Cells with multiplexed interfering RNA

Abstract

This application relates to the field of immunotherapy, more specifically to the field of adoptive cell therapy (ACT). Here, multiple shRNAs designed to downregulate multiple targets are proposed. Also proposed are polynucleotides, vectors encoding shRNAs, and cells that express such shRNAs alone or in combination with chimeric antigen receptors (CARs). These cells are particularly suitable for use in immunotherapy.

Description

[Technical field]

[0001] This application relates to the field of immunotherapy, more specifically to the field of adoptive cell therapy (ACT). Herein, multiple shRNAs designed to downregulate multiple targets are proposed. Also proposed are polynucleotides, vectors encoding the shRNAs, and cells expressing such shRNAs alone or in combination with chimeric antigen receptors (CARs). These cells are particularly suitable for use in immunotherapy. The present invention provides a method for enhancing the efficacy of T cell therapy in patients in need of treatment. Furthermore, strategies are provided for using these cells to treat diseases such as cancer. Engineered immune cells such as T cells or natural killer (NK) cells expressing such CARs are suitable for treating lymphomas, multiple myeloma, leukemia, but other tumors can also be treated depending on the specificity of the CAR. [Background technology]

[0002] In cell therapy, it is often advantageous to downregulate targets that may interfere with the beneficial effects of the therapy, such as TCR components that induce graft-versus-host disease, HLA components that induce host-versus-graft disease, stress ligands, immune checkpoints, etc. However, downregulating multiple of these targets simultaneously is often problematic due to practical constraints (e.g., vector size and number of molecules that can be administered simultaneously) and toxicity issues.

[0003] Typically, genetic modification approaches, such as CRISPR / Cas, TALEN, and zinc finger nucleases (ZFNs), are proposed. However, these approaches usually lead to permanent and irreversible changes and / or complete knockout of genes, which can be problematic if the absence of the target leads to viability issues or toxicity. Furthermore, their permanent nature is inflexible when only a transient downregulation of the target is desired. Genetic modification techniques are generally very cumbersome and are not ideal for knocking down multiple targets simultaneously. For example, in the case of TALENs, a separate nuclease protein needs to be modified for each target to achieve knockdown. After that, the efficacy still needs to be evaluated. Combining two or more different TALENs is theoretically possible, but has obvious practical disadvantages. That is, it is necessary to check whether the combination of two TALENs affects the efficacy. Also, because these are large proteins, it is not practical to express both in, for example, ACT, where the size of the vector is usually limited. All these obstacles become severe when considering more than two targets. Crispr / Cas is usually a more versatile solution, but multiplexing (i.e. modifying multiple target sites simultaneously) remains challenging, especially in eukaryotes. This is due to low DNA repair efficiency (the NHEJ repair mechanism of double-strand breaks in eukaryotes is error-prone), off-target effects and chromosomal rearrangements sometimes seen with CRISPR, and the general low efficiency of CRISPR multiplexing (transfection efficiency drops dramatically when targeting multiple genes), resulting in problems with both efficiency and specificity. Furthermore, gene editing approaches that act directly on DNA to durably silence target genes require robust testing to ensure genomic integrity, while also necessitating elaborate, multi-step manufacturing methods that may result in poorly differentiated or exhausted cells with limited persistence and / or functionality (Gattinoni et al., 2011). This is particularly important in the context of ACT.For therapeutic benefit, early differentiated, non-exhausted cells are clearly superior. Summary of the Invention [Problem to be solved by the invention]

[0004] Thus, there is a need in the art to provide a system that allows for cell therapy by multiplexed knockdown of targets without the need for multi-step manufacturing processes (hence, relative ease and reduced cost of manufacture) and with flexibility (e.g., making the modifications reversible, allowing for attenuation of knockdown (e.g., to avoid toxicity), swapping one target for another, etc.). [Means for solving the problem]

[0005] (overview) To address the issue of multiplexed genome modification, systems with the potential for genetic knockdown rather than knockout are being considered, which allows for greater flexibility (e.g., temporal regulation). Ideally, these systems should be less cumbersome (no need to genetically modify separate proteins for each target) and have sufficient efficiency and specificity.

[0006] One potential solution is RNA interference (RNAi). Several mechanisms of gene regulation by RNAi exist in plants and animals. The first is through the expression of small non-coding RNAs called microRNAs (miRNAs). miRNAs can target specific messenger RNAs (mRNAs) for degradation, thus promoting gene silencing.

[0007] Given the importance of the microRNA pathway in regulating gene activity, researchers are currently investigating the extent to which artificially designed molecules, called small inhibitory RNAs ("siRNAs"), can mediate RNAi. siRNAs can cleave target molecules such as mRNA and, like miRNAs, rely on base complementarity to recognize their targets.

[0008] A class of molecules known as siRNAs includes short hairpin RNAs (shRNAs). shRNAs are single-stranded molecules that contain a sense region and an antisense region that can hybridize to the sense region. shRNAs can form a stem-and-loop structure, where the sense and antisense regions form part or all of the stem. One advantage of using shRNAs is that they can be delivered or transcribed as one molecule, which is not possible when siRNAs have two separate strands. However, like other siRNAs, shRNAs also target mRNAs based on base complementarity.

[0009] Many pathologies, diseases, and disorders are caused by interactions between multiple proteins, so researchers are seeking effective ways to simultaneously deliver multiple siRNAs into a cell or organism.

[0010] One approach is to use vector technology to express shRNAs in cells where they are processed by the endogenous miRNA pathway. However, using separate vectors for each shRNA is cumbersome. Therefore, the use of vectors capable of expressing multiple shRNAs has been considered. Unfortunately, several challenges have been reported when expressing multiple shRNAs from a single vector. Among the problems researchers have faced are (a) the risk of vector recombination and loss of expression of shRNAs, (b) reduced function of shRNAs due to the position of the multiplex cassette, (c) the complexity of shRNA cloning, (d) saturation of RNAi processing, (e) cytotoxicity, and (f) undesirable off-target effects.

[0011] Furthermore, although siRNAs have been shown to be effective for short-term gene inhibition in certain transformed mammalian cell lines, their use in primary cells and for stable transcript knockdown has been more challenging. Knockdown efficacy is known to vary widely, ranging from <10% to >90% (Taxman et al., 2006), and further optimization is required. Optimization becomes even more important when multiple inhibitors are expressed, as efficacy is generally reduced in such cases.

[0012] Thus, there remains a need to develop efficient cassettes and vectors for delivering multiplexed RNA interference molecules, which, although true for general cellular applications, has been less explored in the field of ACT, and there is a strong need for efficient systems in these cells.

[0013] Surprisingly, it is shown herein that not only can shRNAs be successfully multiplexed within cells, particularly within engineered immune cells, but targets are downregulated very efficiently, even comparable to gene knockout (see Examples 5-8 and comparison with CRISPR).

[0014] It is therefore an object of the present invention to provide a modified cell comprising a nucleic acid molecule encoding at least two multiplexed RNA interference molecules.

[0015] According to a further embodiment, a first exogenous nucleic acid molecule encoding a protein of interest; a second nucleic acid molecule encoding at least two multiplexed RNA interference molecules; A modified cell is provided, comprising:

[0016] Said modified cell is particularly a eukaryotic cell, more particularly a modified mammalian cell, more particularly a modified human cell.According to a particular embodiment, said cell is a modified immune cell.Exemplary immune cells are selected from T cells, NK cells, NKT cells, stem cells, progenitor cells, and iPSC cells.

[0017] According to certain embodiments, the modified cell further comprises a nucleic acid that codes for a protein of interest.In particular, the protein of interest is a receptor, in particular a chimeric antigen receptor or TCR.The chimeric antigen receptor can target any target, typical examples include CD19, CD20, CD22, CD30, BCMA, B7H3, B7H6, NKG2D, HER2, HER3, GPC3, etc., but many more exist and are suitable.

[0018] According to certain embodiments, the first and second nucleic acid molecules are present in one vector, e.g., a eukaryotic expression plasmid, a minicircle DNA, or a viral vector (e.g., derived from lentivirus, retrovirus, adenovirus, adeno-associated virus, and Sendai virus).

[0019] The at least two multiplexed RNA interference molecules can be at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more molecules, depending on the number of target molecules to be downregulated and the constraints on co-expression of the multiplexed molecules. A "multiplex" refers to a polynucleotide encoding multiple molecules of the same type, such as multiple siRNAs or shRNAs or miRNAs. Within a multiplex, molecules of the same type (e.g., all shRNAs) may be identical or may contain different sequences. Molecules of the same type may be interposed between them by a sequence such as a linker as described herein. An example of multiplexing of the present invention is a polynucleotide encoding multiple tandem miRNA-based shRNAs. A multiplex may be single-stranded, double-stranded, or both single-stranded and double-stranded regions.

[0020] According to certain embodiments, at least two multiplexed RNA interference molecules are under the control of one promoter. Usually, this promoter is not the U6 promoter. This is because this promoter is associated with toxicity, especially at high levels of expression. For the same reason, it may be considered to exclude the H1 promoter, which is a weaker promoter than U6, or generally the Pol III promoter, although it may be suitable in certain conditions. According to certain embodiments, said promoter is selected from the Pol II promoter and the Pol III promoter. According to certain embodiments, said promoter is a natural or synthetic Pol II promoter. According to a particular embodiment, the promoter is a Pol II promoter selected from the following: cytomegalovirus (CMV) promoter, elongation factor 1 alpha (EF1α) promoter (core or full length), phosphoglycerate kinase (PGK) promoter, composite beta-actin promoter (CAG promoter) with upstream CMV IV enhancer, ubiquitin C (UbC) promoter, spleen focus forming virus (SFFV) promoter, Rous sarcoma virus (RSV) promoter, interleukin-2-promoter, murine stem cell virus (MSCV) long terminal repeat (LTR), gibbon ape leukemia virus (GALV) LTR, simian virus 40 (SV40) promoter, tRNA promoter. These promoters are the most commonly used polymerase II promoters driving the expression of mRNA.

[0021] According to certain embodiments, at least two multiplexed RNA interference molecules can be shRNA molecules or miRNA molecules.Most particularly, they are miRNA molecules.The difference between shRNA molecules and miRNA molecules is that miRNA molecules are processed by Drosha, while traditional shRNA molecules are not processed (which is associated with toxicity.Grimm et al., Nature 441:537-541(2006)).

