Compounds that induce expression of anti-aging gene KLOTHO and uses thereof

Abstract

To provide a composition for inhibiting cellular senescence.SOLUTION: A composition for inhibiting cellular senescence comprises a compound represented by the formula in the figure or a pharmaceutically acceptable salt thereof. (In the formula, L1 is a single bond; R1 and R2 are each H, OH, C1-10 straight or branched alkyl, or the like; and R3 to R7 are each H, halogen, NO2, or C1-10 straight or branched alkyl.)SELECTED DRAWING: Figure 5

Description

[Technical field]

[0001] The present invention relates to a compound that induces the expression of the anti-aging gene klotho and uses thereof. [Background technology]

[0002] The fact that there are genes that can regulate aging in animals was discovered with the report of senescence-accelerated mice (SAM) in 1981. These mice, which were accidentally created during the breeding of AKR / J mice, aged much faster than the same strain of mice, and it was confirmed that these mice had mutations in various genes. After that, the discovery of a single group of aging-related genes was reported in the 1990s. The reported genes were the RecQ family, which express an enzyme called DNA helicase. It was reported that mutations in this gene can cause premature aging and cancer, and this is known to occur by affecting DNA repair. A single gene related to aging is the klotho gene, which was reported in 1997. The klotho gene was discovered by chance while creating a genetically modified animal model of hypertensive mice, and mice that no longer expressed this gene showed premature aging and a shortened lifespan. An even more interesting fact is that mice in which the expression of this gene was subsequently increased showed a 20.0-30.8% increase in male lifespan and a 18.8-19.0% increase in female lifespan. This marked the first time that the public was made aware of the fact that the expression of a single gene can increase or decrease a mouse's lifespan. It was also reported that the base sequence of the Klotho gene is very similar between animals, with about 98% identity between mice and humans. This indicates that lifespan can also be regulated by the expression of the Klotho gene in humans.

[0003] In humans, the klotho gene is located on chromosome 13 and produces a membrane protein with a base sequence similar to that of β-glucosidase. Klotho protein is mainly expressed in renal tubular epithelial cells and the choroid plexus of the brain, and it has been reported that some of it is expressed in the parathyroid gland. The klotho gene is a gene associated with various aging phenotypes, and mice lacking the klotho gene develop syndromes similar to the aging process, such as reduced lifespan, reduced activity, growth retardation, atherosclerosis, arterial calcification, osteoporosis, genital immaturity, infertility, skin atrophy, and emphysema. In klotho mutant mice, atherosclerosis similar to the Monckeberg type atherosclerosis that occurs with aging in humans is observed in all arteries, from the aorta to the small arteries, and angiogenesis and vasculogenesis are impaired.

[0004] Klotho mRNA is significantly more expressed in kidney tissue than in other tissues, but expression of klotho mRNA is reduced in the kidneys of disease model mice with hypertension, type 2 diabetes, diabetic nephropathy, and chronic renal failure. In mice with reduced Klotho expression, production of NO (Nitric Oxide), a vascular endothelium-derived relaxing factor, is reduced. When the klotho gene is injected into Otsuka Long-Evans Tokushima fatty rat (OLETF) mice, which simultaneously have many risk factors for cardiovascular disease, using a viral gene carrier, the dysfunction of the vascular intima is improved, NO production is increased, vascular thickening and fibrosis are suppressed, and blood pressure is reduced. In addition, the klotho gene also affects glucose and insulin metabolism in mice, and statins, a representative hypercholesterolemia treatment drug, increase the expression of klotho mRNA in renal proximal tubule cells. In mice with reduced Klotho expression, osteopenia with low bone turnover due to impaired differentiation of both osteoblasts and osteoclasts occurs, which is similar to the characteristics of bone mass loss due to aging and senile osteoporosis in humans. In addition, abnormal elongation of trabecular bone at the epiphyseal region and abnormal trabecular tissue findings on microcomputer tomography were observed in Klotho mutant mice, which are due to impaired bone resorption. The clinical phenotype changes observed in humans due to Klotho gene mutations are diverse. KL-VS (functional variant of klotho) variants, which have three mutations in exon 2 of the Klotho gene, are associated with lipid metabolism, blood pressure, lifespan, cognitive function, coronary artery disease, and cerebrovascular disease, and it has been reported that microsatellite polymorphism and single base polymorphism of the Klotho gene are associated with bone density, and that single base polymorphism of the Klotho gene is associated with cardiovascular disease risk factors and bone density in healthy adult women. Recently, the association between the Klotho gene and Alzheimer's has also been reported in various papers. It has been reported that when klotho is overexpressed in an Alzheimer's dementia mouse model, the mouse's lifespan increases by 30% and cognitive decline is suppressed. They also observed that klotho expression reduced the production of amyloid beta protein in the brain by 50%.In humans, it has been reported that the expression level of klotho is inversely proportional to the progression of Alzheimer's disease, and that klotho protein reduces the amount of inflammatory cytokines in the blood of patients with Alzheimer's disease.

[0005] Thus, efforts have been made to develop a substance that can induce the expression of the klotho gene, which has a clear anti-aging effect. Among known substances, rapamycin, vitamin D, statin, etc. have been reported to be able to induce the expression of klotho. In 2012, a research team from Boston University screened compounds that can induce the expression of klotho gene using a compound library totaling 150,000 compounds, and reported three compounds. Among these compounds, the inventor selected compound H, which has a structure that has a high possibility of being developed as a medicine, and confirmed through actual experiments that this compound can express the klotho gene in cells, and published the research results on its mechanism of action in a paper. After that, an experiment was conducted to analyze the structure of compound H (Comparative Example 1), and the structural characteristics of the compound that can induce the expression of klotho were identified, and based on this, a new compound with activity increased by more than 10 times was created.

[0006] Aging is an inevitable and gradual biological process that leads to the dysfunction and destruction of almost all tissues and organs, ultimately resulting in death. Aging in the human body is associated, for example, with a decline in cellular function, leading to the development of a variety of diseases. Aging is thought to be due to interactions between genetic and acquired factors and is commonly characterized by increased senescence, a quantitative and qualitative decrease in stem cells, and abnormal structures at the tissue level.

[0007] Based on this, the present inventors synthesized a compound that enhances the expression of the Klotho gene and confirmed that it further enhances the expression of the Klotho gene compared to previously known compounds, thereby completing the present invention. Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0009] Another object of the present invention is to provide a method for preparing the compound represented by Formula 1.

[0010] It is still another object of the present invention to provide a composition for inhibiting cellular senescence, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0011] Another object of the present invention is to provide a cosmetic composition for preventing or improving skin aging, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0012] It is still another object of the present invention to provide a health functional food composition for preventing or improving skin aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0013] Another object of the present invention is to provide a health food composition for preventing or improving skin aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0014] It is yet another object of the present invention to provide a pharmaceutical composition for preventing or treating diseases induced by vascular aging, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0015] Another object of the present invention is to provide a health functional food composition for preventing or improving diseases induced by vascular aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0016] It is yet another object of the present invention to provide a health food composition for preventing or improving diseases induced by vascular aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0017] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating kidney diseases, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0018] It is still another object of the present invention to provide a health functional food composition for preventing or improving kidney diseases, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0019] Another object of the present invention is to provide a health food composition for preventing or improving kidney diseases, comprising the compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof. [Means for solving the problem]

[0020] In order to achieve the above objective, The present invention provides a compound represented by the following Chemical Formula 1 or a pharma- ceutically acceptable salt thereof:

[0021] [Chemical formula 1] [ka]

[0022] (In the above Chemical Formula 1, L 1 is a single bond or [ka] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 Straight or branched chain alkyl of C 6-8 wherein the aryl of the arylamide is selected from the group consisting of halogen, -NO 2 and C 1-10 One or more of the linear or branched alkyl halides may be substituted; R 1 and R 2are C together with the carbon atom to which they are attached. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, and -NO, respectively. 2 or C 1-10 (straight or branched chain alkyl).

[0023] The present invention also provides a method for producing a compound according to the present invention, as shown in the following reaction scheme 1: Step 1: dissolving compound 2 in an organic solvent, adding compound 3, and reacting at 10-50° C. for 12-20 hours to obtain compound 4; and Step 2: adding the organic solvent in which the compound 4 obtained in step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and reacting the mixture at 15 to 30° C. for 10 to 16 hours to obtain compound 1A; The present invention provides a method for preparing a compound represented by formula 1A, comprising:

[0024] [Reaction Scheme 1] [ka]

[0025] (In the above reaction formula 1, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1A is included in the chemical formula 1 of claim 1).

[0026] The present invention also provides a method for producing a compound according to the present invention, as shown in the following reaction scheme 2: Step 1: dissolving compound 5 in an organic solvent, adding compound 3, and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 6; Step 2: Dropping the organic solvent in which the compound 6 obtained in step 1 is dissolved into an organic solvent in which potassium superoxide is dissolved, and reacting for 12 to 24 hours to obtain compound 7; and Compound 7 was dissolved in an organic solvent and treated with boron tribromide (BBr 3 ) and reacting at room temperature for 20 to 28 hours to obtain compound 1B (step 3); The present invention provides a method for preparing a compound represented by formula 1B, comprising:

[0027] [Reaction Scheme 2] [ka]

[0028] (In the above reaction scheme 2, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1B is included in the chemical formula 1 of claim 1.

[0029] The present invention also provides a method for producing a compound according to the present invention, as shown in the following reaction scheme 3: Step 1: dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent and reacting them at 10-50° C. for 2-8 hours to obtain compound 9; and Step 2: dissolving compound 9 and compound 2 in an organic solvent and reacting them for 2 to 8 hours to obtain compound 1C; The present invention provides a method for preparing a compound represented by formula 1C, comprising:

[0030] [Reaction Scheme 3] [ka]

[0031] (In the above reaction formula 3, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1C is included in the chemical formula 1 of claim 1).

