Fusion proteins for improving genome editing efficiency and uses thereof

Abstract

A fusion protein for improving genome editing efficiency and its use is provided. The fusion protein includes a single-stranded DNA-binding protein functional domain, a nucleoside deaminase, and a nuclease. During the conversion of CG to TA bases by CBEs, nucleoside deaminase, such as cytidine deaminase, deammoniates single-stranded DNA as a substrate. By fusing the single-stranded DNA-binding protein functional domain to the nucleoside deaminase and nuclease fusion protein, the exposure of single-stranded DNA to the nucleoside deaminase is significantly increased, thereby significantly improving base editing efficiency. This represents a dramatic improvement in single-base genome editing technology, greatly facilitating its use in genome editing, gene therapy, cell therapy, animal model generation, crop genetic breeding, and other areas.

Description

[Technical field]

[0001] The present invention relates to the field of biotechnology, specifically to a fusion protein that improves genome editing efficiency and its use. [Background technology]

[0002] Finally, since 2013, new generation genome editing technology represented by CRISPR / Cas9 has been introduced into various experiments in the field of biology, changing traditional genetic manipulation methods. In April 2016, David Liu Laboratory reported the first single base genome editing technology, and since then, other types of single base genome editing technology based on the principle of cytidine deaminase (such as lamprey and human cytidine deaminase fused with dCas9 or Cas9n in different ways) have been reported one after another. It is derived from Streptococcus pyogenes spCas9 in CRISPR / Cas9, NGG is used as PAM (precursor adjacent interspaced motif), and DNA is recognized and specifically bound, realizing single base mutation of C to T or G to A upstream of NGG.

[0003] Single-base genome editing technology has been reported to be used to efficiently perform gene mutation or repair of genomes, create disease animal models, and perform gene therapy. Currently, BE3 (base editor 3) is the most widely applied single-base genome editing tool discovered. BE3 has a base substitution efficiency of up to 37%, which is much higher than the efficiency achieved by homologous recombination, and at the same time retains relatively low off-target effects, showing its enormous potential to be used for single-base mutation modification or single-base mutation therapy of genomes. With the study, it is found that the introduction of additional two or more copies of UGI (uracil DNA glycosidase inhibitor) into BE3 can further improve its editing efficiency and product purity. The introduction of double-split NLS (nuclear localization signal) and codonization, i.e., BE4max, further improves its editing efficiency. Although all of these methods improve efficiency to a certain extent, they are all limited.

[0004] β-hemoglobinopathies, such as β-thalassemia and sickle cell disease (SCD), are due to HBB mutations in the β-hemoglobin gene. In a very small number of cases, hereditary hyperfetal hemoglobinemia (HPFH) is a benign genetic disease, and high expression of γ-globulin in adult patients can alleviate the phenotype of the disease caused by β-hemoglobin mutations. It has been reported that deleting 13bp of the promoter region of HBG1 / 2 using CRISPR / Cas9 can activate the expression of γ-globulin, which can further alleviate or treat thalassemia disease, and is an effective treatment policy. It has been reported that in one of these HPFH patients, a heterozygous point mutation (G>A) at the -117 site of the HBG1 / 2 promoter region generates 10-20% fetal hemoglobin (HbF) expression, and the mechanism is that the -117G>A mutation destroys the binding site of the transcriptional repressor BCL11A.

[0005] Conventional genome editing techniques still have a relatively low efficiency in generating animal models by base substitution using CRISPR / Cas9-mediated homologous recombination. Novel single-base genome editing techniques have attracted attention for their ability to generate disease animal models with 100% efficiency, but conventional single-base genome editing techniques are generally C3-C8, and the target is not very effective when it is close to the PAM region C. Summary of the Invention [Problem to be solved by the invention]

[0006] In response to the shortcomings of the prior art, the present invention aims to provide a fusion protein that improves genome editing efficiency and its application. [Means for solving the problem]

[0007] In one aspect, the present invention provides a fusion protein that improves genome editing efficiency, comprising a single-stranded DNA binding protein functional domain, a nucleoside deaminase and a nuclease.

[0008] Specifically, the connection order of the fusion proteins is such that the nucleoside deaminase is located at the N-terminus or C-terminus of the nuclease, and the single-stranded DNA binding protein functional domain is located between the nucleoside deaminase and the N-terminus or C-terminus of the nuclease and / or between the nucleoside deaminase and the nuclease; Preferably, the nucleoside deaminase is located at the N-terminus of the nuclease, More preferably, said single-stranded DNA binding protein functional domain is located between said nucleoside deaminase and said nuclease.

[0009] In the above fusion protein, the single-stranded DNA binding protein comprises a sequence-specific single-stranded DNA binding protein and / or a non-sequence-specific single-stranded DNA binding protein, preferably a non-sequence-specific single-stranded DNA binding protein; Preferably, the non-sequence-specific single-stranded DNA binding protein is selected from any one or more of RPA70 (human replication protein A 70 subunit), RPA32 (human replication protein A 32 subunit), BRCA2 (breast cancer 2 gene), hnRNPK (heterogeneous nuclear ribonucleoprotein K), PUF60 (poly-U-binding splicing factor 60 KDa) and Rad51 (homologous recombination repair protein); Preferably, the sequence-specific single-stranded DNA binding protein is selected from any one or more of TEBP (telomere binding protein), Teb1 (a component protein of telomerase) and POT1 (human telomere protection protein 1); Preferably, the functional domain of the single-stranded DNA-binding protein comprises at least one (any one, any two, any three or all four) of four domains of the single-stranded DNA-binding protein, namely, the OB fold (oligonucleotide / oligosaccharide / oligopeptide binding fold), the KH domain (K homeodomain), the RRMS (RNA recognition motif), and the whirly domains, or a partial polypeptide fragment of the four domains having a function of binding to single-stranded DNA, and any combination thereof; More preferably, the single-stranded DNA binding protein functional domain comprises the DNA binding domain (DBD) of Rad51, more preferably, the amino acid sequence of the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID No.1, more preferably, the coding sequence of the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID No.2; More preferably, the amino acid sequence of the DNA-binding domain of RPA70 comprises the sequence shown in SEQ ID No.11, and more preferably, the coding sequence of the DNA-binding domain of RPA70 comprises the sequence shown in SEQ ID No.12.

[0010] In the above fusion protein, the deaminase comprises a cytidine deaminase (APOBEC) and / or an adenosine deaminase, preferably a cytidine deaminase, the cytidine deaminase may be derived from a different organism; In some embodiments, the cytidine deaminase comprises a rat derived cytidine deaminase, preferably the amino acid sequence of the rat derived cytidine deaminase comprises the sequence shown in SEQ ID No. 3, more preferably the coding sequence of the rat derived cytidine deaminase comprises the sequence shown in SEQ ID No. 4; In some embodiments, the cytidine deaminase comprises human cytidine deaminase APOBEC3A, preferably the amino acid sequence of the human cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID No. 13, more preferably the coding sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID No. 14; In some embodiments, the cytidine deaminase comprises a cytidine deaminase APOBEC3A mutant, in which the asparagine (N or Asn) at position 57 (from the initiation codon) of the cytidine deaminase APOBEC3A is mutated to glycine (G or Gly), preferably the cytidine deaminase APOBEC3A is derived from a human, more preferably the amino acid sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID No. 13, more preferably the coding sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID No. 14, the amino acid sequence of the cytidine deaminase APOBEC3A mutant comprises the sequence shown in SEQ ID No. 15, more preferably the coding sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID No. 16, In the above fusion protein, the nuclease is selected from one or more of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, Cpf1, preferably the nuclease is Cas9, more preferably the Cas9 is selected from Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes or Staphylococcus thermophilus, more preferably the Cas9 is selected from the Cas9 mutants VQR-spCas9, VRER-spCas9, spCas9n, more preferably spCas9n, more preferably the amino acid sequence of spCas9n comprises the sequence as set forth in SEQ ID No.5, more preferably the coding sequence of spCas9n comprises the sequence as set forth in SEQ ID No.6.

[0011] The fusion protein further comprises an NLS (nuclear localization signal), preferably the NLS is located at at least one end (C-terminus and / or N-terminus) of the fusion protein, more preferably the amino acid sequence of the NLS comprises the sequence shown in SEQ ID No. 7, more preferably the coding sequence of the NLS comprises the sequence shown in SEQ ID No. 8; The fusion protein further comprises UGI (uracil DNA glycosidase inhibitor), preferably the UGI is located at at least one end (C-terminus and / or N-terminus) of the fusion protein, more preferably the amino acid sequence of the UGI comprises the sequence shown in SEQ ID No.9, more preferably the coding sequence of the UGI comprises the sequence shown in SEQ ID No.10, more preferably the UGI is in two or more copies.