[0022] According to certain embodiments, the miRNA molecule may be provided as an miRNA scaffold under the control of a promoter.

[0023] Scaffold sequences that are particularly suitable for miRNA multiplexing are the miR-30 scaffold sequence, the miR-155 scaffold sequence, and the miR-196a2 scaffold sequence.

[0024] Typically, at least one of the miRNA molecules comprises a miR-196 scaffold sequence, preferably a miR-196a2 scaffold sequence. According to a particular embodiment, all of the at least two miRNA molecules comprise a miR-scaffold sequence, preferably a miR-196a2 scaffold sequence. The same is true for the miR-30 and miR-155 scaffold sequences. Examples of such suitable scaffolds are described in U.S. Pat. No. 8,841,267 (especially claim 1 therein), which is incorporated herein by reference. A single scaffold can be expressed as a SMARTvector. TM It is commercially available as a micro-RNA adapted scaffold (Horizon Discovery, Lafayette, CO, USA). Multiple copies of this scaffold can be arranged in tandem repeats (see Figure 5).

[0025] Further suitable scaffold sequences include miR-26b (hsa-mir-26b), miR-204 (hsa-mir-204), and miR-126 (hsa-mir-126), hsa-let-7f, hsa-let-7g, hsa-let-7a, hsa-let-7b, hsa-let-7c, hsa-mir-29a, hsa-mir-140-3p, hsa-let-7i, hsa-let-7e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-26a, hsa-mir-340, hsa-mir-101, hsa-mir-29c, hsa-mir-191, hsa-mir-222, hsa-mir-34c-5p, hsa-mir-21, hsa-mir-378, hsa -mir-100, hsa-mir-192, hsa-mir-30d, hsa-mir-16, hsa-mir-432, hsa-mir-744, hsa-mir-29b, hsa-mir-130a, or hsa-mir-15a.

[0026] According to an alternative (but not exclusive) embodiment, instead of using a repeated specific miR scaffold to obtain an artificially repeated scaffold, a genuine polycistronic miRNA cluster or a part thereof can be used, in which the endogenous miRNA is replaced with the shRNA of interest. Particularly suitable miR scaffold clusters for this purpose are the miR-106a-363, miR-17-92, miR-106b-25, and miR-23a-27a-24-2 clusters, most particularly envisaged is the miR-106a-363 ​​cluster and fragments thereof. It is specifically envisaged to use a part of such a natural cluster and not all sequences in order to reduce the vector load (this is particularly useful since not all miRNAs are equally spaced and not all linker sequences are required). Other considerations are possible, for example taking the miRNA that is most efficiently processed in the cell. For example, the miR-17-92 cluster is composed of (in order) miR-17, miR-18a, miR-19a, miR-20a, miR-19b-l and miR-92-1 (also miR-92al), and particularly useful fragments thereof are the scaffold sequences from miR-19a to miR-92-1 (i.e., four of the six miRNAs) or the scaffold sequences from miR-19a to miR-19b-l (three of the six miRNAs). Similarly, the 106a-363 ​​cluster is composed of (in order) miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2 (also miR-92a2), and miR-363. Particularly useful fragments are the scaffold sequences from miR-20b to miR-363 (i.e., 4 of the 6 miRNAs) or from miR-19b-2 to miR-363 (i.e., 3 of the 6 miRNAs). Also, not only natural linker sequences, but also fragments thereof or artificial linkers can be used (to reduce the vector load).

[0027] For example, it is envisioned that both the miR-106a~363 cluster and the miR-196a2 sequence may be used in combination in a novel scaffold.

[0028] According to certain embodiments, at least two of the multiplexed RNA interference molecules are directed to the same target. According to further certain embodiments, at least two of the multiplexed RNA interference molecules are identical.

[0029] According to an alternative embodiment, all of the at least two multiplexed RNA interference molecules are different. According to a further particular embodiment, all of the at least two multiplexed RNA interference molecules are directed to different targets.

[0030] Any suitable molecule present in the modified cell may be targeted by the instant RNA interference molecule. Representative examples of anticipated targets include MHC class I genes, MHC class II genes, MHC coreceptor genes (e.g., HLA-F, HLA-G), TCR chains, CD3 chains, NKBBiL, LTA, TNF, LTB, LST1, NCR3, AIF1, LY6, heat shock proteins (e.g., HSPA1L, HSPA1A, HSPA1B), complement cascades, regulatory receptors (e.g., NOTCH4), TAP, HLA-DM, HLA-DO, RING1, CD52, CD247, HCP5, DGKA, DGKZ, B2M, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, 2B4, A2AR, BAX, BLIMP1, C160 (POLR3A), CBL-B, CCR6, These include CD7, CD95, CD123, DGK [DGKA, DGKB, DGKD, DGKE, DKGG, DGKH, DGKI, DGKK, DGKQ, DGKZ], DNMT3A, DR4, DR5, EGR2, FABP4, FABP5, FASN, GMCSF, HPK1, IL-10R [IL10RA, IL10RB], IL2, LFA1, NEAT1, NFkB (including RELA, RELB, NFkB2, NFkBl, REL), NKG2A, NR4A (including NR4A1, NR4A2, NR4A3), PD1, PI3KCD, PPP2RD2, SHIP1, SOAT1, SOCS1, T-BET, TET2, TGFBR1, TGFBR2, TGFBR3, TIGIT, TIM3, TOX, and ZFP36L2.

[0031] In particular, suitable miRNA-based constructs have been identified. Thus, the present invention provides modified cells comprising a polynucleotide having a multiplexed microRNA-based shRNA coding region, the multiplexed microRNA-based shRNA coding region comprising a sequence encoding: Two or more artificial miRNA-based shRNA nucleotide sequences, each of which comprises: miRNA scaffold sequence, the active or mature sequence, and A passenger or star sequence, wherein within each artificial miRNA-based shRNA nucleotide sequence, said active sequence is at least 80% complementary to said passenger sequence.

[0032] Both the active sequence and the passenger sequence of each artificial miRNA-based shRNA nucleotide sequence usually have a length of 18 to 40 nucleotides, more particularly 18 to 30 nucleotides, most particularly 19 to 25 nucleotides.

[0033] Typically, these microRNA scaffold sequences are separated by a linker, which may have a length of, for example, 30-60 nucleotides, although shorter stretches also work. Indeed, we surprisingly found that the length of the linker does not play a significant role, and that even very short (less than 10 nucleotides) or absent links do not prevent the function of the shRNA. This is shown in Figures 6 and 16.

[0034] The artificial sequence may be, for example, a naturally occurring scaffold (such as a miR cluster, such as the miR-106a-363 ​​cluster, or a fragment thereof) in which the endogenous miR sequence has been replaced with a modified shRNA sequence against a specific target, or it may be a repeat of a single miR scaffold (such as the miR-196a2 scaffold) in which the endogenous miR sequence has been replaced with a modified shRNA sequence against a specific target, or it may be an artificial miR-like sequence, or a combination thereof.

[0035] The modified cell typically further comprises a nucleic acid molecule encoding a protein of interest, such as a chimeric antigen receptor or TCR, and may be a modified immune cell as described above.

[0036] By co-expressing multiplexed RNA interference molecules, at least one gene, but typically multiple genes, are silenced in the engineered cells, which may lead to more effective therapeutic outcomes.

[0037] The modified cells described herein are also provided for use as pharmaceuticals. According to certain embodiments, the modified cells are provided for use in the treatment of cancer.

[0038] This amounts to providing a method of treating cancer comprising administering to a subject in need of treatment an appropriate amount of modified cells as described herein, thereby ameliorating at least one symptom.

[0039] The modified cells may be autologous immune cells (cells obtained from the patient) or allogeneic immune cells (cells obtained from another subject). [Brief description of the drawings]

