Saccharomyces cerevisiae gene modified cell

Abstract

The invention relates to a gene modified cell and a method for producing fucosyllactose by using the gene modified cell, in particular to a saccharomyces cerevisiae gene modified cell and application thereof, and belongs to the technical field of biological gene engineering. The present invention provides a genetically modified cell comprising a recombinant nucleic acid sequence encoding a polypeptide having an [alpha]-1, 2-fucosyltransferase polypeptide ([alpha]-1, 2-fucosyltransferase) activity. The alpha-1, 2-fucosyltransferase polypeptide includes, but is not limited to, polypeptides having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% and 100% identical amino acid sequences with the amino acid sequences of SEQ ID NO: 1-25. According to the gene modified cell, the fucosyllactose synthesis capability of an original strain is improved.

Description

Technical Field

[0001] The present invention relates to a gene modified cell, in particular to a gene modified cell using saccharomyces cerevisiae as a host, and specifically to a gene modified cell of saccharomyces cerevisiae and application thereof, belonging to the technical field of biological genetic engineering. Background Art

[0002] Human milk oligosaccharides (HMOs) are a unique and rich mixture of oligosaccharides in human milk, and are the third largest solid component in breast milk after fat and lactose. Among them, 2'-fucosyllactose (2'-fucosyllactose, 2'-FL) and 3'-fucosyllactose (3'-fucosyllactose, 3'-FL) are important components of human milk oligosaccharides, which have been proven to play an important role in the brain, intestines, growth and development of infants and young children.

[0003] 2'-FL and 3'-FL have been approved as raw materials for infant formula by the U.S. FDA, the European Union, Australia, New Zealand, Canada and other countries and regions, and can be added to infant formula, regular food, dietary supplements and / or medical food.

[0004] Since the chemical synthesis of fucosyllactose requires multiple protection and deprotection, the product yield is low and the production cost remains high. Therefore, the synthesis of fucosyllactose mostly adopts enzymatic method and microbial cell factory synthesis method. Since the pure enzyme catalysis method generally requires fucose as a substrate, the cost is relatively high. Cell factories can often synthesize from scratch to achieve low-cost large-scale industrial production.

[0005] One of the feasible methods for large-scale synthesis of fucosyllactose is the microbial cell factory method. Existing technologies mostly use Escherichia coli to biosynthesize fucosyllactose. Under the premise of providing a carbon source, the gene pathway in Escherichia coli is used to synthesize the precursor of fucosyllactose, GDP-L-fucose, and the receptor lactose. The exogenous fucosyltransferase is transferred into the engineered bacteria to combine the two precursors, thereby industrially synthesizing fucosyllactose.

[0006] Saccharomyces cerevisiae strains are recognized as safe microorganisms, with the characteristics of not producing pyrogens, no toxic side effects, high food safety, and can reduce the subsequent separation and purification costs. Moreover, Saccharomyces cerevisiae is widely used in industry, but Saccharomyces cerevisiae cannot utilize lactose or transport lactose into cells. Although scientists have introduced lactose transporters into Saccharomyces cerevisiae, the yield of 2'-fucosyllactose synthesized by the recombinant Saccharomyces cerevisiae is only 0.5g / L (Yu et al., Microb Cell Fact, 2018, 17: 101. DOI: 10.1186 / s12934-018-0947-2), which is difficult to meet the needs of industrial production.

[0007] Chinese patents 202010187309.1 and 202010187632.9 use recombinant Saccharomyces cerevisiae to synthesize 2'-FL, which includes GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, and α-1,2-fucose transferase, with yields of 2.9 g / L and 3.8 g / L, respectively. Chinese patent 202080061688.8 discloses yeast cells genetically modified to produce one or more human milk oligosaccharides, wherein the yeast cells include GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, and ABC transporters, and expressing heterologous ABC transporters in genetically modified yeast cells can increase the yield and purity of HMO.

[0008] International Publication WO2023122270 (A2) discloses a host cell capable of producing HMO, which comprises one or more heterologous nucleic acids, each of which independently encodes: fucosyltransferase, GDP-fucosyl synthase, GDP-mannose-4,6-dehydratase, lactose permease. Compared with the previous technology, this invention reduces the content of impurities in the product, such as DFL, and improves the yield of 2'-FL.

[0009] With the gradual rise of HMOs in recent years, it is of great significance to optimize the key factors of the fucose synthesis pathway to improve the efficiency of fucose synthesis. Summary of the invention

[0010] Purpose of the invention: To provide a genetically modified cell and its application in synthesizing fucosyllactose, which has the activity of synthesizing fucosyllactose from scratch and has no undesirable side effects. The fucosyllactose includes 2'-fucosyllactose

[0011] (2'-fucosyllactose, 2'-FL).

[0012] The technical solution of the present invention is:

[0013] A genetically modified cell comprises a recombinant nucleic acid sequence encoding a polypeptide having α-1,2-fucosyltransferase activity.

[0014] The α-1,2-fucosyltransferase polypeptide refers to a polypeptide that can catalyze the transfer of a fucose residue from a donor substrate to an acceptor molecule. The donor substrate used to transfer the fucose residue to the acceptor molecule is usually guanosine diphosphate L-fucose (GDP-L-fucose). Suitable acceptor molecules for fucose residues include oligosaccharides, glycopeptides, glycoproteins and glycolipids. Generally, the fucose residue is transferred to, for example, an N-acetylglucosamine residue, an N-acetylgalactosamine residue, a galactose residue, a fucose residue, a sialic acid residue or a glucose residue of an oligosaccharide, or a sugar portion of a glycoprotein or glycolipid; further, the α-1,2-fucosyltransferase polypeptide has the activity of catalyzing the synthesis of 2'-FL using GDP-L-fucose and lactose as substrates.

[0015] The genetically modified cells described in the present application are genetically modified cells of Saccharomyces cerevisiae, which include Saccharomyces sp. cells that can produce fucosyllactose after being modified by the technical scheme described in the present invention, and their starting strains include but are not limited to Saccharomyces cerevisiae, Sae. paradoxus, Saccharomyces bayanus, Sae. pastorianus, Saccharomyces cariocas, Saccharomyces mikatae and Saccharomyces kudriavzevii, etc.

[0016] The α-1,2-fucosyltransferase polypeptide is derived from Helicobacter pylori, Thermophilic Chlorella, Escherichia coli, Caenorhabditis elegans, Schistosoma mansoni, Bacucilius cereus, Pseudopedobater saltans, Helicobacter mustelae, Bacillus fragilis, Bacteroides vulgatus, Bacteroides fragilis, or Bacillus smithii.

[0017] Preferably, the α-1,2-fucosyltransferase polypeptide is an α-1,2-fucosyltransferase (α-1,2-fucosyltransferase) excavated by the applicant from Bacillus smithii in nature, named BSFut-wt, whose amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 26. It has the activity of catalyzing the synthesis of 2'-FL and is accompanied by very low side activity of synthesizing DFL (Difucosyllactose).

