Melanin production inhibitors, collagen production promoters, hyaluronic acid production promoters, MMP-2 inhibitors and internal medicines

Abstract

To provide novel external or internal agents having an excellent melanin production inhibitory action, collagen production promoting action, hyaluronic acid production promoting action, and MMP-2 inhibitory action.SOLUTION: Pinus koraiensis seed extract can be used in any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and the dosage form includes, for example, lotions, creams, detergents, bathing agents, ointments, poultices, candy tablets, chocolates, gums, beverages, powders, granules, tablets, injection solutions and the like. For external use, the content of the extract is preferably 0.0001 wt.% or more, more preferably 0.001 to 10 wt.%, in terms of solid matter.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a melanin production inhibitor, a collagen production promoter, a hyaluronic acid production promoter, an MMP-2 inhibitor, and an internal preparation. [Background technology]

[0002] In general, skin pigmentation such as age spots, freckles, and sunburn is believed to be caused by hormonal abnormalities and UV stimulation, which causes melanin pigment to be produced excessively by melanin-producing cells in the skin, which then deposits in the skin. One method for preventing such pigmentation is known to be a method for suppressing the excessive production of melanin. Conventionally, ascorbic acid (vitamin C) and the like have been used as whitening agents for internal and external use in the treatment of pigmentation (Patent Document 1).

[0003] In addition to ultraviolet rays, the skin is exposed to various physical and chemical stresses such as dryness, cold, heat, and drugs every day. As a result, the skin's functions are reduced, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles, and are temporary wrinkles that occur when the moisture content in the epidermal stratum corneum decreases due to dry skin. On the other hand, dermal wrinkles are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. The mechanism of their formation includes a decrease in the collagen synthesis ability of dermal fibroblasts due to ultraviolet rays and aging, and promotion of collagen decomposition due to an increase in matrix metalloproteinase (MMP).

[0004] Epidermal wrinkles caused by dryness and dermal wrinkles have different histological morphology, onset mechanisms, and treatment methods, and dermal wrinkles caused by ultraviolet rays and aging are difficult to improve with the use of cosmetics with moisturizing effects.

[0005] To date, there have been reports of an agent for preventing and improving skin wrinkles, which contains hydrolyzed almonds as an active ingredient, (Patent Document 2) and an agent for improving wrinkles caused by ultraviolet radiation, which contains extracts of Jojoba grandiflorum, Tianxiang and Xanthomonas japonica as active ingredients, (Patent Document 3) with the aim of improving dermal wrinkles caused by ultraviolet radiation.

[0006] In addition, fibroblasts and collagen are present in the dermis, with type I collagen accounting for 80% of the total. In addition to type I collagen, the existence of types III, V, XII, and XIV collagen is known. One of the causes of wrinkles and sagging is a decrease in type I collagen. Therefore, promoting the production of type I collagen is thought to be effective in preventing and improving wrinkles and sagging. In addition, promoting the production of type I collagen is also effective in improving wound healing of the skin.

[0007] In addition, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains the firmness of the skin. It is believed that wrinkles and sagging of the skin occur when this connective tissue loses its contractile force and further loses its elasticity.

[0008] In particular, hyaluronic acid is known as a polymeric polysaccharide widely distributed in connective tissues, and takes on a gel-like form in the dermis, maintaining the elasticity of the skin. Therefore, the alteration or reduction of hyaluronic acid is considered to be important in skin aging. In addition, since hyaluronic acid is a polymer, there is a problem that cosmetics containing it are not easily absorbed even when directly applied to the skin. Therefore, up until now, skin external preparations that can promote the production of collagen and hyaluronic acid by cells themselves by activating fibroblasts have been sought. A hyaluronic acid production promoter containing an extract of Acanthus arbutus as an active ingredient (Patent Document 4), a hyaluronic acid production promoter containing an extract of sprouted roasted Job's tears as an active ingredient (Patent Document 5), and a hyaluronic acid production promoter containing an extract of Tremella fuciformis fruiting body as an active ingredient (Patent Document 6) have been reported.