[0012] In another aspect, the present invention further provides any one of A) to C) biomaterials. A) a gene encoding any one of the fusion proteins described above, said gene being DNA or RNA (e.g., mRNA); B) A recombinant vector containing the gene according to A), wherein the recombinant vector comprises a viral vector and / or a non-viral vector, the viral vector comprises an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, a retroviral vector, and / or an oncolytic viral vector, and the non-viral vector comprises a cationic polymer, a plasmid vector, and / or a liposome; C) A recombinant cell or recombinant comprising any one of the above fusion proteins or comprising the gene according to A), said recombinant may be an engineered cell, said recombinant cell being a target cell to be edited, such as an immune cell (e.g. a T cell), a hematopoietic stem cell, a bone marrow cell, an erythroid cell, preferably an erythroid progenitor cell or a hematopoietic stem cell.

[0013] In another aspect, the present invention further provides an sgRNA for genome editing of a target gene in a cell, wherein the target sequence of the sgRNA comprises at least one of SEQ ID Nos. 17-36; Preferably, the cell is a T cell, a hematopoietic stem cell, a bone marrow cell or an erythroid cell, more preferably an erythroid progenitor cell or a hematopoietic stem cell; Preferably, the target genes are the HBG1 and HBG2 promoter regions (specifically, the G at -117 site is edited to A, and the G at -117 site, i.e., the 14th G from the left in the promoter region CCAGCCTTGCCTTGACCAATAGCC).

[0014] In another aspect, the present invention further provides a single base genome editing system comprising any one of the above fusion proteins or the above described biomaterials and an sgRNA, wherein the sgRNA guides the fusion protein to perform single base genome editing on a target gene in a cell of interest; Preferably, the target sequence of the sgRNA comprises at least one of SEQ ID Nos. 17-36; and / or the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell; And / or, the target genes are the HBG1 and HBG2 promoter regions.

[0015] In another aspect, the present invention provides a method for the preparation of a genome editing product, a disease treatment and / or prevention product, an animal model, or a new plant variety, comprising the steps of: In some embodiments, the disease is a beta hemoglobinopathy, the beta hemoglobinopathy including beta thalassemia and / or sickle cell anemia.

[0016] In another aspect, the present invention further provides a method for improving single-base genome editing efficiency, comprising the step of introducing into a cell the fusion protein described in any one of the above and an sgRNA to perform genome editing on a target gene, wherein the sgRNA guides the fusion protein to perform single-base genome editing on the target gene.

[0017] In the above method, preferably, the target sequence of the sgRNA comprises at least one of SEQ ID Nos. 17-36; and / or the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell; And / or, the target genes are the HBG1 and HBG2 promoter regions.

[0018] In another aspect, the present invention further provides a method for constructing a disease animal model, comprising the steps of introducing the fusion protein and sgRNA described above into an animal cell and performing genome editing on a target gene, Preferably, the target sequence of the sgRNA comprises at least one of SEQ ID Nos. 17-36, more preferably, the target sequence of the sgRNA comprises the sequence shown in SEQ ID No. 36, and the target gene comprises the DMD gene; Preferably, the animal is a mammal, more preferably, the mammal is a rat or a mouse, more preferably, a mouse; Preferably, the cell is an embryonic cell, Preferably, the mode of introduction is one or a combination of vector transformation, microinjection, transfection, liposome transfection, heat shock, electroporation, transduction, gene gun, DEAE-glucan mediated transfer, more preferably microinjection; Preferably, the introduction is carried out using the mRNA of a fusion protein according to any one of the above and the sgRNA, More preferably, the concentration of the mRNA of any one of the above fusion proteins used in the introduction is 1-1000ng / μL, more preferably 10-600ng / μL, more preferably 50-150ng / μL, more preferably 100ng / μL, and the concentration of the sgRNA used in the introduction is 1-1000ng / μL, more preferably 10-600ng / μL, more preferably 150-250ng / μL, more preferably 200ng / μL; More preferably ,before The sgRNA used in the transfection Concentration of mRNA of any one of the above fusion proteins used in the transfection relative to the concentration of The ratio is 1:(5-1), more preferably 1:(4-1.5), more preferably 1:(3-1.8), more preferably 1:2.

[0019] The present invention protects the application of the animal model obtained by the above method in drug screening, evaluation of disease treatment effect, or research into disease treatment mechanism.

[0020] In another aspect, the present invention provides a product for treating and / or preventing β-hemoglobinopathy, comprising the gene in A) above and a delivery vector for sgRNA, The sgRNA induces the fusion protein to perform single-base genome editing on the HBG1 and HBG2 promoter regions in the target cell (specifically, the G at the -117 site is edited to A, and the G at the -117 site, i.e., the 14th G from the left in the promoter region CCAGCCTTGCCTTGACCAATAGCC), Preferably, the target sequence of the sgRNA comprises the sequence shown in SEQ ID No. 35, Preferably, the beta hemoglobinopathies include beta thalassemia and / or sickle cell anemia, Preferably, the cell is a T cell, a hematopoietic stem cell, a bone marrow cell or an erythroid cell, more preferably an erythroid progenitor cell or a hematopoietic stem cell; Preferably, the target genes are the HBG1 and HBG2 promoter regions (specifically, the G at -117 site is edited to A, and the G at -117 site, i.e., the 14th G from the left in the promoter region CCAGCCTTGCCTTGACCAATAGCC).

[0021] In the above product, the delivery vector comprises a viral vector and / or a non-viral vector, the viral vector comprises an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, a retroviral vector, and / or an oncolytic viral vector, and the non-viral vector comprises a cationic polymer, a plasmid vector, and / or a liposome; Preferably, the delivery vector comprises a lentiviral vector.

[0022] The above "at least one" means any one of all the limited types, a combination of any two, a combination of any three, ..., or a combination of all types, all of which are within the scope of protection of this application.

[0023] Among the above amino acid sequences or coding sequences, sequences that have a homology of 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more with the sequences described in the present application, and / or sequences that have amino acid residue or nucleotide substitutions, deletions or insertions based on the sequences described in the present application and that are used in the present application, are sequences that have the same or similar functions, and all of these are within the scope of protection of the present application. Effect of the Invention

[0024] The beneficial effects of the present invention are as follows: In the present invention, in the process of converting CG to TA bases using CBEs (pyrimidine base conversion technology), a nucleoside deaminase, such as cytidine deaminase, uses single-stranded DNA as a substrate to perform deaminification, and by re-fusing a single-stranded DNA binding protein functional domain to a fusion protein of nucleoside deaminase and nuclease, the opportunity for single-stranded DNA to be exposed to nucleoside deaminase is greatly increased, thereby significantly improving the base editing efficiency.

[0025] The present invention screens the functional domains of 10 types of non-sequence-preferring single-stranded DNA binding proteins and fuses them with BE4max, and finds that one single-stranded DNA binding functional domain (1-114AA) of human-derived Rad51 shows the most efficient improvement when fused between Apobec1 and Cas9n, and names it hyBE4max. The CG-TA editing efficiency of hyBE4max is improved by up to 16-fold compared to BE4max, and the site efficiency close to the PAM region in particular is more significantly improved while maintaining a relatively low indels (insertion or deletion).

[0026] The present invention improves the breakthrough of single-base genome editing technology, and can greatly promote its application in aspects such as genome editing, gene therapy, cell therapy, animal model production, and crop genetic breeding.

[0027] In gene therapy, the present invention takes β-hemoglobinopathy as an example, in comparison with eA3A-BE4max and A3A-BE4max, the promoter region targeting HBG1 and HBG2 (hereinafter abbreviated as HBG1 / 2) of hyeA3A-BE4max is close to the -117 site of the PAM region, and can more accurately and efficiently target -117 to generate a G to A mutation, thereby activating the expression of γ-globulin, and providing a more accurate and efficient treatment policy for the clinical treatment of β-hemoglobinopathy.

[0028] The present invention applies hyA3A-BE4max to the production of mouse disease animal models, and compared with A3A-BE4max, it is more effective for hyA3A-BE4max to target the C-T mutation close to the PAM region to generate disease animal models, so that the present invention provides a novel platform for efficiently producing disease animal models, which greatly facilitates the production process of different animal models. [Brief description of the drawings]

