Method for producing nucleic acid oligomers

Abstract

The present invention addresses the problem of providing a method for producing a nucleic acid oligomer with high efficiency, particularly a method for deprotecting a protecting group for a hydroxyl group in a ribose in a nucleic acid oligomer with high efficiency. The present invention also addresses the problem of providing a method for producing a nucleic acid oligomer represented by formula (4), the method comprising bringing a nucleic acid oligomer represented by formula (3) into contact with a fluoride ion under an inert gas atmosphere having an oxygen concentration of 15% or less (in which the definition for each group in each of formulae (3) and (4) is as described in the description).

Description

[Technical Field]

[0001] This patent application claims priority under the Paris Convention to and the benefit of Japanese Patent Application No. 2020-159460 (filed September 24, 2020), the entire contents of which are incorporated herein by reference. The present invention relates to a method for producing a nucleic acid oligomer containing ribose, and more particularly to a method for deprotecting the protecting group of the hydroxyl group of ribose contained in the nucleic acid oligomer.

[0002] In recent years, there has been growing interest in the application of nucleic acid oligomers in the medical field, including antisense nucleic acids, aptamers, ribozymes, and nucleic acids that induce RNA interference (RNAi), such as siRNA, which are known as nucleic acid drugs.

[0003] Nucleic acid oligomers can be synthesized by solid-phase synthesis, which uses nucleoside phosphoramidites (hereinafter referred to as "amidites") as starting materials. Nucleic acid oligomers synthesized by extending nucleic acids on a solid support are cleaved from the solid support, and then, for nucleic acid oligomers containing ribose, the protecting group on the 2'-hydroxyl group of the ribose is removed by deprotection to produce the desired nucleic acid oligomer. The purity of the nucleic acid oligomers synthesized in this manner is not necessarily satisfactory due to the multiple steps involved, such as the extension reaction step of the nucleic acid on the solid support, the cleavage step from the solid support, and the deprotection step of each protecting group, and the synthesis is inefficient (Patent Documents 1 and 2). [Prior art documents] [Non-patent literature]

[0004] [Patent Document 1] International Publication No. 2006 / 022323 [Patent Document 2] International Publication No. 2013 / 027843 Summary of the Invention [Problem to be solved by the invention]

[0005] An object of the present invention is to provide a method for efficiently producing a nucleic acid oligomer. [Means for solving the problem]

[0006] As a result of extensive research to achieve the above object, the inventors have discovered that the protecting groups of the hydroxyl groups of ribose contained in a nucleic acid oligomer can be efficiently deprotected by contacting the nucleic acid oligomer with fluoride ions in an inert gas atmosphere with an oxygen concentration below a certain level, and as a result, an efficient method for producing a nucleic acid oligomer can be provided.

[0007] The present invention has been completed based on these findings and includes, but is not limited to, the following aspects.

