Cell lines containing novel selectable markers and their use for protein production - Patents.com

Abstract

The present invention relates to cell lines containing a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene and their use for the production of recombinant proteins.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The present invention relates to cell lines and selection markers for protein production. [Background technology]

[0002] 2. Background of the Invention The production of recombinant proteins on an industrial scale requires the isolation of clones that produce large amounts of recombinant proteins. Introducing heterologous genes into animal host cells and screening for the expression of the added genes is a very long and complicated process. This process includes transfection and selection of stable long-term expressing clones, and screening for clones with high expression rates for the corresponding recombinant proteins.

[0003] When generating clones expressing recombinant proteins from expression vectors, host cells are usually transfected with a DNA vector that encodes both the protein of interest and a selection marker on the same vector. Thus, such expression vectors contain a selectable marker that allows for the selection of clones in which the expression vector is present. Such a selectable marker can also result in co-amplification of the transfected DNA, thereby allowing for the isolation of high-producing clones.

[0004] Most selectable markers are either proteins that confer resistance to antibiotics or other toxic substances or proteins essential for cell survival. Several such selectable markers are known in the art, including, for example, G418, hygromycin, puromycin, zeomycin, dihydrofolate reductase (DHFR), glutamine synthetase (GS) and hypoxanthine-guanine phosphoribosyltransferase (HPRT). In particular, GS is widely used as a selectable marker in the field of industrial recombinant protein production in eukaryotic cells. The GS gene allows the synthesis of glutamine, which is essential for cell growth, and is inhibited by MSX (L-methionine sulfoximine). In the presence of MSX, only cells expressing high amounts of GS remain. After appropriate screening, it is possible to select cells producing the exogenous protein.

[0005] In a previous application, US Pat. No. 5,999,366, the present inventors developed an expression system based on the use of dihydroorotate dehydrogenase (DHODH) as a selectable marker. DHODH is an enzyme required for pyrimidine synthesis. Thus, compounds that inhibit DHODH inhibit DNA synthesis and therefore cell proliferation. This selectable marker therefore includes an expression vector encoding DHODH for use in combination with DHODH inhibitors such as leflunomide and teriflunomide.

[0006] However, most of the inhibitors used with the above selection markers are toxic. In the case of the DHODH selection marker, for example, teriflunomide is a strong immunosuppressant and its handling, especially on a large scale, can be difficult for safety reasons. In the case of the GS selection marker, MSX is a convulsant at high doses and therefore can cause handling problems. In the case of the DHFR selection marker, methotrexate is known to exhibit hematopoietic and digestive toxicity, thereby also causing handling problems. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] WO2016 / 062837 Summary of the Invention [Problem to be solved by the invention]

[0008] Thus, there is a need for an expression system that allows selection of clones producing a protein of interest without the addition of difficult to handle compounds.

[0009] The present invention fulfills this need. [Means for solving the problem]

[0010] Summary of the Invention The present invention results from the inventors' design of a cell line in which cells producing a protein of interest can be selected in a medium free of uridine as a result of partial or complete inactivation of the DHODH gene in said cell line. This cell line in which the DHODH gene is partially or completely inactivated is typically grown in a medium supplemented with uridine, but when transfected with an expression vector comprising a nucleotide sequence encoding a mammalian DHODH, in particular a mutated mammalian DHODH, and an expression cassette for expressing a protein of interest, the medium is typically changed to a medium free of uridine, thereby selecting for cells producing the protein of interest.

[0011] Such an expression system is particularly advantageous since it avoids the use of inhibitors as a selection pressure, thereby increasing the viability of the producing cells, and the inventors have further demonstrated that this reduced toxicity is associated with higher productivity.

[0012] The present invention therefore relates to cell lines which contain a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.

[0013] In a particular embodiment, the cell line is a Chinese Hamster Ovary (CHO) cell line.

[0014] In more particular embodiments, the cell line is a) inactivating the endogenous DHODH gene in a cell, in particular by gene editing techniques such as the CRISPR-Cas9 technique; and b) culturing the cells in a medium containing uridine under conditions suitable for generating a cell line in which the endogenous DHODH gene is partially or completely inactivated. Manufactured by.

[0015] In certain embodiments, all alleles of the endogenous DHODH gene of the cell line are partially or completely inactivated.

[0016] In a further embodiment, the cell line further comprises an expression vector comprising a nucleotide sequence encoding exogenous mammalian DHODH and at least one expression cassette for expression of a recombinant protein, wherein the exogenous DHODH comprises a sequence that is at least 60% identical to the sequence of SEQ ID NO:2 or the sequence of SEQ ID NO:4.

[0017] In a particular embodiment thereof, said nucleotide sequence comprises the sequence of SEQ ID NO:1 or the sequence of SEQ ID NO:3.

[0018] In another particular embodiment thereof, said recombinant protein is a monoclonal antibody.

[0019] In yet another particular embodiment thereof, said vector comprises a first expression cassette suitable for cloning an antibody light chain and a second expression cassette suitable for cloning an antibody heavy chain.

[0020] Another object of the present invention is to: (i) a cell line containing a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene as defined above, and (ii) an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing the recombinant protein; wherein the exogenous DHODH comprises a sequence that is at least 60% identical to the sequence of SEQ ID NO:2 or the sequence of SEQ ID NO:4.

[0021] In certain embodiments, the nucleotide sequence comprises the sequence of SEQ ID NO:1 or the sequence of SEQ ID NO:3.

[0022] In another specific embodiment, the recombinant protein is a monoclonal antibody.

[0023] In yet a particular embodiment, said vector comprises a first expression cassette suitable for cloning an antibody light chain and a second expression cassette suitable for cloning an antibody heavy chain.

[0024] The present invention further relates to (i) a cell line as defined above, or an expression system as defined above, and (ii) a uridine-free medium.

[0025] Another object of the present invention relates to a method for producing a recombinant protein in vitro, said method comprising: A) a1) providing a cell line as defined above, further comprising an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein the exogenous DHODH comprises a sequence that is at least 60% identical to the sequence of SEQ ID NO:2 or the sequence of SEQ ID NO:4; or a2) providing a cell line as defined above, and a2') introducing the expression vector defined above into the cell line provided in step a2); or a3) providing a cell line comprising an endogenous DHODH gene; a3') partially or completely inactivating the endogenous DHODH gene in the cell line provided in step a3), and a3″) introducing the expression vector defined above into a cell line containing a partially or completely inactivated endogenous DHODH gene obtained in step a3′); B) culturing the cell line under conditions suitable for the production of the recombinant protein; and C) isolating and / or purifying the recombinant protein Includes.

[0026] In a particular embodiment, step B) of the above method is carried out in a medium free of uridine.

[0027] In another particular embodiment, the method further comprises a step D) of formulating the recombinant protein into a pharmaceutical composition.

[0028] The present invention further relates to the use of a cell line as defined above, an expression system as defined above or a kit as defined above for producing a recombinant protein.

[0029] In certain embodiments, the cell line, expression system or kit is used in combination with medium that does not contain uridine. [Brief description of the drawings]

[0030] [Figure 1] Figure 1 shows the genomic structure of the human DHODH gene, referenced by Gene ID: 100756632 available on December 21, 2018 in Genbank NCBI. [Diagram 2] FIG. 2 shows an alignment of sequence n°1 DHODH exon2. PAM:protospacer adjacent motif sequence (TGG). [Diagram 3] FIG. 3 shows the screening of various KO (knockout) DHODH clones for antibody production in the presence of various concentrations of teriflunomide as the selection agent. [Figure 4]FIG. 4 shows the amount of protein in mg / mL produced using various DHODH variants as selection markers. [Diagram 5] FIG. 5 shows lipase production on day 14 using human DHODH G202A or human GS selection markers and DHODH KO or wild type CHO cells. [Figure 6] FIG. 6 shows production of monoclonal antibody mAb-B on day 14 using human DHODH G202A or human GS selection markers, and DHODH KO or wild type CHO cells. [Figure 7] FIG. 7 shows bispecific antibody production at day 14 using human DHODH G202A and / or human GS selection markers and DHODH KO or wild type CHO cells. [Figure 8] FIG. 8 shows trispecific antibody production at day 14 using human DHODH G202A and human GS selection markers and DHODH KO or wild type CHO cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Detailed Description of the Invention Dihydroorotate dehydrogenase As used herein, the term "dihydroorotate dehydrogenase" or "DHODH" refers to a polypeptide capable of catalyzing the conversion of dihydroorotate (4,5-dihydroorotic acid or 2,6-dioxo-1,3-diazinan-4-carboxylic acid) to orotate (orotic acid or 1,2,3,6-tetrahydro-2,6-dioxo-4-pyrimidinecarboxylic acid), as represented by the following reaction: (S)-Dihydroorotate + O2←→ Orotate + H2O2 Such polypeptides are classified under the Enzyme Commission (EC) number 1.3.3.1. Polypeptides capable of catalyzing the above reaction exhibit "DHODH" activity.

[0032] This reaction is the fourth step in the de novo synthesis of uridine monophosphate (rUMP), which is required for the synthesis of DNA and RNA. Thus, inhibition or inactivation of DHODH has the effect of inhibiting DNA and RNA synthesis and therefore inhibiting cell proliferation.

[0033] cell line The present invention relates to cell lines which contain a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.

[0034] The cell line may be a eukaryotic cell line, for example a mammalian cell line such as a Chinese Hamster Ovary (CHO) cell line, a monkey cell line or a human cell line.

[0035] In a particular embodiment, the cell line is a CHO cell line.