[0009] Hyaluronic acid is also present in joints, and is known to function to cushion the impact of load on joints and to smooth joint movement. The concentration of hyaluronic acid in normal human synovial fluid is about 2.3 mg / mL, but in the case of chronic rheumatoid arthritis, the concentration of hyaluronic acid in synovial fluid is reduced to about 1.2 mg / mL, and the viscosity of synovial fluid is also significantly reduced at the same time (Non-Patent Document 1). It is also known that the content of hyaluronic acid is reduced in purulent arthritis, gouty arthritis, and the like, as in the case of chronic rheumatoid arthritis (Non-Patent Document 2). In the above diseases, it is considered to increase the amount of hyaluronic acid in synovial fluid in order to improve lubrication function, cover and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that when sodium hyaluronate is injected into the joint of a patient with chronic rheumatoid arthritis, the above symptoms are improved (Non-Patent Document 3). However, the treatment of the above diseases is long-term. Therefore, there is a demand for external skin preparations, foods, and medicines that contain hyaluronic acid production promoters so that prevention, treatment, etc. can be easily carried out in daily life.

[0010] Floaters are a symptom where a thin shadow resembling a lint or a mosquito appears in the field of vision. They occur when opacity in the vitreous body, which fills the inside of the eye, casts a shadow on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to aging, ultraviolet rays, active oxygen, etc., and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tear, vitreous hemorrhage, and uveitis. Physiological floaters are caused by liquefaction due to a decrease in hyaluronic acid, the main component of the vitreous body, and the resulting collapse of collagen fibers, causing the vitreous body to become opaque. Treatments include vitrectomy surgery and laser treatment, but these procedures are not often performed in Japan due to safety concerns, and treatment abroad requires a large amount of money. Therefore, in order to prevent and improve physiological floaters, foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis are desired.

[0011] Gelatinase (MMP-2), which belongs to MMP, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and breaks down substrates such as collagen, gelatin, and elastin (structural proteins that are special components of elastic tissues such as arteries, tendons, and skin). Therefore, substances that have inhibitory activity against gelatinase are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissues, and are considered to be useful for the prevention and treatment of cancer diseases. Furthermore, inhibition of MMP is useful not only for cancer diseases, but also for the prevention, treatment, and improvement of diseases caused by the enhancement of MMP, such as ulcer formation, chronic rheumatoid arthritis, osteoporosis, and periodontitis.

[0012] Korean pine (scientific name: Pinus koraiensis) is an evergreen coniferous tree belonging to the genus Pinus, family Pinaceae, order Pinales. In Japan, it grows naturally in the mountainous areas of central Honshu and Shikoku, as well as the Korean Peninsula, northeastern China, Amur, and Ussuri. Mature trees reach a height of over 30m and a diameter of 1.5m. The needles are five-lobed, with five needles growing in clusters on short branches. The cones are large, measuring 9-15cm in length and 5-7cm in diameter, and each cone scale contains two seeds, each about 1.2cm in size. The herbal medicine kaishoushi is made from the dried seeds, which contain 60-70% fatty oil. The seeds are also used for food. It has been reported that Korean pine seed oil has a cholesterol-lowering effect (Patent Document 7), that extracts of the leaves, bark and cones have a hair-growth effect (Patent Document 8), and that extracts of the cones, bark and leaves have a blood fluidity improving effect (Patent Document 9). However, it was not known that Korean pine seed extract has a melanin production suppressing effect, a collagen production promoting effect, a hyaluronic acid production promoting effect, and an MMP-2 inhibitory effect. [Prior art documents] [Patent documents]

[0013] [Patent Document 1] Japanese Patent Application Publication No. 5-229931 [Patent Document 2] JP 2000-119125 A [Patent Document 3] JP 2006-199611 A [Patent Document 4] JP 2007-1924 A [Patent Document 5] JP 2012-153669 A [Patent Document 6] JP 2019-99530 A [Patent Document 7] Japanese Patent Publication No. 61-238729 [Patent Document 8] JP 2004-224783 A [Patent Document 9] JP 2008-161077 A [Non-patent literature]

[0014] [Non-Patent Document 1] Arthritis Rheumatism,vol.10,pp 357,1967 [Non-Patent Document 2] "Bonding Composition", Kanehara Publishing, 481 pages, 1984 [Non-Patent Document 3] "Inflammation", Japanese Society of Inflammation, Vol. 11, No. 16, 1991 Summary of the Invention [Problem to be solved by the invention]

[0015] There is a demand for a material that is safe and stable and has excellent melanin production inhibitory effects, collagen production promoting effects, hyaluronic acid production promoting effects, and MMP-2 inhibitory effects, but at present no fully satisfactory material has been provided. [Means for solving the problem]

[0016] Under these circumstances, the present inventors conducted extensive research and found that an extract from Korean pine seeds has excellent melanin production suppression, collagen production promotion, hyaluronic acid production promotion, and MMP-2 inhibition, and is also excellent in stability. Furthermore, they found that an external or internal preparation containing the extract is safe and stable, has excellent melanin production suppression, collagen production promotion, hyaluronic acid production promotion, and MMP-2 inhibition, and can be used as a multifunctional beauty and health material or medicine, and thus completed the present invention.