[0008] 1. In an inert gas atmosphere with an oxygen concentration of 15% or less, the reaction mixture is reacted with the reaction mixture in the presence of the reaction agent ... [ka] (In the formula, G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, G 9 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, B c each independently represents the same or different nucleobase, R are independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and represent a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a group represented by formula (1): [ka] (In the formula, The bond marked with * indicates a bond with the oxygen atom of the OQ group. n represents an integer equal to or greater than 0.) represents a protecting group of the formula Y's are independently the same or different and represent an oxygen atom or a sulfur atom; m represents an integer between 2 and 200, W and X are defined as either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group above. (b) When X is a hydroxyl group, W represents an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1). However, at least one group among the R, W, and X represents a hydroxyl group protected with a protecting group of the formula (1). When m is an integer of 3 or greater, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. A method for producing a nucleic acid oligomer represented by formula (4): [ka] (In the formula, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are independently the same or different and represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose, Substituent G in formula (4) 4 , G 9 , Y, B cand m are defined as in the formula (3). W0 is a hydroxyl group, X0 has the same definition as the R' group above. When m is an integer of 3 or greater, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. (hereinafter referred to as "the production method of the present invention" in this specification). 2. The method according to item 1 above, wherein n in formula (1) is 0 or 1. 3. The method according to item 1 above, wherein n in formula (1) is 0. 4. The method according to item 1 above, wherein n in formula (1) is 1. 5. The production method according to any one of the preceding items 1 to 4, wherein the non-nucleotide linker is a linker consisting of an amino acid backbone. 6. The production method according to the preceding item 5, wherein the linker consisting of an amino acid skeleton is a linker having a structure of the following formula (A14-1), (A14-2) or (A14-3): [ka] (In the formula, 5' and 3' represent the 5' and 3' ends of the nucleic acid oligomer, respectively.) 7. The production method according to any one of the preceding items 1 to 6, wherein W is a hydroxyl group, X is an R group, W0 is a hydroxyl group, and X0 is an R' group. 8. The method according to any one of the preceding items 1 to 7, wherein the fluoride ion source is tetraalkylammonium fluoride. 9. The method according to any one of the preceding items 1 to 8, wherein the fluoride ion source is tetra-n-butylammonium fluoride (TBAF). 10. The method according to any one of items 1 to 9 above, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 10% or less. 11. The method according to any one of items 1 to 9 above, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less. 12. The method according to any one of items 1 to 9 above, wherein the fluoride ions are contacted in an inert gas atmosphere having an oxygen concentration of 4% or less. 13. The method according to any one of items 1 to 9 above, wherein the fluoride ions are contacted in an inert gas atmosphere having an oxygen concentration of 3% or less. 14. The method according to any one of items 1 to 9 above, wherein the fluoride ions are contacted in an inert gas atmosphere having an oxygen concentration of 2% or less. 15. The method according to any one of items 1 to 9 above, wherein the fluoride ions are contacted in an inert gas atmosphere having an oxygen concentration of 1% or less. 16. The method according to any one of items 1 to 9 above, wherein the fluoride ion is brought into contact with the fluoride ion in an inert gas atmosphere having an oxygen concentration of 0%. 17. The method according to any one of items 1 to 16 above, wherein the temperature in the reaction system when contacting the nucleic acid oligomer represented by formula (3) with fluoride ions is 25°C or lower. 18. The method according to any one of items 1 to 16 above, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 20°C or lower. 19. The method according to any one of items 1 to 16 above, wherein the temperature in the reaction system when contacting the nucleic acid oligomer represented by formula (3) with fluoride ions is 15°C or lower. 20. The method according to any one of items 1 to 16 above, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 10°C or lower. 21. The method according to any one of items 1 to 16 above, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 5°C or lower. 22. The method according to any one of the preceding items 1 to 16, wherein the time required for contacting the nucleic acid oligomer represented by formula (3) with the entire amount of fluoride ions is 30 minutes or longer. 23. The method according to any one of items 1 to 16 above, wherein the time required for contacting the nucleic acid oligomer represented by formula (3) with the entire amount of fluoride ions is 1 hour or longer. 24. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the proportion of protecting groups of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 10% or more, and the nucleic acid chain length is 10 or more. 25. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the proportion of protecting groups of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 20% or more, and the nucleic acid chain length is 10 or more. 26. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 30% or more, and the nucleic acid chain length is 10 or more. 27. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the proportion of protecting groups of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 40% or more, and the nucleic acid chain length is 10 or more chain lengths. 28. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 50% or more, and the nucleic acid chain length is 10 or more chain lengths. 29. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X in the nucleic acid oligomer represented by formula (3) is 60% or more, and the nucleic acid chain length is 10 or more chain lengths. 30. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X in the nucleic acid oligomer represented by formula (3) is 70% or more, and the nucleic acid chain length is 10 or more chain lengths. 31. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X in the nucleic acid oligomer represented by formula (3) is 80% or more, and the nucleic acid chain length is 10 or more chain lengths. 32. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 90% or more, and the nucleic acid chain length is 10 or more chain lengths. 33. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 95% or more, and the nucleic acid chain length is 10 or more chain lengths. 34. A method for producing a nucleic acid oligomer according to any one of items 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 100%, and the nucleic acid chain length is 10 or more chain lengths. 35. The method for production described in any one of the preceding items 1 to 34, wherein the nucleic acid chain length is 20 or more chain lengths. 36. The method for production described in any one of the preceding items 1 to 34, wherein the nucleic acid chain length is 30 or more chain lengths. 37. The method for production described in any one of the preceding items 1 to 34, wherein the nucleic acid chain length is 40 or more chain lengths. 38. The method for production described in any one of the preceding items 1 to 34, wherein the nucleic acid chain length is 50 or more chain lengths. [Effects of the Invention]

[0009] The present invention provides an efficient method for producing nucleic acid oligomers, which is expected to improve the purity of the produced nucleic acid oligomers. DETAILED DESCRIPTION OF THE INVENTION

[0010] A method for producing a nucleic acid oligomer represented by formula (4) in which the protecting group of formula (1) is deprotected by contacting a nucleic acid oligomer represented by formula (3) with fluoride ions in an inert gas atmosphere with an oxygen concentration of 15% or less is described. [ka]

[0011] In formula (1), n is any integer of 0 or more, more preferably an integer of 0 to 3, more preferably an integer of 0 to 2, even more preferably 0 or 1, and particularly preferably 1.

[0012] At least one of the groups R, W, and X in formula (3) represents a hydroxyl group protected with the protecting group of formula (1). The proportion of formula (1) among R, W, and X may be 1% or more, more preferably 5% or more, more preferably 10% or more, more preferably 20% or more, more preferably 30% or more, more preferably 40% or more, more preferably 50% or more, more preferably 60% or more, more preferably 70% or more, more preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more. The chain length of the nucleic acid to be synthesized is preferably 10 chain lengths or more, more preferably 20 chain lengths or more, more preferably 30 chain lengths or more, more preferably 40 chain lengths or more, and even more preferably 50 chain lengths or more.

[0013] In the step of deprotecting the hydroxyl-protecting group represented by formula (1), tetraalkylammonium fluoride is typically used as the fluoride ion source. Examples of tetraalkylammonium fluorides include tetrabutylammonium fluoride and tetramethylammonium fluoride, among which tetrabutylammonium fluoride (TBAF) is more preferred. The amount of fluoride ions used is usually 1 to 1000 mol, preferably 1 to 500, more preferably 2 to 200 mol, more preferably 4 to 100 mol per 1 mol of protecting group to be removed.

[0014] In this step, an organic solvent inert to the reaction is usually used. Specific examples include sulfoxide solvents, nitrile solvents, ether solvents, amide solvents, ketone solvents, aliphatic hydrocarbon solvents, ester solvents, aromatic solvents, and mixed solvents of two or more of these solvents. Of these solvents, sulfoxide solvents are preferred. Examples of sulfoxide solvents include dimethyl sulfoxide. Examples of nitrile solvents include acetonitrile and propionitrile. Examples of ether solvents include tetrahydrofuran. Examples of amide solvents include N-methyl-2-pyrrolidone. Examples of ketone solvents include acetone and methyl ethyl ketone. Examples of aliphatic hydrocarbon solvents include hexane and heptane. Examples of ester solvents include methyl acetate and ethyl acetate. Examples of aromatic solvents include toluene and pyridine. Among these, dimethyl sulfoxide or a mixed solvent of dimethyl sulfoxide and acetonitrile is preferred.