[0029] [Figure 1] 1 is a structural schematic of different single-stranded DNA binding protein functional domains fused to BE4max, where NLS is a nuclear localization signal (its amino acid sequence is shown in SEQ ID No. 7 and the coding sequence is shown in SEQ ID No. 8), rA1 is cytidine deaminase APOBEC1 (its amino acid sequence is shown in SEQ ID No. 3 and the coding sequence is shown in SEQ ID No. 4), spCas9n is Cas9n from Streptococcus pyogenes (its amino acid sequence is shown in SEQ ID No. 5 and the coding sequence is shown in SEQ ID No. 6), UGI is uracil-DNA glycosidase inhibitor (its amino acid sequence is shown in SEQ ID No. 9 and the coding sequence is shown in SEQ ID No. 10) and SSDBD is a single-stranded DNA binding protein functional domain. [Diagram 2] hyBE4max vs. BE4max C-T base editing efficiency (i.e., ordinate, unit is %) achieved at eight targets on 293T. [Diagram 3] Average C-T base editing efficiency (i.e., ordinate, in %) produced by hyBE4max vs. BE4max across eight targets on 293T. [Figure 4] Base editing efficiency (i.e., ordinate, in %) of indels generated by hyBE4max vs. BE4max at eight targets on 293T. [Diagram 5]Schematic diagram of the structure of the fusion proteins A3A-BE4max and hyA3A-BE4max, where hA3A is the cytidine deaminase APOBEC3A of human origin (its amino acid sequence is shown in SEQ ID No. 13, and the coding sequence is shown in SEQ ID No. 14), and the NLS, spCas9n and UGI are the same as in FIG. [Figure 6]Comparison of the C-T base editing efficiency (i.e., ordinate, unit is %) achieved by hyA3A-BE4max and A3A-BE4max at eight endogenous targets on 293T. [Figure 7] Comparison of the average C-T base editing efficiency (i.e., ordinate, unit is %) achieved by hyA3A-BE4max and A3A-BE4max at eight endogenous targets on 293T. [Figure 8] Comparison of the base editing efficiency (i.e., ordinate, unit is %) of indels generated by hyA3A-BE4max and A3A-BE4max at eight endogenous targets on 293T. [Figure 9] Schematic diagram of the structure of the fusion proteins eA3A-BE4max and hyeA3A-BE4max. Here, A3A N57G is the N57G mutant of hA3A used in FIG. 5 (its amino acid sequence is shown in SEQ ID No. 15, and the coding sequence is shown in SEQ ID No. 16), and the NLS, spCas9n and UGI are the same as in FIG. 1. [FIG. 10] Comparison of the C-T base editing efficiency (i.e., ordinate, unit is %) achieved by hyeA3A-BE4max and eA3A-BE4max at 11 endogenous targets on 293T. [FIG. 11] Comparison of the average C-T base editing efficiency (i.e., ordinate, unit is %) achieved by hyeA3A-BE4max and eA3A-BE4max at 11 endogenous targets on 293T. [Figure 12] Comparison of base editing efficiency (i.e., ordinate, unit is %) of indels generated by hyeA3A-BE4max and eA3A-BE4max in 11 endogenous targets on 293T. Here, the C on the abscissa and the number following it in Figures 2, 3, 5, 6, and 11 represent the position of the C edited to T on the corresponding target sequence, for example, C5 represents the efficiency of editing the fifth C from the 5' end of the corresponding target sequence to T. [Figure 13] Schematic diagram of hyeA3A-BE4max targeting HBG1 / 2 promoter region -117G. Here, the -117G>A mutation is displayed in red, the core sequence of the transcription factor BCL11A binding site is displayed in a blank box, the PAM sequence is in blue, and the G>A transcription destroys the binding site of the transcription repressor BCL11A and activates the expression of HBG1 / 2 in HUDEP-2 (ΔGγ).[Figure 14] hyeA3A-BE4max, eA3A-BE4max, A3A-BE4max, hyA3A-BE4max are the C-T base editing efficiencies (i.e., ordinate, in %) achieved by targeting the HBG-117G target in HEK293T cells. [Figure 15] Schematic diagram of the construction of lentiviral vectors Lenti-117G-hyA3A-BE4max-P2A-GFP and Lenti-117G-hyeA3A-BE4max-P2A-GFP. Here, the target sequence of sgRNA is HBG-117G. [Figure 16] hyeA3A-BE4max and hyA3A-BE4max are the C-T base editing efficiencies (i.e., ordinate, in %) achieved by targeting the HBG-117G target in HUDEP-2(ΔGγ) cells. [Figure 17] Comparison of globulin mRNA expression after differentiation of HUDEP-2 (ΔGγ) cells between Lenti-117G-hyeA3A-BE4max-P2A-GFP and Lenti-117G-hyA3A-BE4max-P2A-GFP infected with lentivirus. Here, **** indicates the difference significance level P<0.0001. [Figure 18] Schematic diagram of animal model construction in which hyA3A-BE4max targets Duchenne muscular dystrophy (DMD) gene. [Figure 19] Comparison of F0 high-throughput sequencing results generated after microinjection of A3A-BE4max and hyA3A-BE4max. [Figure 20] Average percentage of reads containing TAA stop codon in F0 by injection of A3A-BE4max and hyA3A-BE4max. [Figure 21] Fluorescent immunostaining of the generated F0 mice to detect dystrophin expression. [Figure 22] Germline inheritance of DMD mutant mice (F0→F1). [Figure 23] Off-target analysis of predicted off-target sites of hyA3A-BE4max and DMD-sg3 in the F0 generation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0030] 1. The Rad51DBD (1-114aa) single-stranded DNA binding protein functional domain was fused to BE4max, which significantly improved the editing efficiency. 1.1. Plasmid design and construction 1.1.1. Based on the characteristics of Apobec1, a CBE in single base editing technology, which uses single-stranded DNA as a substrate, we designed 10 different functional domains of non-sequence-preferring single-stranded DNA binding proteins of human origin (mainly RPA70(630aa)-A, RPA70-B, RPA70-AB, RPA70-C, RPA32-D, BRCA2-OB2, BRCA2-OB3, HNRNPK KH domain, PUF60 RRM, and Rad51 DBD) (Table 1). Since the reported fusion proteins tend to be inactive when left at the C-terminus of BE4max (the first figure from the top in Figure 1), we fused these functional domains to the N-terminus of BE4max (the second figure from the top in Figure 1) and simultaneously designed two endogenous targets of human origin, EMX1 site1 and Tim3-sg1 (the sequences are as shown in Table 2).

[0031] 1.1.2. Ten DNA fragments of different functional domains of human non-sequence-preferring single-stranded DNA binding proteins shown in Table 1 were artificially synthesized and then seamlessly cloned into the N-terminus of BE4max in the plasmid pCMV-BE4max (addgene, #112093) to construct ten recombinant plasmids (Figure 1), namely pRPA70-A-BE4max, pRPA70-B-BE4max, pRPA70-AB-BE4max, pRPA70-C-BE4max, pRPA32-D-BE4max, pBRCA2-OB2-BE4max, pBRCA2-OB3-BE4max, pKH-BE4max, pRRM-BE4max, and pRad51DBD-BE4max.

[0032] DNA targeting EMX1 site1 and Tim3-sg1 shown in Table 2 was artificially synthesized and connected to the Bbs I site (sgRNA for expressing the corresponding target) of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP, respectively, to obtain recombinant plasmids pE and pT.

[0033] The plasmids constructed in 1.1.3, 1.1.1 and 1.1.2 were sequenced by sanger to ensure complete accuracy.

[0034] [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0035] [Table 2]

[0036] 1.2 Cell transfection HEK293T 5×10 5 The cells were seeded in a 24-well plate, and when the cells grew to 70%-80%, the plasmid combination was transfected according to pssDBD-BE4max:pE (or pT)=750ng:250ng, and each plasmid combination transfection was performed in triplicate wells, with 2×10 5 At the same time, a blank was set up without transfection of any plasmid.

[0037] pssDBD-BE4max represents any one of the plasmids pRPA70-A-BE4max, pRPA70-B-BE4max, pRPA70-AB-BE4max, pRPA70-C-BE4max, pRPA32-D-BE4max, pBRCA2-OB2-BE4max, pBRCA2-OB3-BE4max, pKH-BE4max, pRRM-BE4max, and pRad51DBD-BE4max, with the plasmid pCMV-BE4max serving as a negative control.

[0038] 1.3. Genomic Extraction and Preparation of Amplified Sublibraries 72 hours after transfection, the cell genomic DNA was extracted with the Tengen Cell Genome Extraction Kit (DP304).Then, using the operation process of the Hitom Kit, the corresponding identification primers (Table 3) were designed, that is, the forward identification primer was added with the bridging sequence 5'-ggagtgagtacggtgtgc-3' at the 5' end, and the reverse identification primer was added with the bridging sequence 5'-gagttggatgctggatgg-3' at the 5' end to obtain the PCR product, and then the first-round PCR product was used as the template to perform two-round PCR, which was then mixed and gel extracted and purified, and sent to the company for deep sequencing.

[0039] [Table 3]

[0040] 1.4. Deep sequencing results analysis and statistics The deep sequencing results of step 1.3 were analyzed using the BE-analyzer site, and the proportions of C-T and Indels were statistically calculated. The results are shown in Tables 4 and 5. As shown in the results, compared to BE4max, BE4max fused with the functional domain of Rad51 single-stranded DNA binding protein (Rad51DBD-N-BE4max or Rad51DBD-BE4max) had the most significant improvement in editing efficiency for C to T on the target, followed by BE4max fused with the functional domain of RPA70-C single-stranded DNA binding protein.

[0041] 2. Optimize the editing efficiency of hyBE4max To further test the fusion position of the Rad51 single-stranded DNA binding protein functional domain that maximizes the editing efficiency of C to T on the target in step 1, Rad51 DBD was fused to two other different positions of BE4max, and BE4max fused with Rad51 DBD (Figures 3 to 5 from the top in Figure 1) was transfected with the recombinant plasmid pE or pT and the three recombinant plasmids according to the method in 1.2 in step 1, and the editing efficiency results were obtained according to the methods in 1.3 and 1.4 in step 1 (Tables 4 and 5).