[0018] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide shown in SEQ ID NO: 1 is compared with the NCBI database. The α-1,2-fucosyltransferase polypeptide with the amino acid sequence shown in SEQ ID NO: 1 has the highest similarity with Bacillus cereus VD107 (GenBank: EJR48924.1), and the amino acid sequences of the two have only 69.31% consistency (as of October 20, 2023), indicating that the sequence has a low similarity to the amino acid sequence of the known enzyme; and the α-1,2-fucosyltransferase (α-1,2-fucosyltransferase,) derived from Helicobacter pylori (Helicobacter pylori), named

[0019] HPFut-wt, the amino acid sequence is shown in SEQ ID NO: 36, and the nucleotide sequence is shown in SEQ ID NO: 37, and the similarity is 33.57%.

[0020] Further preferably, the α-1,2-fucosyltransferase polypeptide is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 2-25, which is a derivative peptide of the polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, and these polypeptides have no side activities.

[0021] In one embodiment, the α-1,2-fucosyltransferase polypeptide is a polypeptide with an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25. The polypeptides shown in SEQ ID NO: 2-25 are α-1,2-fucosyltransferase polypeptides formed by replacing one or more amino acid residues / or fragments in the polypeptide shown in SEQ ID NO: 1. Specifically, the α-1,2-fucosyltransferase polypeptide is selected from the amino acid sequences obtained by any one of the following.

[0022] 1) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid fragment at positions 5-7 is replaced by QVY to GIW, and the amino acid fragment at positions 28-41 is replaced by NDVYLDSSTSYEKY to DDVYLDIETYFEKN / or

[0023] KDVYLDTVTWYEKY, thereby obtaining a polypeptide with an amino acid sequence as shown in SEQ ID NO:2 / or SEQ ID NO:3;

[0024] 2) In the amino acid sequence shown in SEQ ID NO:2, the amino acid fragment at positions 55-62 is replaced by HIKPKHAS with HTKPKLAK / or PIKPKEAK, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO:4 / or SEQ ID NO:5, respectively;

[0025] 3) In the amino acid sequence shown in SEQ ID NO:5, the amino acid fragment at positions 68-74 is replaced by NLSDLDE with KLSDIDE / or ELGSFDD, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO:6 / or SEQ ID NO:7, respectively;

[0026] 4) In the amino acid sequence shown in SEQ ID NO:7, the amino acid fragment at positions 87-93 is replaced by KKSTYVE with KKDTVIV / or EKKTMIK, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO:8 / or SEQ ID NO:9, respectively;

[0027] 5) In the amino acid sequence as shown in SEQ ID NO:9, the amino acid fragment at positions 110-117 is replaced by TYFKGYY with SFLYGYW / or AYLEGYW, thereby obtaining a polypeptide with an amino acid sequence as shown in SEQ ID NO:10 / or SEQ ID NO:11, respectively;

[0028] 6) In the amino acid sequence shown in SEQ ID NO: 10, the amino acid residue at position 122 is replaced by W to Y, and the amino acid fragment at positions 126-136 is replaced by EEDLLKDYQFT to KEDLLKDYQFL / or LEDLKKAFQFK, thereby obtaining a polypeptide with an amino acid sequence as shown in SEQ ID NO: 12 / or SEQ ID NO: 13, respectively;

[0029] 7) In the amino acid sequence shown in SEQ ID NO: 12, the amino acid fragment at positions 166-173 is replaced by WLNKEYRD with YLNKEYEE / or YLNKEYEE, thereby obtaining polypeptides with amino acid sequences shown in SEQ ID NO: 14 and SEQ ID NO: 15, respectively;

[0030] 8) In the amino acid sequence as shown in SEQ ID NO:14, the amino acid fragment at positions 181-194 is replaced by LEWYLKAIAYVEKR with EEYYLKAIAYVEER / or VDYYLKAINYVLEK, thereby obtaining a polypeptide with an amino acid sequence as shown in SEQ ID NO:16 / or SEQ ID NO:17, respectively;

[0031] 9) In the amino acid sequence shown in SEQ ID NO: 16, the amino acid fragment at positions 201-205 is replaced by EIFSY with YIFSD, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO: 18;

[0032] 10) In the amino acid sequence shown in SEQ ID NO: 18, the amino acid residue at position 211 is replaced by Q to K, and the amino acid residue at position 224 is replaced by D to S, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 19;

[0033] 11) In the amino acid sequence shown in SEQ ID NO: 19, the amino acid fragment at positions 259-264 is replaced by NKWKDK with NKYKDK / or CEDEDA, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO: 20 / or SEQ ID NO: 21, respectively;

[0034] 12) In the amino acid sequence shown in SEQ ID NO:21, the amino acid residue at position 282 is replaced by E with D / or Y, thereby obtaining a polypeptide with an amino acid sequence shown in SEQ ID NO:22 / or SEQ ID NO:23;

[0035] 13) In the amino acid sequence shown in SEQ ID NO:22, the amino acid residue at position 286 is replaced by K to D, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO:24;

[0036] 14) In the amino acid sequence shown in SEQ ID NO:24, the amino acid fragment at positions 289-291 is replaced by IQL to LLLEKEEIEE, thereby obtaining the amino acid sequence as shown in SEQ ID NO:25.

[0037] In certain embodiments, the α-1,2-fucosyltransferase polypeptide, its amino acid sequence includes but is not limited to an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100% identical to SEQ ID NO: 1-25, and comprises an amino acid substitution mutation that is functionally equivalent to the schemes described in 1)-14) above. In certain embodiments, the substitution mutation comprises a mutation to a charged residue; in certain embodiments, the substitution mutation comprises a mutation to a basic residue. In certain embodiments, the substitution mutation comprises a mutation homologous to the amino acid sequence of the schemes described in 1)-14) above.

[0038] In certain embodiments, the α-1,2-fucosyltransferase polypeptide includes but is not limited to a polypeptide having an amino acid sequence and an amino acid sequence as described in any one of SEQ ID NOs: 1 to 25. In certain embodiments, the α-1,2-fucosyltransferase polypeptide includes but is not limited to a polypeptide having an amino acid sequence and an amino acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100% identical amino acid sequence to SEQ ID NOs: 1 to 25, and a polypeptide comprising an amino acid sequence functionally equivalent to that shown in SEQ ID NOs: 1 to 25.

[0039] The method for producing the α-1,2-fucosyltransferase polypeptide as described above comprises:

[0040] (1) culturing the transformed host cell under conditions suitable for expressing the polypeptide;

[0041] Preferably, the host cell is a genetically engineered Escherichia coli BL21 (DE3) or a genetically modified yeast cell;

[0042] (2) Recovering the polypeptide.

[0043] In a specific embodiment, the step (1) comprises: firstly introducing a nucleic acid construct or a recombinant expression vector encoding the above-mentioned α-1,2-fucosyltransferase polypeptide into a host cell to construct an engineered host cell expressing the polypeptide; then, culturing the engineered host cell and inducing it to express the polypeptide.

[0044] In a specific embodiment, the step (2) includes the steps of isolating and purifying the polypeptide from the culture.

[0045] Host cells can be cultivated in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, cells can be cultured by shaking bottles, or in a suitable medium and under conditions that allow polypeptide expression and / or separation, small-scale or large-scale fermentations (including continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) can be carried out in a laboratory or industrial fermentor tank to cultivate cells. Cultivation is to use procedures known in the art, which occur in a suitable nutrient medium, and the medium comprises carbon and nitrogen sources and inorganic salts. Suitable medium can be purchased through commercial channels, or prepared according to disclosed compositions.