[0015] The fluoride ion source, which is a reagent used in the step of removing the hydroxyl-protecting group represented by formula (1), is usually dissolved in a solvent and then dehydrated before use. Examples of dehydrating agents include molecular sieves and sulfates, and molecular sieves 4A are preferably used.

[0016] The amount of solvent used is usually 5 to 8,000 L, preferably 50 to 2,000 L, and more preferably 100 to 1,600 L per mole of nucleic acid oligomer subjected to the deprotection step.

[0017] If necessary, a compound that reacts with the compound represented by formula (2) below, which is a by-product of this step, to capture the compound can be added. Examples of the capturing compound include nitroalkanes, alkylamines, amidines, thiols, thiol derivatives, and mixtures of two or more of these. Examples of "nitroalkanes" include nitromethane. Examples of "alkylamines" include linear alkylamines having 1 to 6 carbon atoms and cyclic amines having 1 to 8 carbon atoms. Specific examples include methylamine, ethylamine, n-propylamine, n-butylamine, n-pentylamine, n-hexylamine, morpholine, and piperidine. Examples of "amidines" include benzamidine and formamidine. Examples of "thiols" include linear thiols having 1 to 6 carbon atoms. Specific examples include methanethiol, ethanethiol, 1-propanethiol, 1-butanethiol, 1-pentanethiol, and 1-hexanethiol. Examples of "thiol derivatives" include alcohols or ethers having the same or different linear alkylthiol groups having 1 to 6 carbon atoms. Specific examples include 2-mercaptoethanol, 4-mercapto-1-butanol, 6-mercapto-1-hexanol, mercaptomethyl ether, 2-mercaptoethyl ether, 3-mercaptopropyl ether, 4-mercaptobutyl ether, 5-mercaptopentyl ether, and 6-mercaptohexyl ether. Nitromethane is more preferably used.

[0018] Formula (2): [ka]

[0019] The amount of the compound that captures the by-product compound represented by formula (2) can be 0.1 to 100.0 mol %, preferably 1.0 to 50.0 mol %, more preferably 2.0 to 40.0 mol %, and even more preferably 3.0 to 30.0 mol %, based on the fluoride ion source that eliminates the hydroxyl-protecting group represented by formula (1).

[0020] The contact reaction between the nucleic acid oligomer represented by formula (3) and fluoride ions may be carried out by adding fluoride ions to the nucleic acid oligomer represented by formula (3), or conversely, by adding the nucleic acid oligomer represented by formula (3) to fluoride ions, or by adding both simultaneously. The method of adding fluoride ions to the nucleic acid oligomer represented by formula (3) is preferred. The time required for adding and contacting the entire amount of fluoride ions with the nucleic acid oligomer represented by formula (3) is preferably 5 minutes or more, more preferably 10 minutes or more, more preferably 15 minutes or more, more preferably 30 minutes or more, and even more preferably 1 hour or more. The addition is preferably carried out dropwise onto the surface of or into the solution containing the nucleic acid oligomer represented by formula (3) over a period of 5 minutes or more, more preferably over a period of 10 minutes or more, more preferably over a period of 15 minutes or more, even more preferably over a period of 30 minutes or more, and even more preferably over a period of 1 hour or more.

[0021] The temperature of either or both of the solutions when adding fluoride ions to the nucleic acid oligomer represented by formula (3) may be 80°C or lower, preferably both are 40°C or lower, preferably both are 35°C or lower, more preferably both are 30°C or lower, more preferably both are 25°C or lower, more preferably both are 20°C or lower, more preferably both are 15°C or lower, more preferably both are 10°C or lower, and even more preferably both are 5°C or lower. After the addition of fluoride ions to the nucleic acid oligomer represented by formula (3) is completed, the mixture may be kept warm for 1 minute or more, preferably 5 minutes or more, more preferably 10 minutes or more, more preferably 15 minutes or more, more preferably 30 minutes or more, and even more preferably 1 hour or more. Furthermore, after keeping the temperature, the temperature may be raised, and may be raised to 5°C or higher and 80°C or lower, preferably to 10°C or higher and 40°C or lower, preferably to 10°C or higher and 35°C or lower, preferably to 15°C or higher and 35°C or lower, more preferably to 20°C or higher and 35°C or lower, and even more preferably to 25°C or higher and 35°C or lower. After further temperature increase, the deprotection reaction time varies depending on the type of deprotecting agent used and the reaction temperature, but is usually 1 to 100 hours, preferably 1 to 24 hours, more preferably 2 to 12 hours, and even more preferably 3 to 6 hours. The fluoride ions may be added at any time.

[0022] The inert gas atmosphere having an oxygen concentration of 15% or less may be adjusted, for example, by preparing an inert gas having an oxygen concentration of not more than the predetermined value, supplying it to the reaction system, and measuring and confirming that the oxygen concentration in the gas phase is within the set concentration range. Specifically, the adjustment can be performed by flowing a high-purity inert gas such as argon or nitrogen, or an inert gas whose oxygen concentration has been adjusted to a predetermined value, into the gas phase of the reaction system, or by replacing the gas phase atmosphere of the reaction system with the inert gas or an inert gas whose concentration has been adjusted. The inert gas used in the production method of the present invention includes, but is not limited to, nitrogen gas, argon gas, helium gas, and carbon dioxide, and is preferably nitrogen gas or argon gas.