[0036] CHO cell lines are commonly used for industrial protein production, and many CHO cell lines are known to those skilled in the art. For example, such CHO cell lines include those publicly available from the American Type Culture Collection, such as the CHO-K1 cell line (ATCC number: CCL-61), the CHO-S cell line (e.g., sold by Invitrogen and Gibco), the CHO DP-12 cell line (ATCC numbers CRL-12444 and 12445), and the CHO 1-15 cell line (ATCC number CRL-9606). Another cell line suitable for industrial protein production is the CHO 9E4 cell line. The 9E4 cell line was established from a clone of the CHO-K1 cell line by a single-cell cloning process. The establishment of the 9E4 cell line is shown in more detail in Example 1. The CHO-K1 cell line was obtained by Puck in 1957 and deposited in the ATCC under number CCL-61.

[0037] Human cells such as HEK293 (ATCC No. CRL-1573), HKB11 (ATCC No. CRL-12568), PER-C6 (Crucell), HT1080 (ATCC No. CRL-121), Jurkat, Daudi, Raji and CAP (ATCC No. CRL-1098) cells can also be used for protein production to obtain native glycosylation patterns for recombinant human proteins.

[0038] In one embodiment, the cell line is capable of growing in serum-free medium (e.g., chemically defined medium) and / or in suspension. Such cell lines are readily obtained by one of skill in the art by adapting a parent cell line to grow in serum-free medium and / or in suspension (e.g., by single cell cloning, by gradual adaptation and / or by a process of "starve and save").

[0039] The cell lines of the present invention are cell lines that contain a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene.

[0040] By "endogenous DHODH gene" herein is meant the DHODH gene that is normally present in that particular cell at a particular developmental stage under particular environmental conditions.

[0041] An "endogenous DHODH gene" is distinguished from an "exogenous DHODH" as defined below, in that the exogenous DHODH is supplied by an expression vector as defined below, and may be present in a cell line of the present invention if the expression vector has been introduced into the cell line.

[0042] As will be appreciated by those skilled in the art, the endogenous DHODH gene depends on the cell line. For example, in a CHO cell line, the endogenous DHODH gene is the Chinese hamster DHODH gene; in a human cell line, the endogenous DHODH gene is the human DHODH gene.

[0043] Typically, wild-type Chinese hamster DHODH refers to a sequence comprising or consisting of SEQ ID NO:2, as well as variants thereof that exhibit DHODH activity. Such variants may, for example, represent naturally occurring variants (e.g. allelic or splice variants) in the hamster species.

[0044] Typically, wild-type human DHODH refers to a sequence comprising or consisting of SEQ ID NO: 4, as well as variants thereof that exhibit DHODH activity. Such variants may, for example, represent naturally occurring variants (e.g. allelic or splice variants) in the human species.

[0045] As used herein, a "gene" includes a DNA region that encodes a gene product, as well as all DNA regions that control the production of the gene product, whether or not such control sequences are contiguous with the coding and / or transcribed sequences. Thus, a gene includes promoter sequences, terminators, translation control sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, border regions, origins of replication, matrix attachment sites, and locus control regions.

[0046] Gene "inactivation" refers to any reduction in gene expression compared to the corresponding wild-type cell. Gene inactivation may be complete (total inactivation or knockout) or partial (e.g., a hypomorph in which the gene exhibits lower than normal expression levels or a mutant gene product that exhibits a partial reduction in the activity it affects).

[0047] In certain embodiments, all alleles of the endogenous DHODH gene are partially or completely inactivated.

[0048] In certain embodiments, the endogenous DHODH gene is completely inactivated.

[0049] In a more particular embodiment, all alleles of the endogenous DHODH gene are completely inactivated.

[0050] In certain embodiments, the endogenous DHODH gene is inactivated using CRISPR-Cas9 methods as described in Aga et al. (2015) BMC Proceedings 9(Suppl 9):P2.

[0051] As known to those skilled in the art, the CRISPR-Cas9 system is a prokaryotic adaptive immune response system that uses non-coding RNA to guide Cas9 nuclease to induce site-specific DNA cleavage. This DNA damage is repaired by cellular DNA repair mechanisms via either the non-homologous end joining DNA repair pathway (NHEJ) or the homology-directed repair (HDR) pathway. To create gene disruption, a single guide RNA (gRNA) consisting of a crRNA sequence specific for a DNA target and a tracrRNA sequence that interacts with Cas9 binds to a recombinant form of Cas9 protein with DNA endonuclease activity. The resulting complex causes target-specific double-stranded DNA breaks. The break site is repaired by the non-homologous end joining (NHEJ) DNA repair pathway, an error-prone process that can generate insertions / deletions (INDELs) that can disrupt gene function.

[0052] In certain embodiments, at least one exon of DHODH gene is targeted for inactivation, particularly by gene editing, such as CRISPR-Cas9 method.In more particular embodiments, the part of DHODH gene that codes for the N-terminal part of DHODH protein is targeted for inactivation, particularly by gene editing, such as CRISPR-Cas9 method.In yet another embodiment, the second exon of DHODH gene is targeted for inactivation, particularly by gene editing, such as CRISPR-Cas9 method.

[0053] In one embodiment, a 20 nucleotide sequence of the sequence CAAGGATGATGGCTGCATCC (SEQ ID NO: 23) or the sequence GGATGCAGCCATCATCCTTG (SEQ ID NO: 5) or any sequence compatible with knockout of the DHODH gene without compromising CHO viability is used as the corresponding piece of DNA to generate a gRNA, which targets the second exon of the DHODH gene. This gRNA is typically obtained using oligonucleotides of the sequences CACCGCACCGGGATGCAGCCATCATCCTTG (SEQ ID NO: 6) and AAAACCAAGGATGATGGCTGCATCC (SEQ ID NO: 7) or using oligonucleotides of the sequences GGATGCAGCCATCATCCTTGGTTTT (SEQ ID NO: 24) and CAAGGATGATGGCTGCATCCCGGTG (SEQ ID NO: 25), which are typically cloned into a unique restriction site of a plasmid, such as the BaeI site of the pCM3561 plasmid (sold by Invitrogen), so that the cloned DNA sequence is under the control of the U6 promoter and, when the plasmid is introduced into a cell, is transcribed into a single transcription unit containing the crRNA fused to the tracrRNA, the crRNA portion specific for the second exon of the DHODH gene and the tracrRNA portion recognized by the Cas9 enzyme.

[0054] To identify cell lines to be inactivated for the DHODH gene, single cells are typically isolated by limiting dilution in well plates, and after reaching a suitable confluence, e.g., 90% confluence, the cells are split into at least two conditions, e.g., one in medium supplemented with uridine and another in medium without uridine. The clones of interest are typically those that are sensitive to uridine deprivation.

[0055] Once isolated, these cells of interest can be cultured in media containing pyrimidine bases, particularly media containing uridine.

[0056] By "pyrimidine base" is meant herein pyrimidine itself and various pyrimidine derivatives having a pyrimidine nucleus as the backbone. Examples of such pyrimidine bases include uracil nucleic acid related substances such as uracil, uridine, uridine phosphates, particularly uridine monophosphate (UMP), uridine diphosphate (UDP) and uridine triphosphate (UTP), deoxyuridine, deoxyuridine phosphates, particularly deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP) and deoxyuridine triphosphate (dUTP); cytosine nucleic acid related substances such as cytosine, cytidine, cytidine phosphates, particularly cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), and cytidine triphosphate (CTP). P), deoxycytidine, 2'-deoxycytidine, deoxycytidine phosphates, particularly deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP); thymine, thymidine, thymidine phosphates, particularly thymidine monophosphate (TMP), thymidine diphosphate (TDP) and thymidine triphosphate (TTP), deoxythymidine, deoxythymidine phosphates, particularly deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP) and deoxythymidine triphosphate (dTTP) and orotate.

[0057] In certain embodiments, the pyrimidine base is uridine.

[0058] By "uridine" herein is meant uridine of the formula [ka] This means a nucleoside.

[0059] By "uridine-free medium" is meant any basal medium suitable for the growth of a particular cell line, wherein the medium contains less than 1 mM uridine, in particular the medium does not contain any uridine.

[0060] By "medium containing uridine" is meant any basal medium suitable for the growth of a particular cell line, wherein the medium further comprises between 1 mM and 25 mM uridine, particularly between 5 mM and 10 mM uridine.

[0061] By "basal medium" is meant herein a supplement-free medium suitable for exposure to cells, e.g., CHO cells. As will be appreciated by those skilled in the art, the basal medium to be used depends on the type of cells used. Examples of basal media include CDCHO medium, OPTiCHO medium, and OPTiCHO medium. TM Culture medium, Fecto CHO TM Culture medium, FortiCHO TM Culture medium, ExpiCHO TM Medium, Ex-Cell TM Culture medium, ActiPRO TM Culture medium, MAM PF77 TM Culture medium and PowerCHO TM Examples of the medium include:

[0062] In certain embodiments, the basal medium is further supplemented with glutamine, typically 4-6 mM glutamine.

[0063] Thus, in certain embodiments, the cell lines of the invention are a) inactivating the endogenous DHODH gene in a cell, in particular by gene editing techniques such as the CRISPR-Cas9 technique; and b) culturing the cells in a medium containing uridine under conditions suitable for generating a cell line in which the endogenous DHODH gene is partially or completely inactivated. Manufactured by.

[0064] The production of CHO cell lines containing an endogenous DHODH gene that has been completely or partially inactivated by the CRISPR-Cas9 approach is illustrated in more detail in Examples 2 and 3.