[0032] The present invention also provides a method for producing a compound according to the present invention, as shown in the following reaction scheme 4: Step 1: dissolving compound 10 and compound 3 in an organic solvent and reacting them at 10-50° C. for 20-28 hours to obtain compound 11; Step 2: adding the organic solvent in which the compound 11 obtained in step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and reacting the mixture at 10 to 50° C. for 12 to 24 hours to obtain compound 12; Step 3: adding compound 12 to an organic solvent together with a catalyst, injecting hydrogen gas, and reacting at 10-50° C. for 12-20 hours to obtain compound 13; and Step 4: dissolving compound 13 and compound 14 in an organic solvent and reacting them at 10-50° C. for 12-24 hours to obtain compound 1D; The present invention provides a method for preparing a compound represented by compound 1D, comprising:

[0033] [Reaction Scheme 4] [ka]

[0034] (In the above reaction formula 4, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of claim 1; R 8 is halogen, -NO 2 and C 1-10and one or more of the linear or branched alkyl halides: The compound 1D is included in the chemical formula 1 of claim 1).

[0035] The present invention also provides a composition for inhibiting cellular senescence, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0036] The present invention also provides a cosmetic composition for preventing or improving skin aging, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0037] The present invention also provides a health functional food composition for preventing or improving skin aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0038] The present invention also provides a health food composition for preventing or improving skin aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0039] The present invention also provides a pharmaceutical composition for preventing or treating a disease induced by vascular aging, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0040] The present invention also provides a pharmaceutical composition for preventing or treating a disease induced by vascular aging, comprising the compound represented by Formula 1 or a pharma- ceutical acceptable salt thereof and an angiotensin II receptor blocker.

[0041] The present invention also provides a health functional food composition for preventing or improving diseases induced by vascular aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0042] The present invention also provides a health food composition for preventing or improving diseases induced by vascular aging, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0043] The present invention also provides a pharmaceutical composition for preventing or treating kidney diseases, comprising the compound represented by Formula 1 or a pharma- ceutically acceptable salt thereof.

[0044] The present invention also provides a functional health food composition for preventing or improving kidney disease, comprising the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0045] The present invention also provides a health food composition for preventing or improving kidney diseases, comprising the compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof. Effect of the Invention

[0046] The compound represented by Chemical Formula 1 according to the present invention has an excellent effect of increasing the expression level of Klotho gene, which is an aging-related gene, and is therefore useful as a pharmaceutical composition, cosmetic composition, or food composition for preventing skin aging, inhibiting cellular aging, or preventing, improving, or treating diseases induced by vascular aging or kidney diseases. [Brief description of the drawings]

[0047] FIG. 1a shows the results of luciferase expression experiments using a reporter gene containing a promoter from the initiation site of the human klotho gene to 1.7 kbp in front of the gene in Comparative Examples 1 to 4. FIG. FIG. 1b shows the results of luciferase expression experiments using a reporter gene containing a promoter from the initiation site of the human klotho gene to 240 bp in front of the gene in Comparative Examples 1 to 4. FIG. 2 shows the results of luciferase expression experiments using a reporter gene containing a promoter extending up to −2.1 kb upstream of the human klotho gene in Examples 1 to 6. FIG. 3 shows the results of luciferase expression experiments using a reporter gene containing a promoter extending up to −2.1 kb upstream of the human klotho gene in Examples 1 to 3. FIG. 4 shows the results of confirming the mRNA expression level of the klotho (KL) gene by RT-PCR in Examples 1 and 2. FIG. 5 shows the results of confirming the expression of the klotho gene in RPTEC cells treated with the compounds of Examples 1-2 and Examples 7-10. FIG. 6 shows the results of confirming the cytotoxicity in HK2 cells treated with the compounds of Examples 1, 9 and 10. FIG. 7a is a schematic diagram showing a protocol for preparing a disease model by treating HK-2 cells (human kidney cells) with cisplatin. FIG. 7b shows the results of analyzing the expression level of Klotho protein in HK-2 cells obtained by the protocol of FIG. 7a. FIG. 8a is a schematic diagram showing the protocol for injecting KS1 compound into an animal model of unilateral ureteral obstruction and obtaining experimental samples. FIG. 8b shows the results of analyzing the degree of renal hypertrophy using the experimental samples obtained according to the protocol of FIG. 8a. FIG. 9 shows the results of confirming changes in the nucleus and cytoplasm in a unilateral ureteral obstruction model through H&E staining. FIG. 10 shows the results of confirming the degree of fibrosis progression in a unilateral ureteral obstruction model using Sirius Red staining. FIG. 11 shows the results of confirming the degree of cell death in a unilateral ureteral obstruction model by TUNEL staining. FIG. 12 shows the results of analyzing changes in Klotho protein expression in a unilateral ureteral obstruction model. FIG. 13 shows the results of an analysis of changes in MMP-9 protein expression in a unilateral ureteral obstruction model. FIG. 14 shows the results of analyzing the effect of KS1 compound in reducing hypertension. FIG. 15 shows the results of analyzing the cell aging inhibitory effect of the KS1 compound. BEST MODE FOR CARRYING OUT THEINVENTION

[0048] The present invention will be described in detail below.

[0049] A compound or a pharma- ceutically acceptable salt thereof The present invention provides a compound represented by the following Chemical Formula 1 or a pharma- ceutically acceptable salt thereof:

[0050] [Chemical formula 1] [ka]

[0051] In the above formula 1, L 1 is a single bond or [ka] and; R 1 and R 2 are -H, -OH, and C, respectively. 1-10 Straight or branched chain alkyl of C 6-8 wherein the aryl of the arylamide is selected from the group consisting of halogen, -NO 2 and C 1-10 One or more of the linear or branched alkyl halides may be substituted; R 1 and R 2 are C together with the carbon atom to which they are attached. 6-8 can form an aryl of; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, and -NO, respectively. 2 or C 1-10 It can be a straight or branched chain alkyl.

[0052] In one embodiment of the present invention, the L 1 is a single bond or [ka] and; R 1 and R 2are -H, -OH, and C, respectively. 1-5 Straight or branched chain alkyl of C 6-7 wherein the aryl of the arylamide is selected from the group consisting of halogen, -NO 2 and C 1-5 One or more of the linear or branched alkyl halides may be substituted; R 1 and R 2 can form a C6-7 aryl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 are -H, halogen, and -NO, respectively. 2 or C 1-5 It can be a straight or branched chain alkyl.

[0053] In one embodiment of the present invention, the L 1 is a single bond or [ka] and; R 1 and R 2 are -H, -OH, and -CH, respectively. 3 or phenylamide, wherein the phenyl of the phenylamide is selected from the group consisting of -Cl, -NO 2 and -CH 2 One or more of Cl can be substituted; R 1 and R 2 can form a phenyl together with the carbon atom to which they are attached; R 3 , R 4 , R 5 , R 6 and R 7 are -H, -F, -Cl, and -NO, respectively. 2 or -CH 2 CH 3 It is possible.

[0054] In one embodiment of the present invention, the L 1 is a single bond or [ka] and; R 1 -H, -OH, -CH 3 , [ka] , [ka] ,or [ka] and; R 2 is -H; R 1 and R 2 can form a phenyl together with the carbon atom to which they are attached; R 3 is -H or -Cl; R 4 is -H, -F or -Cl; R 5 -F, -Cl, -NO 2 , or -CH 2 CH 3 and; R 6 is -H; R 7 can be -H.

[0055] Preferable examples of the compound represented by Chemical Formula 1 according to the present invention include the following compound group. 1) N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide; 2) 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 3) 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol; 4) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide; 5) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide; 6) N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide; 7) 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole; 8) N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine; 9) N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine; and 10) N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0056] The compound of the present invention represented by Chemical Formula 1 may be used in the form of a pharma- ceutically acceptable salt, and the salt may be an acid addition salt formed with a pharma- ceutically acceptable free acid. The term "pharma- ceutically acceptable salt" refers to any organic or inorganic addition salt of the base compound of Chemical Formula 1 that is relatively non-toxic and non-hazardous to the patient at a concentration that has an effective effect, and the side effects caused by the salt do not reduce the beneficial efficacy of the base compound of Chemical Formula 1. These salts can be used as free acids, inorganic acids and organic acids, inorganic acids such as hydrochloric acid, bromic acid, nitric acid, sulfuric acid, perchloric acid, phosphoric acid, etc., and organic acids such as citric acid, acetic acid, lactic acid, maleic acid, fumaric acid, gluconic acid, methanesulfonic acid, succinic acid, tartaric acid, galacturonic acid, embonic acid, glutamic acid, aspartic acid, oxalic acid, (D) or (L) malic acid, maleic acid, methanesulfonic acid, ethanesulfonic acid, 4-toluenesulfonic acid, salicylic acid, citric acid, benzoic acid, malonic acid, etc. Furthermore, these salts include alkali metal salts (sodium salt, potassium salt, etc.) and alkaline earth metal salts (calcium salt, magnesium salt, etc.).For example, acid addition salts include acetate, aspartate, benzoate, besylate, bicarbonate / carbonate, bisulfate / sulfate, borate, camsylate, citrate, edisylate, esylate, formate, fumarate, gluceptate, gluconate, glucuronate, hexafluorophosphate, hybenzoate, hydrochloride / chloride, hydrobromide / bromide, hydroiodide / iodide, isethionate, lactate, malate, maleate, malonate, mesylate, methylsulfate, and naphthylate. , 2-nafcylates, nicotinates, nitrates, yolotates, oxalates, palmitates, pamoates, phosphates / hydrogen phosphates / dihydrogen phosphates, saccharates, stearates, succinates, tartrates, tosylates, trifluoroacetates, aluminum, arginine, benzathine, calcium, choline, diethylamine, diolamine, glycine, lysine, magnesium, meglumine, olamine, potassium, sodium, tromethamine, zinc salts and the like, of which the hydrochloride or trifluoroacetate are preferred.