[0023] The reaction system atmosphere may be substituted by vacuum substitution, pressure substitution, flow substitution, bubbling substitution, or freeze degassing, and ultrasonic waves or heating may be applied during this process. More preferred methods are flow substitution and vacuum substitution. The oxygen concentration is preferably 15% or less, more preferably 10% or less, more preferably 5% or less, more preferably 4% or less, more preferably 3% or less, more preferably 2% or less, more preferably 1% or less, and even more preferably 0%.

[0024] Stirring of the reaction system during the deprotection reaction is not essential, but usually, the stirring power Pv is 0.0 to 0.5 kW / m 3 Stirring is performed within the range of Pv 0.1 to 0.3kW / m 3 It is preferable to stir the mixture.

[0025] The nucleic acid oligomer produced after the reaction can be separated and purified from the reaction mixture by conventional methods, such as extraction, concentration, neutralization, filtration, centrifugation, recrystallization, silica gel column chromatography, thin-layer chromatography, reverse-phase column chromatography, ion-exchange column chromatography, gel filtration column chromatography, hydrophobic interaction chromatography, hydrophilic interaction liquid chromatography, precipitation (e.g., precipitation of the nucleic acid oligomer using ethanol, isopropanol, methanol, or polyethylene glycol), dialysis, and ultrafiltration, to remove the protective group of formula (1) at the 2' or 3' hydroxyl group. The purified nucleic acid oligomer can be isolated. The isolated nucleic acid oligomer is usually obtained as a nucleic acid oligomer with a protected hydroxyl group at its 5' end.

[0026] The reaction for obtaining a nucleic acid oligomer represented by the following formula (4) by deprotecting the protecting group represented by formula (1) from a nucleic acid oligomer represented by formula (3) is as follows (Scheme 1). [ka] G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, G 9 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, B c each independently represents the same or different nucleobase, R are independently the same or different and represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and represent a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a group represented by formula (1): [ka] (In the formula, The bond marked with * indicates a bond with the oxygen atom of the OQ group. n represents an integer equal to or greater than 0.) represents a protecting group of the formula Y's are independently the same or different and represent an oxygen atom or a sulfur atom; m represents an integer between 2 and 200, W and X are defined as either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group above. (b) When X is a hydroxyl group, W represents an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1). However, at least one group among the R, W, and X represents a hydroxyl group protected with a protecting group of the formula (1). When m is an integer of 3 or greater, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides.

[0027] In formula (3) or formula (4), when R represents an OQ group and R' represents an OQ' group, the structure of ribose is represented by the following formula (LNA-1), (LNA-2) or (LNA-3). [ka] (wherein Base represents a nucleic acid base)

[0028] Nucleosides (ribose and deoxyribose) contained in the nucleic acid oligomer used in the present invention include, but are not limited to, DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the above-mentioned LNA.

[0029] The nucleic acid oligomer represented by formula (3) can be obtained, for example, as shown in Scheme 2, by cleaving the nucleic acid oligomer produced by solid-phase synthesis represented by formula (5) from the solid support. [ka]

[0030] The nucleic acid oligomer of formula (5) synthesized on a solid support will now be described. Substituent B a each independently represents the same or different optionally protected nucleobase. G 4 and Y is as defined in formula (3) above; G 2 each independently represents the same or different phosphate protecting group, When X1 represents OZ, W1 represents an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1). When X1 represents an R group, W1 represents a group represented by OZ; Z represents a group consisting of a solid phase carrier and a linking moiety connecting the solid phase carrier with the oxygen atom of the hydroxyl group at the 2'- or 3'-position of ribose at the 3'-end of the nucleic acid oligomer.

[0031] More specifically, Z represents a structure represented by the following formula (6): [ka] In formula (6), Sp represents a spacer. The spacer (Sp) is exemplified by one having the structural formula shown in the following formula (7).

[0032] [ka]

[0033] The linker may have a structure shown in the following formula (8-1), (8-2), (8-3), (8-4), (8-5), (8-6), (8-7), or (8-8), for example. Examples of solid supports include inorganic porous supports and organic resin supports. Examples of inorganic porous supports include controlled pore glass (CPG) and zeolite. Examples of organic resin supports include supports made of polystyrene.

[0034] [ka] [ka] (In the formula, each A may independently be a hydroxyl group, an alkoxy group, or an alkyl group. Examples of alkoxy groups include a methoxy group and an ethoxy group. Examples of alkyl groups include a methyl group, an ethyl group, an isopropyl group, and an n-propyl group. Si indicates that it is bonded to the oxygen of a hydroxyl group on the surface of the support.)

[0035] G 4 represents a protecting group for a hydrogen atom or a hydroxyl group, and when representing a protecting group, 1 represents the same protecting group as G 4is a hydrogen atom when deprotected, and the nucleotide compound in this state is also subjected to a series of steps in a nucleic acid extension reaction.

[0036] G 9 represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion. Specific examples of the alkyl moiety of the alkylammonium ion include methyl, ethyl, n-propyl, and the like. Pi Examples of hydroxyalkyl ions include methyl, isopropyl, n-butyl, dibutyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl, but more specific examples include diethylammonium ion, triethylammonium ion, tetrabutylammonium ion, hexylammonium ion, and dibutylammonium ion. Examples of alkali metal ions include sodium ion and lithium ion. Examples of specific hydroxyalkyl moieties of hydroxyalkyl ammonium ions include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, and trishydroxymethyl, but more specific examples of hydroxyalkyl ammonium ions include trishydroxymethylammonium ion.