[0065] The production of cell lines, such as CHO cell lines, containing endogenous DHODH gene that is completely or partially inactivated can be produced by various other molecular biology techniques known in the art.For example, other gene editing techniques useful for producing cell lines with endogenous DHODH gene that is completely or partially inactivated include the use of zinc finger nucleases (ZFN) or transcription factor-like effector nucleases (TALEN).Cre / Lox method can also be used to knock out one or more or all alleles of DHODH gene.

[0066] In certain embodiments, the cell lines of the invention further comprise an expression vector as defined below in the "Expression Vectors" section.

[0067] The expression vector may be introduced into the cell line by any suitable technique known to those skilled in the art, such as transfection, in particular electroporation or chemical transfection, or transduction.

[0068] In certain embodiments, the cell lines of the invention may further comprise an additional expression vector comprising a selectable marker different from the expression vector of the invention, typically an additional expression vector comprising a sequence encoding glutamine synthetase.

[0069] Exogenous DHODH The DHODH encoded by the expression vector used in the present invention (further referred to as "exogenous DHODH") may comprise or consist of a sequence that is at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91%; 92%; 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% identical to SEQ ID NO:2 or SEQ ID NO:4, or may comprise or consist of a fragment of at least 100, 150, 200, 250, 300 or 350 consecutive amino acids of SEQ ID NO:2 or SEQ ID NO:4, provided that the protein retains DHODH activity.

[0070] In some embodiments, the exogenous DHODH according to the present invention comprises or consists of a sequence that is at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91%; 92%; 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% identical to both the sequence of SEQ ID NO:2 and the sequence of SEQ ID NO:4.

[0071] In some embodiments, the exogenous DHODH according to the present invention is human DHODH, ie, DHODH of human origin.

[0072] As used herein, the term "human DHODH" refers to a protein of sequence comprising or consisting of SEQ ID NO: 4, as well as variants thereof exhibiting DHODH activity. Such variants may represent, for example, naturally occurring variants in the human species (for example, allelic variants or splice variants). Alternatively, such variants may represent variants obtained by genetic engineering. In one embodiment, such variants differ from the sequence of SEQ ID NO: 4 by the presence of at most 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid mutations (these mutations include substitutions, insertions and deletions) compared to SEQ ID NO: 4.

[0073] In a particular embodiment, the human DHODH is a variant comprising a G202A mutation compared to the wild-type sequence, and is typically a protein comprising or consisting of the amino acid sequence of SEQ ID NO:26.

[0074] In some embodiments, the exogenous DHODH is hamster DHODH, i.e., DHODH of hamster origin, such as Chinese hamster (Cetulus griseus) DHODH.

[0075] As used herein, the term "Chinese hamster DHODH" refers to a sequence comprising or consisting of SEQ ID NO:2, as well as variants thereof exhibiting DHODH activity. Such variants may represent variants occurring naturally, for example in hamster species (e.g. allelic variants or splice variants). Alternatively, such variants may represent variants obtained by genetic engineering. In one embodiment, such variants differ from the sequence of SEQ ID NO:2 by the presence of at most 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid mutations (these include substitutions, insertions and deletions) compared to SEQ ID NO:2.

[0076] In another embodiment, the variant DHODH has DHODH activity, optionally at the same level of activity as the wild-type protein, or at 50%, 60%, 70%, 80%, 90%, 100%, 110%, 120%, 130%, 140% or more of the activity level of the wild-type protein.

[0077] By a polypeptide having an amino acid sequence at least, e.g., 95% "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence, except that the sequence of the subject polypeptide may contain up to 5 amino acid changes for each 100 amino acids of the query amino acid sequence. In other words, up to 5% (5 out of 100) of the amino acid residues in the subject sequence may be inserted, deleted or substituted with another amino acid to obtain a polypeptide having an amino acid sequence at least 95% identical to the query amino acid sequence.

[0078] Sequence identity can be determined over the entire length of the variant sequence, the entire length of the reference sequence, or both. For example, the percentage of identity can be calculated using global alignment (i.e., the two sequences are compared over their entire length). Methods for comparing the identity and homology of two or more sequences are well known in the art. The "needle" program can be used, for example, to perform a global alignment, using the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453) to find the optimal alignment (including gaps) of two sequences, taking into account their entire length. This needle program is available, for example, at the ebi.ac.uk World Wide Web site. The percentage of identity according to the present invention is preferably calculated using the EMBOSS::need|e(global) program, with a "gap open" parameter equal to 10.0, a "gap extension" parameter equal to 0.5, and the Blosum62 matrix.

[0079] A variant of a reference sequence may contain mutations such as deletions, insertions and / or substitutions compared to the reference sequence. In case of substitutions, the substitutions preferably correspond to conservative substitutions as shown in the table below.

[0080] [Table 1]

[0081] Expression vector The expression vector used in the context of the present invention is suitable for the production of recombinant proteins and comprises a sequence encoding dihydroorotate dehydrogenase (DHODH).

[0082] The expression vector is preferably a DNA vector.

[0083] An expression vector used in the context of the present invention comprises a sequence encoding exogenous DHODH as defined in the "Exogenous DHODH" section above.

[0084] In a specific embodiment, the cell line into which the expression vector is to be introduced is a CHO cell line and the exogenous DHODH is heterologous (ie, the exogenous DHODH is not hamster DHODH).

[0085] Such an exogenous DHODH-encoding sequence may be a naturally occurring nucleotide sequence. Alternatively, the triplet codon of such a DHODH-encoding sequence may be biased for expression in CHO cells. Software and algorithms for biasing sequences for optimal expression are known in the art, and include, for example, the algorithm described in Raab et al. (2010) Syst Synth Biol. 4:215-225. This algorithm not only provides discretionary available codons for expression, but also takes into account GC content and the absence of unwanted DNA motifs.

[0086] For example, the exogenous DHODH-encoding sequence may comprise or consist of a sequence that is at least 60%, 62%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO:3 (i.e., the sequence encoding human DHODH of SEQ ID NO:4, which is designed for optimal expression in CHO cells) and / or to the sequence of SEQ ID NO:1 (i.e., the sequence encoding hamster DHODH of SEQ ID NO:2, which is designed for optimal expression in CHO cells).

[0087] In one embodiment, the sequence encoding exogenous DHODH comprises or consists of the sequence of SEQ ID NO:1 or SEQ ID NO:3.

[0088] In the expression vector used in the context of the present invention, the sequence encoding the exogenous DHODH defined above may be placed under the control of any promoter known to those skilled in the art.

[0089] For example, the sequence encoding exogenous DHODH as defined above can be under the control of a promoter suitable for driving the expression of DHODH, such as the simian vacuolar virus 40 (SV40) promoter (e.g., the late or early promoter of SV40), the CMV promoter, the elongation factor 1 promoter, the GAPDH promoter, the RPL37 promoter, the actin promoter. The early SV40 promoter is described, for example, in Benoist and Chambon (1981) Nature 290:304-310 and Moreau et al. (1981) Nucleic Acids Res. 9:6047-6068. In particular, the SV40 promoter is a full-length promoter. The SV40 promoter can also have a replication origin containing a 72 bp repeat.

[0090] In some embodiments, the SV40 promoter is not an SV40 promoter in which positions 128-270 have been deleted, i.e., the SV40 promoter is not the SV40 promoter transforming the E. coli transformant described in Korean Patent No. 10-0267720 and deposited with Gene Bank, Institute of Bioengineering, KIST on December 17, 1997 under deposit number: KCTC 8860 P.

[0091] In another embodiment, the sequence encoding exogenous DHODH as defined above is not under the control of an SV40 promoter.

[0092] Expression vectors suitable for the production of recombinant proteins are known to those skilled in the art. Such vectors typically correspond to expression vectors comprising an origin of replication and at least one expression cassette allowing the cloning and expression of the recombinant protein whose production is desired. The expression cassette typically comprises a 5'-untranslated region (comprising or consisting of a promoter and optionally an enhancer sequence), one or more restriction sites allowing the cloning of the sequence coding for the recombinant protein, a 3'-untranslated region (e.g. polyA signal) and optionally one or more introns. The promoter sequence may correspond to any strong promoter known in the art, such as for example the human CMV promoter. Optionally, the expression vector used in the context of the present invention comprises a prokaryotic origin of replication (e.g. a prokaryotic replicon such as ColE1 in E. coli) and at least a prokaryotic-selectable marker gene, also known as a prokaryotic selectable marker, so as to allow the vector to replicate in a prokaryotic cell. Cells replicating the vector also express the prokaryotic-selectable marker gene and thus can be identified and selected. Prokaryotic selectable marker genes are well known to those skilled in the art. Examples of prokaryotic selectable marker genes are sequences encoding proteins that confer antibiotic resistance, such as sequences encoding proteins that confer resistance to ampicillin, chloramphenicol, blasticidin or kanamycin.

[0093] The recombinant protein can correspond to any protein of interest to one of skill in the art.

[0094] As used herein, the term "protein" is meant to include peptides (i.e., amino acid chains of less than 50 amino acids), polypeptides (i.e., amino acid chains of at least 50 amino acids), monomeric proteins (i.e., proteins made up of amino acid chains) and multimeric proteins (i.e., proteins made up of two or more amino acid chains, such as, for example, monoclonal antibodies).

[0095] An expression vector used in the context of the present invention typically contains as many expression cassettes as there are different amino acid chains that make up the protein (e.g. one expression cassette for a monomeric or homodimeric protein, two for a heterodimeric protein of a monoclonal antibody, etc.).