[0040] [Figure 1] Optimization of miRNA scaffold length. Panel A) Percentage of transduced T cells as measured by CD19 expression, Panel B) TCR and Panel C) CD3E MFI of cells transfected with CD247-targeting shRNA incorporated into miRNA scaffolds of different lengths. [Diagram 2] Screening of different CD52 targeting shRNAs. Panel A) Percentage of transduced (CD19+) CD4+ or CD8+ T cells are shown, gated on FSC / SSC, viable, CD3+ cells. Panel B) CD52 MFI is shown for transduced (CD19+ gated) CD4+ or CD8+ T cells. Panel C) Representative histogram showing CD52 expression of transduced T (CD19+CD3+) cells. [Diagram 3]CD52 knockdown in different donors is shown. CD52 MFI of T cells from three different donors is shown. Cells were transduced with mock or CD52 shRNA-3 expression vector. [Figure 4] Screening of gRNAs for generating CRISPR / Cas9-based CD52 knockout T cells is shown. The left panel shows CD52 MFI of CD4+ and CD8+ T cells at the time of harvest (day 8). For Mock (tCD19) and shRNA conditions, gating was performed on CD19+ cells, whereas for the other conditions, gating was performed on CD3+ T cells. In the right panel, representative histograms show CD52 expression of three different gRNAs compared to the Cas9-only control. [Diagram 5] Designs of CAR expression vectors (e.g. CD19, BCMA, B7H3, B7H6, NKG2D, HER2, HER3, GPC3) without (top) or with (bottom) integrated miRNA scaffolds, allowing CAR and multiple shRNAs (e.g. 2, 4, 6, 8,...) to be co-expressed from the same vector. LTR: long terminal repeat; promoter (e.g. EFla, PGK, SFFV, CAG,...); marker protein (e.g. truncated CD34, CD19); multiplexed shRNA. [Figure 6]Two miRNA shRNAs were expressed from the same expression construct in a BCMA-CAR vector in primary T cells. Different spacers between the two shRNAs (multiplex 1-5) were used to evaluate their effect on knockdown of CD247 and CD52 proteins. Panel A) Transduction efficiency measured by expression of the reporter protein tCD34, Panel B) Expression of BCMA CAR on the cell surface when stained with BCMA-Fc fusion protein followed by staining with anti-Fc PE-conjugated antibody. Panel C) Mean fluorescence intensity (MFI) of the TCR as readout showing the efficiency of downregulation of TCR expression following knockdown of the CD3ζ subunit of the TCR by shRNA targeting CD247, Panel D) Efficiency of individual constructs to downregulate CD52 using CD52 MFI as readout. [Figure 7] Panel A) CD247 (CD3ζ) and panel B) CD52 RNA levels were assessed by real-time PCR analysis relative to CYPA RNA, used as a housekeeping gene, in T cells transduced with the indicated single or multiplexed shRNA constructs and respective controls. [Figure 8] Representative flow cytometry data of TCR- and CD52-stained T cells transduced with BCMACAR co-expressing CD247, CD52, or both CD52 and CD247 shRNA multiplexed with spacer 2 or spacer 5. As a control, cells were nucleofected with RNP Cas9 gRNA CD52 and gRNA CD247 complexes. [Figure 9] Flow cytometry analysis of panel A) TCR cell surface expression and panel B) CD52 cell surface expression of T cells transduced with the indicated single or multiplex shRNA constructs and respective controls. [Figure 10]Panel A) BCMA CAR expression of cells transduced with the different expression constructs was assessed by staining with BCMA-Fc fusion protein followed by PE-conjugated anti-Fc and APC-conjugated anti-CD34 antibodies. Median fluorescence intensity of BCMA-Fc staining is shown for transduced (CD34+) T cells. Panel B) Different BCMA-expressing cancer cell lines (RPMI-8226, U266, OPM-2) were co-cultured with Mock (tCD34), BCMA-CAR expressing T cells with or without CD247 shRNA, CD52 shRNA, or CD247 CD52 multiplexed shRNA for 24 hours. IFN-γ levels were measured in the supernatants by ELISA. [Figure 11] In vitro functional assessment of T cell receptor response to mitogenic stimulation. T cells were cultured in the presence of increasing concentrations of anti-CD3E antibody (clone OKT3). After 24 hours, IFN-γ levels in the supernatants were measured by ELISA. Results from two different donors (CC19-174 and CC19-184) are shown. [Figure 12] Figure 1 shows an in vitro functional assay to assess the susceptibility of T cells to anti-CD52 mediated cell killing. Alemtuzumab was used as the anti-CD52 antibody. T cells were treated with 30% complement in the presence of 50 μg / mL alemtuzumab or IgG control antibody. The number of viable cells was assessed after 4 hours. [Figure 13] Four shRNAs targeting B2M, DGK, CD247, and CD52 were expressed singly or multiplexed as indicated in the vector design, along with a second generation CD19 CAR and a selection marker, and RNA expression is shown in Jurkat cells transduced with a lentiviral backbone. Single-step enrichment was performed with marker-specific magnetic beads 7 days post-transduction. ShRNA-induced downregulation of transcriptional expression of the four targets was analyzed by qRT-PCR. [Figure 14]RNA expression in primary T cells from healthy donors transduced with retroviral vectors encoding second generation CD19-directed CARs (truncated CD34 selectable marker, together with 3x or 6x shRNAs targeting CD247, B2M or CD52, introduced into the 106a-363 ​​miRNA cluster). No shRNA (tCD34) was used as control. Two days after transduction, cells were enriched using CD34-specific magnetic beads and further amplified with IL-2 (100 lU / mL) for 6 days. mRNA expression of CD247, B2M and CD52 was assessed by qRT-PCR using cyclophilin as housekeeping gene. [Figure 15] RNA expression in human iPSC cell line SCiPS-Rl transduced with two shRNAs separated by long (linker 1-41 bp) or minimal (linker 2-6 bp) linkers together with the selection marker CD34 (tCD34) using a lentiviral backbone. Transduction was performed with 50 μI or 500 μI of viral supernatant diluted to 1 ml with medium. Single-step enrichment was performed with CliniMACS magnetic beads specific for CD34 8 days after transduction. Transcriptional expression of shRNA targets was then analyzed by qRT-PCR using cyclophilin as housekeeping gene. Bar graph shows the relative expression values ​​with SCiPS-Rl cells (tCD34) not expressing shRNA as control. Linker 1 (41 bp): caagttgggctttaaagcttgcagggcctgatgttgag (SEQ ID NO: 1); Linker 2 (6 bp - cloning derived): aagctt (SEQ ID NO: 2). [Figure 16]RNA expression in human iPSC cell line SCiPS-Rl transduced with two shRNAs separated by either a long linker (linker 1-41 bp) or a minimal linker (linker 2-6 bp) together with the selection marker CD34 (tCD34) using a lentiviral backbone. Transduction was performed by diluting 500 ml of viral supernatant into 1 ml of medium. Single-step enrichment was performed using CD34-specific CliniMACS magnetic beads 8 days after transduction. Cells were analyzed for expression of shRNA targets by qRT-PCR using cyclophilin as housekeeping gene. Bar graph shows expression values ​​relative to SCiPS-Rl cells (tCD34) expressing no shRNA as control. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0041] (definition) The present invention will be described with respect to certain embodiments and with reference to certain drawings, but the invention is not limited thereto, but only by the claims. Reference signs in the claims should not be construed as limiting the scope of the invention. The drawings described are merely schematic and not limiting. In the drawings, the size of the components may be exaggerated for illustrative purposes and are not strictly illustrated. When the term "comprising" is used in the present specification and claims, it does not exclude other elements or steps. When an indefinite or definite article is used in reference to a singular noun, it includes the plural of that noun unless something else is specifically stated, such as "a" or "an", "the".

[0042] Moreover, the terms "first," "second," "third," etc. in the specification and claims are used to distinguish between similar elements and do not necessarily denote an order or chronological sequence. The terms so used are interchangeable under appropriate circumstances, and it is understood that the embodiments of the invention described herein can be practiced in other orders than those described or illustrated herein.

[0043] The following terms or definitions are presented solely to aid in the understanding of the invention.

[0044] Unless otherwise defined herein, all terms used herein have the same meaning as understood by those skilled in the art of the present invention.For definitions and terms of the art, practitioners are specifically referred to the following documents: Green and Sambrook, "Molecular Cloning: A Laboratory Manual, 4th Edition," Cold Spring Harbor Laboratory Press, New York (2012); Ausubel et al., "Current Protocols in Molecular Biology (up to Supplement 114)," John Wiley & Sons, New York (2016).The definitions provided herein should not be interpreted narrower than those understood by those skilled in the art.

[0045] As used herein, a "modified cell" is a cell that has been modified through human intervention (as opposed to a naturally occurring mutation).

[0046] As used herein, the term "nucleic acid molecule," synonymous with "nucleotide" or "nucleic acid" or "polynucleotide," refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Nucleic acid molecules include, but are not limited to, single-stranded and double-stranded DNA, DNA that is a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, RNA that is a mixture of single-stranded and double-stranded regions, and hybrid molecules that contain DNA and RNA that are single-stranded or, more typically, double-stranded or a mixture of single-stranded and double-stranded regions. A "polynucleotide" also refers to a triple-stranded region that contains RNA or DNA, or both RNA and DNA. The term "polynucleotide" also includes DNA or RNA that contains one or more modified bases, and DNA or RNA whose backbones have been modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. "Polynucleotide" includes naturally occurring polynucleotides that have been chemically, enzymatically, or metabolically modified, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also includes relatively short strands of nucleic acid known as oligonucleotides.

[0047] A "vector" is a replicon, such as a plasmid, phage, cosmid, or virus, into which another nucleic acid segment can be operatively inserted to effect replication or expression of the segment. A "clone" is a population of cells derived from a single cell or common ancestor by mitosis. A "cell line" is a clone of a primary cell that can grow stably in vitro for many generations. In some examples provided herein, cells are transformed by transfecting the cells with DNA.

[0048] As used herein, the terms "express" and "produce" are used interchangeably to refer to the biosynthesis of a gene product. These terms encompass the transcription of a gene into RNA. These terms also encompass the translation of RNA into one or more polypeptides, and further encompass all naturally occurring post-transcriptional and post-translational modifications.

[0049] The term "exogenous" as used herein, particularly in the context of cells or immune cells, refers to any material that is present and active within an individual living cell, but originates from outside that cell (as opposed to endogenous factors). Thus, an "exogenous nucleic acid molecule" refers to a nucleic acid molecule that has been introduced into an (immune) cell, typically by transduction or transfection. The term "endogenous" as used herein means any factor or substance that is present and active in an individual living cell and originates from within that cell (and thus is typically produced even in non-transduced or non-transfected cells).

[0050] As used herein, "isolated" means that a biological component (such as a nucleic acid, peptide, protein, etc.) has been substantially separated, produced away from, or purified away from other biological components of the organism in which it naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides, and proteins that are thus "isolated" include nucleic acids and proteins that have been purified by standard purification methods. "Isolated" nucleic acids, peptides, and proteins can be isolated even if they are part of a composition, but such a composition is not part of the native environment. A composition remains isolated if it is not part of the native environment of the nucleic acid, peptide, or protein. The term also encompasses chemically synthesized nucleic acids as well as nucleic acids, peptides, and proteins prepared by recombinant expression in a host cell.

[0051] "Multiplexing" as used herein in the context of gene editing refers to targeting two or more (i.e., multiple) related or unrelated targets at the same time. "RNA interference molecule" as used herein refers to an RNA (or RNA-like) molecule that inhibits gene expression or translation by neutralizing targeted mRNA molecules. Examples include siRNA (including shRNA) or miRNA molecules. "Multiplexed RNA interference molecule" as used herein thus refers to two or more molecules that are present at the same time to simultaneously downregulate one or more targets. Usually, each of the multiplexed molecules is directed to a specific target, but two molecules can be directed to the same target (can be identical).

[0052] As used herein, a "promoter" is a regulatory region of nucleic acid that is usually located adjacent to a gene region and provides a control point for transcription of the regulated gene.

[0053] A "multiplex" is a polynucleotide that encodes multiple molecules of the same type, such as multiple siRNAs or shRNAs or miRNAs. Within a multiplex, when the molecules are of the same type (e.g., all shRNAs), they may be identical or composed of different sequences. Molecules of the same type may be interposed by an intervening sequence, such as a linker, as described herein. An example of a multiplex of the present invention is a polynucleotide that encodes multiple tandem miRNA-based shRNAs. A multiplex may be single-stranded, double-stranded, or have both single-stranded and double-stranded regions.