[0037] The compound of formula (5) is produced, for example, by the amidite method using an amidite compound of formula (A13) below. [ka] (In the formula, R represents a hydrogen atom, a fluorine atom, or an OQ group; Q represents a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the 4' carbon atom, an ethylene group bonded to the 4' carbon atom, an ethylidene group bonded to the 4' carbon atom, or a protecting group represented by formula (1); B a represents an optionally protected nucleobase, G 1 represents a protecting group for a hydroxyl group, G 2 represents a protecting group for phosphate, G 3 represents an alkyl group, or a ring structure formed by bonding together at their ends.

[0038] B a is B c or a nucleic acid base protected with a protecting group. B a The nucleic acid base in is not particularly limited. Examples of the nucleic acid base include adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, and 1-methylpseudouracil. The nucleic acid base may be substituted with a substituent. Examples of such a substituent include a fluoro group and a chloro group. 、 Examples of the substituent include halogen atoms such as bromo and iodo groups, acyl groups such as acetyl groups, alkyl groups such as methyl and ethyl groups, arylalkyl groups such as benzyl groups, alkoxy groups such as methoxy groups, alkoxyalkyl groups such as methoxyethyl groups, cyanoalkyl groups such as cyanoethyl groups, hydroxy groups, hydroxyalkyl groups, acyloxymethyl groups, amino groups, monoalkylamino groups, dialkylamino groups, carboxy groups, cyano groups, and nitro groups, as well as combinations of two or more of these substituents.

[0039] When a nucleic acid base has an amino group outside the ring, the protecting group for the amino group is not particularly limited, and any protecting group known in nucleic acid chemistry can be used. Examples of such protecting groups include a benzoyl group, a 4-methoxybenzoyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a phenylacetyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, and a (dimethylamino)methylene group, as well as combinations of two or more of these protecting groups.

[0040] B aMore specifically, [ka]

[0041] (In the above formula, R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or a benzoyl group, R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group, or a benzoyl group, R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group, or an isobutyryl group; R 7 represents a 2-cyanoethyl group, R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group, or a 4-methylbenzoyl group, R 9 represents a dimethylaminomethylene group. represents a group represented by any one of the following:

[0042] G 1 There are no particular limitations on the protecting group, so long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used.

[0043] G 1 is preferably the following group:

[0044] [ka] (In the formula, R 1 , R 2 and R 3 are the same or different and represent hydrogen or an alkoxy group.

[0045] R 1 , R 2 and R 3 Preferably, one of the groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred as the alkoxy group.

[0046] G 2 There are no particular limitations on the protecting group G as long as it can function as a protecting group, and a wide range of known protecting groups used in amidite compounds can be used. 2 Examples of the alkyl group include an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an arylalkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroarylalkyl group, a silyl group, a silyloxyalkyl group, a mono-, di-, or trialkylsilyl group, and a mono-, di-, or trialkylsilyloxyalkyl group, which may be substituted with one or more electron-withdrawing groups.

[0047] G 2 is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include a cyano group, a nitro group, an alkylsulfonyl group, a halogen atom, an arylsulfonyl group, a trihalomethyl group, and a trialkylamino group, and is preferably a cyano group.

[0048] G 2 Particularly preferred as are the following groups: [ka]

[0049] G 3 is two G 3 may be bonded to each other to form a ring structure. 3 Preferably, both of the groups are isopropyl groups.

[0050] R 1 , R 2 , R 3 and G 2 The alkyl group in the definition may be either linear or branched, and is preferably an alkyl group having 1 to 12 carbon atoms, more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, and the like. Pi Examples include butyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. Notation The alkyl group moiety constituting the alkoxy group in this definition has the same definition as the alkyl group herein.

[0051] As used herein, the term "nucleobase" refers to a group having a natural or non-natural nucleobase backbone. The nucleobase also includes modified forms of the natural or non-natural nucleobase backbone. C More specifically, examples of the nucleic acid base represented by the formula (I) include the following structures: [ka]

[0052] (In the above formula, R 4’ represents a hydrogen atom or a methyl group, R 5’ represents a hydrogen atom or an acetyl group, R 6’ represents a hydrogen atom, R 8’ represents a hydrogen atom or a methyl group.

[0053] The following describes non-nucleotide linkers that can be introduced in place of p nucleotides (where p is a positive integer that satisfies the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides of the nucleic acid oligomers of formula (3) and formula (4). Examples of non-nucleotide linkers include linkers consisting of an amino acid backbone (for example, linkers consisting of an amino acid backbone described in Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Specific, non-limiting examples include linkers represented by formula (A14-1), (A14-2), or (14-3) (for example, those described in Japanese Patent No. 5555346 or Japanese Patent No. 5876890). In addition to these linkers, examples include linkers described in International Publication No. 2012 / 005368, International Publication No. 2018 / 182008, or International Publication No. 2019 / 074110. [ka]

[0054] Nucleotides and amidites in which the R group in formula (3) and the R′ group in formula (4) are substituents other than a hydroxyl group can be produced from nucleosides synthesized by known methods described in Japanese Patent No. 3745226, WO 2001 / 053528, or JP 2014-221817 A and known methods cited therein, or can be produced using commercially available products in accordance with the methods described in the Examples below or by methods with appropriate modifications to these methods.

[0055] Cleavage of nucleic acid oligomers (hereinafter referred to as oligonucleotides) from solid phase supports The excision step was carried out by excising a nucleic acid oligomer of a desired chain length using concentrated aqueous ammonia as an excision agent.