[0057] In addition, the compound represented by Chemical Formula 1 of the present invention includes not only pharma- ceutically acceptable salts, but also all salts, isomers, hydrates and solvates that can be prepared by conventional methods.

[0058] The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving the compound of Chemical Formula 1 in a water-miscible organic solvent, such as acetone, methanol, ethanol, or acetonitrile, adding an excess amount of an organic acid or an aqueous solution of an inorganic acid, and then precipitating or crystallizing the mixture. The solvent or excess acid is then evaporated from the mixture, followed by drying to obtain the addition salt, or the precipitated salt can be filtered by suction.

[0059] Manufacturing method 1 The present invention relates to a process for producing a compound according to the present invention, Step 1: dissolving compound 2 in an organic solvent, adding compound 3, and reacting at 10-50° C. for 12-20 hours to obtain compound 4; and Step 2: adding the organic solvent in which the compound 4 obtained in step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and reacting the mixture at 15 to 30° C. for 10 to 16 hours to obtain compound 1A; The present invention provides a method for preparing a compound represented by formula 1A, comprising:

[0060] [Reaction Scheme 1] [ka]

[0061] In the reaction scheme 1, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1A is included in the formula 1 of claim 1.

[0062] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethylsulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0063] In the production method of the present invention, examples of the compound that can be produced by the production method include 8-methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine, and N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine.

[0064] Manufacturing method 2 The present invention relates to a process for producing a compound according to the present invention, Step 1: dissolving compound 5 in an organic solvent, adding compound 3, and reacting at 10 to 50° C. for 12 to 20 hours to obtain compound 6; Step 2: Dropping the organic solvent in which the compound 6 obtained in step 1 is dissolved into an organic solvent in which potassium superoxide is dissolved, and reacting for 12 to 24 hours to obtain compound 7; and Compound 7 was dissolved in an organic solvent and treated with boron tribromide (BBr 3 ) and reacting at room temperature for 20 to 28 hours to obtain compound 1B (step 3); The present invention provides a method for preparing a compound represented by formula 1B, comprising:

[0065] [Reaction Scheme 2] [ka]

[0066] In the reaction scheme 2, R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1B is included in the formula 1 of claim 1.

[0067] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethylsulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0068] In the production method of the present invention, an example of a compound that can be produced by the production method may be 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol.

[0069] Manufacturing method 3 The present invention relates to a process for producing a compound according to the present invention, Step 1: dissolving compound 8, carbon disulfide, iodomethane, and sodium hydride in an organic solvent and reacting them at 10-50° C. for 2-8 hours to obtain compound 9; and Step 2: dissolving compound 9 and compound 2 in an organic solvent and reacting them for 2 to 8 hours to obtain compound 1C; The present invention provides a method for preparing a compound represented by formula 1C, comprising:

[0070] [Reaction Scheme 3] [ka]

[0071] In the reaction scheme 3, R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R 7 represents the same as defined in Chemical Formula 1 of Claim 1; The compound 1C is included in the formula 1 of claim 1.

[0072] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethylsulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0073] In the preparation method of the present invention, an example of a compound that can be prepared by the preparation method may be N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide.

[0074] Manufacturing method 4 The present invention relates to a process for producing a compound according to the present invention, Step 1: dissolving compound 10 and compound 3 in an organic solvent and reacting them at 10-50° C. for 20-28 hours to obtain compound 11; Step 2: adding the organic solvent in which the compound 11 obtained in step 1 is dissolved to an organic solvent in which potassium superoxide is dissolved, and reacting the mixture at 10 to 50° C. for 12 to 24 hours to obtain compound 12; Step 3: adding compound 12 to an organic solvent together with a catalyst, injecting hydrogen gas, and reacting at 10-50° C. for 12-20 hours to obtain compound 13; and Step 4: dissolving compound 13 and compound 14 in an organic solvent and reacting them at 10-50° C. for 12-24 hours to obtain compound 1D; The present invention provides a method for producing a compound represented by compound 1D, which comprises:

[0075] [Reaction Scheme 4] [ka]

[0076] In the reaction scheme 4, R 3 , R 4 , R 5 , R 6 and R 7represents the same as defined in Chemical Formula 1 of claim 1; R 8 is halogen, -NO 2 and C 1-10 and one or more of the linear or branched alkyl halides: The compound 1D is included in the formula 1 of claim 1.

[0077] In the production method of the present invention, examples of the organic solvent include methanol (MeOH), dimethylformamide (DMF), acetonitrile (MeCN), tetrahydrofuran (THF), dichloromethane (DCM), 1,2-dimethoxyethane, benzene, toluene, xylene, dimethylsulfoxide (DMSO), and dioxane, which can be used alone or in combination.

[0078] In the production method of the present invention, examples of compounds that can be produced by the production method include N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide, or N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide.

[0079] Composition for inhibiting cell aging The present invention provides a composition for inhibiting cellular senescence, comprising a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0080] In the composition of the present invention, the cells may be, but are not limited to, renal proximal tubule epithelial cells.

[0081] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0082] Cosmetic composition for preventing or improving skin aging The present invention provides a cosmetic composition for preventing or improving skin aging, comprising a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0083] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0084] Cosmetic compositions of the present invention can be prepared containing a cosmetically effective amount of the active agent of the present invention described above and a cosmetically acceptable carrier.

[0085] The cosmetic composition according to an embodiment of the present invention is not particularly limited in its formulation, and may be formulated into cosmetics such as skin, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nourishing lotion, massage cream, nourishing cream, eye cream, moisturizing cream, hand cream, essence, nourishing essence, pack, cleansing foam, cleansing water, cleansing lotion, cleansing cream, body lotion, body cleanser, soap or powder.

[0086] When the dosage form of the present invention is a paste, cream or gel, animal fibers, plant fibers, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. may be used as the carrier component.

[0087] When the dosage form of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder can be used as a carrier component, and especially when it is a spray, it can further contain a propellant such as hydrochlorofluorocarbon, propane / butane or dimethyl ether.

[0088] When the dosage form of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifier is used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol oil, glycerin fatty acid ester, polyethylene glycol or sorbitan fatty acid ester.

[0089] When the dosage form of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. may be used as carrier components.

[0090] When the dosage form of the present invention is a surfactant-containing cleanser, fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinic acid monoesters, isethionates, imidazolinium derivatives, methyl taurates, sarcosinates, fatty acid amide ether sulfates, alkylamido betaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerin fatty acid esters may be used as carrier components.

[0091] Health functional food or health food composition for preventing or improving skin aging The present invention provides a health functional food or health food composition for preventing or improving skin aging, comprising a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0092] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0093] There is no particular limitation on the type of food. Examples of foods to which the effective substance of the present invention can be added include drinks, meat, sausages, bread, biscuits, mochi, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, alcoholic beverages, vitamin complexes, dairy products and dairy products, etc., including all health foods and health functional foods in the usual sense.

[0094] The health food and health functional food compositions containing the active substance according to the present invention can be added directly to food or used together with other foods or food ingredients, and can be used appropriately by a conventional method. The amount of the active substance to be mixed can be appropriately determined depending on the purpose of use (for prevention or improvement). In general, the amount of the composition in the health food and health functional food can be added in an amount of 0.1 to 90 parts by weight based on the total weight of the food. However, in the case of long-term intake for the purpose of maintaining health or regulating health, the amount may be less than the above range, and since there is no problem in terms of safety, the active substance can be used in an amount greater than the above range.

[0095] The health food and health functional food compositions of the present invention contain the active substance of the present invention as an essential component in the indicated ratio, but other components are not particularly limited, and may contain various flavorings or natural carbohydrates as additional components along with ordinary beverages. Examples of the above-mentioned natural carbohydrates are monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as ordinary sugars such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavorings other than those mentioned above, natural flavorings (thaumatin, stevia extracts (e.g. rebaudioside A, glycyrrhizin, etc.) and synthetic flavorings (saccharin, aspartame, etc.) can be advantageously used. The ratio of the natural carbohydrates is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 g of the health functional food composition of the present invention.

[0096] In addition to the above, the health food and health functional food compositions containing the active substances of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectinic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated drinks, etc. In addition, the health food and health functional food compositions of the present invention may contain fruit pulp for the production of natural fruit juices and fruit juice drinks and vegetable drinks.

[0097] These ingredients can be used independently or in combination. The ratio of these additives is not particularly important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the health food and health functional food composition containing the active substance of the present invention.

[0098] Pharmaceutical composition for preventing or treating diseases induced by vascular aging The present invention provides a pharmaceutical composition for preventing or treating a disease induced by vascular aging, comprising a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0099] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0100] The present invention also provides a pharmaceutical composition for preventing or treating diseases induced by vascular aging, comprising a compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof and an angiotensin II receptor blocker. Specifically, the angiotensin II receptor blocker may include, but is not limited to, one or more selected from the group consisting of losartan, valsartan, telmisartan, irbesartan, azilsartan, and olmesartan.

[0101] When the compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof is administered in combination with an angiotensin II receptor blocker drug that has been used as a conventional antihypertensive agent, a greater blood pressure reducing effect can be exhibited than when each drug is administered independently.

[0102] In the composition of the present invention, the disease induced by vascular aging may be hypertension, angina pectoris, myocardial infarction, arteriosclerosis, prostatic hyperplasia, vasospasm and contraction, thrombosis, cerebral infarction, or cerebral hemorrhage.

[0103] The compound of the present invention can be administered in various oral and parenteral dosage forms when administered clinically, and when formulated, it is prepared using a diluent or excipient such as a commonly used filler, extender, binder, wetting agent, disintegrant, or surfactant.