[0096] Alternatively, the expression vector used in the context of the present invention may contain only one expression cassette, in the case of the production of heterodimeric proteins or even when the production of monoclonal antibodies is desired. In such cases, the sequence coding for the other amino acid chain of the protein is present on a separate expression vector, which is co-transfected with the expression vector according to the invention into a host cell line, in particular a CHO cell line.

[0097] In that case, the additional, separate expression vector may contain a selectable marker different from the DHODH selectable marker described herein, such as DHFR, GS or HPRT.

[0098] In one embodiment, the expression vector used in the context of the present invention may not contain an expression cassette. In such a case, an expression cassette suitable for the expression of the recombinant protein is present on a separate vector, which is co-transfected together with the expression vector according to the present invention into a host cell line, in particular into a DHODH-inactivated cell line of the present invention, more particularly into a DHODH-inactivated CHO cell line of the present invention.

[0099] Thus, in some embodiments, an expression vector used in the context of the present invention comprises: - an exogenous DHODH coding sequence as defined above placed under the control of the early SV40 promoter; - a first expression cassette in which a sequence encoding the light chain of the antibody is placed under the control of a CMV promoter; - a second expression cassette in which a sequence encoding the heavy chain of the antibody is placed under the control of a CMV promoter; - a prokaryotic origin of replication; and - a sequence coding for a selectable marker for use in prokaryotic cells, i.e. a protein conferring resistance to ampicillin, placed under the control of its native promoter.

[0100] Throughout the present specification, the term "recombinant protein" refers to any recombinant protein whose production is desired. For example, it may correspond to a therapeutic and / or prophylactic protein, i.e. a protein intended for use as a drug (including a vaccine). In a particular embodiment, the recombinant protein whose production is desired is not DHODH. In another particular embodiment, the recombinant protein whose production is desired is an antibody, e.g. a monoclonal antibody. In yet another particular embodiment, the recombinant protein whose production is desired is an antigenic protein.

[0101] The term "antibody" is used herein in the broadest sense and specifically includes monoclonal antibodies of any isotype, such as lgG, lgM, lgA, lgD, and lgE (including full-length monoclonal antibodies), polyclonal antibodies, multispecific antibodies (including bispecific and trispecific antibodies), antibody fragments (e.g., Fv, scFv, ds, Fab, Fab', or F(ab')2 fragments), single domain antibodies and fragments thereof, and fusion proteins comprising antibody fragments. Antibodies reactive to a particular antigen can be produced by recombinant methods, such as selection of libraries of recombinant antibodies in phage or similar vectors, or by immunizing animals with the antigen or a nucleic acid encoding the antigen.

[0102] As used herein, a "monoclonal antibody" is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the antibodies forming the population are essentially identical except for possible naturally occurring mutations that may be present in minor amounts. These antibodies are specific for a single epitope (or a single group of epitopes in the case of polyspecific monoclonal antibodies) and are therefore highly specific.

[0103] A typical monoclonal antibody is composed of two identical heavy chains and two identical light chains linked by disulfide bonds. Each heavy and light chain contains a constant region and a variable region. Each variable region contains three segments called "complementarity determining regions" ("CDRs") or "hypervariable regions", which are primarily responsible for binding to an epitope of an antigen. These are usually called CDR1, CDR2, and CDR3, numbered sequentially from the N-terminus (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., National Institute of Health, Bethesda, MD, 1991). The more highly conserved portions of the variable regions are called "framework regions".

[0104] The monoclonal antibody can be, for example, a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.

[0105] Monoclonal antibodies may be monospecific, bispecific, or trispecific antibodies.

[0106] When the recombinant protein whose production it is desired is a monoclonal antibody, the expression vector according to the invention may comprise a first expression cassette suitable for cloning an antibody light chain and a second expression cassette suitable for cloning an antibody heavy chain.

[0107] In a particular embodiment, the first and second expression cassettes each comprise a cytomegalovirus (CMV) promoter, such as a CMV promoter from human or mouse CMV. More particularly, the first and second expression cassettes comprise: - the CMV immediate early enhancer promoter (e.g., having the sequence described in Teschendorf et al. (2002) Anticancer Res. 22:3325-3330); or - the IE2 promoter / enhancer region from mouse CMV (e.g., having the sequence described in Chatellard et al. (2007) Biotechnol Bioeng. 96:106-117); or - hCMV-MIE control element (e.g. having the sequence described in WO89 / 01036) may include.

[0108] The term "antigenic protein" is used herein in the broadest sense and includes any protein capable of generating an immune response, alone or in combination with an adjuvant. It may be intended for use in either a prophylactic or therapeutic vaccine. In certain embodiments, the antigenic protein is a vaccine protein, i.e., a protein intended for use in a prophylactic vaccine.

[0109] An expression vector can contain at least one sequence encoding a recombinant protein of interest (e.g., one sequence encoding a monomeric protein, one sequence encoding an antibody chain, or two sequences encoding an antibody light chain and an antibody heavy chain, respectively), or it can be empty (i.e., it does not contain any sequence encoding a recombinant protein of interest).

[0110] Expression systems, kits, methods and uses The present invention relates to: (i) a cell line as defined in the "Cell lines" section above, which contains an endogenous DHODH gene that has been partially or completely inactivated as defined in the "Cell lines" section above, and (ii) An expression vector as defined in the "Expression Vector" section above. The present invention provides an expression system comprising:

[0111] The expression system of the present invention may further comprise additional separate expression vectors each comprising a nucleotide sequence encoding a selectable marker different from DHODH, such as DHFR, GS or HPRT, and at least one expression cassette for expressing a recombinant protein.

[0112] Alternatively, the expression system of the present invention may further comprise an additional expression vector as defined in the "Expression Vectors" section above.

[0113] The invention provides a kit comprising (i) a cell line according to the invention comprising an expression vector as defined in the "Expression Vector" section above, or an expression system according to the invention, and (ii) a uridine-free medium as defined above.

[0114] The kit may include an expression vector (in an expression system) encoding exogenous DHODH as described above. In such a kit, the vector is preferably empty, since this allows the skilled artisan to clone the protein of interest. Furthermore, the expression vector is preferably isolated from the cell line in such a kit.

[0115] The kit further comprises uridine-free medium, as defined in the "Cell Lines" section above.

[0116] The kit may further comprise a medium suitable for culturing the cell line, a medium suitable for transfection of the vector into the cell line, packaging materials and / or instructions for use of the expression system.

[0117] In certain embodiments, the kit does not include a DHODH inhibitor.

[0118] Examples of DHODH inhibitors include bicinchoninic acid, brequinar (6-fluoro-2-(2'-fluoro-1,1'-biphenyl-4-yl)-3-methyl-4-quinoline carboxylic acid), naphthoquinone derivatives such as dichloroallyl lawsone, isoxazole derivatives such as leflunomide (5-methyl-N-[4-(trifluoromethyl)phenyl]-isoxazole-4-carboxamide) and its active metabolite teriflunomide ((2Z)-2-cyano-3-hydroxy-N-[4-(trifluoromethyl)phenyl]but-2-enamide), quinolone carboxylic acids, naphthoquinones, isoxazoles, phenoxyquinolines, redoxal and derivatives, lawsone, lapachol, atovaquone and (8-chloro-4-(2-chloro-4-fluoro-phenoxy)quinoline). Inhibitors of DHODH may be capable of inhibiting DHODH activity by at least 20, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100%.

[0119] In certain embodiments, the kit does not include teriflunomide.

[0120] The present invention further provides the use of a cell line according to the invention for the in vitro production of a recombinant protein, comprising an expression vector as defined in the "Expression Vector" section above, an expression system according to the invention, or a kit according to the invention.

[0121] In a particular embodiment, said cell line, expression system or kit is used in combination with a uridine-free medium as defined above, more particularly in combination with a medium in the absence of a DHODH inhibitor.

[0122] The present invention further provides the use of an expression system according to the invention, a cell line according to the invention comprising an expression vector as defined in the "Expression Vectors" section above, or a kit according to the invention, for isolating a clonal cell which produces high levels of recombinant protein in vitro (a "high producing clone"), in particular in the absence of a DHODH inhibitor.

[0123] In the context of the present invention, the term "high levels of recombinant protein" is intended to mean that in the culture medium, the concentration of the recombinant protein is at least 0.05 g / I, preferably at least 0.1 g / l, even more preferably at least 0.2 g / I, more preferably between 0.3 and 1 g / I. The concentration of the recombinant protein can be determined by methods well known to those skilled in the art, including in particular the enzyme-linked immunosorbent assay (ELISA), the Western blot, the caliper technique and the concentration range of the purified Saleta protein corresponding to the recombinant protein.

[0124] The present invention further provides an in vitro method for producing a recombinant protein, the method comprising: A) providing a cell line according to the invention comprising an expression vector as defined in the "Expression Vectors" section above a1); or a2) providing a cell line according to the invention, and a2') introducing an expression vector as defined in the "Expression Vectors" section above into the cell line provided in step a2); or a3) providing a cell line comprising an endogenous DHODH gene; a3') partially or completely inactivating the endogenous DHODH gene in the cell line provided in step a3), and a3'') introducing an expression vector as defined in the "Expression Vectors" section above into the cell line containing the partially or completely inactivated endogenous DHODH gene obtained in step a3'); B) culturing the cell line under conditions suitable for the production of the recombinant protein; and C) isolating and / or purifying the recombinant protein Includes.

[0125] In a particular embodiment, step B) of the above method is carried out in a medium free of uridine, more particularly free of a DHODH inhibitor, and comprises a sub-step consisting of selecting transfected cells which grow despite the absence of uridine, and in particular despite the additional absence of a DHODH inhibitor.