[0042] The three BE4max fused with Rad51 DBD shown in the third to fifth figures from the top of Figure 1 are as follows: Rad51DBD-N-BE4max: Rad51 DBD is fused between the NLS and rA1 in BE4max, i.e., Rad51 DBD is located between rA1 and the N-terminus of spCas9n; Rad51DBD-C-BE4max: Rad51 DBD is fused between spCas9n and UGI in BE4max, i.e., Rad51 DBD is located at the C-terminus of rA1 and spCas9n; hyBE4max: BE4max fuses the Rad51 DBD between rA1 and spCas9n.

[0043] [Table 4]

[0044] [Table 5]

[0045] As shown in the results in Tables 4 and 5, fusing Rad51 DBD between rA1 and spCas9n in BE4max (i.e., hyBE4max) showed the most significant improvement in editing efficiency for C to T on the target compared to fusing Rad51 DBD between NLS and rA1 in BE4max (i.e., Rad51DBD-N-BE4max).

[0046] 3. Operating characteristics of hyBE4max To more fairly describe the operational characteristics of hyBE4max, other six additional targets VEGFA site2, Lag3-sg2, HEK3, HEK4, EMX1-sg2p, Nme1-sg1 (sequences are as shown in Table 2) were designed and connected to the BbsI site of plasmid U6-sgRNA-EF1α-GFP to obtain recombinant plasmids pV, pL, pH3, pH4, pEP and pN. The plasmids were sequenced by sanger to ensure complete accuracy.

[0047] In step 2, recombinant plasmids containing hyBE4max were transfected into cells with recombinant plasmids pE, pT, pV, pL, pH3, pH4, pEP or pN according to the method in 1.2 in step 1, respectively, and the results of editing efficiency were obtained according to the methods in 1.3 and 1.4 in step 1, and statistically plotted using GraphPad Prism 8.0.

[0048] The results are shown in Figures 2 and 3. In the editing window C3-C8, the C-T editing efficiency of hyBE4max was 19-71%, and the corresponding BE4max was 13-47%. In the editing window C9-C12, the C-T editing efficiency of hyBE4max was 19-55%, and the corresponding BE4max was 1.4-17%. Relative to BE4max, within the editing window C3-C8, the hyBE4max average C-T editing efficiency was 1.6-2.2 times that of BE4max, and within the editing window C9-C12, the hyBE4max average C-T editing efficiency was 3.3-17 times that of BE4max. At the same time, hyBE4max maintains a relatively low indels generation (Figure 4).

[0049] 4. Effects of fusion proteins containing different cytidine deaminases (1) Functional characteristics of the fusion protein hyA3A-BE4max 4.1.1, Rad51-DBD was synthesized according to the coding sequence in Table 1, and then seamless cloning was performed to assemble it between hA3A and spCas9n in the plasmid pCMV-A3A-BE4max to express the fusion protein A3A-BE4max (Figure 5), to construct the recombinant plasmid pA expressing the fusion protein hyA3A-BE4max (Figure 5).

[0050] 4.1.2. Eight types of human endogenous targets were sequentially synthesized. The target sequences of EMX1 site1, Tim3-sg1, VEGFA site2, EMX1-sg2p, and Nme1-sg1 are shown in Table 2. The target sequences of FANCF site1, EGFR-sg5, and EGFR-sg21 are shown in Table 6. They were respectively connected to the Bbs I site of the sgRNA expression plasmid pU6-sgRNA-EF1α-GFP to obtain the recombinant plasmids pB1, pB2, ... pB8 of sgRNA expressing the corresponding targets.

[0051] The plasmids constructed in 4.1.3, 4.1.1 and 4.1.2 were sequenced by sanger to ensure complete accuracy.

[0052] [Table 6]

[0053] 4.1.4 Cell transfection 5×10 5 10 HEK293T cells were seeded in a 24-well plate, and when the cells grew to 70%-80%, transfection with the plasmid combination was performed according to pA (or plasmid pCMV-A3A-BE4max):pB1 (or pB2, pB3, … pB8) = 750ng:250ng, each plasmid combination transfection was performed in triplicate wells, 2 × 10 each well. 5 At the same time, a blank was set up without transfection of any plasmid.

[0054] 4.1.5. Genomic Extraction and Preparation of Amplified Sublibraries Follow the method of step 1.3, where the target identification primers for FANCF site1, EGFR-sg5, and EGFR-sg21 are shown in Table 7, and the remaining expression identification primers are shown in Table 3.

[0055] [Table 7]

[0056] 4.1.6. Deep sequencing results analysis and statistics Follow the procedure in step 1.4. As shown in the results, the editing efficiency of the fusion protein hyA3A-BE4max for single bases C to T at different positions (C3-C15) of each target was obviously improved compared to the protein A3A-BE4max (Figure 6). The high activity window of hyA3A-BE4max was expanded from the original C3-C11 to C3-C15 for A3A-BE4max, where the editing efficiency of hyA3A-BE4max for single bases C to T was 1.1-2.3 times that of A3A-BE4max at C3-C11, far from the PAM region, and the editing efficiency of hyA3A-BE4max for single bases C to T was 3.1-4.1 times that of A3A-BE4max at C12-C15, close to the PAM region, i.e., the improvement of the editing efficiency of hyA3A-BE4max for single bases C to T was more significant at C12-C15, close to the PAM region (Figure 7). At the same time, hyA3A-BE4max maintained a relatively low number of indels (Figure 8).

[0057] (2) Functional characteristics of the fusion protein hyeA3A-BE4max 4.2.1. Construction of activator plasmid Rad51-DBD was synthesized according to the coding sequence in Table 1, and then seamless cloning was performed to assemble it between eA3A and spCas9n in the plasmid pCMV-eA3A-BE4max to express the fusion protein eA3A-BE4max (Figure 9), to construct the recombinant plasmid pAe expressing the fusion protein hyeA3A-BE4max (Figure 9).

[0058] 4.2.2. Construction of target plasmid Eleven endogenous targets of human origin were simultaneously designed and synthesized. The target sequences of EMX1-sg2p, EMX1 site1, and Nme1-sg1 are shown in Table 2, the target sequence of EGFR-sg21 is shown in Table 6, and the remaining target sequences are shown in Table 8. They were respectively connected to the BbsI site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP and used to express the sgRNA of the corresponding targets, to obtain recombinant plasmids pC1, pC2, ... pC11.

[0059] The plasmids constructed in 4.2.3, 4.2.1 and 4.2.2 were sequenced by sanger to ensure complete accuracy.

[0060] [Table 8]

[0061] 4.2.4 Cell transfection - validation of hyeA3A-BE4max working line 5×10 5 Seed HEK293T cells in a 24-well plate, and when the cells grow to 70%-80%, transfect the plasmid combination according to pA (or plasmid pCMV-eA3A-BE4max):pC1 (or pC2, pC3, … pC11) = 750ng:250ng, each plasmid combination transfection is done in triplicate wells, 2 × 10 each well 5 At the same time, a blank was set up without transfection of any plasmid.

[0062] 4.2.5. Genomic Extraction and Preparation of Amplified Sublibraries The method was carried out according to step 1.3, where the identification primers for EMX1-sg2p, EMX1 site1, and Nme1-sg1 are shown in Table 3, the identification primers for EGFR-sg21 are shown in Table 7, and the remaining target sequences are shown in Table 9.

[0063] [Table 9]

[0064] 4.2.6 Deep sequencing results analysis and statistics Follow the procedure in step 1.4. As shown in the results, compared with protein eA3A-BE4max, the editing efficiency of the fusion protein hyeA3A-BE4max for single bases C to T at different positions (C3-C15) of each target was significantly improved, and the high activity window was expanded from the original C3-C11 to C3-C15, which can specifically target the single base C in the TC motif to realize the conversion of C to T (Figure 10). Here, in C3-C11, far from the PAM region, the editing efficiency of hyeA3A-BE4max for single bases C to T was 1.6-2.8 times that of eA3A-BE4max, and in C12-C15, close to the PAM region, the editing efficiency of hyeA3A-BE4max for single bases C to T was 4.5-31.9 times that of eA3A-BE4max, that is, in C12-C15, close to the PAM region, the improvement in the editing efficiency of hyeA3A-BE4max for single bases C to T was more significant (Figure 11). At the same time, hyeA3A-BE4max maintains relatively low indels (Figure 12).

[0065] 5. Gene therapy using the fusion protein hyeA3A-BE4max 5.1. Testing the editing efficiency of hyeA3A-BE4max targeting the HBG-117G site in HEK293T cells According to the cell transfection method in 4.2.4, HEK293T cells were transfected with the plasmid combination pA (or plasmid pCMV-A3A-BE4max, or pAe, or pCMV-eA3A-BE4max):pC12 = 750 ng:250 ng, and deep sequencing and statistical analysis were performed according to the method in 4.2.6.

[0066] The construction method of the above recombinant plasmid pC12 is as follows: the sgRNA target sequence of HBG-117G (GGCTATTGGTCAAGGCAAGGCTGG, SEQ ID No. 35) was ligated into the BbsI site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP, which was used to express the corresponding target sgRNA, to obtain the recombinant plasmid pC12.