[0104] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, troches, etc., and such solid preparations are prepared by mixing one or more compounds of the present invention with at least one or more excipients, such as starch, calcium carbonate, sucrose, lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium, stearate, and talc are also used. Liquid preparations for oral administration include suspensions, oral liquids, emulsions, and syrups, and may contain various excipients, such as wetting agents, sweeteners, flavorings, and preservatives, in addition to water and liquid paraffin, which are frequently used simple diluents.

[0105] Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, suppositories, etc. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, etc. As bases for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin, etc. can be used.

[0106] The effective dosage of the compound of the present invention for the human body varies depending on the age, weight, sex, dosage form, health condition and disease level of the patient, and is generally about 0.001 to 100 mg / kg / day, preferably 0.01 to 35 mg / kg / day. Based on an adult patient weighing 70 kg, the dosage is generally 0.07 to 7000 mg / day, preferably 0.7 to 2500 mg / day, and can be administered once or several times a day at regular intervals according to the judgment of a doctor or pharmacist.

[0107] Health functional food or health food composition for preventing or improving diseases induced by vascular aging The present invention provides a health functional food or health food composition for preventing or improving diseases induced by vascular aging, comprising a compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0108] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0109] In the composition of the present invention, the disease induced by vascular aging may be hypertension, angina pectoris, myocardial infarction, arteriosclerosis, prostatic hyperplasia, vasospasm and contraction, thrombosis, cerebral infarction, or cerebral hemorrhage.

[0110] Pharmaceutical composition for preventing or treating kidney disease The present invention provides a pharmaceutical composition for preventing or treating kidney diseases, comprising a compound represented by Chemical Formula 1 or a pharma- ceutically acceptable salt thereof.

[0111] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0112] In the composition of the present invention, the kidney disease may be nephritis, pyelitis, renal syndrome, acute pyelitis, chronic pyelitis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, acute progressive nephritis, nephrotic syndrome, focal glomerulosclerosis, membranous nephropathy or membranoproliferative glomerulonephritis.

[0113] Health functional food or health food composition for preventing or improving kidney disease The present invention provides a functional health food or health food composition for preventing or improving kidney disease, comprising a compound represented by Chemical Formula 1 or a pharma- ceutical acceptable salt thereof.

[0114] In the composition of the present invention, the composition can improve the expression level of the Klotho gene.

[0115] In the composition of the present invention, the kidney disease may be nephritis, pyelitis, renal syndrome, acute pyelitis, chronic pyelitis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, acute progressive nephritis, nephrotic syndrome, focal glomerulosclerosis, membranous nephropathy or membranoproliferative glomerulonephritis.

[0116] The present invention will now be described in more detail with reference to the following examples, however, the following examples are merely illustrative of the present invention and are not intended to limit the scope of the present invention.

[0117] Example 1: Preparation of N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064) [ka]

[0118] Step 1: Preparation of Dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) 2-Chloro-4-nitrobenzamide (500 mg, 2.49 mmol), carbon disulfide (CS 2 ) (759 mg, 9.97 mmol) and iodomethane (1.13 g, 7.97 mmol) were dissolved in N,N-dimethylformamide (7 mL), and then 60% sodium hydride (200 mg, 4.98 mmol) was added and stirred at room temperature for 5 hours.

[0119] The reaction mixture was slowly added with ice-cold water and extracted with ethyl acetate. The organic layer was washed with brine and then extracted with Na 2 SO 4After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (10% ethyl acetate / n-hexane) to obtain dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) as a pale yellow solid (160 mg, 21%).

[0120] 1 H NMR (400MHz, acetone-d 6 );δ8.34(d, 1H, J=2.0Hz), 8.29(dd, 1H, J=2.4, 8.8Hz), 8.20(d, 1H, J=8.4Hz), 2.65(s, 6H).

[0121] Step 2: Preparation of N-(Benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064)

[0122] Dimethyl(2-chloro-4-nitrobenzoyl)carbonimidodithioate (17064-2-1) (150 mg, 0.49 mmol) obtained in step 1 was dissolved in dimethylformamide (15 mL), and then 2-aminophenol (53 mg, 0.49 mmol) was added.

[0123] The reaction mixture was refluxed for 6 hours, and the solvent was removed under reduced pressure. Diethyl ether was added to the reaction mixture, and the precipitated solid was filtered. The solid was purified by silica-gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound, N-(benzo[d]oxazol-2-yl)-2-chloro-4-nitrobenzamide (FCCS-17064), as a brown solid (70 mg, 30%).

[0124] 1 H NMR (400MHz, acetone-d 6 );δ8.36(d, 1H, J=2.0Hz), 8.33(dd, 1H, J=2.0, 8.4Hz), 8.09(d, 1H, J=8.4Hz), 7.62-7.56(m, 2H), 7.40-7.33(m, 2H).

[0125] <Example 2> Preparation of 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065) [ka]

[0126] Step 1: Preparation of 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (17065-2-1) 2-Amino-p-cresol (300 mg, 2.44 mmol) was dissolved in methanol (12 mL), and then 3,4-dichlorophenyl isothiocyanate (497 mg, 2.44 mmol) was added and stirred at room temperature for 18 hours. After the completion of the reaction was confirmed by TLC (thin layer chromatography), the mixture was cooled in a refrigerator (0-4 °C). The precipitated solid was filtered to obtain 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (17065-2-1) as a white solid (346 mg), which was used in the next step without further purification.

[0127] 1 H NMR (400MHz, acetone-d 6 );δ7.98(dd, 1H, J=0.4,2.0Hz), 7.55-7.50(m, 2H), 7.43(br s, 1H), 6.94-6.90(m, 1H), 6.85(d, 1H, J=8.4Hz)2.24(s, 3H).

[0128] Step 2: Preparation of 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065) Potassium superoxide (KO) 2To a solution of 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (17065-2-1) (346 mg, 1.06 mmol) obtained in step 1 in acetonitrile (MeCN) (25 mL) was slowly added, and the mixture was stirred at room temperature for 18 hours.

[0129] The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine and then with Na 2 SO 4 After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain the target compound 8-Methyl-2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065) as a white solid (170 mg, 24%, 2 steps).

[0130] 1 H NMR (400MHz, acetone-d 6 );δ8.29(d, 1H, J=2.8Hz), 7.73(dd, 1H, J=2.8, 8.8Hz), 7.76(d, 1H, J=8.8Hz) , 7.32-7.20(m, 1H), 7.28(d, 1H, J=8.0Hz), 7.00-6.970(m, 1H), 2.41(s, 3H).

[0131] <Example 3> Preparation of 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066) [ka]

[0132] Step 1: Preparation of 1-(3,4-Dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (17066-3-1) 2-Amino-4-methoxyphenol (1.13 g, 8.12 mmol) was dissolved in methanol (40 mL), and then 3,4-dichlorophenyl isothiocyanate (1.99 g, 9.74 mmol) was added and stirred at room temperature for 18 hours. After the completion of the reaction was confirmed by TLC (thin layer chromatography), the mixture was cooled in a refrigerator (0-4 °C). The precipitated solid was filtered to obtain 1-(3,4-dichlorophenyl)-3-(2-hydroxy-5-methoxyphenyl)thiourea (17066-3-1) as a brown solid (2 g), which was used in the next step without further purification.

[0133] 1 H NMR (400MHz, methanol-d 4 );δ7.82(d, 1H, J=2.4Hz), 7.48-7.44(m, 2H), 7.39(dd, 1H, J=1.4, 8.8Hz), 6.81(d, 1H, J=8.8Hz), 6.66(dd, 1H, J=1.6, 8.8Hz), 3.73(s, 3H).

[0134] Step 2: Preparation of N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (17066-3-2) Potassium superoxide (KO) 2 A solution of 17066-3-1 (525 mg, 1.52 mmol) obtained in step 1 in acetonitrile (MeCN) (30 mL) was slowly added to a solution of 17066-3-1 (540 mg, 7.6 mmol) in acetonitrile (MeCN) (20 mL), and the mixture was stirred at room temperature for 18 hours. The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine and then extracted with Na 2 SO 4 After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (20% ethyl acetate / n-hexane) to give N-(3,4-dichlorophenyl)-5-methoxybenzo[d]oxazol-2-amine (17066-3-2) as a brown solid (230 mg, 35%).

[0135] 1 H NMR (400MHz, acetone-d 6 );δ8.29(d, 1H, J=2.4Hz), 7.70(dd, 1H, J=2.4, 8.8Hz), 7.55(d, 1H, J=8.8Hz), 7.30 (d, 1H, J=8.8Hz), 7.08(d, 1H, J=2.8Hz), 7.74(dd, 1H, J=2.4, 8.8Hz), 3.84(s, 3H).

[0136] Step 3: Preparation of 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066) Under an Ar gas atmosphere, 17066-3-2 (200 mg, 0.65 mmol) obtained in step 2 was dissolved in dichloromethane (15 mL, anhydrous) and cooled in an ice bath. 3 ) (3.23 mL, 1.0 M in dichloromethane) was slowly added, and the mixture was allowed to warm to room temperature and stirred for 24 hours. Sodium hydroxide (NaOH) solution (8 mL, 1.0 M in water) was slowly added to terminate the reaction, and the mixture was transferred to a separatory funnel to separate the organic layer and the aqueous layer. The aqueous layer was extracted with ethyl acetate, and then Na 2 SO 4 After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound, 2-((3,4-dichlorophenyl)amino)benzo[d]oxazol-5-ol (FCCS-17066), as a brown solid (97 mg, 50%).

[0137] 1 H NMR (400MHz, acetone-d 6 );δ8.29(br s, -OH), 8.26(d, 1H, J=2.4Hz), 7.72(dd, 1H, J=2.4, 8.8Hz), 7.56(d, 1H, J=8.8Hz) , 7.21(dd, 1H, J=2.0, 7.2Hz), 6.95(d, 1H, J=2.0Hz), 6.66(dd, 1H, J=2.4, 8.8Hz).