[0046] In some embodiments, the preferred host cell is Escherichia coli, or other transformable host cells. Further preferably, the host cell is a genetically modified E. coli BL21 (DE3) cell or a genetically modified yeast cell.

[0047] The yeast gene-modified cells in the method for producing the α-1,2-fucosyltransferase polypeptide as described above include Saccharomyces sp. cells, and their starting strains include but are not limited to Saccharomyces cerevisiae, Sae. paradoxus, Saccharomyces bayanus, Sae. pastorianus, Saccharomyces cariocas, Sac. mikatae and Sac. kudriavzevii, etc.

[0048] The genetically modified cells include, but are not limited to, polypeptides having an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to an amino acid sequence such as SEQ ID NO: 1-25 or to a polypeptide as shown in SEQ ID NO: 1-25.

[0049] Further, in some embodiments, the genetically modified Saccharomyces cerevisiae gene cell, in addition to the heterologous nucleic acid encoding the above enzyme, also includes one or more heterologous nucleic acids encoding GDP-mannose-4,6-dehydratase (e.g., from Escherichia coli, but not limited to Escherichia coli), GDP-L-fucose synthase (e.g., from Escherichia coli, but not limited to Escherichia coli). The genetically modified yeast gene cell can synthesize 2'-fucosyllactose de novo using lactose and glucose, or glycerol, or sucrose as carbon sources.

[0050] The heterologous GDP-mannose-4,6-dehydratase (gmd) gene is from Escherichia coli. Other suitable sources of GDP-mannose-4,6-dehydratase include, but are not limited to, Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, Dictyostelium discoideum, Mus musculus, Drosophila melanogaster, Sinorhizobium fredii, Pandoraea vervacti, Caenorhabditis briggsae, Candidatus Curtissbacteria, Pseudomonas sp., Clostridium sp., Cricetulus griseus), Arthrobacter iccitolerans or Paraburkholderia piptadeniae, etc.

[0051] The heterologous GDP-L-fucose synthase (wcag) gene is from Escherichia coli. Other suitable sources of GDP-L-fucose synthase include, for example, but not limited to, Mus musculus, Homo sapiens, Marinobacter salarius, Sinorhizobium freundii NGR234, Citrobacter rodentium, Pongoabelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria bacterium, Azorhizobium caulinodans, or Candictus Nitrospiranitrificans, etc.

[0052] In some embodiments, the Saccharomyces cerevisiae cell further comprises a heterologous nucleic acid encoding a lactose permease. The lactose permease is a lactose transporter responsible for transferring lactose from the extracellular space to the intracellular space. In some embodiments, the lactose permease source includes but is not limited to Neurospora crassa, Neofusicoccum parvum, Scheffersomyces stipitis, Aspergillus lentulus, Emericella nid ulans, Microdochium bolleyi, Beauveria bassiana, Metarhizium robertsii, Phialocephala, Botryosphaeria parva, Moniliophthora roreri, Cordyceps fumosorosea, Diplodiaseriata, Hypocrea jecorina, Kluyveromyces lactis, Kluyveromyces marxianus. marxianus, Helicobacter pylori, Magnaporthe oryzae, Phialophora attae, Rhizobium meliloti, Zymomonas mobilis, or Escherichia coli, etc.

[0053] In some embodiments, the genetically modified cell of Saccharomyces cerevisiae further comprises a heterologous nucleic acid encoding a transporter polypeptide that exports 2'-fucosyllactose, wherein the heterologous nucleic acid encoding the transporter polypeptide is integrated into the genome of the yeast cell.

[0054] In some embodiments, the transporter polypeptide that exports 2'-fucosyllactose is derived from, but not limited to, Escherichia coli, Kluyveromyces marxianus, Kluyveromyces lactis, Neurospora crassa, and the like.

[0055] In some embodiments, a heterologous nucleic acid encoding the 2'-fucosyllactose exporting transporter polypeptide is integrated into the genome of the yeast cell and / or one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway.

[0056] In some embodiments, the heterologous nucleic acid encoding the transporter polypeptide that exports 2'-fucosyllactose and / or one or more heterologous nucleic acids that independently encode at least one enzyme of the 2'-fucosyllactose biosynthetic pathway are, for example, encoded in episomal form by one or more plasmids. For example, the enzyme encoded by the one or more heterologous nucleic acids that independently encode at least one enzyme of the 2'-fucosyllactose biosynthetic pathway may include one or more of GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, α-1,2-fucosyltransferase, lactose permease, and transporter that exports 2'-fucosyllactose.

[0057] Any gene encoding the above enzymes, or any other enzymes mentioned herein, can be optimized by genetic or protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. This effect allows those of ordinary skill in the art to optimize the expression of the enzyme in yeast and increase activity.

[0058] In one embodiment, a preferred technical solution is: the starting strain of the Saccharomyces cerevisiae genetically modified cells is Saccharomyces cerevisiae CCTCC NO: M20231127 (Saccharomyces cerevisiae SctgtP8), and the Saccharomyces cerevisiae starting strain can be easily purchased through commercial channels or culture collection centers.

[0059] The genetically modified cell of Saccharomyces cerevisiae has been genetically engineered to contain increased intracellular GDP-L-fucose and 2'-FL production capacity compared to the starting strain. Preferably, the genetically modified cell has been genetically engineered to:

[0060] 1) expressing a gene encoding a bifunctional fucokinase / L-fucose-1-phosphate-guanosyltransferase, which catalyzes the formation of GDP-fucose from L-fucose; or

[0061] 2) Overexpression of at least one of the genes encoding GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, a transporter polypeptide for exporting 2'-fucosyllactose, and lactose permease.

[0062] 3) expressing a gene encoding an α-1,2-fucosyltransferase polypeptide.

[0063] Optionally, the GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, 2'-fucosyllactose exporting transporter polypeptide, and lactose permease may be genetically modified enzymes or wild-type enzymes.

[0064] The present invention also provides a genetically modified cell containing a molecular marker. The molecularly marked genetically modified cell comprises a nucleotide sequence such as a nucleotide sequence shown in SEQ ID NO: 29. The present invention also provides a method for preparing a genetically modified cell, wherein the method uses Saccharomyces cerevisiae CCTCC NO: M20231127 as a starting strain, and integrates a heterologous α-1,2-fucosyltransferase gene, a heterologous GDP-L-fucose synthase gene (wcaG), a heterologous GDP-mannitol-4,6-dehydratase gene (gmd), a heterologous lactose permease (lac12), and a heterologous 2'-fucosyllactose exporting transporter polypeptide (CDT2) into the Saccharomyces cerevisiae genome.

[0065] Preferably, the α-1,2-fucosyltransferase gene includes but is not limited to a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1-25.

[0066] Preferably, the genetically modified cells in the preparation method are genetically modified cells of Saccharomyces cerevisiae; further preferably, they are genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127.