[0067] The identification primers used for the above deep sequencing target HBG-117G are as follows: HBG-117G F:AGTGAGTACGGTGTGCTGGAATGACTGAATCGGAACAAGGC, HBG-117G R:GTTGGATGCTGGATGGCTGGCCTCACTGGATACTCTAAGACT.

[0068] Results: As shown in Figure 14, A3A-BE4max can target the -117G>A (C11) mutation in the HBG1 / 2 promoter region, as well as produce -109G>A (C3), -122G>A (C16) "bystander" mutations. In the case of eA3A-BE4max and hyeA3A-BE4max, eA3A-BE4max does not precisely edit the G to A conversion (i.e., complementary strand C to T conversion) on -117 to cause "bystander" mutations, but the efficiency is very low. Compared with eA3A-BE4max, hyeA3A-BE4max improves the G to A conversion efficiency by 6.6 times, and no detectable "bystander" mutations are generated at -109 and -122. As shown in the results, hyeA3A-BE4max showed the property of precisely and efficiently targeting the HBG1 / 2 promoter region -117G (a summary of the mechanism of action is shown in Figure 13).

[0069] 5.2. Construction of lentiviral vectors and viral packaging 5.2.1 Construction of lentiviral vectors pLenti-BE3-P2A-Puro (Addgene, #110838) was used as the backbone vector, and the coding sequence of hyA3A-BE4max was replaced with BE3 on the backbone vector via seamless cloning to obtain the lentiviral vector Lenti-hyA3A-BE4max-P2A-GFP.

[0070] pLenti-BE3-P2A-Puro (Addgene, #110838) was used as the backbone vector, and the coding sequence of hyeA3A-BE4max was replaced with BE3 on the backbone vector via seamless cloning to obtain the lentiviral vector Lenti-hyeA3A-BE4max-P2A-GFP.

[0071] The HBG-117G target sequence in 5.2 was connected upstream of the above two lentiviral vectors hyA3A-BE4max or hyeA3A-BE4max (upper panel of Figure 15), respectively, to obtain the recombinant plasmid Lenti-117G-hyA3A-BE4max-P2A-GFP and the recombinant plasmid Lenti-117G hyeA3A-BE4max-P2A-GFP (lower panel of Figure 15).

[0072] 5.2.2 Lentiviral packaging 5.2.2.1 Transfection On day 1, HEK293T cells in good growth condition were digested and seeded on 10 cm dishes, about 30 dishes per virus. On day 2, when the confluency reached 80%-90%, plasmid transfection was performed with Lenti-117G-hyA3A-BE4max-P2A-GFP (or Lenti-117G-hyeA3A-BE4max-P2A-GFP):PSPAX2:PMD2.G=10ug:10ug:10ug.

[0073] 5.2.2.2 Virus collection and purification The virus supernatant was collected from HEK293T cell supernatant 48 h after transfection (transfection can be calculated as 0 h) and 72 h after transfection. After centrifugation at 4000g at 4°C for 10 min to remove cell debris, the supernatant was filtered into a 40 mL ultrafiltration centrifuge tube with a 0.45 μm filter, and the lentivirus crude extract was added to the filtration cup and centrifuged at 25000g at 4°C for 2.5 hours. After centrifugation, the centrifuge device was removed and the filtration cup and the filtrate collection cup below were separated. The liquid in the sample collection cup is the virus concentrate (containing lentivirus Lenti-117G-hyA3A-BE4max-P2A-GFP or lentivirus Lenti-117G-hyeA3A-BE4max-P2A-GFP). The virus concentrate was transferred and stored in a virus tube after dispensing, and stored at -80°C for a long period of time.

[0074] 5.3. Gene therapy 5.3.1, HUDEP-2 (Δ G γ) Cell-infecting viruses 5 x 10 in a 96-well plate 4 HUDEP-2 (Δ G γ) Cells were seeded in triplicate wells, and the culture medium in a total volume of 100ul was infected with the lentiviruses Lenti-117G-hyA3A-BE4max-P2A-GFP and Lenti-117G-hyeA3A-BE4max-P2A-GFP at equal titers, respectively, with the infection system as follows: [Table 9-2]

[0075] 5.3.2 Editing Efficiency Detection HUDEP-2(Δ G γ) GFP-positive cells were selected by flow cytometry, and the cell count was 5 × 10 4After culturing until larger, the cells were harvested, genomic DNA was extracted, and deep sequencing and analysis were performed according to the method in step 5.1.

[0076] Results: Compared to hyA3A-BE4max, hyeA3A-BE4max was significantly higher than HUDEP-2 (Δ G γ) cells and showed higher activity (Figure 16).

[0077] 5.3.3 Detection of Differentiation and Gamma Globulin Expression HUDEP-2(Δ G γ) GFP-positive cells were selected by flow cytometry, and the cell count was 5 × 10 4 After culturing for about 5-7 days, HUDEP-2(Δ G γ) cells were collected and subjected to differentiation expression. The differentiation process was as follows: After counting, 1 x 10 5 HUDEP-2(Δ G γ) cells were differentiated in erythroid differentiation medium (IMDM) supplemented with 2% human blood type AB plasma (serum) (Gemini, 100-512), 1% L-glutamine, 2 IU / mL heparin, erythropoietin (EPO, 3 IU / ml, PeproTech), 330 μg / mL Holo-human transferrin (Sigma-Aldrich), human stem cell factor (SCF, 50 ng / ml, PeproTech), 2% Pen / Strep (Gibco), and 10 μg / ml recombinant human insulin for 8 days.

[0078] Gamma globulin expression detection: After differentiation for 8 days, cells were harvested and total mRNA was extracted by phenol-chloroform extraction method. The isolated mRNA was reverse transcribed with HiScript II Q RT SuperMix (Vazyme) and qPCR was performed on QuantiStudio 3 real-time PCR system (ABI), and quantification was performed for HBG and HBB mRNA via SYBRGreen qPCR. The primers (5'-3') were as follows: HBG-QPCR-F:GGTTATCAATAAGCTCCTAGTCC, HBG-QPCR-R:ACAACCAGGAGCCTTCCCA, HBB-QPCR-F:TGAGGAGAAGTCTGCCGTTAC, HBB-QPCR-F:ACCACCAGCAGCCTGCCCA.

[0079] Result: HUDEP-2(Δ G Compared with WT cells of HUDEP-2 (Δγ), hyA3A-BE4max and hyeA3A-BE4max showed G hyeA3A-BE4max can significantly increase the level of γ-globulin mRNA in HUDEP-2(Δγ) cells. G The degree of increase in the level of γ-globulin mRNA in hyA3A-BE4max cells was three-fold higher than that of hyA3A-BE4max (FIG. 17).

[0080] 6. Construction of DMD disease animal model using fusion protein hyA3A-BE4max The mice used below are C57 / BL6 mice.

[0081] 6.1. Construction of operative mRNA and target sgRNA transcription templates The mouse relevant gene sequence was downloaded from NCBI, and sgRNA (DMD-sg3 target sequence: ACATCTCATCAAGGACTTGTTGG, SEQ ID No. 36) was designed at the target site (dystrophin gene, i.e., the rectangular frame site in the 12th exon of the DMD gene) as shown in Figure 18. Oligo primers were ordered, and the sgRNA formed by annealing was cloned into the T7 vector backbone. The DMD-sg3 template containing the T7 promoter was amplified by in vitro transcription (IVT) using the primer pair IVT-PCR-F and IVT-PCR-R (Table 10). The T7 promoter was introduced into the mRNA template of hyA3A-BE4max or A3A-BE4max by PCR using the primer pair IVT-T7-hyA3A-BE4max-F and IVT-T7-hyA3A-BE4max-R (Table 10).

[0082] [Table 10]

[0083] 6.2. In vitro transcription of sgRNA (DMD-sg3) The PCR product from 6.1 was purified using a standard DNA product purification kit, and the purified PCR product was used as a linearized DNA template for in vitro transcription using a T7 in vitro transcription kit (MEGAshortscriptTM Kit). The transcribed sgRNA was purified by lithium chloride precipitation.

[0084] 6.3. Transcription of agonist mRNA (A3A-BE4max and hyA3A-BE4max) The T7 templates of A3A-BE4max and hyA3A-BE4max were in vitro transcribed using an in vitro RNA transcription kit (mMESSAGE mMACHINE® T7 Ultra Kit) to obtain working mRNA, which was then purified.

[0085] 6.4 Preparation of the microinjection mixture The injection mixture was prepared with nuclease-free water to obtain a total volume of 20 μL, a mixture of agonist mRNA (mRNA containing A3A-BE4max or mRNA containing hyA3A-BE4max) at a final concentration of 100 ng / μL and sgRNA (DMD-sg3) at a final concentration of 200 ng / μL.