[0138] <Example 4> Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067) [ka]

[0139] Step 1: Preparation of 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1)

[0140] 2-Amino-4-nitrophenol (1.88g, 12.25mmol) and 4-ethylphenyl isothiocyante (2g, 12.25mmol) were dissolved in methanol (80mL) and stirred at room temperature for one day. After removing the solvent under reduced pressure, the residue was purified by silica-gel column chromatography (20% ethyl acetate / n-hexane) to obtain 1-(4-ethylphenyl)-3-(2-hydroxy-5-nitrophenyl)thiourea (Interm-3-1) as a brown solid (2.9g, 65%).

[0141] 1 H NMR (400MHz, methanol-d 4);δ9.24(d, 1H, J=2.8Hz), 7.88(dd, 1H, J=2.0, 9.2Hz), 7.36(d, 2H, J=8.4Hz), 7.25( d, 2H, J=8.8Hz), 6.94(d, 1H, J=9.2Hz), 2.66(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0142] Step 2: Preparation of N-(4-ethylphenyl)-5-nitrobenzo[d]oxazol-2-amine (Interm-3-2) Potassium superoxide (KO) 2 After cooling a solution of Interm-3-1 (2.8 g, 39.38 mmol) and acetonitrile (MeCN) (130 mL) in an ice bath, a solution of Interm-3-1 (2.5 g, 7.88 mmol) obtained in step 1 dissolved in acetonitrile (MeCN) (170 mL) was slowly added and stirred at room temperature for 18 hours. The reaction mixture was extracted with dichloromethane and water. The organic layer was washed with brine and then extracted with NaCl. 2 SO 4 After drying at 40° C., the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (10% ethyl acetate / n-hexane) to obtain compound Interm-3-2 as a brown solid (1.78 g, 80%).

[0143] 1 H NMR (400MHz, methanol-d 4 );δ8.20(d, 1H, J=1.0Hz), 8.08(dd, 1H, J=0.8, 9.6Hz), 7.59(d, 2H, J=8.8Hz), 7.51( d, 1H, J=8.8Hz), 7.22(d, 2H, J=8.8Hz), 2.64(q, 2H, J=7.6Hz), 1.24(t, 3H, J=7.6Hz).

[0144] Step 3: Preparation of N-(4-ethylphenyl)benzo[d]oxazole-2,5-diamine (Interm-3-3) Pd / C (palladium on carbon) (1.70 g, 0.80 mmol, 10 wt.%, wet support) was weighed and placed in a round flask, and then purged with Ar gas. A solution of Interm-3-2 (1.58 g, 5.30 mmol) obtained in step 2 dissolved in methanol (80 mL) was slowly added thereto, and then H 2 (g) was substituted. H 2 (g) was stirred at room temperature for 18 hours while bubbling. After confirming the completion of the reaction by TLC (thin layer chromatography), the mixture was filtered through a Celite pad and the solvent was removed under reduced pressure. The reaction mixture was purified by chromatography (Silica-gel column chromatography) (40% Ethyl acetate / n-hexane) to obtain compound Interm-3-3 as a light brown solid (1.21 g, 90%).

[0145] 1 H NMR (400MHz, Acetone-d 6 );δ7.71(m, 2H), 7.19(m, 2H), 7.03(dd, 1H, J=0.8, 8.4Hz), 6.75(dd, 1H, J=0.8, 2 .0Hz), 6.44(dd, 1H, J=2.0, 8.4Hz), 2.60(q, 2H, J=7.6Hz), 1.19(t, 3H, J=7.6Hz).

[0146] Step 4: Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067) Interm-3-3 (253 mg, 1 mmol) and 2-chloro-5-nitrobenzoyl chloride (220 mg, 1 mmol) obtained in step 3 were dissolved in dimethylformamide (DMF) (4 mL), and diisomethylpropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. After 18 hours, 0.5 equivalents each of 2-chloro-5-nitrobenzoyl chloride and diisomethylpropylethylamine (DIPEA) were added and stirred for another 8 hours. 10% HCl (aq.) was added to the reaction mixture, which was extracted with ethyl acetate, and the organic layer was washed with saturated NaHCO 3 The organic layer was washed with aqueous solution and then with brine. 2 SO 4 After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound, N-(2-(4-ethylphenylamino)benzo[d]oxazol-5-yl)-2-chloro-5-nitrobenzamide (FCCS-17067), as a pale yellow solid (120 mg, 27%).

[0147] 1 H NMR (400 MHz, DMSO-d 6);δ10.71(s, 1H), 10.53(s, 1H), 8.48(d, 1H, J=2.8Hz), 8.34(dd, 1H, J=2.4, 8.8Hz), 7.90(d, 1H, J=8.8Hz), 7.82(d, 1H, J=2.0Hz), 7.64( d, 2H, J=8.8Hz), 7.46(d, 1H, J=8.8Hz), 7.40(dd, 1H, J=2.0, 8.4Hz), 7.21(d, 1H, J=8.8Hz), 2.58(q, 2H, J=7.6Hz), 1.18(t, 3H, J=7.6Hz).

[0148] <Example 5> Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3,4-dichlorobenzamide (FCCS-17068) [ka]

[0149] Interm-3-3 (253 mg, 1 mmol) obtained in step 3 of Example 4 and 3,4-dichlorobenzoyl chloride (209 mg, 1 mmol) were dissolved in N,N-dimethylformamide (DMF) (4 mL), and diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. The reaction mixture was added with 10% HCl (aq.) and extracted with ethyl acetate, and the organic layer was washed with saturated NaHCO 3 The organic layer was washed with aqueous solution and then with brine. 2 SO 4After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (40% ethyl acetate / n-hexane) to obtain the target compound FCCS-17068 as a pale white solid (270 mg, 64%).

[0150] 1 H NMR (400MHz, Acetone-d 6 );δ8.18(d, 1H, J=2.4Hz), 7.99(t, 1H, J=2.4Hz), 7.97(d, 1H, J=2.0Hz), 7.80-7.20(m, 3H), 7.70-7.5 0(m, 1H), 7.35(d, 1H, J=8.8Hz), 7.24(d, 1H, J=8.8Hz), 2.63(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0151] <Example 6> Preparation of N-(2-(4-Ethylphenylamino)benzo[d]oxazol-5-yl)-3-(chloromethyl)benzamide (FCCS-17069) [ka]

[0152] Interm-3-3 (253 mg, 1 mmol) obtained in step 3 of Example 4 and 3-(chloromethyl)benzoyl chloride (189 mg, 1 mmol) were dissolved in N,N-dimethylformamide (DMF) (4 mL), and diisopropylethylamine (DIPEA) (129 mg, 1 mmol) was added and stirred at room temperature for 18 hours. The reaction mixture was added with 10% HCl (aq.) and extracted with ethyl acetate, and the organic layer was washed with saturated NaHCO 3The organic layer was washed with aqueous solution and then with brine. 2 SO 4 After drying at 40°C, the solvent was removed under reduced pressure. The reaction mixture was purified by silica gel column chromatography (30% ethyl acetate / n-hexane) to obtain the target compound FCCS-17069 as a pale white solid (170 mg, 40%).

[0153] 1 H NMR (400MHz, Acetone-d 6 );δ8.08(t, 1H, J=1.2Hz), 8.03(d, 1H, J=2.0Hz), 7.98(dt, 1H, J=1.2, 7.6Hz), 7.80-7.75(m, 2H), 7.69-7.65(m, 1H), 7.57-7.52(m, 3H), 7.34(d, 1H, J=8.8Hz), 7.26-7.22(m, 2H), 2.62(q, 2H, J=7.6Hz), 1.22(t, 3H, J=7.6Hz).

[0154] <Example 7> Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A) [ka]

[0155] Step 1: Preparation of 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1) Under Ar gas atmosphere, 2-aminophenol (300mg, 2.749mmol) was dissolved in anhydrous MeOH (8mL), and then 3,4-dichlorophenyl isothiocyanate (0.47mL, 3.299mmol) was slowly added dropwise and stirred at room temperature for 14 hours. After confirming that the starting material had completely disappeared by TLC (thin layer chromatography), the pressure was reduced and the solvent was removed. After that, silica was added to the crude to adsorb it, and the crude was subjected to silica-gel flash column chromatography (30% EtOAc / hexane, R f =0.4) to obtain 1-(3,4-dichlorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-17065-A-2-1), 793 mg (light brown foamy solid, 92%).

[0156] 1 H NMR (400MHz, CD3OD); δ7.82(d, 1H, J=2.8Hz), 7.63(d, 1H, J=7.6Hz), 7.45(d, 1H, J=8.8Hz), 7.39( dd, 1H, J=8.6, 2.2Hz), 7.11-7.06(m, 1H), 6.90(dd, 1H, J=8.0, 1.2Hz), 6.85(td, 1H, J=7.6, 1.2Hz)

[0157] Step 2: Preparation of 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A) FCCS-17065-A-2-1 (400 mg, 1.277 mmol) obtained in step 1 and potassium peroxide (Potassium superoxide, KO 2) (454 mg, 6.386 mmol) was added, acetonitrile (MeCN) (48 mL) was added, and the mixture was stirred at room temperature for 14 hours. After checking by TLC (thin layer chromatography) that all the starting material had disappeared, silica was added to the crude to adsorb it, and the pressure was reduced. Silica-gel Flash Column Chromatography (20% EtOAc / hexane, R f =0.4) to obtain the target compound, 2-[N-(3,4-dichlorophenyl)]aminobenzoxazole (FCCS-17065-A), 231 mg (white solid, 65%).