[0056] In the phosphoramidite method, a nucleic acid extension reaction is carried out by repeatedly performing the deprotection step, the condensation step, and the oxidation step according to a generally known method (for example, the method described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881).

[0057] (Nucleic acid extension reaction) As used herein, the term "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially linked via phosphodiester bonds to extend an oligonucleotide. The nucleic acid extension reaction can be carried out according to the general procedure of the phosphoramidite method. The nucleic acid extension reaction may also be carried out using an automatic nucleic acid synthesizer that employs the phosphoramidite method.

[0058] The chain length of the nucleic acid oligomer may be, for example, 2 to 200 mer, 10 to 150 mer, or 15 to 110 mer.

[0059] The 5'-deprotection step is a step in which the protecting group of the 5' hydroxyl group at the end of the RNA strand supported on the solid phase support is removed. Common protecting groups include the 4,4'-dimethoxytrityl group (DMTr group), the 4-monomethoxytrityl group, and the 4,4',4"-trimethoxytrityl group. Deprotection can be carried out using an acid. Examples of acids used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, and p-toluenesulfonic acid.

[0060] The condensation step is a reaction in which a nucleoside phosphoramidite represented by formula (A13) is bonded to the 5' hydroxyl group at the end of the oligonucleotide chain deprotected in the deprotection step. The phosphoramidite used in nucleic acid elongation is an amidite compound represented by formula (A13) or (A12). Other usable phosphoramidites include 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, and the like. The nucleoside phosphoramidite used has its 5' hydroxyl group protected with a protecting group (e.g., DMTr). The condensation step can be carried out using an activator that activates the nucleoside phosphoramidite. Examples of the activator include 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium triflate (N-MeBIT), benzimidazolium triflate (BIT), N-phenylimidazolium triflate (N-PhIMT), imidazolium triflate (IMT), 5-nitrobenzimidazolium triflate (NBT), 1-hydroxybenzotriazole (HOBT), and 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole.

[0061] After the condensation step, any unreacted 5' hydroxyl groups may be capped, if desired, using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0062] The oxidation step is a step of converting the phosphite group formed in the condensation step into a phosphate group or a thiophosphate group. This step is a reaction of converting trivalent phosphorus to pentavalent phosphorus using an oxidizing agent, and can be carried out by allowing the oxidizing agent to act on an oligonucleic acid derivative supported on a solid phase carrier. When converting a phosphite group to a phosphate group, the "oxidizing agent" can be, for example, iodine, a peracid such as tert-butyl hydroperoxide or hydrogen peroxide, (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO), or a mixture of two or more of these. The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.005 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include pyridine, THF, water, acetonitrile, and any mixture of two or more of these solvents. For example, iodine / water / pyridine / acetonitrile, iodine / water / pyridine, iodine / water / pyridine / acetonitrile / NMI, iodine / water / pyridine / THF, iodine / water / pyridine / THF / NMI, CSO / acetonitrile, iodine / pyridine-acetic acid, or a peracid (tert-butyl hydroperoxide / methylene chloride) can be used.

[0063] When converting a phosphite triester group to a thiophosphate group, examples of the "oxidizing agent" that can be used include sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylidene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS). The oxidizing agent can be diluted with an appropriate solvent to a concentration of 0.01 to 2 M before use. The solvent used in the reaction is not particularly limited as long as it is inert to the reaction, and examples include dichloromethane, acetonitrile, pyridine, and any mixture thereof. The oxidation step may be performed after the capping step, or conversely, the capping step may be performed after the oxidation step, and the order is not limited.

[0064] In the step of deprotecting the phosphate protecting group, after the synthesis of a nucleic acid having a desired sequence is completed, an amine is reacted to deprotect the protecting group of the phosphate moiety, such as diethylamine described in Japanese Patent No. 4705716.

[0065] The protecting group for the 5' hydroxyl group of the nucleoside introduced at the end of elongation may be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, and the protecting group for the 5' hydroxyl group may be deprotected after column purification.

[0066] Furthermore, the oligonucleotide chain is cleaved and recovered from the solid support using aqueous ammonia or amines, for example, as shown in the above Scheme 2. Examples of amines include methylamine, ethylamine, propylamine, isopropylamine, ethylenediamine, and diethylamine.

[0067] Nucleic acid oligomers that can be produced using the production method of the present invention include, but are not limited to, nucleic acid oligomers in which the nucleosides contained therein are RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. Examples of various nucleosides include those described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558.