[0017] That is, the present invention includes the following inventions. (1) A melanin production inhibitor characterized by containing an extract of Korean pine seeds. (2) A collagen production promoter comprising an extract of Korean pine seeds. (3) A hyaluronic acid production promoter characterized by containing an extract of Korean pine seeds. (4) An MMP-2 inhibitor comprising an extract of Korean pine seeds. (5) A skin whitening agent containing an extract of Korean pine seeds. (6) A food composition for preventing and improving various diseases caused by increased MMP, characterized by containing an extract of Korean pine seeds. Effect of the Invention

[0018] According to the present invention, a melanin production inhibitor (skin whitening agent), a collagen production promoter, a hyaluronic acid production promoter, and an MMP-2 inhibitor are provided, each of which contains an extract of Korean pine seeds as an active ingredient. In addition, Korean pine seeds are eaten as food, so they have no side effects and are highly safe. Therefore, external or internal preparations containing Korean pine seed extracts can be used with confidence. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] Korean pine (scientific name: Pinus koraiensis, herbal medicine name: Kaishoushi) used in the present invention is an evergreen coniferous tree belonging to the genus Pinus, family Pinaceae, order Pinales, and grows naturally in the mountainous regions of central Honshu and Shikoku in Japan, as well as the Korean peninsula, northeastern China, Amur, and Ussuri, but the place of origin is not particularly limited. In the present invention, for extracting Korean pine seeds, the seeds may be used as they are, or may be treated by drying, crushing, etc.

[0020] The extraction method is not particularly limited, and may be carried out by stirring or column extraction using water or hot water, or a mixed solvent of water and an organic solvent. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are good, and more preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are good. These solvents may be used alone or in combination. Particularly preferred extraction solvents include water, a mixed polar solvent of water-ethanol, or a mixed polar solvent of water-1,3-butylene glycol. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, relative to the Korean pine seeds (dry weight), but is preferably 100 times or less for convenience of operations in the case of concentration and isolation after extraction. In addition, the extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0021] The extract may be used as it is in the form of an extracted solution, or may be used after subjecting it to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., as long as the effects of the present invention are achieved. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0022] In the present invention, the above-mentioned extract may be used as it is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, acidulants, and other ingredients used in cosmetics, quasi-drugs, medicines, foods, and the like, within the scope of not impairing the effects of the extract.

[0023] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of the dosage forms thereof include lotions, creams, milky lotions, gels, aerosols, essences, packs, cleansers, bath agents, foundations, dusting powders, lipsticks, ointments, poultices, tablet confections, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and injectable solutions.

[0024] In the case of external use, the content of the above extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as a solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, it is difficult to see an increase in the effect, which is uneconomical.

[0025] In the case of internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. In general, the daily dosage for an adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0026] In the following, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. In the production examples, % means % by weight, and in the formulation examples, parts means parts by weight. EXAMPLES

[0027] Example of manufacturing Korean pine seed extract An extract of Korean pine seeds was prepared as follows.

[0028] (Production Example 1) Preparation of hot water extract of Korean pine seeds 200 mL of water was added to 10 g of dried Korean pine seeds, and the mixture was extracted for 2 hours at 95-100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.1 g of a hot water extract of Korean pine seeds.

[0029] (Production Example 2) Preparation of 50% ethanol extract of Korean pine seeds 200mL of 50% ethanol solution was added to 10g of dried Korean pine seeds, and the mixture was stirred at 180 rpm for 7 days at room temperature for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.6g of 50% ethanol extract of Korean pine seeds.

[0030] (Production Example 3) Preparation of ethanol extract of Korean pine seeds 200mL of ethanol was added to 10g of dried Korean pine seeds, and the mixture was stirred at 180 rpm for 7 days at room temperature for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.2g of ethanol extract of Korean pine seeds.

[0031] (Production Example 4) Preparation of 1,3-butylene glycol extract of Korean pine seeds 200 mL of 1,3-butylene glycol was added to 10 g of dried Korean pine seeds, and the mixture was stirred at 180 rpm for 7 days at room temperature to extract. The resulting extract was filtered to obtain 194 g of 1,3-butylene glycol extract of Korean pine seeds.