[0158] 1 H NMR (400 MHz, CD 3 OD);δ8.06(d, 1H, J=2.8Hz), 7.55(dd, 1H, J=8.6,2,6Hz), 7.48-7.45(m, 2H), 7 .39(d, 1H, J=8.0Hz), 7.24(td, 1H, J=7.6, 1.2Hz), 7.16(td, 1H, J=7.8, 1.2Hz)

[0159] Example 8: Preparation of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B) [ka]

[0160] Step 1: Preparation of 1-(3,4-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (FCCS-17065-B-2-1)

[0161] 3-Amino-2-naphthol (350 mg, 2.119 mmol) was dissolved in anhydrous MeOH (7 mL) and chloroform (CHCl) under an Ar gas atmosphere. 3 Add 2mL of 1,000g of 1,000g of 3,4-dichlorophenyl isothiocyanate and stir at room temperature for 5 minutes. Add 0.38mL of 3,638mmol of 3,4-dichlorophenyl isothiocyanate and stir at room temperature for 13 hours. Check with TLC (thin layer chromatography) to make sure that all the starting material has disappeared. Reduce pressure to remove the solvent, add 8mL of dichloromethane, stir for 5 minutes, and filter the insoluble solid to obtain 792mg (white solid, 99%) of 1-(3,4-dichlorophenyl)-3-(3-hydroxynaphthalen-2-yl)thiourea (FCCS-17065-B-2-1).

[0162] 1 H NMR (400 MHz, DMSO-d 6 );δ10.48(s, 1H), 10.34(s, 1H), 9.57(s, 1H), 8.59(s, 1H), 8.05(d, 1H, J=2.0Hz), 7.73(d, 1H, J=8.0Hz), 7.67(d, 1H, J =7.6Hz), 7.60(d, 1H, J=8.4Hz), 7.52(dd, 1H, J=8.6, 2.2Hz), 7.35(t, 1H, J=7.2Hz), 7.27(t, 1H, J=7.6Hz), 7.24(s, 1H)

[0163] Step 2: Preparation of N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B) FCCS-17065-B-2-1 (400 mg, 1.101 mmol) obtained in step 1 and potassium peroxide (Potassium superoxide, KO 2 ) (391 mg, 5.505 mmol), acetonitrile (MeCN) (42 mL) was added, and the mixture was stirred at room temperature for 14 hours. After checking by TLC (thin layer chromatography) that all the starting material had disappeared, silica was added to the crude to adsorb it, and the pressure was reduced. Silica-gel Flash Column Chromatography (20% EtOAc / hexane, R f =0.5) to obtain the target compound, N-(3,4-dichlorophenyl)naphtho[2,3-d]oxazol-2-amine (FCCS-17065-B), 236 mg (white solid, 65%).

[0164] 1 H NMR (400 MHz, DMSO-d 6 );δ11.22(s, 1H), 8.20(d, 1H, J=2.0Hz), 7.98-7.95(m, 4H), 7.72(dd, 1H, J=8.8,2.4Hz), 7.66(d, 1H, J=8.4Hz), 7.47-7.41(m, 2H)

[0165] <Example 9> Preparation of N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C) [ka]

[0166] Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (FCCS-17065-C-2-1) Under Ar gas atmosphere, 2-amino-p-cresol (300 mg, 2.436 mmol) was dissolved in anhydrous MeOH (8 mL), and then 3,4-difluorophenyl isothiocyanate (0.37 mL, 2.923 mmol) was slowly added dropwise and stirred at room temperature for 13 hours. After confirming that the starting material had completely disappeared by TLC (thin layer chromatography), the solvent was removed under reduced pressure, and silica was added to the crude to adsorb it, and the crude was subjected to silica-gel flash column chromatography (30% EtOAc / hexane, R f =0.4) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxy-5-methylphenyl)thiourea (FCCS-17065-C-2-1), 710 mg (white foamy solid, 99%).

[0167] 1 H NMR (400 MHz, CD 3 OD);δ7.57-7.52(m, 1H), 7.40(s, 1H), 7.25-7.13(m, 2H), 6.91(dd, 1H, J=8.0, 1.6Hz), 6.79(d, 1H, J=8.0Hz), 2.25(s, 3H)

[0168] Step 2: Preparation of N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C) FCCS-17065-C-2-1 (400 mg, 1.359 mmol) obtained in step 1 and potassium peroxide (KOP) were added under an Ar gas atmosphere. 2 ) (483 mg, 6.795 mmol) was added to the crude, and acetonitrile (MeCN) (52 mL) was added and stirred at room temperature for 14 hours. After checking by TLC (thin layer chromatography) that all the starting material had disappeared, silica was added to the crude to adsorb it, and the pressure was reduced. Silica-gel Flash Column Chromatography (20% EtOAc / hexane, R f =0.45) to obtain the target compound, N-(3,4-difluorophenyl)-5-methylbenzo[d]oxazol-2-amine (FCCS-17065-C), 224 mg (white solid, 63%).

[0169] 1 H NMR (400 MHz, CD 3 OD);δ=7.83-7.78(m, 1H), 7.33-7.29(m, 1H), 7.27-7.20(m, 3H), 6.97-6.95(m, 1H), 2.41(s, 3H)

[0170] <Example 10> Synthesis of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) [ka]

[0171] Step 1: Preparation of 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) 2-Aminophenol (150 mg, 1.37 mmol) was dissolved in methanol (8 mL) under an Ar gas atmosphere, and then 3,4-difluorophenyl isothiocyanate (224 μL, 1.65 mmol) was slowly added and stirred at room temperature for 13 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), methanol was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (20% acetone / n-hexane) to obtain 1-(3,4-difluorophenyl)-3-(2-hydroxyphenyl)thiourea (FCCS-19025-2-1) as a pale yellow solid (354 mg, 92%).

[0172] 1 H-NMR (400 MHz, MeOH-d 4 )δ7.62(d, J=8.0Hz, 1H), 7.55(ddd,J=2.4Hz, 1H), 7.25-7.13(m, 2H), 7.11-7.05(m, 1H), 6.92-6.82(m, 2H);ESI-(+)281.3[M+H] + .

[0173] Step 2: Preparation of N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) In an Ar gas atmosphere, FCCS-19025-2-1 (224 mg, 0.80 mmol) obtained in step 1 and potassium peroxide (KO 2 ) (284 mg, 4.00 mmol) was dissolved in acetonitrile (MeCN) (25 mL) and stirred at room temperature for 14 hours. After confirming the completion of the reaction by TLC (thin layer chromatography), acetonitrile (MeCN) was removed under reduced pressure. The reaction mixture was purified by silica-gel column chromatography (10-20% ethyl acetate / n-hexane) to obtain the target compound N-(3,4-difluorophenyl)benzo[d]oxazol-2-amine (FCCS-19025) as a white solid (160 mg, 82%).

[0174] 1 H-NMR (400 MHz, MeOH-d 4 )δ7.82(ddd,J=2.8Hz, 1H), 7.42(d, J=7.6Hz, 1H), 7.36(d, J=8.0Hz, 1H), 7. 34-7.29(m, 1H), 7.28-7.18(m, 2H), 7.16-7.10(m, 1H);ESI-(+)247.2[M+H] + .

[0175] Table 1 below shows the chemical structural formulas of Examples 1 to 10.

[0176] [Table 1]

[0177] <Comparative Example 1> N-(2-chlorophenyl)-1H-indole-3-carboxamide was used as Comparative Example 1. [ka]

[0178] <Comparative Example 2> 2'-Chloroacetanilide (C0621) was purchased and used as Comparative Example 2. [ka]

[0179] <Comparative Example 3> N-methyl-1H-indole-3-carboxamide (FCCS-16030) was purchased and used as Comparative Example 3. [ka]

[0180] <Comparative Example 4> Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031) [ka]

[0181] Step 1: Preparation of methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1) In an Ar gas atmosphere, indole-3-carboxylic acid (600 mg, 3.72 mmol) and glycine methyl ester (467 mg, 3.72 mmol) are dissolved in chloroform (11 mL) and cooled in an ice bath. Triethylamine (1.04 mL, 7.446 mmol) and N,N-diisopropylcarbodiimide are further added, and the mixture is stirred at 0°C for 14 hours. 10% NaHCO 3 After washing with aqueous solution of 5% HCl, it was washed with anhydrous Na 2 SO 4 The residue was passed through a pad to remove the remaining water, and the solvent was removed under reduced pressure. Silica-gel Flash Column Chromatography (70% ethyl aceate / n-hexane) was performed to obtain 430 mg (white solid, 50%) of methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1) in a mixture state. The mixture was carried to the next step without further purification. ESI-MS: 231.2 [MH] -

[0182] Step 2: Preparation of 2-(1H-indole-3-carboxamido)acetic acid (FCCS-16031-3-2) 2-(1H-indole-3-carboxamido)acetate (methyl 2-(1H-indole-3-carboxamido)acetate (CCS-16031-3-1) (220 mg, 0.947 mmol) obtained in step 1 was dissolved in tetrahydrofuran (6 mL), and a solution of lithium hydroxide monohydrate (LiOH monohydrate) (131 mg, 3.126 mmol) dissolved in water (2 mL) was added thereto and stirred at room temperature for 1 hour. After adjusting the pH to 2 with 1.0N HCl aqueous solution, extraction was performed with ethyl acetate. Anhydrous Na 2 SO 4 The remaining water was removed by passing through a pad, and the solvent was removed under reduced pressure. Silica-gel Flash Column Chromatography (10% methanol / dichloromethane) was performed to obtain 147 mg (yellow foamy solid, 71%) of 2-(1H-indole-3-carboxamido)acetic acid (FCCS-16031-3-2).