[0086] 6.5. Collection of one-cell embryos (1) Day 1: 100 μL (5 IU) of PMSG working solution was intraperitoneally injected into 6-8 week-old donor mother mice between 1-2 pm. (2) Day 3: 100μL (5IU) of hCG working solution was intraperitoneally injected into PMSG-treated mother mice between 2pm and 4pm, and after administration, the hormone-treated mother mice were housed one-to-one with 10-14 week-old male mice. At the same time, non-hormonally treated female mice were mated with oviduct-ligated male mice at around 4pm during the estrus period to prepare pseudo-pregnant mother mice. (3) Day 4: Before 9 a.m., the recipient mice caged with the ligated male mice were checked for the presence or absence of pregnancy plugs, and the recipient mice with pregnancy plugs were concentrated in a new cage and used for the embryo transfer experiment in the afternoon. (4) Superovulated donor mice were sacrificed by carbon dioxide asphyxiation, and the oviducts were removed and placed in a petri dish, to which pre-warmed M2 medium was added. (5) The oviduct was placed in a new petri dish, and pre-heated M2 medium and hyaluronic acid were added to the petri dish, with a volume ratio of M2 medium to hyaluronic acid of 9:1. Under a stereomicroscope, the ampulla of the oviduct was pulled with forceps, and the embryo was released from the oviduct into the petri dish. The embryo was constantly incubated in M2 medium containing hyaluronic acid until the cumulus cells fell off. After removing the cumulus cells, the embryo was transferred to a new petri dish, M2 medium without hyaluronic acid was added to the petri dish, and the embryo was repeatedly washed with M2 medium to thoroughly wash off both the hyaluronic acid and the cumulus cells. (6) The cleaned embryos were transferred to a new dish, and a few drops of KSOM medium were first dispersed in the dish, and then mineral oil was gradually added to the dish, so that the KSOM medium was separated and covered with mineral oil. Generally, 6 spots of KSOM medium could be added to a 35 mm dish, and each spot was 50 μL. A set of 50 embryos was first placed in the central KSOM medium spot, washed, and then transferred to one new medium spot. Before microinjection, the extracted embryos were incubated in M2 medium in a cell culture box.

[0087] 6.6 Microinjection and Embryo Transfer (1) A fixing needle, an injection needle, and a silicided glass slide were prepared, and one drop of M2 medium covered with mineral oil was placed on the center of the slide. (2) The injection needle was automatically drawn in by capillary action and filled with the microinjection mixture prepared in step 2.4, and the injection needle was mounted on the fixed handle of the microinjector. (3) 50 embryos were transferred to M2 medium on a slide glass, and the needle was moved close to the embryos, and the embryos were fixed to the needle by negative pressure. After the embryos were fixed, the cytoplasm was found under a high-power microscope, and the tip of the injection needle was pushed to penetrate the transparent belt and cell membrane, and the mixture was injected into the cytoplasm of the embryos. (4) The injected embryo cells were transferred to a new M2 medium. Steps (3) and (4) were repeated until all embryos were injected. After one experimental group was injected, the embryos were transferred to a new KSOM medium, and the embryos were placed in a cell culture box and cultured for 1-2 hours or overnight. After all embryos were injected, the dead embryos due to mechanical force injury were eliminated, and the healthy embryos were transferred to a new KSOM medium. (5) 600 μL of avertin was intraperitoneally injected into the pseudopregnant mother mouse, and the pseudopregnant mother mouse was anesthetized. The hair on the back of the mother mouse was shaved using a hair shaver. After shaving, the skin was wiped with 70% ethanol. (6) A small opening was cut into the ovary, and the ovary fat pad was pulled out with blunt forceps. At the same time, the ovary was fixed outward with a hemostat, and the infundibulum of the fallopian tube, located below the ovary, was found using blunt forceps. (7) M2 medium, two small air bubbles, and approximately 15 embryos were sequentially aspirated into the transfer needle, and the air bubbles made it easier to observe the position of the embryos in the transfer needle. (8) The ovarian cyst was gently cut open, the infundibulum of the ovary was positioned with the shaft, the transfer needle was extended to the opening of the ovary, the embryo inside the transfer needle was then ejected, and the transfer needle was gently retracted. (9) The hemostatic forceps fixing the ovarian fat pad were released, the ovary was returned to its original cavity, and the muscle opening and skin opening were sutured together. (10) After surgery, the mice were placed on a 37°C incubator and allowed to recover. After that, they were transferred to a cage and kept there until the embryos were allowed to develop. Generally, mother mice with successful transplants give birth to baby mice after 3 weeks.

[0088] 6.7. Mouse genome identification Take the 10-15 day old mice produced in step 6.6, cut off their toes and perform genome identification. The specific steps are as follows: 6.7.1 Genome extraction (1) The toes were placed into 1.5 mL centrifuge tubes, and 500 μL of toe digestion fluid prepared in a ratio of proteinase K:tissue lysis solution = 1:500 was added to each tube, followed by overnight water bath at 55°C. (2) The toes that had been digested overnight were removed, left at room temperature for 10-15 minutes, thoroughly mixed uniformly by inversion, and centrifuged at 13,000 rpm for 15 minutes. (3) 400 μL of the supernatant was aspirated from each tube, and an equal volume of chloroform was added. The mixture was thoroughly mixed until DNA was precipitated, and then centrifuged at 12,000 rpm for 10 minutes. (4) Add 200 μL of 75% alcohol that had been pre-cooled in a -20°C refrigerator to each tube, mix gently to homogenize, and then centrifuge at 12,000 rpm at 4°C for 5 minutes. Discard the supernatant and dry on a clean work bench. (5) Depending on the amount of DNA, add 50 to 100 μL of deionized ultrapure water and dissolve at 55°C for 2 hours to prepare a PCR template. 6.7.2 Genome Identification The primer pair F / R (Table 11) of target DMA-sg3 was used to obtain DNA fragments containing the target, and the appearance of double peaks was confirmed by first generation sequencing, and then high-throughput deep sequencing was performed to obtain the editing efficiency. According to the high-throughput results, among the 10 F0 mice with mutations in the hyA3A-BE4max treatment group, there were 6 homozygous CAA to TAA stop nonsense mutations (mice numbered #BD03, #BD05, #BD07, #BD12, #BD15, and #BD16 in the lower panel of Figure 19), while no CAA to TAA stop nonsense mutations were found among the F0 mice in the A3A-BE4max treatment group (upper panel of Figure 19). The percentage of reads (high-throughput sequencing fragments) containing the stop codon TAA in the homozygous mutation in the hyA3A-BE4max-treated mice was higher than that in the A3A-BE4max-treated mice (Figure 20).

[0089] [Table 11]

[0090] 6.8. Phenotypic identification of DMD genes Five-week-old wild-type mice (blank) and DMD gene mutant mice identified in 2.7.2 were collected and subjected to immunohistochemical detection according to the following method. The tibialis anterior muscle of a mouse was collected and washed with alcohol and PBS. It was placed in a small square box lined with OTC glue, placed in an isobenthan beaker, frozen in liquid nitrogen, removed after about 30 s, stored at -20°C, and then cryosectioned. The prepared section was washed with PBST 3 times / 5 min, oil rings were drawn according to the tissue position, blocking was added with blocking solution, and after blocking for 1 h, it was incubated overnight with laminin primary antibody or dystrophin primary antibody (primary antibody rabbit polyclonal antibody (Abcam, ab11575) or primary antibody rabbit polyclonal antibody (Abcam, ab15277) diluted at 1:500). The sections were washed 3 times for 5 min with PBST, then incubated with secondary antibody in 1:1000 rabbit antibody dilution for 2 h, washed 3 times for 5 min with PBST, added DAPI diluted 1:100 and incubated for 10 min, washed 3 times for 5 min with PBST, dripped with anti-quenching agent, added a cover glass, sealed with nail polish, and finally observed the fluorescence of the sections using a fluorescence microscope.

[0091] As shown in the results, compared with WT (+ / +) and A3A-BE4max-treated mice (e.g., #AD26), only DMD among six F0 generation mice (e.g., #BD03 in Figure 21) that had a homozygous nonsense mutation at position 10 of the DMA-sg3 target sequence in the hyA3A-BE4max-treated mice did not show protein expression (Figure 21), which also demonstrated the successful establishment of a DMD animal disease model.

[0092] According to the fluorescence observation results, a summary of the F0 generation mice generated after hyA3A-BE4max and A3A-BE4max editing was obtained at the same time, and the summary is shown in Table 12. [Table 12]

[0093] 6.9. Germline genetic analysis of DMD mutant mice (F0→F1) #BD12 (F0), a female homozygous DMD phenotype, was crossed with a male wild-type mouse to obtain eight homozygous F1 offspring. The genotypes of the F1 offspring were identified, and the Sanger sequencing results showed that the reads frequency of nonsense mutations per F1 was more than 96%, indicating that such nonsense mutations can be stably inherited in the F1 generation (Figure 22).

[0094] 6.10. Off-target detection The off-target primers (Table 13) were designed using the Cas-OFFinder function on the CRISPR RGEN Tools site (http: / / www.rgenome.net). First, select the PAM type of the test tool and the type of the species to be tested (e.g., Mus musculus (mm10)-Mouse for mouse), enter the PAM-removed portion of the designed sgRNA sequence in the blank space of Query Sequences, select no more than 3 mismatch bases, and set the formed DNA Bulge Size to within 1, and then submit to obtain the corresponding off-target primers.

[0095] Using the above off-target primers, PCR was performed on F0 mouse genomic DNA edited with hyA3A-BE4max (WT was used as blank), and the products were then subjected to high-throughput deep sequencing to obtain the off-target efficiency results (Figure 23).