[0068] Typical examples of nucleic acid oligomers that can be used in the production method of the present invention are shown below in addition to the examples described in the Examples, but are not limited to these. In the following explanation of the sequences, U represents uridine, C represents cytidine, A represents adenosine, or G represents guanosine. Examples include nucleic acid oligomers having the following sequences (B) and (C), which are described in International Publication No. 2019 / 060442. Sequence (B): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (Antisense) (SEQ ID NO: 3) 21mer Sequence (C): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmdTdT-3' (Sense) (SEQ ID NO: 4) 21mer In sequences (B) and (C), Um represents 2'-O-methyluridine, Cm represents 2'-O-methylcytidine, and dT represents thymidine. Examples include the nucleic acid oligomer described in Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 (see page 553). A typical example is a nucleic acid oligomer having the following sequence (D): Sequence (D): 5'-AGAGCCAGCCUUCUUAUUGUUUUAGAGCUAUGCUGU-3' (SEQ ID NO: 5) 36mer Examples include the nucleic acid oligomer described in Japanese Patent No. 4965745. A typical example is a nucleic acid oligomer having the following sequence (E): Sequence (E): 5'-CCAUGAGAAGUAUGACAACAGCC-P-GGCUGUUGUCAUACUUCUCAUGGUU-3' 49mer. CCAUGAGAAGUAUGACAACAGCC (SEQ ID NO: 6), GGCUGUUGUCAUACUUCUCAUGGUU (SEQ ID NO: 7). In sequence (E), "P" is represented by the partial structure separated by a wavy line in formula (A5) below. An example is a nucleic acid oligomer having the following sequence (F), which is described in Nucleic Acids Research, 2019, Vol. 47, No. 2: 547. Sequence (F): 5'-ACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU-3' (SEQ ID NO: 8) 67mer An example is a nucleic acid oligomer having the following sequence (G), which is described on page 173 of JP 2015-523856. array( G ): 5'-GUUUUCCCUUUUCAAAGAAAUCUCCUGGGCACCUAUCUUCUUAGGUGCCCUCCCUUGUUUAAACCUGACCAGUUAACCGGCUGGUUAGGUUUUU-3' (SEQ ID NO: 9) 94mer Examples include the nucleic acid oligomers described in JP 2017-537626. Typical examples include nucleic acid oligomers having the following sequences (F), (G), (H), and (J). Sequence (F): 5'-AGUCCUCAUCUCCCUCAAGCGUUUUAGAGCUAGUAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU-3' (SEQ ID NO: 10) 100mer Sequence (G): 5'-GCAGAUGUAGUGUUUCCACAGUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU-3' (SEQ ID NO: 11) 113mer Sequence (H): 5'-dAdGdTdCdCdTdCdAdTdCdTdCdCdCdTdCdAdAdGdCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU -3' (SEQ ID NO: 12) 113mer In sequence (H), dT represents thymidine, dC represents 2'-deoxycytidine, dA represents 2'-deoxyadenosine, and dG represents 2'-deoxyguanosine. Sequence (J): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUAAGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUmsUmsU-3' (SEQ ID NO: 13) 113mer In sequence (J), Um represents 2'-O-methyluridine, Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents a phosphorothioate modification. [Example]

[0069] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0070] Measurement method The measurement methods used in the following tests are shown below.

[0071] (Measurement Method 1: Method for Measuring Oligonucleotide Purity) The purity of the crude oligonucleotide product after solid-phase synthesis was measured by HPLC. The crude product was separated into its components by HPLC (wavelength 260 nm, column ACQUITY UPLC Oligonucleotide BEH C18, 2.1 mm × 100 mm, 1.7 μm), and the purity of the oligonucleotide was calculated from the area of the main product in the total area of the resulting chromatogram.

[0072] The HPLC measurement conditions are shown in Table 1 below. [Table 1]

[0073] (Measurement Method 2: Measurement of Oligonucleotide Yield) The OD of the crude product 260 The OD was measured. 260represents the absorbance of UV260nm per 10mm path length in 1mL solution (pH=7.5). It is generally known that 1OD = 40μg for RNA. 260 The yield was calculated based on the measured values. Furthermore, the yield per unit volume of the solid phase carrier was calculated. For Examples 1 to 5 and Comparative Examples 1 and 2, the relative yield to the yield of Example 1 was determined.

[0074] (Measurement method 3: Oxygen concentration measurement) The oxygen concentration in the atmosphere (gas phase) of the reaction system was measured using a PACK KEEPER (Residual Oxygen Meter) manufactured by IIJIMA ELECTRONICS CORP. Before measuring the oxygen concentration, the device was calibrated by measuring the oxygen concentrations in air and pure nitrogen, and then the needle attached to the device was inserted into a container such as a flask capped with a septum, and the oxygen concentration in the gas phase of the system was measured. The measured oxygen concentration was displayed in real time, and the point at which the measured value stabilized was considered to be the oxygen concentration of the atmosphere.

[0075] (Measurement Method 4: Measurement of Enzymatic Degradation Products of Oligonucleotides) The enzymatic degradation products of the crude oligonucleotide products after solid-phase synthesis were measured by HPLC. The degradation products were separated into their respective components by HPLC (wavelength 260 nm, column Develisil ODS-UG-5, 4.6 mm × 250 mm, 5 μm), and the HPLC area percentage values of adenosine shown in formula (A15) and adenosine cyanoethyl adduct shown in formula (A16) were calculated based on the total area value of the resulting chromatogram. Hereinafter, "HPLC area percentage value" means "HPLC area percentage value."

[0076] The HPLC measurement conditions are shown in Table 2 below. [Table 2]

[0077] The structural formulae of adenosine and adenosine cyanoethyl adduct, which are components detected by HPLC after enzymatic decomposition of the oligomer, are shown in formula (A15) and formula (A16), respectively.

[0078] [ka]

[0079] (Enzymatic decomposition method) The method for enzymatic decomposition of oligonucleotides is described below. 83 μL of crude oligonucleotide solution adjusted to a concentration of 0.5 mg / mL was placed in a 2 mL vial, and 2 μL of 0.2 unit / μL Nuclease P (Penicillium citrinum) solution was added. The mixture was then incubated in a 60°C incubator for 2 hours. 10 μL of 10x Alkaline Phosphatase (Calf Intestinal) Buffer and 5 μL of Alkaline Phosphatase (Calf Intestinal) were then added, and the mixture was incubated in a 56°C incubator for 2 hours.