[0183] 1 H NMR (400 MHz, CD 3 OD);δ8.10-8.08(m, 1H), 7.92(s, 1H), 7.43(dt, J=8.0, 1.2Hz, 1H), 7.17(quint d, J=7.2, 1.6Hz, 2H), 4.12(s, 2H)

[0184] Step 3: Preparation of N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031) Under Ar gas atmosphere, 2-(1H-indole-3-carboxamido)acetic acid (FCCS-16031-3-2) (200 mg, 0.917 mmol) obtained in step 2 and TSTU (N,N,N',N'-Tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate) (290 mg, 0.962 mmol) were dissolved in N,N-dimethylformamide (4 mL, anhydride), N,N-diisomethylpropylethylamine (DIEA) (0.4 mL, 2.293 mmol) was added, and the mixture was stirred at room temperature for 3 hours. 2-chloroaniline (0.29 mL, 2.751 mmol) and N,N-diisomethylpropylethylamine (DIEA) (0.64 mL, 3.668 mmol) were added and heated at 60°C for 4 hours. After removing the solvent under reduced pressure, dichloromethane and NH 4 The organic layer was extracted with saturated aqueous Cl solution. 2 SO 4 The remaining water was removed by passing through a pad, and the solvent was then removed under reduced pressure. Silica-gel Flash Column Chromatography (70% ethyl acetate / n-hexane) was performed to obtain the target compound N-(2-((2-chlorophenyl)amino)-2-oxoethyl)-1H-indole-3-carboxamide (FCCS-16031) 20 mg (white solid, 6.6%).

[0185] 1 H NMR (400 MHz, CD 3OD);δ8.15-8.12(m, 1H), 8.04(dd,J=8.0, 1.2Hz, 1H), 7.97(s, 1H), 7.46-7.41(m, 2H), 7.33-7.28(m, 1H), 7.23-7.12(m, 3H), 4.26(s, 2H)

[0186] <Experimental Example 1-1> Luciferase expression experiment (Comparative Examples 1 to 4) To evaluate the expression of the klotho gene through luciferase activity, human renal proximal tubule epithelial cells (RPTEC, ATCC CRL-4031) were purchased from Lonza, USA.

[0187] For the culture, Renal Epithelial Growth Medium (REGM) from the same company, Lonza, was used. TM ) Using Bulletkit, 37℃, 5% CO 2 The plasmid used for luciferase expression was one in which the promoter region of the human KL (klotho) gene was positioned to regulate the expression of the firefly luciferase gene.

[0188] The plasmid was introduced into the cells using X-treme GENE transfection reagent (Roche). Luciferase activity expressed in the cells was measured using Dual-Luciferase reporter assay system (Promega). The cells were cultured and treated with the indicated concentrations of each compound for 24 hours, after which luciferase activity was measured. High luciferase activity indirectly indicates increased expression of the klotho gene.

[0189] Comparative Examples 1 to 4 were treated at a concentration of 5 μM with RPTEC cells, and reporter gene expression was confirmed using a reporter gene containing a promoter up to 1.7 kbp from the start site of the human klotho gene or a reporter gene containing a promoter up to 240 bp from the start site of the human klotho gene.

[0190] As a result, as shown in FIG. 1, it was confirmed that the compound of Comparative Example 1 had the highest luciferase activity.

[0191] <Experimental Example 1-2> Luciferase expression experiment (Examples 1 to 6) Based on the results of Experimental Example 1-1, Examples 1 to 6 having similar chemical structures to Comparative Example 1 were synthesized, and Experimental Example 1-2 was carried out.

[0192] RPTECs, epithelial cells of the proximal tubule of the human kidney, were treated with Examples 1 to 6 at concentrations of 0.5, 1, and 5 μM, respectively, and Comparative Example 1 was treated at a concentration of 5 μM. Expression of the reporter gene was confirmed using a reporter gene (pHKP-luc) containing a promoter extending up to -2.1 kb upstream of the human klotho gene, and the results are shown in Figures 2 and 3.

[0193] As shown in FIG. 2, it was confirmed that the expression of the reporter gene for the compounds of Examples 1 and 2 was at a similar level to that of Comparative Example 1.

[0194] As shown in Figure 3, Comparative Example 1 and Examples 1 to 3 were treated at a concentration of 5 μM with RPTEC cells, and reporter gene expression was confirmed using a reporter gene (pHKP-luc) containing a promoter up to -2.1 kb upstream of the human klotho gene. As a result, it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1.

[0195] <Experimental Example 2> Quantitative evaluation of klotho (KL) gene expression using real-time PCR experiments Qiagen's RNeasy kit was used to extract RNA from RPTEC cells, which are epithelium cells of the proximal tubule of the human kidney, treated for 6 hours with the compounds of Comparative Example 1 and Examples 1 and 2. cDNA was produced from the extracted RNA using Thermo's Superscript II kit, and the KL (klotho) gene specific kit was Taqman Gene Expression assays from Appliedbiosystem, with the results shown in Figure 4.

[0196] As shown in FIG. 4, it was confirmed that the compound of Example 2 had a similar level to that of Comparative Example 1.

[0197] Based on the results of Experimental Example 2, compounds of Examples 7 to 10 having similar chemical structures to the compound of Example 2 were synthesized and used in the next Experimental Example 3.

[0198] <Experimental Example 3> Quantitative evaluation of klotho (KL) gene expression using general PCR experiment RPTEC cells, which are epithelial cells of the proximal tubule of the human kidney, were treated with each of Examples 7 to 10 at 2.5 μM for 6 hours, and RNA was extracted from the cells. The extracted RNA was used to prepare cDNA using Thermo's Superscript II kit, and then a general PCR was performed.

[0199] The information on the primers used in the experiment is as follows:

[0200] KL-F GATAGAGAAAAATGGCTTCCCTCC (SEQ ID NO: 1) KL-R GGTCGGTAAACTGAGACAGAGTGG (SEQ ID NO: 2) GAPDH-F TGACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 3) GAPDH-R AGGGATGATGTTCTGGAGAGCC (SEQ ID NO: 4)

[0201] The DNA amplified by PCR was electrophoresed on an agarose gel and stained with ethidium bromide. The amount of DNA in each band was quantified using the SpeedyQuant program and shown in FIG.

[0202] As shown in FIG. 5, it was confirmed that the expression level of the klotho (KL) gene in Examples 8 to 10 was higher than that in Comparative Example 1, and in particular, it was shown that the expression level in Example 10 was improved by about 10 times compared to Comparative Example 1.

[0203] <Experimental Example 4> Toxicity test Cultured HK2 (Human kidney-2) cells were treated with Comparative Example 1, Example 2, and Example 9-Example 10 at a concentration of 25 μM or 12.5 μM, and 24 hours later, cytotoxicity was measured using the EZ-Cytox kit. EZ-Cytox produces formazan with absorbance at 450 nm by mitochondrial enzymes in living cells, so living cells show higher absorbance at 450 nm. When the toxicity of cells treated with DMSO at the same volume as the amount of the treated compound is considered to be 1, the extent to which the toxicity of the cells was reduced by the treatment with the compound sample was confirmed, and the results are shown in FIG. 6.

[0204] As shown in FIG. 6, when treated at a concentration of 12.5 μM or 25 μM, all of the compounds of Example 10 showed the least toxicity, and it was confirmed that the toxicity was improved by more than 20% compared to Comparative Example 1.

[0205] <Experimental Example 5> Analysis of Klotho protein expression in HK-2 cells As shown in the protocol of Figure 7a, HK-2 cells (human kidney cells) were treated with cisplatin (20 μM) to create a disease model, and then treated with KS1 compound (Example 10) (3 μM). After 24 hours, the cells were harvested and the level of Klotho protein expression was confirmed. As shown in Figure 7b, it was confirmed that the expression of Klotho protein in HK-2 cells was decreased in the group treated with cisplatin, and increased in the group treated with KS1 compound (Example 10).

[0206] <Experimental Example 6> Analysis of the effect of KS1 compound (Example 10) in a unilateral ureter obstruction (UUO) model The unilateral ureteral obstruction model was performed using 5-week-old male C56BL / 6 mice. To create the unilateral ureteral obstruction model, the right ureter was tied with a thread, and KS1 compound (20 mg / kg / day) was injected intraperitoneally every day from 24 hours after the ligation. The mice were then sacrificed on the 7th and 14th days, samples were collected, and the experiment was carried out (Figure 8a).

[0207] Check for renal enlargement The experimental results showed that the kidneys were enlarged in the unilateral ureteral obstruction model, whereas the kidneys treated with the KS1 compound showed no difference in size (FIG. 8b).

[0208] Identification of nuclear and cytoplasmic changes To investigate the changes to the nucleus and cytoplasm in the unilateral ureteral obstruction model, H&E staining was performed, and the results are shown in Figure 9. In the 1-week sample from the unilateral ureteral obstruction model without KS1 treatment, the number of nuclei was significantly increased, and in the 2-week sample, the cytoplasm was destroyed, whereas in the KS1-treated sample, the tissue destruction was significantly decreased (Figure 9).

[0209] Check for progression of fibrosis Sirius Red staining was also performed to examine changes due to the progression of fibrosis in the unilateral ureteral obstruction model. In the 1-week tissue sample from the KS1-untreated unilateral ureteral obstruction model, the progression of fibrosis could be seen in red, and in the 2-week sample, fibrosis was more advanced than in the 1-week sample. However, the KS1-treated group showed less fibrosis than the KS1-untreated unilateral ureteral obstruction model (Figure 10).

[0210] Confirmation of cell death To investigate the degree of cell death in the unilateral ureteral obstruction model, TUNEL staining was performed. In the 1-week tissue samples from the unilateral ureteral obstruction model without KS1 treatment, cell death occurred, and in the 2-week tissue samples, cell death was increased compared to the 1-week tissue samples. However, in the KS1-treated group, cell death was significantly reduced compared to the unilateral ureteral obstruction model without KS1 treatment (Figure 11).