[0067] Preferably, the method for preparing the genetically modified cells of Saccharomyces cerevisiae comprises the following steps:

[0068] (1) Cultivating Saccharomyces cerevisiae cells;

[0069] Preferably, the Saccharomyces cerevisiae cell is CCTCC NO: M20231127;

[0070] (2) constructing an expression cassette and introducing a heterologous α-1,2-fucosyltransferase gene into Saccharomyces cerevisiae cells;

[0071] (3) constructing an expression cassette and introducing a heterologous GDP-L-fucose synthase gene (wcag) into Saccharomyces cerevisiae cells; and / or

[0072] (4) constructing an expression cassette and introducing a heterologous GDP-mannitol-4,6-dehydratase (gmd) gene into Saccharomyces cerevisiae cells;

[0073] (5) constructing an expression cassette to introduce a 2'-fucosyllactose exporting transporter polypeptide (CDT2) into Saccharomyces cerevisiae cells;

[0074] (6) Construct an expression cassette to introduce heterologous lactose permease into Saccharomyces cerevisiae cells.

[0075] Preferably, the recombinant construction technology of the genetically engineered yeast Saccharomyces cerevisiae also includes:

[0076] (7) Construct a molecular marker expression cassette and introduce the marker gene into Saccharomyces cerevisiae cells.

[0077] Preferably, the method further comprises the step of (8) recovering the genetically engineered Saccharomyces cerevisiae.

[0078] Preferably, in the above method for preparing genetically modified cells of Saccharomyces cerevisiae, the steps are not ordered in any particular order.

[0079] In another aspect, provided herein is a method of genetically modifying a yeast cell to produce one or more HMOs, the method comprising:

[0080] (a)(i) introducing a heterologous nucleic acid of a heterologous α-1,2-fucosyltransferase; and / or

[0081] (ii) introducing into the yeast cell one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway; and / or

[0082] (b) introducing a heterologous nucleic acid encoding a lactose permease into the yeast cell; and / or

[0083] (c) introducing a heterologous nucleic acid encoding a transporter polypeptide that exports 2'-fucosyllactose into the yeast cell;

[0084] wherein the yeast cell comprises one or more heterologous nucleic acids that each independently encode at least one enzyme of the 2'-fucosyllactose biosynthetic pathway.

[0085] Preferably, the one or more heterologous nucleic acids encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway include a heterologous GDP-L-fucose synthase (wcag), or a GDP-mannitol-4,6-dehydratase (gmd) nucleic acid, or a transporter polypeptide nucleic acid (CDT2) that exports 2'-fucosyllactose, or a lactose permease nucleic acid (lac12).

[0086] In some embodiments of the present invention, the use of the genetically modified Saccharomyces cerevisiae cells in synthesizing 2'-fucosyllactose (2'-FL) is described.

[0087] Preferably, the genetically modified cells of Saccharomyces cerevisiae are genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127.

[0088] In some embodiments, the carbon source in the culture medium comprises lactose and sucrose, or glycerol, or glucose.

[0089] In some embodiments, the culture medium can be any genetically modified cell that can maintain growth and vitality of the fucoidan-producing cell. In some embodiments, the culture medium can also include appropriate salts, minerals, metals or other nutrients. In some embodiments, the carbon source and nutrients necessary for each cell growth are added to the culture medium in an incremental or continuous manner.

[0090] The application of the genetically modified cell of Saccharomyces cerevisiae in synthesizing 2'-FL uses lactose and sucrose, or glycerol, or glucose as carbon sources.

[0091] In some embodiments, the culture medium does not contain fucose. In some embodiments, the method further comprises adjusting the mass ratio of the carbon source (such as sucrose) to lactose to adjust the yield of 2'-fucoyl lactose.

[0092] The fermentation method described in the present application can be carried out in a conventional culture mode, including but not limited to batch, fed-batch, cell recirculation, continuous and semi-continuous. In some embodiments, the fermentation is carried out in a fed-batch mode. In this case, some components of the culture medium are exhausted during the culture period, such as during the production phase of the fermentation. In some embodiments, the culture can be supplemented with relatively high concentrations of such components at the beginning of the production phase, such as to support growth and / or 2'-fucoyl lactose production for a period of time before the need to add. The preferred range of these components can be maintained by adding when the level is exhausted by the culture during the entire culture process. The level of the component in the culture medium can be monitored by, for example, regularly sampling the culture medium and determining the concentration. Alternatively, once a standard culture procedure is developed, it can be added at a time interval corresponding to a known level at a specific time during the entire culture process. As will be appreciated by those of ordinary skill in the art, the consumption rate of nutrients during the culture process increases with the increase of the cell density of the culture medium. In addition, to avoid the introduction of foreign microorganisms into the culture medium, aseptic addition methods known in the art can be used for addition. In addition, a small amount of defoaming agent can be added during the culture process.

[0093] The present application also provides a method for recovering 2'-fucoyl lactose from a fermentation composition. In some embodiments, the fermentation product is any fermentation composition disclosed herein and described above. The method includes separating at least a portion of the yeast cell population from the culture medium. In some embodiments, the separation includes centrifugation. In some embodiments, the separation includes filtering, washing the separated cells with a washing solution, and then collecting the washing solution.

[0094] The term "heterologous": when used in reference to a polynucleotide, gene, nucleic acid, polypeptide or enzyme, refers to a polynucleotide, gene, nucleic acid, polypeptide or enzyme that is from or derived from a source other than the host organism's species.

[0095] The term "host cell" is defined as a cell that has been transformed or transfected or is capable of being transformed or transfected with an exogenous polynucleotide sequence, thereby comprising at least one non-naturally occurring sequence in the host cell.

[0096] The term "molecular marker" refers to a specific DNA fragment that can reflect certain differences in the genome between biological individuals or populations.

[0097] Beneficial Effects

[0098] The present invention provides a genetically modified cell of Saccharomyces cerevisiae, which includes but is not limited to the nucleotide sequence of the transferase polypeptide with an amino acid sequence such as SEQ ID NO: 1-25, and has the beneficial effects of:

[0099] (1) Compared with the original strain, the genetically modified cells of Saccharomyces cerevisiae produced the activity of synthesizing 2'-FL and had no side activities (such as the side activity of producing DFL).

[0100] (2) Compared with 2'-FL produced by Escherichia coli or genetically modified cells of Escherichia coli, 2'-FL products synthesized by recombinant yeast genetically modified cells do not contain endotoxins and other allergens, are safe for consumption, and are more suitable for applications in the fields of food, health products, and infant food.

[0101] (3) The process of fermenting and synthesizing 2'-FL by the genetically modified cells of Saccharomyces cerevisiae described in the present invention is simple and easy, which improves production efficiency and reduces production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 .HPLC spectrum of lactose.

[0103] Figure 2 .HPLC spectrum of 2'-FL standard.

[0104] Figure 3 .HPLC spectrum of DFL standard.

[0105] Figure 4 .HPLC profile of fermentation broth of Saccharomyces cerevisiae CCTCC NO:M20231127 gene-modified cells SC-M20.

[0106] Figure 5 .Mass spectrometry analysis of 2'-FL standard.

[0107] Figure 6 . Figure 4 The HPLC spectrum shown is the LC-MS analysis spectrum of the substance with rt of about 15.06 min. DETAILED DESCRIPTION

[0108] The experimental methods used in the following examples are conventional methods unless otherwise specified; all materials, reagents, etc., are commercially available unless otherwise specified.

[0109] The present invention is further described in detail below through examples. It should be understood that the specific implementation methods described herein are only used to explain the present invention and are not used to limit the present invention. Modifications or replacements to the details and forms of the technical solution without departing from the structural concept and scope of use of the present invention all fall within the protection scope of the present invention.