[0032] (Production Example 5) Preparation of hexane extract of Korean pine seeds 200mL of hexane was added to 10g of dried Korean pine seeds, and the mixture was stirred at 180 rpm for 7 days at room temperature for extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.1g of hexane extract of Korean pine seeds. EXAMPLES

[0033] (Formulation example 1) Lotion Prescription Content (parts) 1. Hot water extract of Korean pine seeds (Production Example 1) 2.0 2.1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly with components 7 to 10, respectively, and the two are mixed and filtered to obtain the product.

[0034] (Comparative Formulation Example 1) Conventional lotion A conventional lotion was prepared by replacing the hot water extract of Korean pine seeds in Formulation Example 1 with purified water.

[0035] (Formulation Example 2) Cream Prescription Content (parts) 1. 50% ethanol extract of Korean pine seeds (Preparation Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-Butylene glycol 8.5 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-9, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1 and 11-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 10 at 45°C, and cool further to 30°C to make the product.

[0036] (Comparative Formulation Example 2) Conventional cream In Formulation Example 2, the 50% ethanol extract of Korean pine seeds was replaced with purified water to form a conventional cream.

[0037] (Formulation Example 3) Emulsion Prescription Content (parts) 1. Korean pine seed hexane extract (Production Example 5) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetanol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 1-8, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 10-13, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, cool with stirring, add ingredient 9 at 45°C, and cool further to 30°C to make the product.

[0038] (Formulation Example 4) Gel Prescription Content (parts) 1. Korean pine seeds 1,3-Butylene glycol extract (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make up to 100% [Manufacturing method] Components 2 to 5, 1 and 6 to 11 are each dissolved uniformly, and then the two are mixed to obtain the product.

[0039] (Formulation Example 5) Pack Prescription Content (parts) 1. Hot water extract of Korean pine seeds (Production Example 1) 1.0 2. Korean pine seeds 1,3-Butylene glycol extract (Production Example 4) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5.1,3-Butylene glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make up to 100% [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0040] (Formulation Example 6) Foundation Prescription Content (parts) 1. 50% ethanol extract of Korean pine seeds (Preparation Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetanol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow iron oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 2-8, and keep at 80°C to make the oil phase. Allow ingredient 9 to swell well in ingredient 19, then add ingredients 1 and 10-13 and mix uniformly. Add ingredients 14-17, which have been ground and mixed in a grinder, and stir with a homomixer to make the water phase, keeping the temperature at 75°C. Add the water phase to the oil phase while stirring, and emulsify. Then cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to make the product.

[0041] (Formulation Example 7) Bath additive Prescription Content (parts) 1. Ethanol extract of Korean pine seeds (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total amount 100. [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0042] (Prescription Example 8) Ointment Prescription Content (parts) 1. Hot water extract of Korean pine seeds (Production Example 1) 5.0 2. Korean pine seeds 1,3-Butylene glycol extract (Production Example 4) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetanol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene glycol 10.0 9. Add purified water to make up to 100% [Manufacturing method] Heat and dissolve ingredients 3-6, mix, and keep at 70°C to make the oil phase. Heat and dissolve ingredients 1, 2, and 7-9, mix, and keep at 75°C to make the water phase. Add the water phase to the oil phase to emulsify, and cool to 30°C while stirring to make the product.

[0043] (Prescription Example 9) Powder Prescription Content (parts) 1. Hot water extract of Korean pine seeds (Production Example 1) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to make a powder.

[0044] (Formulation Example 10) Tablets Prescription Content (parts) 1. Ethanol extract of Korean pine seeds (Production Example 3) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing method] Mix ingredients 1 to 4, then add an aqueous solution of ingredient 5 as a binder and mold into granules. Add ingredient 6 to the molded granules and compress into tablets. Each tablet weighs 0.52 g.

[0045] (Prescription Example 11) Tablets Prescription Content (parts) 1. Ethanol extract of Korean pine seeds (Production Example 3) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric Acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing method] Mix ingredients 1-4 and 7 and mold into granules. Add ingredients 5 and 6 to the molded granules and compress into tablets. Each tablet weighs 1.0 g.