[0126] The present invention further provides an in vitro method for isolating clonal cells producing high levels of a recombinant protein, the method comprising the steps of: A) providing a cell line according to the invention comprising an expression vector as defined in the "Expression Vectors" section above a1); or a2) providing a cell line according to the invention, and a2') introducing an expression vector as defined in the "Expression Vectors" section above into the cell line provided in step a2); or a3) providing a cell line comprising an endogenous DHODH gene; a3') partially or completely inactivating the endogenous DHODH gene in the cell line provided in step a3), and a3'') introducing an expression vector as defined in the "Expression Vectors" section above into the cell line containing the partially or completely inactivated endogenous DHODH gene obtained in step a3'); B) culturing the cell line under conditions suitable for the production of the recombinant protein; and C) Isolating clones producing high levels of recombinant protein Includes.

[0127] In a particular embodiment, step B) of the above method is carried out in a medium free of uridine, more particularly free of a DHODH inhibitor, and comprises a substep consisting of selecting transfected cells which grow despite the absence of uridine, and in particular despite the additional absence of a DHODH inhibitor.

[0128] Said expression vector may be introduced into said cell line in step a2') or a3'') by any technique well known to those skilled in the art, such as transfection, in particular electroporation or chemical transfection, or transduction.

[0129] Suitable conditions for the production of recombinant proteins are well known to those skilled in the art, for example the protocols described in the Examples may be used.

[0130] In a particular embodiment, the medium used in step B) contains a decreasing concentration of uridine, which makes it possible to select clones in which the exogenous DHODH gene (and thus the sequence encoding the recombinant protein) from the vector has been amplified.

[0131] The method may further comprise the step of formulating the recombinant protein into a pharmaceutical composition.

[0132] Throughout the specification, terms such as "comprises," "comprised," and "comprising" have the meanings ascribed to them in most patent jurisdictions, preferably in the jurisdiction at issue; for example, they may mean "includes," "included," "including," etc. Terms such as "consisting," "consisting essentially of," and "consisting essentially of" have the meanings ascribed to them in most patent jurisdictions, preferably in the jurisdiction at issue; for example, they indicate the exclusion of all, a majority, or all but a negligible amount of other elements, which allow for elements not expressly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

[0133] Several documents are cited throughout the text of this specification. Each of these documents cited herein (including any journal articles or abstracts, published or unpublished patent applications, issued patents, manufacturer's specifications, instructions, etc.) is hereby incorporated by reference. However, no admission is made that any document cited herein is in fact prior art with respect to the present invention.

[0134] The invention will now be further described with reference to the following figures and examples, which are illustrative only and are not intended to limit the invention.

[0135] The invention is defined by the claims, which should be interpreted in conjunction with the specification and drawings.

[0136] A brief description of the sequence [Table 2] [Table 3] EXAMPLES

[0137] Example 1 Obtaining the CHO 9E4 cell line This example describes the derivation of the CHO 9E4 cell line from the CHO-K1 cell line commercially available from the ATCC under the number ATCC CCL-61.

[0138] 1. CHO-K1 cell line A vial of CHO-K1 cells (ATCC CCL-61), frozen in the presence of bovine serum in 1969, was obtained from ATCC.

[0139] 2. Ex-Cell TM Thawing vials in 302 medium and preparation of CHO-LG-APF banks CHO-K1 vials were cultured in Ex-Cell TMThe resulting CHO-LG-APF bank was expanded in Ex-Cell 302 medium (SAFC) after 12 passages and 17.3 generations. TM The cells were frozen in medium 302.

[0140] 3. Ex-Cell TM Thawing of CHO-LG-APF bank in 302 medium and preparation of ABC-024 P22 bank CHO-LG-APF vial was placed in Ex-Cell TM The resulting ABC-024 P22 bank was thawed after 18.5 generations and amplified in medium 302.

[0141] 4. Adaptation of CMV07-024 bank to CDCHO fusion medium and preparation of ABC-003 bank CMV07-024 bank was thawed and incubated in Ex-cell supplemented with 4 mM glutamine. TM The ABC-003 bank was directly adapted to CDCHO fusion medium (SAFC) and cultured on a shaker for 12.5 generations. TM The cells were acclimatized in CDCHO fusion medium until freezing.

[0142] 5. Thawing of ABC-003 bank in CDCHO fusion medium and preparation of ABC-053 bank in CDCHO fusion medium The ABC-003 vial was thawed in CDCHO fusion medium and after dilution, the ABC-53 bank was frozen after 4.2 generations.

[0143] 6. Thawing, selection, and cloning of the ABC-053 bank in CDCHO fusion medium and preparation of the P15A11 bank in CDCHO fusion medium Ex-cell supplemented with 4mM glutamine TMThe ABC-053 bank was thawed in CDCHO fusion medium (SAFC). The culture was amplified and then cloned by limiting dilution on plates and then amplified in CDCHO fusion medium. The bank of clone P15A11 resulting from this cloning was frozen. This cloning and amplification corresponds to approximately 94 generations.

[0144] 7. Thawing of P15A11 bank in CDCHO fusion medium, acclimatization of bank by direct passaging in CDCHO, and preparation of CHOSP10-002 bank in CDCHO medium Ex-cell supplemented with 4mM glutamine TM The P15A11 bank was thawed in CDCHO fusion medium (SAFC) and after 2 passages in CDCHO fusion medium, the cells were diluted in CDCHO medium. After 3 passages in CDCHO medium, the CHOSP10-002 bank was frozen after a total of 15.9 generations.

[0145] 8. Thawing, amplifying, removing clumps by centrifugation, and selecting by clump-free subculture in 96-well plates, amplifying in 6-well plates and on a shaker to prepare CHOSP10-012 bank in CDCHO medium The CHOSP10-002 bank was thawed and then amplified in CDCHO medium (Invitrogen) supplemented with 6 mM glutamine. The culture was centrifuged to remove cell clumps, and culture was continued using only cells isolated from the supernatant. At this stage, 11.3 generations were generated from the thaw. The culture was split at 10 cells per well in 96-well plates. Wells containing cells growing isolated in suspension were expanded in 6-well plates and then on a shaker. The CHOSP10-012 bank was expanded for 23.2 generations before freezing.

[0146] 9. Thawing of CHOSP10-012 bank, amplifying and preparing CHOSP11-008 bank (9E4 bank) The CHOSP10-012 bank was thawed in CDCHO medium (Invitrogen) supplemented with 6 mM glutamine and then amplified from the Erlenmeyer stage up to a 17 liter bioreactor. The 9E4 bank was frozen after a total of 10 generations.

[0147] Example 2: Production of a CHO cell line with a nullified DHODH gene A - Design and construction of CRISPR CAS9 guide RNA (gRNA) To disable the DHDOH gene in CHO cells, we started by retrieving the hamster DHODH gene sequence and using the publicly available Tefor software to design different guide RNAs (gRNAs) for transfection with CRISPR-Cas9 in the CHO genome. The entire CHO DHODH sequence, including introns and exons, is shown in Figure 1.

[0148] The software determined eight sequences that could target the DHODH gene: Array 1 CACCGGGATGCAGCCATCATCCTTG (SEQ ID NO:6) AAAACCAAGGATGATGGCTGCATCC (SEQ ID NO: 7) Array 2 CACCGGATGCAGCCATCATCCTTGG (SEQ ID NO:8) AAAACCCAAGGATGATGGCTGCATC (SEQ ID NO: 9) Array 3 CACCGGCAGCCATCATCCTTGGGGG (SEQ ID NO: 10) AAAACCCCCCAAGGATGATGGCTGC (SEQ ID NO:11) Array 4 CACCGGCCATCATCCTTGGGGGAGG (SEQ ID NO: 12) AAAACCCTCCCCCAAGGATGATGGC (SEQ ID NO: 13) Array 5 CACCGGCTATTCGCTTCACGTCCCT (SEQ ID NO: 14) AAAACAGGGACGTGAAGCGAATAGC (SEQ ID NO: 15) Array 6 CACCGGCCTCTACAAACTGGGCTTT (SEQ ID NO: 16) AAAACAAAGCCCAGTTTGTAGAGGC (SEQ ID NO: 17) Array 7 CACCGGGGCTTTGGGTTTGTCGAGGT (SEQ ID NO: 18) AAAACACCTCGACAAACCCAAAGCC (SEQ ID NO: 19) Array 8 CACCGGCTGGTCTGAGGAGCCTACA (SEQ ID NO:20) AAAACTGTAGGCTCCTCAGACCAGC (SEQ ID NO:21)

[0149] Eight sequences were tested and cloned, but only four of the eight cloned sequences were transfected, and only one successfully generated a knockout of the DHODH gene. The following 20 nucleotide sequence was used as the corresponding piece of DNA to generate a gRNA as shown in FIG. 2: GGATGCAGCCATCATCCTTG (SEQ ID NO: 5), which targets the second exon of the DHODH gene. To obtain the appropriate gRNA transcript, two oligonucleotides were used: [ka] was synthetically produced, annealed and cloned into the unique BaeI site of pCM3561 (commercially available from Invitrogen).

[0150] The cloned DNA sequence was thereby under the control of the U6 promoter, and when the DNA was transfected into CHO cells, it was transcribed into a single transcription unit containing the crRNA fused to the tracrRNA, the crRNA portion being specific for the second exon of the DHODH gene, whereas the tracrRNA was recognized by the Cas9 enzyme itself.