[0110] Unless otherwise defined, all technical terms and scientific terms used in this specification have the same meanings as those commonly understood by those skilled in the art. In general, the nomenclature used in this specification and the experimental methods described below are well known and commonly used in the art.

[0111] It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention. In the following specific embodiments, if the experimental methods of specific conditions are not indicated, they are generally in accordance with the conventional methods and conditions of molecular biology within the art, and such techniques and conditions are fully explained in the literature. See, for example, Sambrook et al., the techniques and conditions described in "Molecular Cloning: A Laboratory Manual", or the conditions recommended by the manufacturer.

[0112] In the following specific embodiments, if the experimental methods for specific conditions are not specified, they are usually based on conventional methods and conditions of molecular biology within the technology of the field, and such techniques and conditions are fully explained in the literature; all materials, reagents, etc., unless otherwise specified, can be obtained from commercial channels.

[0113] The fermentation product of the yeast gene modified cells of the present invention can be purified by centrifugation, filtration, decolorization, nanofiltration, chromatography purification and crystallization to obtain a reaction solution or solid with high purity; it can also be made into powder by spray drying or freeze drying technology.

[0114] Explanation of abbreviations in the examples: gmd: GDP-4,6-mannitol dehydratase; wcaG: GDP-L-fucose synthase; futC: α-1,2 fucosyltransferase polypeptide; lac12: lactose permease; CDT2: transporter polypeptide for exporting 2'-fucosyllactose.

[0115] Also provided herein is a method for preparing fucoidan lactose. The method includes providing a genetically modified yeast cell capable of producing fucoidan lactose. The yeast cell includes the α-1,2-fucosyltransferase polypeptide gene described in the present application. In some embodiments, the method also includes providing a culture medium, and culturing the yeast cell in the culture medium under conditions suitable for the yeast cell to produce fucoidan lactose.

[0116] Cultivation can be carried out in suitable container, including but not limited to suitable culture medium in cell culture plate, culture bottle or fermentation tank.Any suitable fermentation tank can be used, including but not limited to stirred fermentation tank, airlift fermentation tank, bubble fermentation tank or its any combination.In the specific embodiment utilizing saccharomyces cerevisiae CCTCC NO:M20231127 as host cell, bacterial strain can be grown in fermentation tank.In addition, described method can be performed with the fermentation of any scale known in the art, to support the industrial production of microbial products.Material and method for cell culture maintenance or growth are well known to the technicians in microbiology or fermentation field.

[0117] In some embodiments, the culture medium comprises lactose and sucrose, or glucose. In some embodiments, the carbon source in the culture medium consists essentially of lactose and sucrose, or glucose. Preferably, in some embodiments, the carbon source in the culture medium consists of lactose and sucrose.

[0118] In the following examples, the starting strain is Saccharomyces cerevisiae CCTCC NO: M20231127 (Saccharomyces cerevisiae SctgtP8):

[0119] GDP-mannitol-4,6-dehydratase (Gmd) is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO:27.

[0120] GDP-L-fucose synthase (WcaG) is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO:28.

[0121] The amino acid sequences of α-1,2-fucosyltransferase polypeptides (futC) are shown in SEQ ID NOs: 1-25, respectively.

[0122] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Helicobacter pylori is shown in SEQ ID NO: 36, and the nucleotide sequence thereof is shown in SEQ ID NO: 37, which is represented by HPFut-wt.

[0123] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide derived from Escherichia coli is shown in SEQ ID NO:38, and the nucleotide sequence thereof is shown in SEQ ID NO:39, which is represented by ECFut-wt.

[0124] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide derived from Bacillus cereus is shown in SEQ ID NO:40, and the nucleotide sequence thereof is shown in SEQ ID NO:41, which is represented by BCFut-wt.

[0125] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Bacteroides fragilis is shown in SEQ ID NO:42, and the nucleotide sequence thereof is shown in SEQ ID NO:43, and is represented by BFFut-wt.

[0126] Lactose permease (lac12) is derived from Kluyveromyces lactis, and its amino acid sequence is shown in SEQ ID NO:44, and its nucleotide sequence is shown in SEQ ID NO:45.

[0127] The 2'-fucosyllactose exporting transporter polypeptide (CDT2) is derived from Neurospora crassa, and its amino acid sequence is shown in SEQ ID NO:46, and its nucleotide sequence is shown in SEQ ID NO:47.

[0128] Those skilled in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA molecules with different nucleotide sequences can be used to encode a given heterologous polypeptide of the present application. The natural DNA sequences encoding the above-mentioned biosynthetic enzymes are herein and only used to illustrate the embodiments of the present disclosure, and the present disclosure includes DNA molecules of any sequence of amino acid sequences of polypeptides and proteins encoding enzymes used in the methods of the present disclosure. In a similar manner, polypeptides can generally tolerate one or more amino acid substitutions, deletions, and insertions in their amino acid sequences without loss or significant loss of desired activity. The present disclosure includes such polypeptides having amino acid sequences different from the specific proteins described herein, as long as the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. In addition, the amino acid sequences encoded by the DNA sequences shown herein only illustrate embodiments of the present disclosure.

[0129] Example 1. Expression of polypeptides shown in SEQ ID NOs: 1-25 in Escherichia coli.

[0130] 1. Using the amino acid sequence of the polypeptide shown in SEQ ID NO: 1 (nucleotide sequence shown in SEQ ID NO: 26) as a template, synthesize the polypeptide shown in SEQ ID NO: 1, and finally construct it into the PET32a vector to obtain the PET32a-wt plasmid. Yeast codon optimization synthesis was performed according to the amino acid sequences HPFut-wt, ECFut-wt, BCFut-wt and BFFut-wt, and finally constructed into the PET32a vector, and named PET32a-HPFut-wt, PET32a-ECFut-wt, PET32a-BCFut-wt, PET32a-BFFut-wt, respectively.

[0131] 2. Different mutation sites were obtained by computer-assisted rational design. According to the method of Molecular Cloning Experiment Guide, the nucleotide sequence of PET32a-wt (SEQ ID NO: 26) was used to perform Primer-BLAST ( Primer designing tool (nih.gov) ) mutant primers were designed and the recombinant plasmid series (pET32a-M1-M25) were constructed using the Fast Mutagenesis Kit.

[0132] 3. The above recombinant plasmids were transformed into Escherichia coli BL21 (DE3) according to the following steps:

[0133] Take the prepared Escherichia coli BL21 (DE3) competent cells, place them on ice for 30 minutes to melt, take 100 μL of competent cells and 10 μL of pET32a-M1-M25 recombinant plasmid (concentration 50 ng / μL) respectively, mix them, place them in a 42°C water bath for heat shock for 45 seconds, then immediately cool them in an ice bath for 2 minutes, add 1 mL of fresh LB medium (LB medium: peptone 1.0%, yeast extract 0.5%, NaCl 1.0%, and 1.5% agar powder on the plate), and resuscitate and culture at 37°C and 100 rpm for 1 hour. Then take 100 μL of the bacterial solution and spread it on an LB plate containing ampicillin (100 μg / mL). After culturing in a 37°C constant temperature incubator for 12 hours, pick a single colony for colony PCR to screen out positive transformants.

[0134] 4. Cultivate the positive transformants, extract their plasmids, and use double enzyme digestion and gene sequencing to verify whether the pET32a-M1-M25 recombinant plasmid has been successfully introduced into E. coli.