[0054] As used herein, a "chimeric antigen receptor" or "CAR" refers to a chimeric receptor (i.e., composed of sites from different sources) that has at least a binding site with specificity for an antigen (which may be derived, e.g., from an antibody, receptor or its cognate ligand) and a signaling site capable of transmitting a signal within an immune cell (e.g., the CD3 zeta chain; other signaling or co-signaling sites may be used, e.g., the Fc epsilon Rl gamma domain, the CD3 epsilon domain, the recently described DAP10 / DAP12 signaling domain, or domains from CD28, 4-1BB, OX40, ICOS, DAP10, DAP12, CD27, and CD2 as co-stimulatory domains). A "chimeric NK receptor" is a CAR in which the binding site is obtained or isolated from a NK receptor.

[0055] As used herein, "TCR" refers to a T cell receptor. In the context of adoptive cell transfer, this usually refers to a modified TCR, i.e., a TCR that has been modified to recognize a specific antigen, most typically a tumor antigen. As used herein, "endogenous TCR" refers to a TCR that is endogenously present in an unmodified cell, typically a T cell. TCRs are usually disulfide-linked membrane-bound heterodimers of highly variable alpha (α) and beta (β) chains, expressed as part of a complex with an invariant CD3 chain molecule. The TCR receptor complex is an octomeric complex of the variable TCR receptor a and b chains with the CD3 co-receptor (including the CD3γ chain, the CD36δ chain, and two CD3ε chains) and two CD3ζ chains (also known as the CD247 molecule). As used herein, "functional TCR" refers to a TCR that is capable of signaling upon binding of its cognate ligand. Typically, allogeneic therapies involve modifications to reduce or impair the function of the TCR, such as by knocking out or knocking down at least one of the TCR chains. The endogenous TCR in the modified cells is considered functional if it retains at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, or at least 90% of the signaling capacity (or T cell activation) compared to cells with unmodified endogenous TCR. Assays for assessing signaling capacity or T cell activation are known to those skilled in the art and include, in particular, ELISAs measuring interferon gamma. According to alternative embodiments, the endogenous TCR is considered functional if it has not been modified to inhibit the function of the TCR.

[0056] The term "immune cells" as used herein refers to cells that are part of the immune system (which may be either the adaptive or innate immune system). Immune cells as used herein are typically immune cells that have been produced for adoptive cell transfer (either autologous or allogeneic). Many different types of immune cells are used in adoptive therapy and are therefore envisioned for use in the methods described herein. Examples of immune cells include, but are not limited to, T cells, NK cells, NKT cells, lymphocytes, dendritic cells, myeloid cells, stem cells, progenitor cells or iPSCs. The latter three are not immune cells per se but may be used in adoptive cell transfer for immunotherapy (see, for example, Jiang et al., Cell Mol Immunol 2014; Themeli et al., Cell Stem Cell 2015). Typically, production begins with stem cells or iPSCs (or may begin with a dedifferentiation step from immune cells to iPSCs), but production involves a differentiation step into immune cells prior to administration. Stem cells, progenitor cells and iPSCs used to produce immune cells for adoptive transfer (i.e., stem cells, progenitor cells and iPSCs transduced with a CAR as described herein or their differentiated progeny) are considered immune cells herein. According to certain embodiments, the stem cells contemplated in this method do not include a step of destroying a human embryo.

[0057] Particularly contemplated immune cells include white blood cells such as lymphocytes, monocytes, macrophages, and dendritic cells. Particularly contemplated lymphocytes include T cells, NK cells, B cells, and the like, but particularly contemplated are T cells. It should be noted that in adoptive transfer, the immune cells are usually primary cells (cells directly isolated from human or animal tissue and not cultured or only briefly cultured) and not cell lines (i.e. cells continuously passaged over a long period of time and have acquired homogeneous genotypic and phenotypic characteristics). According to certain embodiments, the immune cells are primary cells (i.e. cells directly isolated from human or animal tissue and not cultured or only briefly cultured) and not cell lines (i.e. cells continuously passaged over a long period of time and have acquired homogeneous genotypic and phenotypic characteristics). According to alternative certain embodiments, the immune cells are not cells from cell lines.

[0058] As used herein, a "microRNA scaffold" or "miRNA scaffold" refers to a well-characterized primary microRNA sequence that contains specific microRNA processing requirements, into which an RNA sequence can be inserted (typically to replace an existing miRNA sequence with an shRNA directed to a specific target). Examples of miRNA scaffolds include the SMARTvector TM micro-RNA adapted scaffolds (Horizon Discovery, Lafayette, CO, USA), or naturally derived miRNA clusters such as the miR-106a~363 cluster.

[0059] The term "subject" refers to all vertebrates, e.g., mammals and non-mammals, e.g., non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and reptiles, including humans and non-human animals. In the most particular embodiment of the described method, the subject is a human.

[0060] The term "treat" or "treatment" refers to any success or indication of success in alleviating or ameliorating an injury, disease state or condition, including any objective or subjective parameter, such as alleviation, remission, attenuation of symptoms or making the condition more tolerable to the patient, slowing the rate of degeneration or decline, making the degenerative end point less debilitating, improving the physical or mental health of the subject, or prolonging survival. The treatment may be evaluated by objective or subjective parameters, such as physical exam, neurological exam, psychiatric evaluation, etc.

[0061] As used herein, the phrase "adoptive cell therapy", "adoptive cell transfer", or "ACT" refers to the transfer of cells, most typically immune cells, into a subject (e.g., a patient). These cells can be derived from the subject (in the case of autologous therapy) or from another individual (in the case of allogeneic therapy). The goal of this therapy is to improve immune function and characteristics, and in cancer immunotherapy, to enhance the immune response against cancer. ACT is most commonly performed with T cells, but can also be performed with other types of immune cells, such as NK cells, lymphocytes (e.g., TILs (tumor infiltrating lymphocytes)), dendritic cells, and myeloid cells.

[0062] An "effective amount" or "therapeutically effective amount" refers to an amount effective at the dosage and for the period of time necessary to obtain a desired therapeutic result. A therapeutically effective amount of a therapeutic agent, such as the transformed immune cells described herein, may vary depending on factors such as the individual's medical condition, age, sex, weight, and the ability of the therapeutic agent (such as the cells) to elicit a desired response in the individual. A therapeutically effective amount is also an amount in which the therapeutically beneficial effects outweigh the toxic or harmful effects of the therapeutic agent.

[0063] "Graft-versus-host disease" (GvHD) is a condition that can occur after allogeneic transplantation. In GvHD, donor bone marrow, peripheral blood (stem) cells, and other immune cells view the recipient's body as foreign and attack it. Because donor immunoresponsive immune cells, such as T cells, are the primary drivers of GvHD, one strategy to prevent GvHD is to reduce (TCR-based) signaling in these immunoresponsive cells, for example by directly or indirectly inhibiting the function of the TCR complex.

[0064] To assess whether it is possible to target multiple genes in adoptive cell transfer (ACT) without the need for genome editing (and its associated costs and complex manufacturing processes), it was decided to test multiplexed RNA interference molecules.

[0065] This approach is based on transcription of RNA from a specific vector that is processed by the endogenous RNA editing machinery to generate an active shRNA. This shRNA can target any mRNA by base recognition, resulting in the destruction of that specific mRNA by the DICER complex. The specific destruction of the targeted mRNA suppresses the expression of the associated protein. While transient knockdown of gene expression can be achieved by transfection of any target cell with RNA oligonucleotides, stable knockdown of gene expression can be achieved by expressing the desired shRNA in an integrated vector.

[0066] For successful expression of shRNA, it is important to bind to a polymerase III (Pol III) promoter (e.g., H1, U6) to generate an RNA species lacking a 5' cap and 3' polyadenylation, allowing processing of the shRNA duplex. The transcribed shRNA is processed to be released from the nucleus and further processed into the RNA-induced silencing complex (RISC) complex, which targets the selected mRNA for degradation (Moore et al., 2010). Although effective, the efficiency of transcription by the Pol III promoter may lead to cytotoxicity due to overexpression of shRNA from the Pol III promoter saturating the endogenous microRNA pathway (Fowler et al., 2015). Furthermore, expression of both therapeutic genes and shRNAs by a single vector has usually been achieved by employing a polymerase II (Pol III) promoter to drive the therapeutic gene and a Pol III promoter to drive the shRNA of interest. Although functional, this comes at the expense of vector space, which reduces options for including therapeutic genes ( Chumakov et al., 2010 ; Moore et al., 2010 ).

[0067] Embedding shRNAs within a microRNA (mir) framework allows processing of the shRNA under the control of the Pol ll promoter (Giering et al., 2008). Importantly, embedded shRNAs tend to be expressed at low levels, thereby avoiding the toxicity observed when expression is performed using other systems such as the U6 promoter (Fowler et al., 2015). Indeed, mice administered shRNAs driven by the liver-specific Pol ll promoter showed stable gene knockdown without tolerability issues for over a year (Giering et al., 2008). However, this was the result for one shRNA performed in hepatocytes, which only reduced the protein level by 15% (Giering et al., 2008). It is therefore unclear whether higher efficiency can be achieved with multiple targets, especially in immune cells (which are difficult to manipulate).

[0068] Surprisingly, it is shown herein that expression of multiple microRNA-based shRNAs (e.g., based on the miR196a2 scaffold or the miR106a-363 ​​cluster as a scaffold) against different targets is feasible in T cells without showing recombination, without showing toxicity, and at the same time achieving efficient downregulation of the targets.

[0069] Thus, not only can shRNAs be successfully multiplexed within cells, particularly within engineered immune cells, but targets are downregulated so efficiently that they rival gene knockout (see Examples 5-8 and Figures 8-12 for a comparison with CRISPR).

[0070] It is therefore an object of the present invention to provide a modified cell comprising a nucleic acid molecule encoding at least two multiplexed RNA interference molecules.

[0071] The cell that comprises at least two RNA interference molecules can have advantages, particularly therapeutic advantages.The RNA interference molecule can actually be directed to a target that (over)expression is undesirable.However, the modified cell provided herein usually further comprises a protein of interest.

