cacao bean, Rubus fragilis extract (Patent Document 4), lactoferrin (Patent Document 5), etc. In a situation where interest in skin aging and oral hygiene is increasing, there is a demand for finding materials with excellent collagenase activity inhibitory action that are free of side effects and highly safe.

[0009] In addition, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains the firmness of the skin. It is believed that wrinkles and sagging of the skin occur when this connective tissue loses its contractile force and further loses elasticity.

[0010] In particular, hyaluronic acid is known as a polymeric polysaccharide widely distributed in connective tissue, and takes on a gel-like form in the dermis, maintaining the elasticity of the skin. Therefore, it is believed that the alteration or reduction of hyaluronic acid is important in skin aging. In addition, since hyaluronic acid is a polymer, there is a problem that cosmetics containing it are not easily absorbed even when directly applied to the skin. Therefore, up until now, a skin external preparation that can promote the production of collagen and hyaluronic acid by activating fibroblasts has been sought (Patent Document 6). In addition, hyaluronic acid is also present in joints, and is known to function to cushion the impact of the load on the joints and to smooth the movement of the joints. In the case of joint diseases such as osteoarthritis, chronic rheumatoid arthritis, suppurative arthritis, gouty arthritis, traumatic arthritis, and osteoarthritis, it is known that the amount of hyaluronic acid in synovial fluid decreases or decreases with age. In such joint diseases, it is considered that it is effective to increase the amount of hyaluronic acid in synovial fluid in order to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve or normalize pathological synovial fluid.For example, it is known that when sodium hyaluronate is injected into the joints of patients with chronic rheumatoid arthritis, traumatic arthritis, osteoarthritis, and osteoarthritis, the above-mentioned symptoms are improved.However, these treatments are long-term.Therefore, there is a demand for food and medicine that contain hyaluronic acid production promoters so that they can easily prevent and treat in daily life.

[0011] Floaters are a symptom where a thin shadow resembling a lint or a mosquito appears in the field of vision. They occur when opacity in the vitreous body, which fills the inside of the eye, casts a shadow on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to aging, ultraviolet rays, active oxygen, etc., and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tear, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous body, and the resulting collapse of collagen fibers, causing the vitreous body to become opaque. Treatments include vitrectomy surgery and laser treatment, but these procedures are not often performed in Japan due to safety concerns, and treatment abroad requires a large amount of money. Therefore, in order to prevent and improve physiological floaters, foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis are desired.

[0012] In general, skin pigmentation such as age spots, freckles, and sunburn is believed to be caused by hormonal abnormalities and UV stimulation, which causes melanin pigment-producing cells in the skin to produce excessive melanin, which then deposits in the skin. One method for preventing such pigmentation is known to be a method of suppressing the excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and the like have been used internally or externally to treat pigmentation (Patent Document 7).

[0013] In addition, the skin is located in the outermost layer of the body, and is an organ that is prone to the generation of active oxygen due to the effects of ultraviolet rays, etc., and is constantly exposed to oxygen stress. On the other hand, active oxygen scavenging enzymes exist in skin cells, and they protect skin cells from damage caused by active oxygen unless active oxygen is generated in excess of their capacity. However, it is known that the activity of active oxygen scavenging enzymes in skin cells decreases with age, and it is thought that when damage caused by active oxygen overcomes the defense reaction, the skin is oxidized, the cell function deteriorates, and aging progresses. In addition, it is thought that when organs other than the skin are exposed to active oxygen that exceeds their active oxygen scavenging capacity, their function decreases, leading to aging, and various lifestyle-related diseases such as cancer and myocardial infarction develop. Therefore, active oxygen scavengers and antioxidants have been studied for the purpose of protecting against damage caused by active oxygen, and foods, cosmetics, quasi-drugs, and medicines containing active oxygen scavenging enzymes such as SOD and catalase, active oxygen scavengers such as SOD-like active substances, and antioxidants have been developed (Patent Documents 8 and 9).