[0135] 5. The correct transformant was inoculated into LB liquid medium, placed on a shaker at 37°C and 200rpm for 12h to obtain seed liquid; then the seed liquid was inoculated into fresh LB medium at an inoculum amount of 1% (v / v), shaken and cultured at 37°C until OD600 was 0.8, and then induced with isopropyl-β-D-thiogalactopyranoside (IPTG), the final concentration of IPTG was 0.1mmol / L, and the induction was carried out at 16°C for 12h, the speed was 200rpm; after induction expression, the fermentation liquid was centrifuged at 5000r / min for 30min at 4°C to collect the bacteria; the bacteria were resuspended in 20mM pH7.4 PBS buffer, and ultrasonicated at a frequency of plus on 5s / off 5s for 30min to break the bacteria; the broken liquid was centrifuged at 13000×g and 4°C for 30min to remove cell debris and collect the supernatant.

[0136] 6. The soluble polypeptide sequence was purified by nickel column affinity chromatography. The process was as follows: deionized water was added to the top of the nickel column, and after natural elution, it was eluted with 5 volumes of Binding buffer; the crude enzyme solution filtered through a 0.45 μm filter membrane was then loaded onto the column, and the sample was fully combined with the nickel column at a flow rate of 1.5 mL / min. After the sample was dried, it was continuously eluted with 5 column volumes of Washing buffer to remove impurities, and finally the target protein was eluted with 5 times the Elution buffer, and the eluate was collected; then, the expression of the target protein was analyzed by SDS-PAGE.

[0137] The SDS-PAGE results showed that the genetically engineered bacteria had obvious specific expression bands after induction, and the molecular weight of the bands was basically consistent with the expected molecular weight of 35.3 kDa. It can be seen that the polypeptides shown in SEQ ID NO: 1-25 were obtained. For detailed information, see Table 1.

[0138] Table 1. Correspondence between the transferase polypeptides and their amino acid sequence numbers

[0139]

[0140]

[0141] Example 2. Construction of genetically modified cells of Saccharomyces cerevisiae.

[0142] (1) Construction of SC-ΔARO3::GMD-WCAG expression cassette

[0143] The upstream and downstream homology arm sequences aro3-up and aro3-do, the promoter sequence TDH3p and the terminator sequence PGK1t, the promoter sequence TFF1p and the terminator sequence GPMt were amplified using the Saccharomyces cerevisiae genome as a template, respectively; the GMD target gene sequence was amplified using the synthetic gmd sequence as a template; the wcaG target gene sequence was amplified using the synthetic wcaG as a template; referring to the applicant's prior patent: 202211453172.5, the invention name: Recombinant yeast and its application, Chinese The KL-ΔLAC4 knockout cassette was used as a template to amplify the G418+loxp sequence, and aro3-up, TDH3p, GMD, PGK1t, TEF1p, WCAG, ADH1t, G418+loxp and aro3-do were fused by successive fusion PCR of two fragments. Finally, primers ARO3-F and ARO3-R were used as primers and the fusion PCR system was used as a template to obtain the GMD+WCAG expression cassette SC-ΔARO3::GMD-WCAG by PCR amplification.

[0144] Table 2. Plasmids and primers

[0145]

[0146] (2) Construction of SC-ΔTRP3::CDT2-LAC12 expression cassette

[0147] The upstream and downstream homology arm sequences trp3-up and trp3-do of the TRP3 coding region, the promoter sequence TFF1p and the terminator sequence CYC1t, the terminator sequence GPMt and the promoter sequence TPILp were amplified using the Saccharomyces cerevisiae genome as a template, respectively; the CDT2 target gene sequence was amplified using the synthetic CDT2 sequence as a template; the lac12 gene was amplified using the Kluyveromyces lactis genome as a template; the G418+loxp sequence was amplified using SC-ΔARO3::GMD-WCAG as a template, and trp3-up, TFF1p, CDT2, CYC1t, GPMt, lac12, TPILp, G418+loxp and trp3-do were fused by successive fusion PCR of two fragments, and finally the expression cassette SC-ΔTRP3::CDT2-LAC12 was obtained by PCR amplification using primers TRP3-F and TRP3-R as primers and the fusion PCR system as a template.

[0148] Table 3. Plasmids and primers

[0149] Plasmids Primers Primer sequence number TRP3-F CAATCACATGAATACAAGATCATAG SEQ ID NO:32 TRP3-R TTCCCGATAGAGCAATTAGAAGAA SEQ ID NO:33

[0150] (3) Construction of expression cassettes of SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, and SC-ΔGK::BFFut-wt.

[0151] Using Saccharomyces cerevisiae genomic DNA as a template, PCR amplification was performed to obtain the upstream and downstream homology arms gk-up and gk-down, the promoter sequence CUP1p and the terminator sequence GPMt; using the SC-ΔTRP3::CDT2-LAC12 expression cassette as a template, a resistance screening marker containing G418 resistance and loxp sites was amplified; using PET32a-WT, PET32a-M1 to PET32a-M24, PET32a-HPFut-wt, PET32a-ECFut-wt, PET32a-BCFut-wt, and PET32a-BFFut-wt as templates, PCR amplification was performed to obtain BSFut-wt and mutant sequences, as well as HPFut-wt, ECFut-wt, BCFut-wt and BFFut-wt gene sequences; The two fragments were fused PCR successively to fuse gk-up, CUP1p, BSFut-wt and mutant sequence / HPFut-wt / ECFut-wt / BCFut-wt / BFFut-wt gene sequence, GPMt, G418+loxp and gk-do. Finally, primers GK-F and GK-R were used as primers and the fusion PCR system was used as template for PCR amplification to obtain expression cassettes SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, SC-ΔGK::BFFut-wt for the next step of constructing recombinant strains.

[0152] Primers for constructing expression cassettes of SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, SC-ΔGK::BFFut-wt.

[0153] Table 4. Plasmids and primers

[0154] Plasmids Primers Primer sequence number GK-F CGGTCACACAAATCAACCTCAT SEQ ID NO:34 GK-R AAGTTGGCGAGAGTTCAATCT SEQ ID NO:35

[0155] (2) Transformation of the recombinant expression cassette and verification of the recombinant strain.

[0156] The expression cassettes constructed in the above (1) were respectively transferred into the starting strain Saccharomyces cerevisiae CCTCC NO: M20231127 cells.

[0157] The specific method is:

[0158] 1) Prepare yeast competent cells: Take a small amount of frozen yeast strains and streak them on a plate solid culture medium, invert and culture at 30°C for 2 days. Pick a single yeast colony in 50mL liquid culture medium and culture at 30°C, 220rpm until OD 600 Between 0.8 and 1.5. Collect the cells and wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the precipitate, centrifuge at 12000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the precipitate, and obtain the competent yeast cells, and dispense them into 50 μL / tube for transformation.

[0159] Meanwhile, boil 1 mL of salmon sperm DNA for 5 min and quickly put it on ice to prepare single-stranded DNA.