[0072] According to a further embodiment, a first exogenous nucleic acid molecule encoding a protein of interest, and a second nucleic acid molecule encoding at least two multiplexed RNA interference molecules; A modified cell comprising:

[0073] Any additional protein of interest can provide, for example, additive, supportive, or synergistic effects, or can be used for another purpose.For example, the protein of interest can be a CAR targeted to tumor, and the RNA interference molecule can interfere with tumor function, for example, by targeting immune checkpoints, directly downregulating tumor targets, or targeting tumor microenvironment.Alternatively or additionally, one or more RNA interference molecules can prolong the persistence of therapeutic cells or change other physiological responses (e.g., interference with GvHD or host-versus-graft response).

[0074] The protein of interest can in principle be any protein depending on the setting. However, it is generally a protein with a therapeutic function. These include therapeutic proteins that are secreted, such as, for example, interleukins, cytokines, hormones, etc. However, according to certain embodiments, the protein of interest is not secreted. Typically, the protein of interest is a receptor. According to further particular embodiments, the receptor is a chimeric antigen receptor or a TCR. The chimeric antigen receptor can be directed to any target expressed on the surface of the target cell, typical examples being CD5, CD19, CD20, CD22, CD23, CD30, CD33, CD38, CD44, CD56, CD70, CD123, CD133, CD138, CD171, CD174, CD248, CD274, CD276, CD279, CD319, CD326, CD340, BCMA, B7H3, B7H6, CEA Many more exist and are suitable, including but not limited to CAM5, EGFRvlll, EPHA2, mesothelin, NKG2D, HER2, HER3, GPC3, Flt3, DLL3, IL1RAP, KDR, MET, mucin1, IL13Ra2, FOLH1, FAP, CA9, FOLR1, ROR1, GD2, PSCA, GPNMB, CSPG4, ULBP1, ULBP2, etc. Most CARs are scFv-based (i.e., the binding moiety is an scFv directed to a specific target, and the CAR is usually named after the target), while some CARs are receptor-based (i.e., the binding moiety is a part of a receptor, and the CAR is usually named after the receptor). An example of the latter is NKG2D-CAR.

[0075] Modified TCR can target any target of cell, including intracellular target.In addition to the above targets present on cell surface, typical targets of TCR include but are not limited to NY-ESO-1, PRAME, AFP, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, gp100, MART-1, tyrosinase, WT1, p53, HPV-E6, HPV-E7, HBV, TRAIL, thyroglobulin, KRAS, HERV-E, HA-1, CMV and CEA.

[0076] According to these particular embodiments in which there is an additional protein of interest, the first and second nucleic acid molecules in modified cells are typically present in one vector, such as eukaryotic expression plasmid, minicircle DNA, or viral vector (e.g., derived from lentivirus, retrovirus, adenovirus, adeno-associated virus, and Sendai virus). According to further particular embodiments, said viral vector is selected from lentivirus vector and retrovirus vector. Especially in the latter case, vector load (i.e. total size of construct) is important, and the use of compact multiplexing cassette is particularly advantageous.

[0077] Said modified cell is particularly a eukaryotic cell, more particularly a modified mammalian cell, more particularly a modified human cell.According to a particular embodiment, said cell is a modified immune cell.Exemplary immune cells are selected from T cells, NK cells, NKT cells, stem cells, progenitor cells, and iPSC cells.

[0078] The at least two multiplexed RNA interference molecules may be at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or even more molecules, depending on the number of target molecules to be downregulated and the constraints of co-expressing the multiplexed molecules. A "multiplex" refers to a polynucleotide that encodes multiple molecules of the same type, such as multiple siRNAs, or shRNAs, or miRNAs. Within a multiplex, in the case of molecules of the same type (e.g., all shRNAs), they may be identical or composed of different sequences. Between molecules of the same type, there may be an intervening sequence, such as a linker, as described herein. One example of multiplexing of the present invention is a polynucleotide that encodes multiple tandem miRNA-based shRNAs. A multiplex may be single-stranded, double-stranded, or both single-stranded and double-stranded regions.

[0079] According to a particular embodiment, said at least two multiplexed RNA interference molecules are under the control of one promoter. Usually, when expressing multiple RNA interference molecules, this is done by integrating multiple copies of shRNA expression cassettes. They usually have the same promoter sequence, which results in frequent recombination events that remove repeated sequence fragments. As a solution, multiple different promoters are usually used for one expression cassette (e.g., Chumakov et al., 2010). However, according to the present embodiment, recombination can be avoided by using only one promoter. Although the expression level is usually low, there is also an advantage in terms of toxicity, since too much siRNA can be toxic to the cell (e.g., by interfering with the endogenous siRNA pathway). Another advantage of using only one promoter is that all shRNAs are coregulated and expressed at similar levels. Surprisingly, as shown in the examples, transcribing multiple shRNAs from one promoter does not significantly reduce efficacy.

[0080] Further, according to certain embodiments, both at least two multiplexed RNA interference molecules and the protein of interest are under the control of one promoter.This reduces the load of vector (because no separate promoter is used to express the protein of interest) and provides the advantage of coregulated expression.This is advantageous, for example, when the protein of interest is a CAR that targets cancer, and the RNA interference molecule is intended to have an additive or synergistic effect in tumor eradication.

[0081] Usually, the promoter used for the expression of the RNA interference molecule is not the U6 promoter, since this promoter is associated with toxicity, especially at high levels of expression. For the same reason, one can consider excluding the H1 promoter (which is a weaker promoter than U6), or generally the Pol III promoter (although it may be suitable in certain conditions). Thus, according to certain embodiments, the promoter used for the expression of the inhibitory molecule is not an RNA Pol III promoter. RNA Pol III promoters lack temporal and spatial control and do not allow for controlled expression of miRNA inhibitors. In contrast, many RNA Pol II promoters allow for tissue-specific expression, and both inducible and repressible RNA Pol II promoters exist. Although tissue-specific expression is often not required in the context of the present invention (because the cells are selected before modification), it is still an advantage to have a promoter specific for, for example, immune cells, since it has been shown that the differences in RNAi potency from various promoters are particularly pronounced in immune cells (Lebbink et al., 2011). According to certain embodiments, the promoter is selected from Pol II promoters and Pol III promoters. According to certain embodiments, the promoter is a natural or synthetic Pol II promoter. Suitable promoters include, but are not limited to, cytomegalovirus (CMV) promoter, elongation factor 1 alpha (EFla) promoter (core or full length), phosphoglycerate kinase (PGK) promoter, composite beta actin promoter (CAG promoter) with CMV IV enhancer upstream, ubiquitin C (UbC) promoter, spleen focus forming virus (SFFV) promoter, Rous sarcoma virus (RSV) promoter, interleukin 2 promoter, murine stem cell virus (MSCV) long terminal repeat (LTR), gibbon ape leukemia virus (GALV) LTR, simian virus 40 (SV40) promoter, and tRNA promoter. These promoters are most commonly used as polymerase II promoters to drive the expression of mRNA.

[0082] According to certain embodiments, at least two multiplexed RNA interference molecules can be shRNA molecules or miRNA molecules.Most particularly, they are miRNA molecules.The difference between shRNA molecules and miRNA molecules is that miRNA molecules are processed by Drosha, while traditional shRNA molecules are not processed (which is associated with toxicity, Grimm et al., Nature 441:537-541(2006)).

[0083] According to certain embodiments, miRNA molecules can be provided as one miRNA scaffold under the control of one promoter. If the scaffold selected usually carries one miRNA, it can be repeated or combined with other scaffolds to obtain the expression of multiple RNA interference molecules. However, when repeated or combined with additional scaffolds, it is generally assumed that all of the multiplexed RNA interference molecules are under the control of one promoter (i.e., when a single scaffold is repeated, the promoter is not repeated).

[0084] Particularly suitable scaffold sequences for miRNA multiplexing are the miR-30 scaffold sequence, the miR-155 scaffold sequence, and the miR-196a2 scaffold sequence.However, according to certain embodiments, the miR-30 or the miR-155 sequence is not used.

[0085] Typically, at least one of the miRNA molecules comprises a miR-196 scaffold sequence, preferably a miR-196a2 scaffold sequence. According to a particular embodiment, all of the at least two miRNA molecules comprise a miR-scaffold sequence, preferably a miR-196a2 scaffold sequence. The same is true for the miR-30 and miR-155 scaffold sequences. Examples of such suitable scaffolds are described in U.S. Pat. No. 8,841,267 (especially claim 1 therein), which is incorporated herein by reference. A single scaffold is a SMARTvector. TM It is commercially available as micro-RNA adapted scaffold (Horizon Discovery, Lafayette, CO, USA).

[0086] Further suitable scaffold sequences include miR-26b (hsa-mir-26b), miR-204 (hsa-mir-204), and miR-126 (hsa-mir-126), hsa-let-7f, hsa-let-7g, hsa-let-7a, hsa-let-7b, hsa-let-7c, hsa-mir-29a, hsa-mir-140-3p, hsa-let-7i, hsa-let-7e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-140-4p, hsa-mir-140-5p, hsa-mir-140-6p, hsa-mir-140-7p, hsa-mir-140-8p, hsa-mir-140-9p, hsa-mir-140-10p, hsa-mir-140-15p, hsa-mir-140-16p, hsa-mir-140-17p, hsa-mir-140-18p, hsa-mir-140-19p, hsa-mir-140-20p, hsa-mir-140-31p, hsa-mir-140-21p, hsa-mir-140-32p, hsa-mir-140-33p, hsa-mir-140-34p, hsa-mir-140-35p, hsa-mir-140-36p, hsa-mir-140-37p, hsa-mir-140-38p, hsa-mir-140-39p, hsa-mir-140-41p, hsa-mir-140-42p, hsa-mir-140-43p, hsa-mir-140-44p, hsa-mir-1 r-26a, hsa-mir-26a, hsa-mir-340, hsa-mir-101, hsa-mir-29c, hsa-mir-191, hsa-mir-222, hsa-mir-34c-5p, hsa-mir-21, hsa-mir-378, Examples include hsa-mir-100, hsa-mir-192, hsa-mir-30d, hsa-mir-16, hsa-mir-432, hsa-mir-744, hsa-mir-29b, hsa-mir-130a, or hsa-mir-15a.