[0014] It is known that the vegetable oil and fermented liquid of the fruits of the Rowan (Sorbus aucuparia) of the family Rosales Rosaceae are used as hair and nail conditioning agents (Patent Documents 10 and 11). However, it was not known that the fruits of the Rowan have MMP inhibitory effects, collagen production promoting effects, hyaluronic acid production promoting effects, antioxidant effects, and melanin production suppressing effects. [Prior art documents] [Patent documents]

[0015] [Patent Document 1] JP 2000-119125 A [Patent Document 2] JP 2006-199611 A [Patent Document 3] Japanese Patent Application Publication No. 3-44331 [Patent Document 4] JP 2003-137801 A [Patent Document 5] Japanese Patent Application Publication No. 5-186368 [Patent Document 6] JP 2007-1924 A [Patent Document 7] Japanese Patent Application Publication No. 05-229931 [Patent Document 8] Japanese Patent Application Publication No. 9-118630 [Patent Document 9] Japanese Patent Application Publication No. 9-208484 [Patent Document 10] Special Publication No. 2019-510803 [Patent Document 11] Special Publication No. 2015-503587 Summary of the Invention [Problem to be solved by the invention]

[0016] There is a demand for materials that are safe and stable and have excellent MMP inhibitory effects, collagen production promoting effects, hyaluronic acid production promoting effects, antioxidant effects, and melanin production suppression effects, but the current situation is that no fully satisfactory materials have been provided yet. [Means for solving the problem]

[0017] In order to solve this problem, the present inventors have conducted extensive research and found that Rowan fruit extract has excellent MMP inhibitory activity, collagen production promoting activity, hyaluronic acid production promoting activity, antioxidant activity, and melanin production suppression activity, and is also excellent in stability.Furthermore, they found that external or internal preparations containing the extract are safe and stable, and have excellent MMP inhibitory activity, collagen production promoting activity, hyaluronic acid production promoting activity, antioxidant activity, and melanin production suppression activity, and can be used as multifunctional beauty and health materials and medicines, which led to the completion of the present invention.

[0018] That is, the present invention comprises the following (1) to (8).

[0019] (1) An MMP inhibitor characterized by containing an extract of Rowan fruit. (2) A collagen production promoter characterized by containing an extract of Rowan fruit. (3) A wrinkle improving agent characterized by containing an extract of Rowan fruit. (4) A hyaluronic acid production promoter characterized by containing an extract of Rowan fruit. (5) An antioxidant characterized by containing an extract of Rowan fruit. (6) A skin whitening agent characterized by containing an extract of Rowan fruit. (7) A medicine containing an extract of Rowan fruit. (8) A food composition for preventing and improving various diseases, joint diseases and physiological floaters caused by increased MMP, characterized by containing an extract of Rowan fruit. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] The present invention will be described in detail below.

[0021] The European rowan (scientific name: Sorbus aucuparia) used in the present invention is a deciduous tree native to Europe that belongs to the genus Sorbus and the family Rosaceae, and is a medium-sized shrub about 8 to 10 meters tall. Its fruit is a pome-shaped fruit that changes from green to bright red as it ripens in the summer, and is mainly used for food.

[0022] The Rowan fruit used in the present invention can be obtained from the growing area or can be purchased commercially. The fruit may be extracted as is, or may be subjected to processing such as drying, crushing, or shredding.

[0023] Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are good, and more preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are good. These solvents may be used alone or in combination of two or more. Particularly preferred extraction solvents include water, ethanol, 1,3-butylene glycol, mixed polar solvents of water-ethanol, or mixed polar solvents of water-1,3-butylene glycol. The amount of solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, relative to the fruit (dry weight) of Rowan, but is preferably 100 times or less for convenience of operations in the case of concentration or isolation after extraction. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0024] The extraction method is not particularly limited, and may be performed by heating extraction, room temperature extraction, low temperature extraction, stirring extraction, column extraction, etc. The extract may also be used in combination with the fruit.

[0025] The extract may be used as it is in the form of an extracted solution, but if necessary, it may be used after being subjected to treatments such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc., deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be concentrated to dryness, spray-dried, freeze-dried, etc., and used as a dried product.

[0026] In the present invention, the above-mentioned extract may be used as it is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, acidulants, and other ingredients used in cosmetics, quasi-drugs, medicines, foods, etc., within the scope that does not impair the effects of the extract.