[0096] [Table 13]

[0097] As shown in the results in Figure 23, compared to the blank, the fusion proteins hyA3A-BE4max and DMD-sg3 hardly cause C to T editing at sites similar to the 15 DMD-sg3 targets in Table 13 (i.e., off-target sites), i.e., the fusion proteins hyA3A-BE4max and DMD-sg3 of the present application hardly cause off-target effects. Exemplary embodiments of the present invention are described below. <1> A fusion protein that improves genome editing efficiency, the fusion protein comprising a single-stranded DNA binding protein functional domain, a nucleoside deaminase and a nuclease. <2> The connection order of the fusion protein is characterized in that the nucleoside deaminase is located at the N-terminus or C-terminus of the nuclease, and the single-stranded DNA binding protein functional domain is located between the nucleoside deaminase and the N-terminus or C-terminus of the nuclease and / or between the nucleoside deaminase and the nuclease. <1> A fusion protein according to claim 1. <3> The nucleoside deaminase is located at the N-terminus of the nuclease. <2> A fusion protein according to claim 1. <4> the single-stranded DNA binding protein functional domain is located between the nucleoside deaminase and the nuclease. <3> A fusion protein according to claim 1. <5> The single-stranded DNA binding protein is characterized in that it includes a sequence-specific single-stranded DNA binding protein and / or a non-sequence-specific single-stranded DNA binding protein. <1> A fusion protein according to claim 1. <6> The non-sequence-specific single-stranded DNA binding protein is selected from any one or more of RPA70, RPA32, BRCA2, hnRNPK, PUF60, and Rad51; The sequence-specific single-stranded DNA binding protein is selected from any one or more of TEBP, Teb1, and POT1. <5> A fusion protein according to claim 1. <7> The functional domain of the single-stranded DNA-binding protein includes at least one of the four domains of the single-stranded DNA-binding protein, namely, the OB fold, the KH domain, the RRMS, and the spiral domain, or a partial polypeptide fragment of the four domains having a function of binding to single-stranded DNA, and any combination thereof. <5> A fusion protein according to claim 1. <8> The single-stranded DNA binding protein functional domain comprises a DNA binding domain of Rad51 and / or a DNA binding domain of RPA70. <5> A fusion protein according to claim 1. <9> The amino acid sequence of the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID NO:1, and / or the coding sequence of the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID NO: 2. <8> A fusion protein according to claim 1. <10> The amino acid sequence of the DNA binding domain of RPA70 comprises the sequence shown in SEQ ID NO: 11, and / or the coding sequence of the DNA binding domain of RPA70 comprises the sequence shown in SEQ ID NO: 12. <8> A fusion protein according to claim 1. <11> (missing) <12> The deaminase is characterized in that it includes cytidine deaminase and / or adenosine deaminase. <1> A fusion protein according to claim 1. <13> The cytidine deaminase is characterized in that it includes rat-derived cytidine deaminase. <12> A fusion protein according to claim 1. <14> The amino acid sequence of the rat-derived cytidine deaminase comprises the sequence shown in SEQ ID NO:3, and / or the coding sequence of the rat-derived cytidine deaminase comprises the sequence shown in SEQ ID NO: 4. <13> A fusion protein according to claim 1. <15> The cytidine deaminase is characterized in that it includes human cytidine deaminase APOBEC3A. <12> A fusion protein according to claim 1. <16> The amino acid sequence of the human cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 13, and / or the coding sequence of the human cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 14. <15> A fusion protein according to claim 1. <17> The cytidine deaminase includes a mutant of cytidine deaminase APOBEC3A, and the mutant is characterized in that asparagine at position 57 of the cytidine deaminase APOBEC3A is mutated to glycine. <12> A fusion protein according to claim 1. <18> The cytidine deaminase APOBEC3A is characterized in that it is derived from a human. <17> A fusion protein according to claim 1. <19> The amino acid sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 13, and / or the coding sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 14. <18> A fusion protein according to claim 1. <20> The amino acid sequence of the cytidine deaminase APOBEC3A mutant comprises the sequence set forth in SEQ ID NO: 15, and / or the coding sequence of the cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 16. <17> A fusion protein according to claim 1. <21> The nuclease is selected from one or more of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1. <1> A fusion protein according to claim 1. <22> The nuclease is Cas9. <21> A fusion protein according to claim 1. <23> The Cas9 is selected from Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, or Streptococcus thermophilus. <22> A fusion protein according to claim 1. <24> The Cas9 is selected from the Cas9 mutants VQR-spCas9, VRER-spCas9, or spCas9n. <22> A fusion protein according to claim 1. <25> The amino acid sequence of the spCas9n comprises the sequence shown in SEQ ID NO:5, and / or the coding sequence of the spCas9n comprises the sequence shown in SEQ ID NO:6. <24> A fusion protein according to claim 1. <26> The fusion protein further comprises a NLS. <1> A fusion protein according to claim 1. <27> the NLS is located at least at one end of the fusion protein. <26> A fusion protein according to claim 1. <28> The amino acid sequence of the NLS comprises the sequence shown in SEQ ID NO:7, and / or the coding sequence of the NLS comprises the sequence shown in SEQ ID NO:8. <26> A fusion protein according to claim 1. <29> The fusion protein further comprises two or more copies of UGI. <1> A fusion protein according to claim 1. <30> The UGI is located at least at one end of the fusion protein. <29> A fusion protein according to claim 1. <31> The amino acid sequence of the UGI comprises the sequence set forth in SEQ ID NO:9, and / or the coding sequence of the UGI comprises the sequence shown in SEQ ID NO: 10. <29> A fusion protein according to claim 1. <32> A) <1> ~ <31> A gene encoding the fusion protein according to any one of the above. B) A recombinant vector containing the gene according to A). C) <1> ~ <31> Any one of A) to C) recombinant cells or recombinant biological materials containing a fusion protein described in any one of A) to C) or a gene described in A). <33> the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell. <32> The biomaterial described in <34> An sgRNA that performs genome editing on a target gene in a cell, characterized in that the target sequence of the sgRNA includes at least one of SEQ ID NOs: 17 to 36. <35> the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell. <34> The sgRNA described in. <36> The target genes are HBG1 and HBG2 promoter regions. <34> The sgRNA described in. <37> A single base genome editing system, comprising: <1> ~ <31> and / or <32> or <33> and a sgRNA that induces single-base genome editing on a target gene in a target cell, wherein the fusion protein comprises the biomaterial described in the above. <38> The target sequence of the sgRNA includes at least one of SEQ ID NOs: 17 to 36; and / or the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell; and / or the target gene is the HBG1 and HBG2 promoter regions. <37> A single base genome editing system as described in. <39> In the production of genome-edited products, disease treatment and / or prevention products, animal models, or new plant varieties; <1> ~ <31> The fusion protein according to any one of the preceding claims. <32> or <33> The biomaterial according to <34> ~ <36> or <37> or <38> Use of the single base genome editing system described in. <40> The disease is a beta hemoglobinopathy, the beta hemoglobinopathy including beta thalassemia and / or sickle cell anemia. <39> The application described in. <41> <1> ~ <31> 2. A method for improving single-base genome editing efficiency, comprising the step of introducing a fusion protein described in any one of claims 1 to 10 into a cell and performing genome editing on a target gene, wherein the sgRNA induces the fusion protein to perform single-base genome editing on the target gene. <42> The target sequence of the sgRNA includes at least one of SEQ ID NOs: 17 to 36; and / or the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell; and / or the target gene is the HBG1 and HBG2 promoter regions. <41> The method described above. <43> <1> ~ <31> A method for constructing a disease animal model, comprising a step of introducing a fusion protein described in any one of the above and an sgRNA into an animal cell and performing genome editing on a target gene. <44> The target sequence of the sgRNA includes at least one of SEQ ID NOs: 17 to 36. <43> The method described above. <45> The target sequence of the sgRNA comprises the sequence shown in SEQ ID NO: 36, and the target gene comprises the DMD gene. <44> The method described above. <46> the animal is a mammal; and / or the cell is an embryonic cell, and / or the mode of introduction is one or any combination of vector transformation, microinjection, transfection, liposome transfection, heat shock, electroporation, transduction, gene gun, DEAE-glucan mediated transfer; And / or, the introduction <1> ~ <31> The method is characterized in that the method is carried out using the mRNA of the fusion protein according to any one of the above and the sgRNA. <43> The method described above. <47> the mammal is a rat or a mouse, and / or, if the method of introduction is microinjection, the <1> ~ <31> The concentration of the mRNA of the fusion protein according to any one of the above items is 1 to 1000 ng / μL. <46> The method described above. <48> Used in the above introduction <1> ~ <31> 1. The concentration ratio of the mRNA of the fusion protein according to any one of claims 1 to 1:(5 to 1) <47> The method described above. <49> In drug screening, disease treatment effect evaluation, or disease treatment mechanism research, <43> ~ <48> 2. Use of an animal model obtained by the method according to any one of claims 1 to 11. <50> 1. A product for treating and / or preventing beta hemoglobinopathies, said product comprising: <32> The gene in A) and a delivery vector for sgRNA, The product, wherein the sgRNA induces the fusion protein to perform single-base genome editing on a target gene in a target cell, and the target gene is the HBG1 and HBG2 promoter regions. <51> The target sequence of the sgRNA comprises the sequence shown in SEQ ID NO: 35, and / or the beta hemoglobinopathy comprises beta thalassemia and / or sickle cell anemia, and / or the cell is a T cell, a hematopoietic stem cell, a bone marrow cell, an erythroid cell, or an erythroid progenitor cell. <50> Products listed in. <52> The delivery vector comprises a viral vector and / or a non-viral vector, the viral vector comprises an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, a retroviral vector, and / or an oncolytic viral vector, and the non-viral vector comprises a cationic polymeric polymer and / or a liposome. <50> Products listed in.