[0087] According to an alternative, but not exclusive, embodiment, rather than using repeated specific miR scaffolds to obtain artificially repeated scaffolds, true polycistronic miRNA clusters or parts thereof may be used, in which endogenous miRNAs are replaced with shRNAs of interest. Particularly suitable miR scaffold clusters for this purpose are the miR-106a-363, miR-17-92, miR-106b-25, and miR-23a-27a-24-2 clusters, most particularly envisaged is the miR-106a-363 ​​cluster and fragments thereof. Of note, it is also specifically envisaged to use parts of such natural clusters and not all sequences in order to reduce the vector load (this is particularly useful since not all miRNAs are evenly spaced and not all linker sequences are required). Other considerations are possible, such as taking the miRNAs that are most efficiently processed in the cell. For example, the miR-17-92 cluster is composed of (in order) miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1 (also miR-92al), and particularly useful fragments thereof are the scaffold sequences from miR-19a to miR-92-1 (i.e., four of the six miRNAs) or the scaffold sequences from miR-19a to miR-19b-1 (three of the six miRNAs). Similarly, the 106a-363 ​​cluster is composed of (in order) miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2 (also miR-92a2), and miR-363. Particularly useful fragments are the scaffold sequences from miR-20b to miR-363 (i.e., 4 of the 6 miRNAs) or from miR-19b-2 to miR-363 (i.e., 3 of the 6 miRNAs). In addition to the natural linker sequences, fragments thereof or artificial linkers can also be used (to reduce the vector load).

[0088] It is envisioned that these strategies may be used in combination, for example, both the miR-106a~363 cluster and the miR-196a2 sequence could be combined into a novel scaffold.

[0089] The cells disclosed herein contain multiplexed RNA interference molecules. They can target one or more targets that need to be downregulated (either intracellular targets, or extracellular targets if shRNA is secreted). Each RNA interference molecule can target different molecules, target the same molecule, or a combination thereof (i.e., two or more RNA molecules are targeted to one target, and only one RNA interference molecule is targeted to a different target). When RNA interference molecules target the same target, they can target the same region, or they can target different regions. In other words, when targeting the same target, the RNA interference molecules can be identical or not. An example of such a combination of RNA interference molecules is shown in Example 9.

[0090] Thus, according to certain embodiments, at least two of the multiplexed RNA interference molecules are directed to the same target. According to further certain embodiments, at least two of the multiplexed RNA interference molecules are identical.

[0091] According to an alternative embodiment, all of the at least two multiplexed RNA interference molecules are different. According to a further specific embodiment, all of the at least two multiplexed RNA interference molecules are directed to different targets.

[0092] Any suitable molecule present in the modified cells can be targeted by the immediate RNA interference molecule. Representative examples of possible targets include MHC class I genes, MHC class II genes, MHC coreceptor genes (HLA-F, HLA-G, etc.), TCR chains, CD3 chains, NKBBiL, LTA, TNF, LTB, LST1, NCR3, AIF1, LY6, heat shock proteins (HSPA1L, HSPA1A, HSPA1B, etc.), complement cascades, regulatory receptors (NOTCH4, etc.), TAP, HLA-DM, HLA-DO, RING1, CD52, CD247, HCP5, DGKA, DGKZ, B2M, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, 2B4, A2AR, BAX, BLIMP1, C160 (POLR3A), CBL-B, CCR6, CD 7, CD95, CD123, DGK [DGKA, DGKB, DGKD, DGKE, DKGG, DGKH, DGKI, DGKK, DGKQ, DGKZ], DNMT3A, DR4, DR5, EGR2, FABP4, FABP5, FASN, GMCSF, HPK1, IL-10R [IL10RA, IL10RB], IL2, LFA1, NEAT1, NFkB (including RELA, RELB, NFkB2, NFkB1, REL), NKG2A, NR4A (including NR4A1, NR4A2, NR4A3), PD1, PI3KCD, PPP2RD2, SHIP1, SOAT1, SOCS1, T-BET, TET, TGFBR1, TGFBR2, TGFBR3, TIGIT, TIM3, TOX, and ZFP36L2.

[0093] In particular, suitable miRNA-based constructs have been identified. Thus, the present invention provides modified cells comprising a polynucleotide having a multiplexed microRNA-based shRNA coding region, the multiplexed microRNA-based shRNA coding region comprising a sequence encoding: Two or more artificial miRNA-based shRNA nucleotide sequences, each of which comprises: miRNA scaffold sequence, the active or mature sequence, and A passenger or star sequence, wherein within each artificial miRNA-based shRNA nucleotide sequence, said active sequence is at least 80% complementary to said passenger sequence.

[0094] Both the active and passenger sequences of each artificial miRNA-based shRNA nucleotide sequence typically have a length of 18-40 nucleotides, more particularly 18-30 nucleotides, and most particularly 19-25 nucleotides.

[0095] Typically, these microRNA scaffold sequences are separated by linkers, which have a length of, for example, 30-60 nucleotides, although shorter stretches also work. Indeed, it was surprisingly found that the length of the linker does not play a significant role, and that even very short (less than 10 nucleotides) or absent links do not prevent the function of the shRNA. This is shown, for example, in Figures 6 and 16.

[0096] The artificial sequence may be, for example, a naturally occurring scaffold (such as a miR cluster or fragment thereof, such as the miR-106a-363 ​​cluster) in which the endogenous miR sequence is replaced with a modified shRNA sequence against a specific target, it may be a repeat of a single miR scaffold (such as the miR-196a2 scaffold) in which the endogenous miR sequence is replaced with a modified shRNA sequence against a specific target, an artificial miR-like sequence, or a combination thereof.

[0097] The modified cell typically further comprises a nucleic acid molecule encoding a protein of interest, such as a chimeric antigen receptor or TCR, and may be a modified immune cell as described above.

[0098] By co-expressing multiplexed RNA interference molecules, at least one gene, but typically multiple genes, are silenced in the engineered cells, which may lead to more effective therapeutic outcomes.

[0099] The modified cells described herein are also provided for use as pharmaceuticals. According to certain embodiments, the modified cells are provided for use in the treatment of cancer. Exemplary types of cancer that can be treated include, but are not limited to, adenocarcinoma, adrenocortical carcinoma, anal cancer, astrocytoma, bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing's sarcoma, eye cancer, fallopian tube cancer, gastric cancer, glioblastoma, head and neck cancer, Kaposi's sarcoma, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, melanoma, mesothelioma, myelodysplastic syndrome, multiple myeloma, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, peritoneal cancer, pharyngeal cancer, prostate cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, skin cancer, small intestine cancer, stomach cancer, testicular cancer, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, and Wilms' tumor.

[0100] According to certain embodiments, the cells may be provided for the treatment of liquid or blood cancers, such as leukemias (including acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML), and chronic lymphocytic leukemia (CLL)), lymphomas (Hodgkin's lymphoma and non-Hodgkin's lymphomas, including B-cell lymphomas (e.g., DLBCL), T-cell lymphoma, Burkitt's lymphoma, follicular lymphoma, mantle cell lymphoma, small lymphocytic lymphoma), multiple myeloma, or myelodysplastic syndromes (MDS).

[0101] This is equivalent to providing a method of treating cancer comprising administering to a subject in need thereof an appropriate dose of the modified cells described herein (i.e., modified cells comprising exogenous nucleic acid molecules encoding at least two multiplexed RNA interference molecules, and optionally comprising an additional nucleic acid molecule encoding a protein of interest), thereby ameliorating at least one symptom associated with the cancer. Cancers contemplated for treatment include, but are not limited to, adenocarcinoma, adrenocortical carcinoma, anal cancer, astrocytoma, bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing's sarcoma, eye cancer, fallopian tube cancer, gastric cancer, glioblastoma, head and neck cancer, Kaposi's sarcoma, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, melanoma, mesothelioma, myelodysplastic syndrome, multiple myeloma, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, parathyroid cancer, penile cancer, peritoneal cancer, pharyngeal cancer, prostate cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, skin cancer, small intestine cancer, stomach cancer, testicular cancer, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, and Wilms' tumor. According to further particular embodiments, a method of treating hematological cancer is provided, comprising administering to a subject in need thereof an appropriate dose of modified cells as described herein, thereby ameliorating at least one symptom of the cancer.

[0102] According to an alternative embodiment, the cells may be provided for use in the treatment of autoimmune diseases. Exemplary types of autoimmune diseases that may be treated include, but are not limited to, rheumatoid arthritis (RA), systemic lupus erythematosus (SLE), inflammatory bowel disease (IBD), multiple sclerosis (MS), type 1 diabetes, amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), spinal muscular atrophy (SMA), Crohn's disease, Guillain-Barre syndrome, chronic inflammatory demyelinating polyneuropathy, psoriasis, psoriatic arthritis, Addison's disease, ankylosing spondylitis, Behcet's disease, celiac disease, Coxsackie myocarditis, endometriosis, fibromyalgia, Graves' disease, Hashimoto's thyroiditis, Kawasaki disease, Meniere's disease, myasthenia gravis, sarcoidosis, scleroderma, Sjogren's syndrome, thrombocytopenic purpura (TTP), ulcerative colitis, vasculitis, and vitiligo.

[0103] This amounts to providing a method of treating an autoimmune disease, comprising administering to a subject in need of treatment an appropriate dose of modified cells as described herein, thereby ameliorating at least one symptom associated with the autoimmune disease. Exemplary autoimmune diseases that can be treated are described above.

[0104] According to yet another embodiment, the cells may be provided for use in treating infectious diseases. "Infectious diseases" is used herein to refer to any type of disease caused by the presence of a foreign organism (pathogen) in or on a diseased subject or organism. Infectious diseases are usually thought to be caused by microorganisms or microparasites such as viruses, prions, bacteria, viroids, but larger organisms such as macroparasites and fungi can also infect. Organisms causing infections are referred to herein as "pathogens" (if they cause disease) and "parasites" (if they benefit at the expense of the host organism, thereby reducing its biological fitness, even in the absence of any obvious disease), and include, but are not limited to, viruses, bacteria, fungi, protists (e.g., Plasmodium, Phytophthora) and protozoa (e.g., Plasmodium, Entamoeba, Giardia, Toxoplasma, Cryptosporidium, Trichomonas, Leishmania, Trypanosoma) (microparasites) and macroparasites such as worms (e.g., nematodes such as roundworms, heartworms, hookworms, pinworms, whipworms, or flatworms such as tapestries and flukes), as well as ectoparasites such as ticks and mites. Within the term parasites, parasites that sterilize or kill the host organism, i.e., parasitoids, are envisaged. According to certain embodiments, the infectious disease is caused by a microbial or viral organism.