[0151] B- Preparing materials for CRISPR-Cas9 gene editing CHO 9E4 cells were isolated and selected from CHO K-1 cells purchased from ATCC as disclosed in Example 1, and were grown and maintained as suspension cultures in CDCHO serum-free, chemically defined medium, optimized for the growth of Chinese Hamster Ovary (CHO) cells, supplemented with 6 mM L-glutamine, at 37° C. in an incubator with 8% CO2 and 80% humidity.

[0152] 10 μg of sgRNA expression vector (pCM3561) was digested with 1 μL of BaeI enzyme at 5 units / μl supplemented with 20 μM S-adenosylmethionine (SAM) for 1 hour at 25° C., and then the digested plasmid was separated by electrophoresis using a 1% agarose gel. The resulting sgRNA cloning vector was then recovered by gel extraction kit (Qiagen Kit).

[0153] The sgRNA cloning vector and the annealed guide oligonucleotides were ligated using T4 DNA ligase enzyme (Biolabs) and incubated for 10 minutes at room temperature.

[0154] 5 μL of the ligation product was added to 50 μL of E. coli DH5a competent cells (Invitrogen).

[0155] The cells and DNA were incubated on ice for 30 minutes and then heat shocked at 42°C for 45 seconds. 500mL SOC medium was added and incubated at 37°C (800 rpm) for 1 hour to give the bacteria time to develop the antibiotic resistance encoded on the plasmid backbone. After incubation, each tube was spread onto one coated LB supplemented with 100μg / mL ampicillin. The dishes were incubated overnight at 37°C. A negative control (water instead of insert DNA) was used to assess the success of the transformation.

[0156] For the amplification step, two colonies per construct were selected and inoculated into 2 mL of LB medium supplemented with 100 μg / ml ampicillin in tubes that were placed overnight in an incubator (37° C., 700 rpm). The overnight cultures were harvested by centrifugation. QIAprep Miniprep Kit TM Amplified DNA was recovered (eluted with EB buffer) using a QIAGEN kit. The sequences of the guide oligonucleotides of interest were then confirmed by Sanger sequencing (sense and antisense sequencing, GATC Company). After verification by alignment with Vector NTI software (Thermofisher Scientific), the corresponding colonies were used to inoculate 200 mL of LB medium supplemented with 100 μg / ml ampicillin. After 24 h of incubation, bacteria were harvested by centrifugation at 6000 g for 15 min at 4°C. EndoFree Plasmid Maxi Kit TM MaxiPrep was prepared using a 500 µL ELISA kit (QIAGEN). DNA was precipitated by adding isopropanol at room temperature. After 1 h of centrifugation (4°C, 8000 rpm), the DNA pellet was washed with endotoxin-free room temperature 70% ethanol. After a short new centrifugation, the pellet was air-dried for 1 h and redissolved in an appropriate volume of endotoxin-free sterile water to obtain a DNA concentration of 5 mg / mL. DNA concentration was measured using a nanodrop device.

[0157] Four different plasmids were prepared, namely pBH6840 plasmid (KO DHODH SEQ1), pBH6841 plasmid (KO DHODH SEQ4), pBH6842 plasmid (KO DHODH SEQ5) and pBH6843 plasmid (KO DHODH SEQ7). The target of these plasmids in the CHO DHODH gene is shown in the sequence SEQ ID NO:22.

[0158] DNA sequencing was performed by GATC's subcontractor - A Eurofins Genomics Company.

[0159] C- CRISPR-Cas9 gene editing Transfections were performed by electroporation using MaxCyte STX and its CHO-specific protocol, which were performed in an OC-100 (20 million cells per transfection) processing assembly.

[0160] The day before transfection, cells were diluted to 1.5 × 10 6 Cells / mL were seeded in CDCHO medium supplemented with 6 mM L-glutamine.

[0161] On the day of transfection, cells were counted in a ViCell instrument (Beckman & Coulter). The required number of cells was centrifuged at 250 g for 10 min and the supernatant was discarded.

[0162] For each transfection condition, 20 × 10 6 The cells were centrifuged for 10 min at 250 g. The pellet was resuspended with 70 μL Maxcyte buffer. 30 μg of DNA was added and the mixture (cells, buffer and DNA) was transferred to a 100 μL Maxcyte electroporation cassette. The processing assembly used was OC-100 specific for the 100 μL cassette and the CHO optimized program was selected.

[0163] The following transfections were performed: [Table 4]

[0164] After electroporation, the cells were transferred to a 25 mL working Erlenmeyer flask. They were placed in a static incubator at 37°C, 5% CO2 for 45 minutes. 25 mL of CDCHO medium supplemented with 6 mM L-glutamine was then added to resuspend the cells, and the Erlenmeyer flask was placed on a shaker at 37°C, 5% CO2, 70% humidity, 110 rpm.

[0165] The day after electroporation, a single cell per well was seeded by limiting dilution from the CHO9E4 transfected pool described above. After approximately 20 days, when the cells were approximately 90% confluent and looked normal when examined under a microscope, the cells were split into two new 96-well plates with or without uridine.

[0166] Several clones were selected for their sensitivity to uridine depletion and were adapted for growth in CDCHO medium supplemented with 6 mM glutamine and 5 mM uridine.

[0167] To confirm that gene editing was successful, we used the Qiagen DNeasy kit TM Genomic DNA was extracted from CRISPR-Cas9 clone cells using Qiagen. The targeted locus was amplified by PCR using primers appropriate for the region of the DHODH locus targeted by CRISPR-Cas9, and the PCR products were sequenced by NGS using PCR fragments covering the potential deleted region.

[0168] Example 3 : Production of an alternative CHO cell line in which the DHODH gene has been disabled A - Design and construction of CRISPR CAS9 guide RNA (gRNA) To disable the DHDOH gene in CHO cells, we started by retrieving the hamster DHODH gene sequence and using the publicly available Tefor software to design different guide RNAs (gRNAs) for transfection with CRISPR-Cas9 in the CHO genome.

[0169] The software determined eight sequences that could target the DHODH gene: Sequence 1' GGATGCAGCCATCATCCTTGGTTTT (SEQ ID NO:24) CAAGGATGATGGCTGCATCCCGGTG (SEQ ID NO:25) Sequence 2' GATGCAGCCATCATCCTTGGGTTTT (SEQ ID NO:27) CCAAGGATGATGGCTGCATCCGGTG (SEQ ID NO:28) Sequence 3' GCAGCCATCATCCTTGGGGGGTTTT (SEQ ID NO:29) CCCCCAAGGATGATGGCTGCCGGTG (SEQ ID NO:30) Sequence 4' GCCATCATCCTTGGGGGAGGGTTTT (SEQ ID NO:31) CCTCCCCCAAGGATGATGGCCGGTG (SEQ ID NO:32) Sequence 5' GCTATTCGCTTCACGTCCCTGTTTT (SEQ ID NO:33) AGGGACGTGAAGCGAATAGCCGGTG (SEQ ID NO:34) Sequence 6' GCCTCTACAAACTGGGCTTTGTTTT (SEQ ID NO:35) AAAGCCCAGTTTGTAGAGGCCGGTG (SEQ ID NO:36) Sequence 7' GGCTTTGGGTTTGTCGAGGTGTTTT (SEQ ID NO:37) ACCTCGACAAACCCAAAGCCCGGTG (SEQ ID NO:38) Sequence 8' GCTGGTCTGAGGAGCCTACAGTTTT (SEQ ID NO:39) TGTAGGCTCCTCAGACCAGCCGGTG (SEQ ID NO: 40)

[0170] Eight sequences were tested and cloned, but of the eight sequences, only four cloned sequences were transfected, and only one was successful in generating a knockout of the DHODH gene. The following 20 nucleotide sequence was used as the DNA counterpart to generate the gRNA: GGATGCAGCCATCATCCTTG (SEQ ID NO:5), which targets the second exon of the DHODH gene. To obtain proper gRNA transcription, two oligonucleotides GGATGCAGCCATCATCCTTGGTTTT (oligo1', SEQ ID NO:24) and CAAGGATGATGGCTGCATCCCGGTG (oligo2', SEQ ID NO:25) were synthetically generated, annealed, and cloned into the unique BaeI site of pCM3561 (commercialized by Invitrogen).

[0171] Thereby, the cloned DNA sequence was under the control of the U6 promoter, and when the DNA was transfected in CHO cells, it was transcribed into a single transcription unit containing the crRNA fused to the tracrRNA, the crRNA part being specific for the second exon of the DHODH gene, whereas the tracrRNA is recognized by the Cas9 enzyme itself.

[0172] B- Preparing materials for CRISPR-Cas9 gene editing CHO 9E4 cells were isolated and selected from CHO K-1 cells purchased from ATCC as disclosed in Example 1, and were grown and maintained as suspension cultures in CHO serum-free, chemically defined medium optimized for the growth of Chinese Hamster Ovary (CHO) cells supplemented with 6 mM L-glutamine at 37° C., 8% CO2 and 80% humidity.

[0173] 10 μg of sgRNA expression vector (pCM3561) was digested with 1 μL 5 units / μl of BaeI enzyme supplemented with 20 μM S-adenosylmethionine (SAM) at 25° C. for 1 hour, and then the digested plasmid was separated by electrophoresis using a 1% agarose gel. The resulting sgRNA cloning vector was then recovered by gel extraction kit (Qiagen Kit).

[0174] The sgRNA cloning vector and the annealed guide oligonucleotides were ligated using T4 DNA ligase enzyme (Biolabs) and incubated for 10 minutes at room temperature.

[0175] 5 μL of the ligation product was added to 50 μL of E. coli DH5a competent cells (Invitrogen).