[0027] The present invention can be used in any of cosmetics, quasi-drugs, medicines, and foods, and examples of the dosage forms include lotions, creams, milky lotions, gels, aerosols, essences, packs, cleaning agents, bath agents, foundations, dusting powders, lipsticks, ointments, poultices, tablets, capsules, chocolate, gum, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0028] In the case of external use, the content of the above extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as a solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an increase in the effect, which is uneconomical.

[0029] In the case of internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. In general, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0030] In the following, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. In the production examples, % means % by weight, and in the formulation examples, parts means parts by weight. EXAMPLES

[0031] Example of manufacturing Rowan fruit extract A Rowan fruit extract was produced as follows: In Production Examples 1 to 4, Rowan fruit was used as the extraction material.

[0032] (Production Example 1) Preparation of hot water extract of Rowan fruit 200 mL of water was added to 10 g of dried Rowan fruit, and extraction was performed for 2 hours at 95 to 100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 3.6 g of a hot water extract of Rowan fruit.

[0033] (Production Example 2) Preparation of 50% ethanol extract of Rowan fruit 10 g of dried Rowan fruit was soaked in 200 mL of 50% ethanol solution at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 3.5 g of 50% ethanol extract of Rowan fruit.

[0034] (Production Example 3) Preparation of ethanol extract of Rowan fruit 10 g of dried Rowan fruit was soaked in 200 mL of ethanol at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 3.3 g of Rowan fruit ethanol extract.

[0035] (Production Example 4) Preparation of 1,3-butylene glycol extract of Rowan fruit 10 g of dried Rowan fruit was immersed in 200 mL of 1,3-butylene glycol at low temperature for 7 days to perform extraction. The resulting extract was filtered to obtain 192 g of 1,3-butylene glycol extract of Rowan fruit.

[0036] Next, experimental examples will be given to explain the effects of the present invention in detail. EXAMPLES

[0037] Experimental Example 1 Measurement of mRNA expression levels of type I collagen (COL1A1), hyaluronic acid synthase 2 (HAS2), MMP-1 and MMP-2 Human skin fibroblasts (or keratinocytes) were placed in a 60 mm dish at 1 × 10 5 The cells were seeded and incubated in DMEM culture medium containing 10% FBS at 37°C and 5% CO 2 The cells were cultured under the following conditions. When the cells reached a confluent state, they were cultured for 24 hours in DMEM(-) culture medium to which each sample had been added at a final concentration of 1, 10, or 100 μg / mL, and then total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the amount of total RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The amount of mRNA expression was measured by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other operations were performed according to the prescribed method, and the expression levels of COL1A1, HAS2, MMP-1 and MMP-2 mRNA were calculated as a ratio to the expression level of GAPDH mRNA, which is an internal standard. The COL1A1 expression rate was calculated as the ratio of the expression level of COL1A1 mRNA in the sample-added group to the expression level of COL1A1 mRNA in the control (no sample added) group. The expression rates of HAS2, MMP-1 and MMP-2 were calculated in the same manner. The primers used to measure the expression level of each gene are as follows.

[0038] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 1) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 2) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 3) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 4) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 5) TGAGCATCCCCTCCAATACC (SEQ ID NO: 6) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO: 7) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 8) Primer set for GAPDH CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 9) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 10)

[0039] The results of these experiments are shown in Tables 1 to 4. As a result, the Rowan fruit extract of the present invention was found to have excellent COL1A1 expression promoting effect (collagen production promoting effect), HAS2 expression promoting effect (hyaluronic acid production promoting effect), MMP-1 expression suppressing effect (MMP inhibitory effect) and MMP-2 expression suppressing effect (MMP inhibitory effect). In particular, the Rowan fruit hot water extract (Production Example 1) was significantly effective in promoting COL1A1 expression and suppressing MMP-1 expression, the 50% ethanol extract (Production Example 2) was significantly effective in suppressing MMP-2 expression, and the ethanol extract (Production Example 3) was significantly effective in promoting COL1A1 expression and promoting HAS2 expression.