[0105] As used herein, "microorganisms" include bacteria, such as gram-positive bacteria (e.g., the genera Staphylococcus, Enterococcus, and Bacillus), gram-negative bacteria (e.g., the genera Escherichia and Yersinia), spirochetes (e.g., the genera Treponema, such as Treponema pallidum, Leptospira, and Borrelia, such as Borrelia burgdorferi), mollicutes (bacteria without a cell wall, such as the genus Mycoplasma), and acid-resistant bacteria (the genus Mycobacterium, such as Mycobacterium tuberculosum, and the genus Nocardia). "Microorganisms" include fungi (such as yeasts and molds, e.g., genera Candida, Aspergillus, Coccidioides, Cryptococcus, Histoplasma, Pneumocystis, or Trichophyton), protozoa (e.g., genera Plasmodium, Entamoeba, Giardia, Toxoplasma, Cryptosporidium, Trichomonas, Leishmania, Trypanosoma), and archaea (archae). Further examples of microorganisms causing infections that can be treated in an instant manner include, but are not limited to, food pathogens such as Staphylococcus aureus (including methicillin-resistant Staphylococcus aureus (MRSA)), Enterococcus spp. (including vancomycin-resistant enterococci (VRE), the nosocomial pathogen Enterococcus faecalis), Bacillus subtilis, B. cereus, Listeria monocytogenes, Salmonella spp., and Legionella pneumophilia.

[0106] "Viral organism" or "virus", as used herein in the same sense, is a small infectious agent that can only replicate in living cells of organisms.These include dsDNA viruses (such as adenoviruses, herpesviruses, poxviruses), ssDNA viruses (such as parvoviruses), dsRNA viruses (such as reoviruses), (+)ssRNA viruses (such as picornaviruses, togaviruses, coronaviruses), (-)ssRNA viruses (such as orthomyxoviruses, rhabdoviruses), ssRNA-RT (reverse transcription) viruses, i.e., viruses that have (+)sense RNA and DNA in the middle of their life cycle (such as retroviruses), and dsDNA-RT viruses (such as hepadnaviruses).Examples of viruses that can infect humans include adenoviruses, astroviruses, hepadnaviruses (such as hepatitis B virus), herpesviruses (e.g., herpes simplex virus type 1, herpes simplex virus type 2, human cytomegalovirus, Epstein-Barr virus, varicella zoster virus, roseolovirus), papovaviruses (e.g., human herpes virus, and human polyoma virus), poxviruses (e.g., variola virus, vaccinia virus, smallpox virus), arenaviruses, and avian influenza viruses. Viruses, buniaviruses, calciviruses, coronaviruses (e.g., SARS-coronavirus, MERS-coronavirus, SARS-CoV-2 coronavirus (the etiological agent of COVID-19)), filoviruses (e.g., Ebola virus, Marburg virus), flaviviruses (e.g., yellow fever virus, West Nile virus, dengue virus, hepatitis C virus, tick-borne encephalitis virus, Japanese encephalitis virus, encephalitis virus), orthomyxoviruses, Examples of the infectious disease include, but are not limited to, viruses (e.g., influenza A, B and C viruses), paramyxoviruses (parainfluenza viruses, rubulaviruses (mumps), morbilliviruses (measles), pneumonia viruses (such as human respiratory syncytial virus), picornaviruses (such as polioviruses, rhinoviruses, coxsackie A viruses, coxsackie B viruses, hepatitis A viruses, echoviruses and enteroviruses), reoviruses, retroviruses (such as lentiviruses, such as human immunodeficiency virus and human T lymphotropic virus (HTLV)), rhabdoviruses (such as rabies virus), or togaviruses (such as rubella virus). According to certain embodiments, the infectious disease to be treated is not HIV. According to alternative embodiments, the infectious disease to be treated is not a disease caused by a retrovirus. According to alternative embodiments, the infectious disease to be treated is not a viral disease.

[0107] This amounts to providing a method for treating an infectious disease, comprising administering to a subject in need thereof an appropriate dose of the modified cells described herein (i.e., modified cells comprising exogenous nucleic acid molecules encoding two or more multiplexed RNA interference molecules, and optionally further comprising a nucleic acid molecule encoding a protein of interest), thereby improving at least one symptom. Particularly contemplated microbial or viral infectious diseases are those caused by the above-mentioned pathogens.

[0108] These cells provided for use as pharmaceuticals can be provided for use in allogeneic therapy. That is, these cells are provided for use in treatments where allogeneic ACT is considered as a treatment option (cells from another subject are provided to a subject in need of it). According to certain embodiments, in allogeneic therapy, at least one of the RNA interference molecules will target TCR (most particularly a subunit of TCR complex). According to another embodiment, these cells are provided for use in autologous therapy, particularly autologous ACT therapy (i.e., therapy using cells obtained from a patient).

[0109] Although specific embodiments, particular configurations, and materials and / or molecules of the cells and methods according to the invention have been described herein, it should be understood that various changes and modifications in form and detail may be made without departing from the scope and spirit of the invention. The following examples are provided to further illustrate certain embodiments and are not to be construed as limiting the scope of the present application. The present application is limited only by the scope of the claims. EXAMPLES

[0110] Example 1. Evaluation of miRNA scaffold length in TCR downregulation To successfully multiplex different shRNAs within the same viral expression vector, the miRNA-based scaffold needs to be as small as possible. This allows combining multiple shRNAs without significantly affecting the overall vector size. To evaluate whether the target knockdown is also efficient with a truncated miRNA-based shRNA scaffold, we used the miRNA-196a2 scaffold (SMARTvector TM We expressed a previously identified CD247 (TCR subunit)-targeting shRNA from a micro-RNA adapted scaffold (Horizon Discovery, Lafayette, CO, USA), and the new constructs differed in the length of the miRNA scaffold. The original construct had 263 nucleotides, while the two shortened constructs used 150 or 111 nucleotides, respectively. All viral vectors were able to transduce primary T cells to varying degrees, as indicated by the truncated CD19 marker (Figure 1). However, the extent of TCR or CD3E protein knockdown was comparable for all three constructs. This indicates that even the smallest miRNA-based shRNA scaffolds can silence the expression of the TCR / CD3 complex to the same extent as the longer miRNA scaffolds.

[0111] Example 2. Screening of various C52-targeting shRNAs To compare the efficiency of various CD52-targeting shRNAs, we used an identical backbone structure as previously used for CD247, only exchanging the target sequence of the shRNA, placing the CD52 target sequence in place of the CD247 target sequence. We introduced the shRNA into primary T cells using a retroviral vector and could track them with the truncated CD19 (tCD19) marker. We cloned various CD52-targeting shRNAs into the miRNA scaffold of the retroviral vector. The degree of CD52 knockdown was evaluated on day 8 of cell culture. All constructs were able to transduce primary T cells, as measured by the expression of CD19 (Figure 2). However, the degree of CD52 knockdown differed among the four shRNAs tested. Considering knockdown of CD52 expression, shRNA-3 was the most efficient, followed by shRNA-1 and shRNA-2. In contrast, shRNA-4 showed no reduction in CD52 expression (Figure 2).

[0112] To assess whether the knockdown efficiency of this shRNA differed between different donors, T cells from three different donors were transduced with mock constructs or constructs expressing CD52 shRNA-3 (Figure 3). In all three donors, shRNA-3 showed significant and consistent knockdown of CD52 (Figure 3), indicating that the identified shRNAs provided consistent, donor-independent knockdown of CD52.

[0113] Example 3. Screening of gRNAs for CRISPR / Cas9-mediated CD52 knockout To generate positive controls for the suppression of expression of CD52 and / or TCR / CD3 complex, we generated respective knockout T cells using CRISPR / Cas9 technology. Various guide RNAs (gRNAs) were designed and evaluated to identify those that efficiently generate CD52-deficient T cells (Figure 4). Two of the three gRNAs were able to generate CD52 knockout cells (gRNA-1, shown as CD52.1.AA in Figure 4, and gRNA-3, shown as CD52.2.AE in Figure 4), with CD52gRNA-1 resulting in a slightly higher frequency of CD52-deficient cells.

[0114] Example 4. Effect of miRNA spacers on target knockdown Efficient processing of miRNAs from transcribed RNA by the DROSHA complex is important for efficient target knockdown. Previous data have revealed that miRNA-based shRNAs can be efficiently co-expressed with vectors encoding CARs and are processed from the vector by the miRNA machinery. Furthermore, it would be desirable to generate CAR expression vectors in which multiple miRNA-based shRNAs (e.g., 2, 4, 6, 8...) can be co-expressed from the same vector (Figure 5). However, previous studies have shown that co-expression of multiple miRNA-based shRNAs results in loss of shRNA activity. Thus, efficient miRNA processing is important for knockdown of multiple targets from a single expression vector.

[0115] To optimize the activity of two co-expressed shRNAs, we hypothesized that not only the size but also the sequence of the linker between the two miRNA-based shRNAs and the miRNA scaffold would affect the activity of the shRNA. To optimize shRNA processing, we evaluated the impact of various shRNA linkers on the knockdown of two target genes, CD247 (CD3ζ) and CD52. Five different spacers were designed based on the spacer sequence derived from the native human miR-17-92 cluster. The five different spacers were cloned between the CD247 and CD52 shRNAs in the context of a BCMA CAR. The results of transducing T cells with the different constructs, using tCD34(Mock) and the BCMA-CD247shRNA vector as controls, are shown in Figure 6. Multiplex 1 does not contain a spacer between the lllbp CD247 shRNA and the lllbp CD52 shRNA. Multiplex 2 contained a 43 bp naturally occurring spacer between miR-17 and miR-18a in the miR-17-92 cluster. Multiplex 3 contained a 92 bp spacer corresponding to the spacer region between miR-19a and miR-20a in the miR-17-92 cluster. Multiplex 4 contained a 56 bp spacer corresponding to the spacer region between miR-20a and miR-19bl in the miR-17-92 cluster. Multiplex 5 contained a 29 bp random TA-rich spacer region. All shRNA-containing constructs showed low but comparable transduction efficiency at the time of collection. Also, BCMA CAR expression was only slightly affected by the expression of multiple shRNAs (Figure 6). CD52 and TCR knockdown was evaluated, showing that all constructs were able to reduce TCR and CD52 expression at comparable levels. Only the first multiplex construct, which had no spacer between the two hairpins, had slightly lower knockdown activity against TCR (but not against CD52) compared to the other constructs, but was still able to reduce expression very well (Figure 6).