Claims

1. A fusion protein, the fusion protein comprising a single-stranded DNA binding protein, a nucleoside deaminase and a nuclease; The order of connection of the fusion proteins is such that the single-stranded DNA binding protein is located between the nucleoside deaminase and the nuclease, The nucleoside deaminase is located on the N-terminal side of the nuclease, The single-stranded DNA binding protein is Rad51. Fusion proteins.

2. The single-stranded DNA binding protein comprises at least one of four domains, namely, the OB fold, the KH domain, the RRMS, and the spiral domain of the single-stranded DNA binding protein, a partial polypeptide fragment of the four domains having a function of binding to single-stranded DNA, or a combination of two or more selected from the group consisting of the four domains and the partial polypeptide fragment. The fusion protein of claim 1.

3. The fusion protein of claim 2 , wherein the single-stranded DNA binding protein comprises the DNA binding domain of Rad51.

4. The amino acid sequence of the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID NO:

1. The fusion protein according to claim 3.

5. The fusion protein of claim 1, wherein the nucleoside deaminase comprises a cytidine deaminase and / or an adenosine deaminase.

6. The fusion protein of claim 5 , wherein the cytidine deaminase comprises rat-derived cytidine deaminase or human-derived cytidine deaminase APOBEC3A.

7. The amino acid sequence of the rat-derived cytidine deaminase comprises the sequence shown in SEQ ID NO: 3, and / or The amino acid sequence of the human cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO:

13. The fusion protein according to claim 6.

8. The fusion protein of claim 5, wherein the cytidine deaminase comprises a mutant of cytidine deaminase APOBEC3A, the mutant comprising the sequence set forth in SEQ ID NO:

15.

9. 2. The method according to claim 1, wherein the nuclease is selected from one or more of Cas9, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, and Cpf1. The fusion protein described above.

10. The fusion protein of claim 9, wherein the nuclease is Cas9.

11. 11. The fusion protein of claim 10, wherein the Cas9 is selected from Cas9 derived from Streptococcus pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, or Streptomyces thermophilus, or the Cas9 is selected from Cas9 mutants VQR-spCas9, VRER-spCas9, or spCas9n.

12. The fusion protein of claim 11, wherein the amino acid sequence of the spCas9n comprises the sequence set forth in SEQ ID NO:

5.

13. The fusion protein of claim 1 , further comprising an NLS.

14. The NLS is located at least at one end of the fusion protein. Or, the amino acid sequence of the NLS comprises the sequence shown in SEQ ID NO:

7. The fusion protein of claim 13.

15. The fusion protein of claim 1, further comprising two or more copies of a UGI.

16. The UGI is located at least at one end of the fusion protein. Or, the fusion protein of claim 15, wherein the amino acid sequence of the UGI comprises the sequence shown in SEQ ID NO:

9.

17. A gene encoding the fusion protein according to any one of claims 1 to 16.

18. The gene according to claim 17, wherein the coding sequence for the DNA binding domain of Rad51 comprises the sequence shown in SEQ ID NO:

2.

19. The nucleoside deaminase comprises a rat-derived cytidine deaminase, and the coding sequence of the rat-derived cytidine deaminase comprises the sequence shown in SEQ ID NO:4; or The nucleoside deaminase comprises human cytidine deaminase APOBEC3A, and the coding sequence of the human cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 14; or The nucleoside deaminase comprises a mutant of cytidine deaminase APOBEC3A, and the coding sequence of the mutant of cytidine deaminase APOBEC3A comprises the sequence shown in SEQ ID NO: 16; or The nuclease is spCas9n, and the coding sequence of the spCas9n comprises the sequence set forth in SEQ ID NO:6; or The fusion protein further comprises an NLS, the coding sequence of which comprises the sequence shown in SEQ ID NO:8; or The fusion protein further comprises two or more copies of UGI, wherein the coding sequence of the UGI comprises the sequence set forth in SEQ ID NO:

10. The gene described in claim 18.

20. A recombinant vector comprising the gene according to any one of claims 17 to 19.

21. Containing a fusion protein according to any one of claims 1 to 16 or claim 17 A recombinant cell or recombinant body containing the gene according to any one of claims 1 to 19.

22. 22. The recombinant cell or recombinant of claim 21, wherein the recombinant cell is a T cell, a hematopoietic stem cell, a bone marrow cell, or an erythroid progenitor cell.

23. A fusion protein according to any one of claims 1 to 16, a gene according to any one of claims 17 to 19, a recombinant vector according to claim 20, or a recombinant cell or recombinant according to claim 21 or 22, and The fusion protein induces single-base genome editing of a target gene in a target cell. A single base genome editing system comprising:

24. The target sequence of the sgRNA comprises at least one of SEQ ID NOs: 17 to 36; and / or the target cell is a T cell, a hematopoietic stem cell, a bone marrow cell, or an erythroid progenitor cell; And / or, the target gene is in the HBG1 promoter region or the HBG2 promoter region; The single base genome editing system of claim 23.

25. Use of a fusion protein according to any one of claims 1 to 16, a gene according to any one of claims 17 to 19, a recombinant vector according to claim 20, a recombinant cell or recombinant according to claim 21 or 22, or a single-base genome editing system according to claim 23 or 24 in the manufacture of a product for genome editing, a product for the treatment and / or prevention of a disease, a non-human animal model, or a new plant variety.

26. 26. The use according to claim 25, wherein the disease is a beta hemoglobinopathy, the beta hemoglobinopathy comprising beta thalassemia and / or sickle cell anemia.

27. An in vitro single-base genome editing method comprising a step of introducing a fusion protein according to any one of claims 1 to 16 and an sgRNA into a cell in vitro and performing genome editing on a target gene, wherein the sgRNA induces the fusion protein to perform single-base genome editing on the target gene in the target cell.

28. The target sequence of the sgRNA comprises at least one of SEQ ID NOs: 17 to 36; and / or the target cell is a T cell, a hematopoietic stem cell, a bone marrow cell, or an erythroid progenitor cell; And / or, the target gene is in the HBG1 promoter region or the HBG2 promoter region; 28. The method of claim 27.

29. A method for constructing a disease animal model, comprising a step of introducing the fusion protein and sgRNA according to any one of claims 1 to 16 into an animal cell and performing genome editing on a target gene, wherein the animal model is a non-human animal model.

30. The target sequence of the sgRNA comprises at least one of SEQ ID NOs: 17 to 36.

30. The method of claim 29.

31. 31. The method of claim 30, wherein the target sequence of the sgRNA comprises the sequence set forth in SEQ ID NO: 36, and the target gene comprises the DMD gene.

32. the animal cell is a non-human mammalian cell, and / or the animal cell is a non-human embryonic cell; and / or said mode of introduction is one of vector transformation, microinjection, transfection, liposome transfection, heat shock, electroporation, transduction, gene gun, DEAE-glucan mediated transfer; And / or the method of claim 29, wherein the introduction is carried out using the mRNA of the fusion protein and the sgRNA.

33. the mammal is a rat or a mouse, And / or, when the mode of introduction is microinjection, the concentration of the mRNA of the fusion protein according to any one of claims 1 to 16 used in the introduction is 1 to 1000 ng / μL.

34. The method of claim 33, wherein the ratio of the concentration of the mRNA of the fusion protein of any one of claims 1 to 16 to the concentration of the sgRNA used in the introduction is 1:(5 to 1) (ng / μL:ng / μL).

35. A product for treating and / or preventing β-hemoglobinopathy, the product comprising a gene according to any one of claims 17 to 19 and a delivery vector for sgRNA, The product, wherein the sgRNA guides the fusion protein to perform single-base genome editing on a target gene in a target cell, and the target gene is in an HBG1 promoter region or an HBG2 promoter region.

36. The target sequence of the sgRNA comprises the sequence set forth in SEQ ID NO: 35; and / or the beta hemoglobinopathy comprises beta thalassemia and / or sickle cell anemia; And / or the target cell is a T cell, a hematopoietic stem cell, a bone marrow cell, or an erythroid progenitor cell.

37. 36. The article of manufacture of claim 35, wherein the delivery vector comprises a viral vector and / or a non-viral vector, the viral vector comprising an adeno-associated viral vector, an adenoviral vector, a lentiviral vector, a retroviral vector, and / or an oncolytic viral vector, and the non-viral vector comprises a cationic macromolecular polymer and / or a liposome.

Images