[0040] [Table 1]

[0041] [Table 2]

[0042] [Table 3]

[0043] [Table 4] EXAMPLES

[0044] Experimental Example 2: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma was plated in a 60 mm dish at 3 × 10 4 The cells were seeded with 100 cells / mL of each sample and incubated at 37℃ in 5% CO in MEM culture medium containing 10% FBS. 2 The cells were cultured for 5 days under the above conditions. After the culture, the cells were detached, centrifuged, and the pellet obtained was dissolved in PBS(-) by ultrasonic disruption. Protein quantification was performed using the Lowry method (J.Biol.Chem.,193,265-275,1951). When measuring the amount of melanin, 4N NaOH was added to the remaining cell disruption solution taken for protein quantification, and the solution was heated at 60°C for 2 hours, after which the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation), the amount of melanin was calculated from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the amount of melanin reduction in the sample-added group to the control (no sample added) group.

[0045] The test results are shown in Table 5. It was confirmed that the hot water extract of Rowan fruit of the present invention (Production Example 1) has an excellent melanin production inhibitory effect.

[0046] [Table 5] EXAMPLES

[0047] Experimental Example 3: Active oxygen elimination test (antioxidant test) The free radical scavenging and removal effect was evaluated. Ascorbic acid was used as a positive control. As a model of free radicals, the stable free radical α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH) was used. It was reacted with the sample at a certain ratio for a certain period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at a wavelength of 517 nm.

[0048] Method for measuring free radical scavenging and removal activity Each sample was added to 2 mL of 1.0 M acetate buffer (pH 5.5) to a final concentration of 100 μg / mL (ascorbic acid was 20 μg / mL), and 2 mL of anhydrous ethanol and 1 mL of 0.5 mM DPPH anhydrous ethanol solution were added to the 2 mL of the sample to prepare a reaction solution. In the case of an oil-soluble sample, the sample was added to 2 mL of anhydrous ethanol to prepare a reaction solution. After that, the reaction was carried out at 37°C for 30 minutes, and the absorbance (A) at a wavelength of 517 nm was measured using water as a control. In addition, the absorbance (B) was measured using purified water instead of the sample as a blank. The free radical capture and removal rate was calculated using the following formula. Free radical scavenging and removal rate (%) = (1-A / B) x 100

[0049] The test results are shown in Table 6. It was confirmed that the hot water extract (Production Example 1) and 50% ethanol extract (Production Example 2) of the Rowan fruit of the present invention have a stable and excellent free radical scavenging and removing effect.

[0050] [Table 6] EXAMPLES

[0051] (Formulation example 1) Lotion Formula Content (%) 1. Hot water extract of Rowan fruit (Production Example 1) 2.0 2.1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly with components 7 to 10, respectively, and the two are mixed and filtered to obtain the product.

[0052] (Comparative Formulation Example 1) Conventional lotion A conventional lotion was prepared by replacing the hot water extract of Rowan fruit in Formulation Example 1 with purified water.

[0053] (Formulation Example 2) Cream Formula Content (%) 1. 50% ethanol extract of Rowan fruit (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-9, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1 and 11-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 10 at 45°C, and cool further to 30°C to make the product.

[0054] (Comparative Formulation Example 2) Conventional cream In the formulation example 2, the 50% ethanol extract of Rowan fruit was replaced with purified water to prepare a conventional cream.

[0055] (Formulation Example 3) Emulsion Formula Content (%) 1. Ethanol extract of Rowan fruit (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 1-8, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 10-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 9 at 45°C, and cool further to 30°C to make the product.

[0056] (Formulation Example 4) Gel Formula Content (%) 1. Rowan fruit 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make up to 100% [Manufacturing method] Components 2 to 5, 1 and 6 to 11 are each dissolved uniformly, and then the two are mixed to obtain the product.

[0057] (Formulation Example 5) Pack Formula Content (%) 1. Hot water extract of Rowan fruit (Production Example 1) 1.0 2. Rowan fruit 1,3-Butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0058] (Formulation Example 6) Foundation Formula Content (%) 1. 50% ethanol extract of Rowan fruit (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetanol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-8, and keep at 80°C to make the oil phase. Allow ingredient 9 to swell well in ingredient 19, then add ingredients 1 and 10-13 and mix uniformly. Add ingredients 14-17, which have been ground and mixed in a grinder, and stir in a homogenizer while keeping the temperature at 75°C to make the water phase. Add the water phase to the oil phase while stirring, and emulsify. After that, cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to make the product.