[0160] 2) Transformation: Centrifuge the competent yeast prepared above and remove the residual lithium chloride solution with Tips. For each transformation, add the following order: 50% PEG3350 (240 μL); 1M LiCl (36 μL); 2mg / mL single-stranded Salmon sperm DNA (25 μL); 5-10 μg / 50 μL plasmid DNA aqueous solution (50 μL), vortex vigorously until the precipitated bacteria are completely distributed; incubate in a 30℃ water bath for 30 minutes; heat shock in a 42℃ water bath for 20-25 minutes; centrifuge at 8000rpm for 10 minutes, and collect the yeast cells; then, resuspend the yeast in 500 μL liquid culture medium and incubate in a shaking table at 30℃; after 1-4 hours, take 25-100 μL of bacterial solution and spread it on a selective culture medium plate, and incubate it upside down at 30℃.

[0161] 3) Verification: The correspondence between the recombinant strain and its genotype is shown in Table 5. To verify the correctness of the above strains, we extracted the genomes of the above transformants and the original strains, and amplified the genomes by PCR using the corresponding knockout cassette or expression cassette amplification primers. If the size of the only band obtained after PCR amplification is consistent with the knockout cassette or expression cassette, the strain is judged to be correct, otherwise the strain is judged to be a false positive error.

[0162] Table 5. Saccharomyces cerevisiae engineered strains and their genotypes (α-1,2-fucosyltransferase gene)

[0163]

[0164]

[0165] Example 3. Construction of genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 carrying a marker gene and identification of the marker gene.

[0166] (1) The artificial amino acid sequence containing the encryption tag was sent for synthesis (Shanghai Shenggong Biotechnology Co., Ltd.), and the artificial sequence containing the encryption tag was randomly inserted into the genome of Saccharomyces cerevisiae CCTCCNO: M20231127 in the same manner as in Example 2.

[0167] The artificial amino acid sequence containing the encrypted tag is as follows:

[0168] The correspondence between the labeled recombinant strains and their genotypes is shown in Table 6.

[0169] Table 6

[0170]

[0171]

[0172] (3) Verification.

[0173] To verify the correctness of the above strains, we extracted the genomes of the above transformants and original strains, and amplified the genomes by PCR using the corresponding knockout box or expression box amplification primers. If the size of the only band obtained after PCR amplification is consistent with the knockout box or expression box, the strain is judged to be correct, otherwise the strain is judged to be a false positive error. For the verification of the label, PCR amplification is performed using primers, and further verification is performed by sequencing, otherwise the strain is judged to be a false positive error.

[0174] Example 4. Fermentation synthesis of 2'-FL by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127

[0175] Yeast was cultured with glucose as the carbon source. The genetically modified cells obtained in Examples 2-3 were taken respectively, and the genetically modified cells of Saccharomyces cerevisiae were grown rapidly until the growth entered the late logarithmic phase or the stable phase. The strains were streaked and cultured in solid culture media such as YDP, and after culturing at 30°C for 2-3 days, single colonies were picked and inoculated into 1.5mL YPD liquid culture medium, and cultured at 30°C and 200rpm overnight. Subsequently, they were inoculated into 50mL liquid culture medium shake flasks at a 2% inoculation rate, and cultured at 30°C and 200rpm until OD 600 =1, lactose, 3% (w / v) sucrose, and 0.1 mM CuSO4 were added to a final concentration of 10 g / L, and the total fermentation time was 72 h at 30°C and 200 rpm. After 72 h of fermentation, samples were taken and boiled for 10 min, and the final fermentation product of yeast was obtained after centrifugation, and the 2'-FL content in the supernatant was detected.

[0176] HPLC detection method: Detection conditions: Chromatographic column model: Shodex Asahipak NH2P-50 4E, mobile phase: 65% acetonitrile aqueous solution, flow rate: 0.5 ml / min, column temperature: 35°C, injection volume: 10 μL, evaporative light detector, evaporation temperature 75°C, nebulization temperature 45°C.

[0177] The LC-MS analysis conditions are as follows:

[0178] Chromatographic column model: Shodex Asahipak NH2P-50 4E, detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 0.5 mL / min, column temperature: 35°C, mobile phase: acetonitrile: water = 65:35; ESI-MS mode, molecular weight scanning range 100-800.

[0179] The standard product and the reaction solution were tested according to the above analytical method. The HPLC analysis results showed:

[0180] (1) The peak time rt of 2'-FL standard is 15.06min ( Figure 2 ); HPLC analysis of DFL standard ( Figure 3 )rt is 17.7min.

[0181] (2) The fermentation broths of the genetically modified cells SC-M1 to SC-M24, SC-M1-1 to SC-M24-1, etc. obtained in Example 2-3 all showed a strong absorption peak at around 15.06 min (see Appendix Figure 4 ), which is consistent with the peak time of the 2'-FL standard, indicating that 2'-FL is produced in the fermentation broth of the genetically modified cells obtained in Example 2-3.

[0182] (3) The fermentation liquid of the genetically modified cells obtained in Example 2-3 had no absorption peak near 17.7 min, indicating that no DFL was generated in the fermentation liquid of the genetically modified cells obtained in Example 2-3.

[0183] (4) No 2'-FL and DFL were produced in the fermentation broth of the starting strain.

[0184] The LC-MS analysis conditions are shown above, and the analysis results show:

[0185] The product of the HPLC chromatogram peak of the reaction solution near rt = 15.06min was analyzed by LC-MS, and its spectrum is shown in the attached Figure 6 The MH value of the fermentation broth was 487.17, which was consistent with the Figure 5 The mass spectrum of the 2'-FL standard is consistent with the theoretical molecular weight of 2'-FL, which is 488.44, and is within the allowable error range. This proves that the fermentation process of the genetically modified cells obtained in Example 2-3 successfully synthesized 2'-FL, and there was no byproduct DFL in the product.

[0186] The yields of 2'-FL and DFL in the fermentation broth were detected by the above-mentioned HPLC analysis method, and the results are recorded in Tables 7-8.

[0187] Table 7. Study on the synthesis of 2'-FL by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 obtained in Example 2

[0188]

[0189]

[0190] Table 8. Study on the synthesis of 2'-FL by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 obtained in Example 3

[0191]

[0192]

[0193] Table 7-8 Data Description:

[0194] (1) The starting strain of Saccharomyces cerevisiae and the genetically modified cells SC-1 and SC-2 were all unable to synthesize 2'-FL; however, SC-3-1 was able to produce 2'-FL, indicating that Saccharomyces cerevisiae cells themselves did not have the ability to synthesize 2'-FL, and that the introduction of Gmd (GDP-mannose-4,6-dehydratase) and WcaG (GDP-L-fucose synthase) did not allow the synthesis of 2'-FL. The introduction of BSFut-wt successfully detected the production of 2'-FL, thus proving that BSFut-wt had α-1,2-fucosyltransferase activity, but the activity was low.

[0195] (2) The genetically modified cells of Saccharomyces cerevisiae of the present invention have the activity of synthesizing 2'-FL, and no DFL is detected in the fermentation broth.