[0211] Confirmation of Klotho protein expression level When changes in Klotho protein expression were confirmed in 1-week samples from the unilateral ureteral obstruction model, the results showed that Klotho protein was reduced in samples from the unilateral ureteral obstruction model that were not treated with KS1, but that Klotho protein expression was increased in samples treated with the KS1 compound (Figure 12).

[0212] MMP-9 protein expression analysis When we examined changes in MMP-9 protein, an inflammation marker, in the unilateral ureteral obstruction model, we found that MMP-9 was increased in the 1-week and 2-week samples from the unilateral ureteral obstruction model that was not treated with KS1, but that when KS1 was treated, the MMP-9 expression level was significantly reduced (Figure 13).

[0213] <Experimental Example 7> Analysis of the effect of KS1 compound (Example 10) on reducing hypertension 1. Laboratory rat Six-week-old male rats (WKY / lzm) were used as normal control groups, and six-week-old male rats (SHR / lzm) were used as experimental groups to induce hypertension. All animals were purchased from Central Laboratory Animals, and experiments were carried out in the re-import area breeding facility in the Experimental Animal Center of the Ohsung Foundation for Advanced Medical Industry Promotion. Experimental rats were quarantined and purified for seven days after acquisition, and the health of the animals was observed during this period.

[0214] 2. Rat breeding environment (1)Environmental conditions This experiment was carried out in the re-entry area breeding facility in the Experimental Animal Center of the Ohsung Foundation for Advanced Medical Industry Promotion, with the following settings: temperature 22±2℃, relative humidity 50±10%, ventilation frequency 10-15 times / hr, lighting time 12 hours (lights on 8am - lights off 8pm) and illuminance of 500 Lux or more. All experimenters wore work clothes and protective gear that had been autoclaved (121℃, 20 minutes) during the work.

[0215] (2) Cages and stocking density The test animals were housed in individually ventilated cages (IVCs) that met AAALAC guideline standards (W200 × D310 × H150) with two animals per cage during the purification period and during the experimental period.

[0216] (3) Feed and water supply method The feed provided for the test was solid feed for test water (+40RMM-10, SAFE) that was sterilized by irradiation, and the feed ingredient analysis report showed that there were no factors that would affect the test in terms of feed composition and contaminant testing. Water was ultra-pure water produced by an RO water (reverse osmosis distilled water) production and supply device, which was sterilized with sodium hypochlorite (NaOCl) and UV equipment, and was available for free consumption through water bottles. Regular water quality testing was conducted by an accredited institution (Chungbuk Health and Environment Research Institute, 184, Oseongsaem-ro 1-ro, Oseong-eup, Cheongwon-gun, Chungbuk), and the result was that it "met the drinking water quality standards."

[0217] (5) Quarantine Purification The animals were visually inspected when they were brought in. During the purification period, general symptoms were observed once a day and recorded on a general symptoms observation record sheet. On the final day of the purification period, the general symptoms were checked to evaluate the health of the animals.

[0218] (6) Identification of individuals and cages During the purification period, the animals were individually marked with a red oil-based pen on their tails when they were received, and individual identification cards were attached to the rearing cage pups during the quarantine purification period. During the observation period, the animals were individually marked with a blue oil-based pen on their tails when they were separated into groups, and individual identification cards were attached to the rearing cage pups.

[0219] (7) Group separation The animals were randomly divided into 5 groups with 5 animals per group on the day of the end of device purification (group separation day) among those with no abnormal general symptoms. 2 The animal was euthanized using

[0220] 3. Composition of experimental groups To determine whether blood pressure increases, WKY rats were used as a normal control group. SHR rats were divided into a negative control group, a test substance administration group, a positive substance administration group, and a test substance + positive substance administration group.

[0221] 4. Preparation and Administration of Test Substances (1) The test substance and positive control substance were dissolved in the vehicle at a volume of 20 mL / kg according to the relevant concentration.

[0222] (2) After quarantine and purification, the animals were divided into groups based on their blood pressure and body weight, and then administered the vehicle, test substance, and positive control substance.

[0223] (3) All animals in each group were orally administered 20mL / kg of liquid using a 3mL syringe, 7 times a week for 8 weeks, based on the body weight measured once a week. The substance concentration was 20mg / kg / day.

[0224] 5. Blood Pressure Measurement Thirty-six and sixty-four days after drug administration, the animals were placed in a blood pressure compensation device and blood pressure was measured by tail protruding. Blood pressure measurements were recorded using a MODA High Throughput System (Kent Scientific).

[0225] 6. Experimental Results The systolic pressure of the drug-treated groups measured in rats is shown in Figure 14. The experimental results showed that when spontaneously hypertensive rats (SHR), an animal model of hypertension, were treated with the KS1 compound, the systolic blood pressure was significantly reduced, indicating that the KS1 compound can be effectively used to prevent and treat hypertension. In addition, when administered in combination with losartan, an angiotensin II receptor blocker drug that has been used as a conventional hypertension treatment, it showed a better blood pressure reduction effect than when each drug was administered independently, indicating that KS1 can also be used in combination administration for the treatment of hypertension.

[0226] <Experimental Example 5> Analysis of the cell aging inhibitory effect of KS1 compound (Example 10) 1. Cell Culture and Compound Treatment Renal proximal tubule epithelial cells (RPTECs) were purchased from Lonza, and the culture medium was the REGM kit provided by the same company. Cell culture was performed in an incubator at 37°C with 5% CO 2 The cells were cultured under the conditions described above. When the cells reached 80% saturation, they were treated with trypsin and transferred to a new culture dish for subculture. The compound was added to the medium to a final concentration of 2.5 μM, and the compound was added at each subculture to maintain a constant concentration. For the negative control, cells containing only the solvent DMSO were used, and as a control group in which senescence did not progress, cells that had been subcultured 9 times (#9) were used. For the cells in which senescence was induced, cells that had been subcultured a total of 17 times (#17) were used.

[0227] 2. Check the degree of aging To confirm the degree of cellular senescence, Cell Signaling Technology's Senescence β-galactosidase staining kit was used. On the day of the experiment, the staining solution was added to the cells, and the stained cells were confirmed 8 hours later. The number of stained cells out of the total number of cells observed under a 200x microscope was counted and expressed as a ratio, and the number of stained cells in three different places per sample was counted and averaged. As the expression of β-galactosidase enzyme increases as the cellular senescence progresses, stained cells can be considered to be cells that have senesced more than unstained cells.

[0228] 3. Experimental Results The experimental results showed that the degree of senescence was significantly increased in cells subcultured 17 times compared to cells subcultured 9 times. When observed under a microscope at 200x magnification, about 90% of the cells subcultured 17 times were stained, while only 50% of the cells subcultured 9 times were stained (Figure 15). In the same cells subcultured 17 times, the degree of staining was reduced in the cell group cultured in the medium containing KS1 compound (Example 10), with about 70% of the cells stained (Figure 15). In other words, it was shown that the degree of senescence of cells cultured in the presence of KS1 compound (Example 10) was reduced by about 20% compared to cells grown in the medium containing DMSO during the 17-times subculture period.

Claims

1. The present invention relates to a compound represented by the following chemical formula 1 or a pharma- ceutically acceptable salt thereof: A composition for inhibiting cellular senescence. [Chemical formula 1] 【Chemistry 1】 (In the above formula 1, R1 and R2 are each —H or a C 1-10 straight or branched chain alkyl.)

2. The cells are characterized as being renal proximal tubule epithelial cells. The composition of claim 1.

3. The composition is characterized in that it improves the expression level of the Klotho gene. The composition of claim 1.

4. The present invention relates to a compound represented by the following chemical formula 1 or a pharma- ceutically acceptable salt thereof: A cosmetic composition for preventing or improving skin aging. [Chemical formula 1] 【Chemistry 2】 (In the above formula 1, R1 and R2 are each —H or a C 1-10 straight or branched chain alkyl.)

5. A pharmaceutical composition for preventing or treating a disease induced by vascular aging, comprising a compound represented by the following formula 1 or a pharma- ceutical acceptable salt thereof: The disease induced by vascular aging is selected from the group consisting of hypertension, angina pectoris, myocardial infarction, arteriosclerosis, prostatic hyperplasia, vasospasm and contraction, thrombosis, cerebral infarction and cerebral hemorrhage; A pharmaceutical composition for preventing or treating diseases induced by vascular aging. [Chemical formula 1] 【Chemistry 3】 (In the above formula 1, R1 and R2 are each —H or a C 1-10 straight or branched chain alkyl.)

6. A pharmaceutical composition for preventing or treating a disease induced by vascular aging, comprising a compound represented by the following formula 1 or a pharma- ceutical acceptable salt thereof and an angiotensin II receptor blocker: The disease induced by vascular aging is selected from the group consisting of hypertension, angina pectoris, myocardial infarction, arteriosclerosis, prostatic hyperplasia, vasospasm and contraction, thrombosis, cerebral infarction and cerebral hemorrhage; A pharmaceutical composition for preventing or treating diseases induced by vascular aging. [Chemical formula 1] 【Chemistry 4】 (In the above formula 1, R1 and R2 are each —H or a C 1-10 straight or branched chain alkyl.)

7. A pharmaceutical composition for preventing or treating kidney disease, comprising a compound represented by the following chemical formula 1 or a pharma- ceutical acceptable salt thereof: The kidney disease is selected from the group consisting of nephritis, pyelitis, renal syndrome, acute pyelitis, chronic pyelitis, urinary tract infection, diabetic nephropathy, chronic glomerulonephritis, acute progressive nephritis, nephrotic syndrome, focal glomerulosclerosis, membranous nephropathy, and membranoproliferative glomerulonephritis; A pharmaceutical composition for preventing or treating kidney disease. [Chemical formula 1] 【Chemistry 5】 (In the above formula 1, R1 and R2 are each —H or a C 1-10 straight or branched chain alkyl.)

Images