[0176] The cells and DNA were incubated on ice for 30 min, then heat shocked at 42°C for 45 s. 500 mL SOC medium was added and incubated at 37°C (800 rpm) for 1 h to give the bacteria time to produce the antibiotic resistance protein encoded on the plasmid backbone. After incubation, each tube was spread onto one coated LB supplemented with 100 μg / mL ampicillin. The dishes were incubated overnight at 37°C. A negative control (water instead of insert DNA) was used to assess the success of the transformation.

[0177] For the amplification step, two colonies per construct were selected and inoculated into 2 mL of LB medium supplemented with 100 μg / mL ampicillin in tubes that were placed in an incubator overnight (37° C., 700 rpm). The overnight cultures were harvested by centrifugation. QIAprep Miniprep Kit TMAmplified DNA was recovered (eluted with EB buffer) using a QIAGEN kit. The sequence of the desired guide oligonucleotide was then confirmed by Sanger sequencing (sense and antisense sequencing, GATC Company). After verification by alignment with Vector NTI software (Thermofisher Scientific), the corresponding colonies were used to inoculate 200 mL of LB medium supplemented with 100 μg / ml ampicillin. After 24 h of incubation, bacteria were harvested by centrifugation at 6000 g for 15 min at 4°C. EndoFree Plasmid Maxi Kit TM MaxiPreps were prepared using a ELISA kit (QIAGEN). DNA was precipitated by adding isopropanol at room temperature. After centrifugation for 1 h (4°C, 8000 rpm), the DNA pellet was washed with endotoxin-free room temperature 70% ethanol. After another short centrifugation, the pellet was air-dried for 1 h and redissolved in an appropriate volume of endotoxin-free sterile water to a DNA concentration of 5 mg / mL. DNA concentration was measured using a nanodrop device.

[0178] Four different plasmids were prepared, namely pBH6840 plasmid (KO DHODH SEQ1), pBH6841 plasmid (KO DHODH SEQ4), pBH6842 plasmid (KO DHODH SEQ5) and pBH6843 plasmid (KO DHODH SEQ7).

[0179] DNA sequencing was performed by GATC's subcontractor - A Eurofins Genomics Company.

[0180] C- CRISPR-Cas9 gene editing Transfections were performed by electroporation using MaxCyte STX and its CHO-specific protocol, which were performed in an OC-100 (20 million cells per transfection) processing assembly.

[0181] The day before transfection, cells were diluted to 1.5 × 10 6 Cells / mL were seeded in CDCHO medium supplemented with 6 mM L-glutamine.

[0182] On the day of transfection, cells were counted in a ViCell instrument (Beckman & Coulter). The required number of cells was centrifuged at 250 g for 10 min and the supernatant was discarded.

[0183] For each transfection condition, 20 × 10 6 The cells were centrifuged for 10 min at 250 g. The pellet was resuspended with 70 μL Maxcyte buffer. 30 μg of DNA was added and the mixture (cells, buffer and DNA) was transferred to a 100 μL Maxcyte electroporation cassette. The processing assembly used was OC-100 specific for the 100 μL cassette and the CHO optimized program was selected.

[0184] The following transfections were performed: [Table 5]

[0185] After electroporation, the cells were transferred to a 25 mL working Erlenmeyer flask. These were placed in a static incubator at 37°C, 5% CO2 for 45 minutes. 25 mL CDCHO medium supplemented with 6 mM L-glutamine was added to resuspend the cells, and the Erlenmeyer flask was placed in a 110 rpm shaker at 37°C, 5% CO2, 70% humidity.

[0186] The day after electroporation, a single cell per well was seeded by limiting dilution from the CHO9E4 transfected pool described above. After approximately 20 days, when the cells were approximately 90% confluent and looked normal when examined under a microscope, the cells were split into two new 96-well plates with or without uridine.

[0187] Several clones were selected for their sensitivity to uridine depletion and were adapted for growth in CDCHO medium supplemented with 6 mM glutamine and 5 mM uridine.

[0188] To confirm that gene editing was successful, we used the Qiagen DNeasy kit TM Genomic DNA was extracted from CRISPR-Cas9 clone cells using Qiagen. The targeted locus was amplified by PCR using primers appropriate for the region of the DHODH locus targeted by CRISPR-Cas9, and the PCR products were sequenced by NGS using PCR fragments covering the potential deleted region.

[0189] Example 4 Use of DHODH-deficient CHO cell lines for recombinant protein production To verify whether these clones were capable of expressing antibodies without teriflunomide, antibody production was tested in the effective DHODH-deficient CHO clones obtained in Examples 2 or 3.

[0190] The designed vectors were manufactured and prepared at a concentration of 5 mg / mL, all of which, apart from the transposase-encoding plasmid pBH6209, have ITRs that allow the use of a transposon system for integration of the plasmid in the genome of the producer cell.

[0191] The cell lines used were CHO 9E4_SP11 wild type and KO2 and KO19 knockouts for DHODH.

[0192] CHO 9E4_SP11 was cultured in CDCHO medium supplemented with 6 mM L-glutamine.

[0193] KO2 and KO19 were cultured in CDCHO medium supplemented with 6 mM L-glutamine and 5 mM uridine.

[0194] These were initially cultured in 25 mL working Erlenmeyer flasks and amplified until the required viable cell number was reached.

[0195] A variety of proteins were produced in a Maxcyte STX device using a highly efficient electroporation protocol developed by Maxcyte.

[0196] One day before transfection, cells were cultured at 1.5 × 10 6 was divided into

[0197] On the day of transfection, cells were co-transfected with two vectors: a DNA plasmid expression vector containing human anti-CD38 heavy chain (HC) and light chain (LC) expression cassettes flanked by PiggyBac recognition sites (inverted terminal repeats, ITRs) and a DHODH selection marker (as described in WO2016 / 062837), and a transposase vector from Transposagen that catalyzes the movement of the transposon into the CHO genome at a TTAA site.

[0198] For each transfection condition, 80 x 10 6 The cells were centrifuged for 10 min at 250 g. The pellet was resuspended in 250 μL Maxcyte buffer. 120 μg of DNA was added and the mixture (cells, buffer and DNA) was transferred to a 400 μL Maxcyte electroporation cassette. The processing assembly used was the OC-400 specific for the 400 μL cassette and the CHO optimized program was selected.

[0199] For the recovery step, the transfected cells were immediately transferred to a 125 ml flask for 40 min at 37° C. without stirring. 25 mL of pre-warmed CDCHO medium supplemented with 6 mM glutamine (+5 mM uridine for KO cells) was added and the transfected cultures were maintained in an incubator at 37° C. with 8% CO2 and 80% humidity. One day after transfection, the cells were centrifuged and transferred to 125 ml of CDCHO medium supplemented with 6 mM glutamine, 30% FeedB (Gibco) and various amounts of teriflunomide (0, 5, 15 and 25 μM). TM 1 × 10 6 Resuspended at 100 cells / mL.

[0200] Fourteen days after transfection, the cells were centrifuged at 200 g for 10 min at 25° C. The supernatant was filtered through a 0.22 μm PES filter and the antibody titers were measured using an Octet instrument.

[0201] As shown in FIG. 3, two clones (KO2 and KO19) showed good production without teriflunomide, and genomic NGS showed that these two clones contained knockout mutations in two alleles of the DHODH locus.

[0202] Surprisingly, all KO clones produced antibodies even in the absence of teriflunomide as a selection agent. Two clones, KO2 and KO19, were selected for further studies. Furthermore, these cited clones were the only ones that showed homozygous knockout of the DHODH gene.

[0203] Thus, this example demonstrates that the present invention provides a set of cell lines and vectors that allow the production of antibodies without the use of any selective pressure.

[0204] Example 5 : Evaluation of three human DHODH variants To determine whether the use of impaired forms of human DHODH would enhance the integration copy number into the CHO genome and thus allow better productivity, DHODH KO2, KO19 and WT CHO 9E4 cell lines were transfected with three human DHODH cDNA variants described in Miller syndrome patients (R135C, G202A and R346W, see Fang et al. (2012) Biosci.32:631-639 for details). As a control vector, a plasmid carrying a cDNA encoding human WT DHODH was transfected.

[0205] 50 ng of plasmid vector encoding human anti-CD38 monoclonal antibody, mAb-A (pBH6204), digested with SalI-BglII restriction enzymes, was mixed with 37.5 ng of SalI-BglII purified DNA fragments corresponding to each variant (R135C, G202A, and R346W). After adding 1 μL of T4-DNA ligase (BioLabs) and concentrated ligation buffer, the ligation reaction (final volume 10 μL) was carried out for 10 min at room temperature.

[0206] An aliquot of this DNA pool was then used to infect E. coli competent cells (Stellar TM , Takara) was transformed.

[0207] Small-scale plasmid preparations were performed using the commercially available Qiagen plasmid miniprep kit (Qiagen) according to the manufacturer's recommendations.

[0208] DNA sequencing using 603 sense (sequence GTTGGCCTTCCAATGGCTT, SEQ ID NO: 41) and 503 antisense (sequence GTTCCTTCACAAAGAT, SEQ ID NO: 42) oligonucleotides was performed by a GATC subcontractor - A Eurofins Genomics Company.

[0209] Transfection of DHODH variants was performed by electroporation using MaxCyte STX. These were performed with the OC-100 processing assembly as described above.

[0210] One day after transfection, cells were centrifuged and plated at 1 × 10 in CD CHO selection medium supplemented with 6 mM glutamine and 25 μM teriflunomide for 9E4 CHO cells, and without teriflunomide for KO2 and KO19 clones. 6 Resuspended at 100 cells / mL.