[0196] Example 5. Saccharomyces cerevisiae SC-M24, SC-M1-1, SC-M24-1, and SC-6-1 were streaked and cultured in solid culture media such as YDP. After culturing at 30°C for 2-3 days, a single colony was picked and inoculated into 1.5 mL YPD liquid culture medium and cultured at 30°C and 200 rpm overnight. Subsequently, each was inoculated into a 50 mL liquid culture medium shake flask at a 2% inoculum and cultured at 30°C and 200 rpm until OD 600 =1, inoculated in 1L YPD medium (yeast extract powder 10g / L, peptone 20g / L, glucose 20g / L) (3L volume fermenter) at an inoculum of 2%, cultured for 6-7h, added CuSO4, the final concentration of Cu ion was controlled at about 0.1mM, and began to flow sucrose (mother liquor concentration 50%), the sucrose addition flow rate was controlled at 8mL / h, and lactose (mother liquor concentration was 40%) was added at the same time, the final concentration of lactose was maintained at 15g / L, and the total fermentation time was 72h. After 72h of fermentation, the fermentation liquid was centrifuged, the supernatant and the precipitate were collected respectively, the precipitate was crushed by a high-pressure homogenizer, the protein was removed by boiling and centrifugation, the supernatant was combined to obtain the final fermentation product of yeast, and the 2'-FL and DFL contents in the supernatant were detected, and the results were recorded in Table 9.

[0197] Table 9

[0198] Genetically modified cells 2'-FL yield, g / L DFL yield, g / L SC-M1-1 20.6 Not detected SC-M24-1 35.2 Not detected SC-6-1 15.8 Not detected SC-M24 34.7 Not detected

[0199] Although the present invention has been described in considerable detail by way of illustration and example for purposes of clear understanding, it will be apparent to one of ordinary skill in the art that any equivalent aspects or modifications may be implemented. Therefore, the present description and examples should not be construed as limiting the scope of the present invention.

Claims

1. A genetically modified cell, characterized in that Contains a polypeptide encoding an α-1,2-fucosyltransferase The recombinant nucleic acid sequence of (α-1,2-fucosyltransferase).

2. The genetically modified cell according to claim 1, characterized in that Genetically modified cells of Saccharomyces cerevisiae. Preferably, the starting strain of the genetically modified Saccharomyces cerevisiae cell includes but is not limited to Saccharomyces cerevisiae (Sac. cerevisiae), Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces cerevisiae, pastorianus), Saccharomyces cariocas, Saccharomyces mikatae and Saccharomyces kuvei. kudriavzevii).

3. The genetically modified cell according to any one of claims 1 or 2, characterized in that The α-1,2-fucosyltransferase polypeptide is derived from Helicobacter pylori, Thermophilic chlorella, Escherichia coli, Caenorhabditis elegans, Schistosoma mansoni, Bacucilius cereus, Pseudopedobater saltans, Helicobacter mustelae, Bacillus fragilis, Bacteroides vulgatus, Bacteroides fragilis, or Bacillus smithii; Preferably, the α-1,2-fucosyltransferase polypeptide includes but is not limited to the amino acid sequence and the amino acid sequence and SEQ ID NO: 1-25 polypeptides having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100% identical amino acid sequences; Further preferably, the α-1,2-fucosyltransferase polypeptide is an amino acid sequence such as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ Polypeptides shown in ID NO:23, SEQ ID NO:24, and SEQ ID NO:

25.

4. The genetically modified cell according to any one of claims 1 to 3, characterized in that The genetically modified yeast gene cell further comprises one or more heterologous nucleic acids encoding GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, lactose permease, and a transporter for exporting 2'-fucosyllactose; Preferably, the GDP-mannose-4,6-dehydratase and GDP-L-fucose synthase are genetically modified enzymes or wild-type enzymes; preferably, the heterologous GDP-mannose-4,6-dehydratase (gmd) gene is from Escherichia coli, and other suitable sources of GDP-mannose-4,6-dehydratase include but are not limited to Caenorhabditis elegans, Homo sapiens, sapien), Arabidopsis thaliana, Dictyostelium discoideum, Mus musculus, Drosophila melanogaster, Sinorhizobium fredii, Pandoraea vervacti, Caenorhabditis briggsae, Candidatus Curtissbacteria, Pseudomonas sp., Clostridium sp., Cricetulus griseus, Arthrobacter iccitolerans, or Paraburkholderia piptadeniae; Preferably, the heterologous GDP-L-fucosesynthase (wcag) gene is from Escherichia coli. Other suitable sources of GDP-L-fucose synthase include, for example, but not limited to, Mus musculus, Homo sapiens, Marinobacter salarius, Sinorhizobium freundii NGR234, Citrobacter rodentium, Pongoabelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria bacterium, Azorhizobium caulinodans or Candictus Nitrospiranitrificans. Preferably, the lactose permease source includes but is not limited to Neurospora crassa, Neofusicoccum parvum, Scheffersomyces stipitis, Aspergillus lentulus, Emericella nid ulans, Microdochium bolleyi, Beauveria bassiana, Metarhizium robertsii, Phialocephala, Botryosphaeria parva, Moniliophthora aroreri, Cordyceps fumosorosea, Diplodiaseriata, Hypocrea jecorina, Kluyveromyces lactis, Kluyveromyces marxianus. marxianus, Helicobacter pylori, Magnaporthe oryzae, Phialophora attae, Rhizobium meliloti, Zymomonas mobilis, or Escherichia coli, and more preferably Kluyveromyces lactis or Kluyveromyces marxianus. Preferably, the transporter polypeptide for exporting 2'-fucosyllactose is derived from, but not limited to, Escherichia coli, Kluyveromyces marxianus, Kluyveromyces lactis, and Neurospora crassa; Preferably, the GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, 2'-fucosyllactose exporting transporter polypeptide, and lactose permease may be genetically modified enzymes or wild-type enzymes.

5. The genetically modified cell according to any one of claims 1 to 4, characterized in that It also includes molecular marker genes, Preferably, the nucleotide sequence of the marker gene is as shown in SEQ ID NO:

29.

6. The genetically modified cell according to any one of claims 1 to 5, characterized in that The production method of the α-1,2-fucosyltransferase polypeptide comprises the following steps: (1) culturing the transformed host cell under conditions suitable for expressing the polypeptide; and (2) Recovering the polypeptide.

7. The method for preparing a genetically modified cell according to any one of claims 1 to 6, characterized in that: Include one or more of the following steps: (1) Cultivating the starting strain; (2) constructing an expression cassette and introducing the α-1,2-fucosyltransferase gene into the starting strain; (3) constructing an expression cassette and introducing a heterologous GDP-L-fucose synthase gene (wcag) into the starting strain; (4) constructing an expression cassette and introducing a heterologous GDP-mannitol 4,6 dehydratase (gmd) gene into the starting strain; (5) constructing an expression cassette and introducing a 2'-fucosyllactose exporting transporter polypeptide (CDT2) into the starting strain; (6) Construct an expression cassette and introduce lactose permease (lac12) into the starting strain. As described above, the steps of the method for preparing genetically modified cells of Saccharomyces cerevisiae are not in any particular order.

8. The method for preparing genetically modified cells according to claim 7, characterized in that: Also includes: (7) Construct a molecular marker expression cassette and introduce the marker gene into the starting strain.

9. The method for preparing a genetically modified cell according to any one of claims 7 or 8, characterized in that: Also includes: (8) A step of recovering the genetically modified cells.

10. Use of the genetically modified cell according to any one of claims 1 to 6 in the synthesis of 2'-fucosyllactose (2'-FL); In the application, preferably, the carbon source in the culture medium comprises lactose and sucrose, or glycerol, or glucose. In the application, preferably, the culture medium also includes metal salts, minerals or other nutrients. In the application, preferably, the culture medium does not contain fucose.

Images