[0116] Example 5. Comparison of multiplexed and single shRNAs We next aimed to directly compare the effect of multiplexing two shRNAs with the effect of expressing single shRNAs for CD247 and CD52. RNA expression analysis showed that multiplexed shRNAs downregulated CD52 or CD247 as efficiently as each single shRNA (Figure 7).

[0117] As another control, we used the CRISPR / Cas9 system to simultaneously target CD52 and CD247 using two different gRNAs. At the time of harvest, cells containing CD247 shRNA or gRNA were depleted of TCR positive cells before further analysis. TCR and CD52 expression was assessed by flow cytometry to compare protein expression of cells transduced with single or multiplex shRNAs (Figures 8 and 9). Single CD247 shRNA was able to reduce TCR expression (Figures 8 and 9). The reduction in TCR surface expression was equivalent to CRISPR / Cas9-mediated knockout of CD247. Similarly, single CD52 shRNA was able to reduce CD52 expression (Figures 8 and 9). Two multiplexed shRNA constructs with different linkers (see Example 4) both showed the same degree of TCR knockdown as single shRNA. Similarly, CD52 expression was reduced to the same extent by single or multiplexed shRNA constructs (Figures 8 and 9).

[0118] Example 6. CAR expression and cell differentiation potential To evaluate the impact of co-expression of one or more shRNAs on CAR expression and functionality, BCMA-CAR expression was assessed by flow cytometry. Cells were stained with BCMA-Fc fusion protein followed by secondary PE-conjugated antibody. As shown in Figure 10, CAR expression was similar in all groups, indicating that these multiplexed shRNAs did not affect CAR expression levels. Furthermore, the functional activity of BCMA-CAR-expressing cells against the BCMA-positive cancer cell lines RPMI-8226, OPM-2, and U226 was evaluated (Figure 10). To this end, T cells were co-cultured with cancer cells for 24 h before evaluating IFNγ levels in the supernatants. T cells alone did not produce IFNγ, but when co-cultured with BCMA-expressing cancer cells, comparable IFNγ production was seen in T cells from all groups. Thus, co-expression of one or more shRNAs does not affect CAR expression or the functional activity of CAR-T cells against cancer cell lines.

[0119] Example 7. Functional response of CAR-T cells to mitogenic stimulation We next assessed the responsiveness of CAR-T cells to mitogenic TCR stimulation. To this end, T cells were stimulated with increasing concentrations of anti-CD3 antibodies (clone OKT3) and IFNγ production was measured 24 h later. Mock-transduced cells produced high levels of IFNγ after OKT3 activation. Similarly, co-expression of BCMA-CAR alone or in combination with CD52 shRNA did not reduce the ability of T cells to respond to TCR activation stimuli. However, co-expression of CD247 shRNA alone or in multiplex significantly reduced the functional response of the TCR to the level of CIRSPR / Cas9 CD247 genome-edited control cells (Figure 11). Thus, multiplexed shRNAs are as effective at inhibiting TCR function as single shRNA control cells and genome-edited T cells.

[0120] Example 8. Functional inhibition of CD52 As a next step, we aimed to evaluate how expression of single or multiplexed CD52 shRNAs affects complement-dependent killing of T cells in the presence of anti-CD52 antibodies. To this end, T cells were cultured with complement in the presence of anti-CD52 antibodies (alemtuzumab) or control IgG antibodies. After 4 hours, cell counts were measured. Mock- and BCMA-CAR-transduced T cells were efficiently targeted by the complement system in the presence of alemtuzumab (Figure 12). However, both single and multiplexed CD52 shRNAs were able to prevent CD52-mediated killing.

[0121] Example 9. Multiplexing More Than Two Targets Next, we assessed the feasibility of multiplexing four shRNAs. To assess this, Jurkat cells were transduced with single or multiplexed shRNAs targeting β2m, DGK, CD247 (CD3ζ), CD52, and a second generation CD19CAR using a lentiviral backbone and a repeat miR-196a2 scaffold, as well as a selection marker. Single-step enrichment was performed using marker-specific magnetic beads 7 days after transduction. Cells were analyzed for expression of shRNA targets by qRT-PCR. shRNA-mediated downregulation of transcriptional expression of the four targets was comparable between the multiplex and each single shRNA (Figure 13).

[0122] Next to Jurkat cells, primary T cells were transduced with a retroviral vector encoding a second-generation CD19 CAR containing either 3x shRNA or 6x shRNA targeting CD247, β2m and CD52 delivered in the miR-106a-363 ​​cluster (Figure 14). Briefly, primary T cells from healthy donors were transduced with a retroviral vector encoding a second-generation CD19-directed CAR and a truncated CD34 selection marker together with 3 shRNAs targeting CD247, B2M, CD52 delivered in the last three miRs of the 106a-363 ​​miRNA cluster (miR-19b2, miR-92a2, miR-363) or 6 shRNAs targeting the same three genes in the six miR scaffolds of the cluster (in this case the two shRNAs targeting CD247 were different). Briefly, shRNAs were expressed in 6-plex, 3-plex, or no shRNA (tCD34) as a control. Two days after transduction, cells were enriched using CD34-specific magnetic beads and further amplified with IL-2 (100 μU / mL) for 6 days. mRNA expression of CD247, B2M, and CD52 was assessed by qRT-PCR using cyclophilin as a housekeeping gene.

[0123] Multiplexed shRNAs provided efficient RNA knockdown levels for all target genes. Incorporation of six multiplexed shRNAs (two shRNAs for each protein target) resulted in higher RNA knockdown levels compared to three multiplexed shRNAs (one shRNA for each protein target) (Figure 14).

[0124] Example 10. Multiplex knockdown of targets in iPSC cells To investigate the knockdown of multiplexed RNA interference molecules in other immune cells, multiplexing was next evaluated in iPS cells. Two shRNAs (against β2m and DGKa), separated by either a long (41 bp) or minimal (6 bp) linker, were expressed in the human iPSC cell line SCiPS-R1. Transduction was performed with 50 μl or 500 μl of viral supernatant. Multiplexed shRNAs resulted in efficient RNA knockdown levels, regardless of the size of the linker or the amount of viral supernatant used, when compared to cells transduced without shRNA (Figure 15, Figure 16).

Claims

1. a first exogenous nucleic acid molecule encoding a protein of interest; and a second nucleic acid molecule encoding at least two multiplexed miRNA molecules; The modified cell, wherein at least one of said miRNA molecules comprises a miR-196a2 scaffold sequence.

2. The modified cell of claim 1 which is a modified immune cell.

3. The modified cell of claim 1 or 2, wherein the cell is selected from a T cell, a NK cell, a NKT cell, a stem cell, a progenitor cell, and an iPSC cell.

4. The modified cell of claim 1 , wherein the protein of interest is a receptor.

5. The modified cell described in claim 4, wherein the receptor is a chimeric antigen receptor or a TCR.

6. A modified cell described in any one of claims 1 to 5, wherein the first and second nucleic acid molecules are present in a single vector.

7. The modified cell described in claim 6, wherein the vector is a eukaryotic expression plasmid, minicircle DNA, or a viral vector (including viral vectors derived from lentivirus, retrovirus, adenovirus, adeno-associated virus, and Sendai virus).

8. The modified cell of any one of claims 1 to 7, wherein the at least two multiplexed miRNA molecules are under the control of one promoter.

9. The modified cell of claim 8 , wherein the promoter is not a U6 promoter.

10. 9. The modified cell of claim 8, wherein the promoter is a Pol II promoter selected from a CMV promoter, an EFlα promoter (core or full length), a PGK promoter, a CAG promoter, a UbC promoter, a SFFV promoter, a RSV promoter, an IL2-promoter, an MSCV LTR, a SV40 promoter, a GALV LTR, and a tRNA promoter.

11. The modified cell of claim 8, wherein all of the at least two miRNA molecules comprise a miR-196a2 scaffold sequence.

12. The modified cell of any one of claims 1 to 11, wherein at least two of the multiplexed miRNA molecules are directed to the same target.

13. The modified cell of claim 12, wherein at least two of the multiplexed miRNA molecules are identical.

14. The modified cell of any one of claims 1 to 11, wherein all of the at least two multiplexed miRNA molecules are different.

15. 15. The modified cell of claim 14, wherein all of the at least two multiplexed miRNA molecules are directed to different targets.

16. The molecules targeted by the at least two multiplexed miRNA molecules are selected from the group consisting of MHC class I genes, MHC class II genes, MHC coreceptor genes (including HLA-F, HLA-G), TCR chains, NKBBiL, LTA, TNF, LTB, LST1, NCR3, AIF1, LY6, heat shock proteins (including HSPA1L, HSPA1A, HSPA1B), complement, and the like. Cascade, regulatory receptors (including NOTCH4), TAP, HLA-DM, HLA-DO, RING1, CD52, CD247, HCP5, DGKA, DGKZ, B2M, MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, ULBP6, 2B4, A2AR, BAX, BLIMP1, C160 (POLR3A), CBL-B, CCR6, CD7, CD 95, CD123, DGK [DGKA, DGKB, DGKD, DGKE, DKGG, DGKH, DGKI, DGKK, DGKQ, DGKZ], DNMT3A, DR4, DR5, EGR2, FA BP4, FABP5, FASN, GMCSF, HPK1, IL-10R [IL10RA, IL10RB], IL2, LFA1, NEAT1, NFkB (RELA, RELB, NFkB2, NFk 16. The modified cell of any one of claims 1 to 15, wherein the mitochondrial protein is selected from the group consisting of NR4A (including NR4A1, NR4A2, NR4A3), NKG2A, NR4A (including NR4A1, NR4A2, NR4A3), PD1, PI3KCD, PPP2RD2, SHIP1, SOAT1, SOCS1, T-BET, TET2, TGFBR1, TGFBR2, TGFBR3, TIGIT, TIM3, TOX, and ZFP36L2.

17. A modified cell according to any one of claims 1 to 16 for use as a medicament.

18. 20. A modified cell according to any one of claims 1 to 17 for use in the treatment of cancer.

Images