[0046] (Formulation Example 12) Beverage Prescription Content (parts) 1. Hot water extract of Korean pine seeds (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make up to 100% [Production method] Dissolve ingredients 1 to 3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0047] Next, experimental examples will be given to explain the effects of the present invention in detail. EXAMPLES

[0048] Experimental Example 1: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were cultured in a 60 mm dish at 3 × 10 4 The cells were seeded and cultured for 5 days at 37°C and 5% CO2 in MEM culture medium containing 10% FBS to which each sample was added at a final concentration of 1, 10 or 100 μg / mL. After the culture, the cells were detached, centrifuged, and the resulting pellet was dissolved in PBS(-) by ultrasonication. Protein quantification was performed using the Lowry method (J.Biol.Chem.,193,265-275,1951). When measuring the amount of melanin, 4N NaOH was added to the remaining cell disruption solution taken for protein quantification, and the solution was heated at 60°C for 2 hours, after which the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation), the amount of melanin was calculated from the calibration curve, and the amount of melanin per mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the amount of melanin reduction in the sample-added group to the control (no sample added) group.

[0049] The results of these experiments are shown in Table 1. The extract of Korean pine seeds of the present invention was found to have an excellent melanin production inhibitory effect (skin whitening effect). In particular, the ethanol extract of Korean pine seeds (Production Example 3) was remarkably effective.

[0050] [Table 1]

[0051] Experimental Example 2 Measurement of type I collagen (COL1A1), hyaluronic acid synthase 2 (HAS2) and MMP-2 mRNA expression levels The mRNA expression levels of COL1A1, HAS2, and MMP-2 were measured. Human fibroblasts NB1RGB were cultured in a 60 mm dish at 1 × 10 5 The cells were seeded with 10% FBS and cultured at 37°C and 5% CO2 in DMEM culture medium. When the cells were confluent, they were cultured for 24 hours in DMEM(-) culture medium to which each sample was added at a final concentration of 10 or 100 μg / mL, and then total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). The mRNA expression level was measured by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Life Technologies) were used. That is, 500 ng of total RNA was reverse transcribed, followed by PCR (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles). Other operations were performed according to the prescribed method, and the expression levels of COL1A1, HAS2, and MMP-2 mRNA were calculated as a ratio to the expression level of GAPDH mRNA, which is an internal standard. The COL1A1 expression promotion rate was calculated as the ratio of the COL1A1 mRNA expression level in the sample-added group to the COL1A1 mRNA expression level in the control (no sample added) group. The HAS2 expression promotion rate and MMP-2 expression inhibition rate were calculated in the same manner. The primers used to measure the expression level of each gene are as follows.

[0052] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 1) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 2) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 3) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 4) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO:5) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 6) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 7) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 8)

[0053] The results of these experiments are shown in Tables 2 to 4. As a result, the extract of Korean pine seed of the present invention was found to have excellent COL1A1 expression promoting effect (collagen production promoting effect), HAS2 expression promoting effect (hyaluronic acid production promoting effect) and MMP-2 expression suppressing effect (MMP-2 inhibitory effect). In particular, the hexane extract of Korean pine seed (Production Example 5) was remarkably effective in promoting COL1A1 expression, and the 50% ethanol extract of Korean pine seed (Production Example 2) was remarkably effective in suppressing MMP-2 expression and promoting HAS2 expression.

[0054] [Table 2]

[0055] [Table 3]

[0056] [Table 4]

[0057] Experimental Example 3: Use test A one-month usage test was conducted on five subjects (aged 26-66) with wrinkles and sagging skin using the cream of Formulation Example 2 and the conventional cream of Comparative Formulation Example 2. After use, the degree of wrinkles and sagging skin was assessed by questionnaire.

[0058] As a result, wrinkles and sagging skin were reduced by the cream containing the extract of the present invention. Furthermore, during the test period, not a single subject experienced skin trouble, and there were no safety issues. There were also no problems with the deterioration of the prescribed ingredients.

[0059] A similar use test was also carried out using the lotion of Formulation Example 1 and the conventional lotion of Comparative Formulation Example 1. As a result, it was found that the lotion containing the extract of the present invention reduced wrinkles and sagging. [Industrial Applicability]

[0060] From the above, the Korean pine seed extract of the present invention has excellent melanin production suppression, collagen production promotion, hyaluronic acid production promotion, and MMP-2 inhibition, and is also excellent in stability. Therefore, the Korean pine seed extract of the present invention can be used not only in the beauty field such as skin aging, but also in the medical field such as suppressing functional decline due to aging, preventing and treating cancer, and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A melanin production inhibitor characterized by containing an ethanol extract of Korean pine seeds (excluding the outer seed coat).

2. A skin whitening agent comprising an ethanol extract of Korean pine seeds (excluding the outer seed coat).

Images