[0211] After two passages, production of mAb-A was increased to 0.3 × 10 in CD OPTiCHO medium supplemented with 30% FeedB, 6 mM glutamine, and 25 μM teriflunomide for 9E4 CHO cells, and without teriflunomide for KO2 and KO19 clones. 6 Started with cells / mL.

[0212] Fourteen days after transfection, the cells were centrifuged at 200 g for 10 min at 25° C. The supernatant was filtered through a 0.22 μm PES filter and the antibody titers were measured using an Octet instrument.

[0213] As shown in Figure 4, no significant effect was observed with the R138C and R346W DHODH mutations in WT CHO 9E4 and DHODH KO clones. On the other hand, the G202A mutation allowed us to obtain gram-scale antibody production using the WT CHO 9E4 strain and enhanced the productivity of the DHODH KO2 and KO19 clones.

[0214] Example 6 Protein production using the expression system of the present invention To ensure that final productivity is at least in the same range as prior art expression systems using human glutamine synthetase (GS) as a selectable marker, a variety of proteins were produced using the expression system of the present invention, in particular using the human DHODH cDNA containing the G202A mutation disclosed above in the validated clones CHO 9E4 KO2 and KO19 disclosed in Example 3 above.

[0215] The following proteins were produced: - Lipase : using the monocistronic cDNA PLBL2-His, and Uses the selectable marker hDHODH G202A plasmid or hGS plasmid, - Monoclonal antibody (mAb-B) : Uses a bicistronic cDNA encoding the VH and VL chains of the antibody, and Uses the selectable marker hDHODH G202A plasmid or hGS plasmid; - bispecific antibody : (i) using a bicistronic cDNA encoding the VH and VL chains of the antibody, or (ii) using two monocistronic cDNAs encoding the VH and VL chains of the antibody, respectively; and Use of selectable markers (i) hDHODH G202A plasmid (bicistronic cDNA) or (ii) two hDHODH G202A plasmids or hDHODH G202A plasmid and hGS plasmid (monocistronic cDNA); - trispecific antibody : using two bicistronic cDNAs, and Uses selectable markers hDHODH G202A plasmid and hGS plasmid.

[0216] One day prior to FectoPRO® transfection, 1.5×10 cells were cultured in CD40 CHO medium supplemented with 6 mM glutamine and 5 mM uridine. 6 Cells were diluted to 100 cells / mL.

[0217] On the day of transfection, 1.1 × 10 6 The cell suspension was diluted to 1000 cells / ml. The FectoPRO® Reagent was vortexed for 5 seconds and spun down before adding 25 μL / tube to an empty 50 mL tube. In a second 50 mL tube, 12.5 μg of cDNA was diluted in CD CHO medium and the diluted DNA was added all at once to the pure FectoPRO® Reagent. This solution was homogenized immediately and incubated for 10 minutes. The FectoPRO® / DNA transfection mix was poured onto the cells and the culture was incubated at 37° C., 190 rpm and a CO2 level of 8%.

[0218] 24 hours after transfection, cells were transfected with Invitrogen TM Countess TM The cells were counted using the ELISA kit. The whole cell culture was centrifuged at 200 g for 10 minutes. The pellet was resuspended in 5 mL of pre-warmed Production Medium 2 at the conditions disclosed below.

[0219] In the case of complex proteins containing three or more subunits, a second transfection was performed again using the transfection protocol described above.

[0220] [Table 6]

[0221] [Table 7]

[0222] [Table 8]

[0223] [Table 9]

[0224] 72 hours after transfection, Invitrogen TM Countess TM The cells were counted using an instrument and changed to a different medium to boost protein production, and the viability of the transfected cells was measured 3 and 7 days after transfection.

[0225] 14 days after transfection, the cells were centrifuged at 200 g for 10 min at 25° C. The supernatant was filtered through a 0.22 μm PES filter and the protein titer was determined using an Octet instrument.

[0226] The following results were obtained.

[0227] a) Lipase [Table 10]

[0228] Lipase production on day 14 is shown in FIG.

[0229] These results indicate that both KO DHODH cell lines have the ability to produce lipase in the absence of teriflunomide selective pressure, allowing for reduced toxicity to producing cells.

[0230] Furthermore, the KO DHODH cell line was able to produce lipase in the same range as the prior art GS system (in wild type 9E4 CHO cells), i.e. 1 g / l at 25 ml scale.

[0231] b) Monoclonal antibody mAb-B [Table 11]

[0232] Monoclonal antibody mAb-B production on day 14 is shown in FIG.

[0233] These results indicate that the KO DHODH cell lines behaved differently during the production of this particular antibody. Indeed, the KO19 clone produced significantly better productivity than the KO2 clone, even though both clones produced better productivity than prior art teriflunomide production.

[0234] In the best KO cell line (KO19), antibody production was in the same range as the prior art GS system (in wild type 9E4 CHO cells) at approximately 0.67 g / l at 25 ml scale.

[0235] Furthermore, increased viability was observed using the KO cell lines.

[0236] c) bispecific antibody [Table 12]

[0237] Bispecific antibody production on day 14 is shown in FIG.

[0238] Bispecific antibodies were not produced as efficiently as monospecific antibodies in all cases tested, but despite the difficulties in producing this type of bispecific antibody, the productivity of the best KO cell line was in the same range as the prior art GS system (in wild type 9E4 CHO cells), approximately 0.145 g / l at 25 ml scale.

[0239] Furthermore, increased viability was observed using the KO cell lines.

[0240] d) trispecific antibody [Table 13]

[0241] Trispecific antibody production on day 14 is shown in FIG.

[0242] In all conditions, the two KO cell lines produced results in the same range as the prior art selection system, ie, excellent at 0.5 g / l.

[0243] This example therefore confirms that KO DHODH CHO clones are suitable for the expression of various protein formats (proteins, monoclonal antibodies, bispecific antibodies, trispecific antibodies). These clones can even be used in double transfections to produce complex proteins.

Claims

1. 1. A cell line comprising a partially or completely inactivated endogenous dihydroorotate dehydrogenase (DHODH) gene, said cell line being selected from among a Chinese Hamster Ovary (CHO) cell line, HEK293, HKB11, PER-C6, HT1080, Jurkat, Daudi, Raji and CAP cell line.

2. 2. The cell line of claim 1 which is a Chinese Hamster Ovary (CHO) cell line.

3. The cell line is a) inactivating the endogenous DHODH gene in a cell; and b) culturing the cells in a medium containing uridine under conditions suitable to generate a cell line in which the endogenous DHODH gene is partially or completely inactivated. The cell line according to claim 1 or 2, produced by

4. The cell line of claim 3, wherein the endogenous DHODH gene is inactivated by gene editing.

5. The cell line of claim 4, wherein the endogenous DHODH gene is inactivated by the CRISPR-Cas9 method.

6. The cell line of any one of claims 1 to 5, wherein one or more or all alleles of the endogenous DHODH gene are partially or completely inactivated.

7. The cell line of any one of claims 1 to 6, further comprising an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein the exogenous DHODH comprises a sequence that is at least 90% identical to the sequence of SEQ ID NO:2 or the sequence of SEQ ID NO:

4.

8. (i) a cell line according to any one of claims 1 to 6, and (ii) an expression vector comprising a nucleotide sequence encoding a mammalian DHODH and at least one expression cassette for expressing the recombinant protein; wherein the DHODH comprises a sequence that is at least 90% identical to the sequence of SEQ ID NO:2 or the sequence of SEQ ID NO:

4.

9. The cell line of claim 7 or the expression system of claim 8, wherein the nucleotide sequence comprises the sequence of SEQ ID NO: 1 or the sequence of SEQ ID NO:

3.

10. 10. The cell line of claim 7 or 9 or the expression system of claim 8 or 9, wherein the recombinant protein is a monoclonal antibody.

11. The cell line of any one of claims 7, 9 and 10 or the expression system of any one of claims 8 to 10, wherein the vector comprises a first expression cassette suitable for cloning an antibody light chain and a second expression cassette suitable for cloning an antibody heavy chain.

12. A kit comprising (i) a cell line according to any one of claims 7 and 9 to 11, or an expression system according to any one of claims 8 to 11, and (ii) a uridine-free medium.

13. A) a1) providing a cell line according to any one of claims 7 and 9 to 11; or a2) providing a cell line according to any one of claims 1 to 6, and a2') introducing an expression vector as defined in any one of claims 9 to 11 into the cell line provided in step a2); or a3) providing a cell line comprising an endogenous DHODH gene; a3') partially or completely inactivating the endogenous DHODH gene in the cell line provided in step a3); and a3'') introducing an expression vector as defined in any one of claims 9 to 11 into a cell line containing a partially or completely inactivated endogenous DHODH gene obtained in step a3'); B) culturing the cell line under conditions suitable for the production of the recombinant protein; and C) isolating and / or purifying the recombinant protein. A method for producing a recombinant protein in vitro, comprising:

14. The method according to claim 13, wherein step B) is carried out in a medium containing no uridine.

15. The method according to claim 13 or 14, further comprising a step D) of formulating the recombinant protein into a pharmaceutical composition.

16. Use of a cell line according to any one of claims 7 and 9 to 11, an expression system according to any one of claims 9 to 11, or a kit according to claim 12 for producing a recombinant protein.

17. 17. The use according to claim 16, wherein the cell line, expression system or kit is used in combination with a medium that does not contain uridine.

18. The kit of claim 12, wherein the uridine-free medium does not further contain a DHODH inhibitor.

19. The method of claim 14, wherein the uridine-free medium further does not contain a DHODH inhibitor.

20. The method or use according to claim 17.

Images