[0059] (Formulation Example 7) Bath additive Formula Content (%) 1. Ethanol extract of Rowan fruit (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total amount 100. [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0060] (Prescription Example 8) Ointment Formula Content (%) 1. Hot water extract of Rowan fruit (Production Example 1) 5.0 2. Rowan fruit 1,3-Butylene glycol extract (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 3-6, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1, 2, and 7-9, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, and cool to 30°C while stirring to make the product.

[0061] (Prescription Example 9) Powder Formula Content (%) 1. Hot water extract of Rowan fruit (Production Example 1) 1.0 2. Dried cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to make a powder.

[0062] (Formulation Example 10) Tablets Formula Content (%) 1. Ethanol extract of Rowan fruit (Production Example 3) 5.0 2. Dried cornstarch 25.0 3. Calcium carboxymethyl cellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing method] Mix ingredients 1 to 4, then add an aqueous solution of ingredient 5 as a binder and mold into granules. Add ingredient 6 to the molded granules and compress into tablets. Each tablet weighs 0.52 g.

[0063] (Prescription Example 11) Tablets Formula Content (%) 1. Ethanol extract of Rowan fruit (Production Example 3) 2.0 2. Dried cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7. Add purified water to make up to 100% [Manufacturing method] Mix ingredients 1-4 and 7 and mold into granules. Add ingredients 5 and 6 to the molded granules and compress into tablets. Each tablet weighs 1.0 g.

[0064] (Formulation Example 12) Beverage Formula Content (%) 1. Hot water extract of Rowan fruit (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make up to 100% [Production method] Dissolve ingredients 2 and 3 in a small amount of water. Then add ingredients 1, 4 and 5 and mix. [Industrial Applicability]

[0065] From the above, the Rowan fruit extract of the present invention has excellent collagen production promoting action, hyaluronic acid production promoting action, MMP inhibitory action, melanin production suppressive action, and antioxidant action, and is also excellent in stability. Therefore, the Rowan fruit extract of the present invention can be used not only in the beauty field such as skin aging, but also in the medical field such as suppressing functional decline due to aging, preventing and treating cancer, and is expected to be applied to foods, cosmetics, quasi-drugs, medicines, etc.

Claims

1. An MMP-1 inhibitor comprising an extract of Rowan fruit using water or using a hydroethanolic solution having an ethanol concentration of 50% by weight or less.

2. An MMP-2 inhibitor comprising an extract of Rowan fruit using water, aqueous ethanol or ethanol.

3. A collagen production promoter (excluding those for improving wrinkles) characterized by containing an extract of Rowan fruit.

4. A hyaluronic acid production promoter (excluding those for improving wrinkles) characterized by containing an extract of Rowan fruit.

5. An antioxidant characterized by containing an extract of Rowan fruit with water at 95 to 100°C.

6. A pharmaceutical for preventing and improving various diseases caused by the enhancement of MMP-1, comprising an extract of Rowan fruit with water or with aqueous ethanol having an ethanol concentration of 50% by weight or less.

7. A pharmaceutical for preventing and improving various diseases caused by the enhancement of MMP-2, characterized by containing an extract of Rowan fruit using water, aqueous ethanol or ethanol.

8. A pharmaceutical for preventing and improving joint diseases caused by decreased collagen production and / or physiological floaters caused by decreased hyaluronic acid production, characterized by containing an extract of Rowan fruit.

9. A pharmaceutical for preventing and improving various diseases caused by a decrease in the ability to scavenge active oxygen, which is characterized by containing an extract of Rowan fruit in water at 95 to 100°C.

10. A food composition for preventing and improving various diseases caused by the enhancement of MMP-1, characterized by containing an extract of Rowan fruit with water or with aqueous ethanol having an ethanol concentration of 50% by weight or less.

11. A food composition for preventing and improving various diseases caused by the enhancement of MMP-2, characterized by containing an extract of Rowan fruit with water, aqueous ethanol or ethanol.

12. A food composition for preventing and improving joint diseases caused by decreased collagen production and / or physiological floaters caused by decreased hyaluronic acid production, characterized by containing an extract of Rowan fruit.

13. A food composition for preventing and improving various diseases caused by a decrease in the ability to scavenge active oxygen, which comprises an extract of Rowan fruit with water at 95-100°C.

Images