[0080] As a result of enzymatic degradation of the oligonucleotide, the content of adenosine cyanoethyl adduct, an impurity contained in the oligomer, was calculated from the HPLC area percentage values of formula (A15) and formula (A16) detected by HPLC analysis described in Measurement Method 4. The calculation method is shown below. [d] = [a] × ([a] + [b]) × 100 × [c] In the above formula, [a] represents the HPLC area percentage value of formula (A16) detected by the HPLC analysis described in Measurement Method 4, [b] represents the HPLC area percentage value of formula (A15) detected by the HPLC analysis described in Measurement Method 4, [c] represents the number of adenosines contained in the target oligonucleotide, and [d] represents the content of adenosine cyanoethyl adducts, which are impurities contained in the oligomer, based on the HPLC area percentage values of formula (A15) and formula (A16) detected by the HPLC analysis described in Measurement Method 4.

[0081] Solid-phase synthesis of oligonucleotides Sequence (I): 5'-AGCAGAGUACACACAGCAUAUACC-P-GGUAUAUGCUGUGUGUACUCUGCUUC-PG-3' (SEQ ID NOs: 1 and 2) 53mer In the sequence (I), "A" is represented by the partial structure separated by a wavy line in the following formula (A1). "C" is represented by the partial structure separated by a wavy line in the following formula (A2). "G" is represented by the partial structure separated by a wavy line in the following formula (A3). ”U” is represented by the partial structure separated by a wavy line in the following formula (A4). "P" is represented by the partial structure separated by a wavy line in the following formula (A5). "A" at the 5'-end is represented by the partial structure separated by a wavy line in the following formula (A6). Furthermore, "G" at the 3'-end is represented by the partial structure separated by a wavy line in the following formula (A7). However, the phosphate group in the structural formula may be a salt. AGCAGAGUAC ACACAGCAUA UACC (SEQ ID NO: 1) GGUAUAUGCU GUGUGUACUC UGCUUC (SEQ ID NO: 2)

[0082] [ka]

[0083] [ka]

[0084] [ka]

[0085] [ka]

[0086] [ka]

[0087] [ka]

[0088] [ka]

[0089] Oligonucleotides consisting of the above sequence (I) were synthesized from the 3' to 5' ends by phosphoramidite solid-phase synthesis using controlled pore glass (CPG) as the solid support and an AKTA oligopilot plus 100 (GE Healthcare) as the nucleic acid synthesizer. The synthesis was carried out on a 77.89 μmol scale. The synthesis also included the uridine EMM amidite (A11) described in Example 2 of U.S. Patent Publication No. 2012 / 0035246, the cytidine EMM amidite (A9) described in Example 3, the adenosine EMM amidite (A8) described in Example 4, the guanosine EMM amidite (A10) described in Example 5, the compound (A12) described in WO 2017 / 188042, and the N-terminus EMM amidite described in Example 9 of Japanese Patent Publication No. 5157168. 6 -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)adenosine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite (A15), N as described in Example 8 2 -acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)guanosine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A17), N as described in Example 5 4The following reagents were used: 5'-O-acetyl-5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)cytidine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A16) and 5'-O-(4,4'-dimethoxytrityl)-2'-O-(2-cyanoethoxymethyl)uridine 3'-O-(2-cyanoethyl N,N-diisopropylphosphoramidite) (A18) described in Example 2; high-purity trichloroacetic acid in toluene as the deblocking solution; 5-benzylmercapto-1H-tetrazole as the condensing agent; iodine solution as the oxidizing agent; and phenoxyacetic anhydride and N-methylimidazole solutions as the capping solutions. After nucleic acid elongation, the cyanoethyl protecting groups on the phosphate moieties were selectively deprotected by applying diethylamine solution to the nucleic acid on the support.

[0090] [ka]

[0091] [ka]

[0092] [ka]

[0093] [ka]

[0094] [ka]

[0095] [ka]

[0096] [ka]

[0097] [ka]

[0098] [ka]

[0099] Next, specific examples of oligonucleotides (nucleic acid oligomers) produced by the method of the present invention will be described. In the following examples, the oligonucleotides produced by the method of the present invention are oligonucleotides having the sequence (I) shown in SEQ ID NOs: 1 and 2. Furthermore, the guanosine derivatives described in the following examples and comparative examples refer to compounds represented by the following structural formula: The circle illustrated in the following structural formula is a schematic representation of CPG. [ka]

[0100] Example 1 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.53 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was then placed in the flask, and the flask was sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 0% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.13 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KD Scientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 13.0 mg, with a purity of 58%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0101] Example 2 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. 0.98 μmol of the solution was collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced through the septum. The system was purged with argon by flowing argon, resulting in a 5% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 0.76 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (13.2 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KD Scientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.3 mg, with a purity of 54%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0102] Example 3 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.00 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 10% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 0.74 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KD Scientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.4 mg, with a purity of 49%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0103] Example 4 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.00 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 15% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 0.75 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.9 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KD Scientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.4 mg, with a purity of 46%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0104] (Reference example 1) Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.51 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The oxygen concentration in the gas phase was measured by piercing the septum with an oxygen meter needle and finding a value of 21%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.09 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.4 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KDScientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 13.0 mg, and the purity was 45%. The purity of the resulting crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0105] Example 5 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.53 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was then placed in the flask, and the flask was sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced through the septum. The system was replaced with argon by flowing argon, bringing the oxygen concentration in the gas phase to 0%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.13 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.5 mg, with a purity of 48%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0106] Example 6 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.53 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was then placed in the flask, and the flask was sealed with a 29 mm diameter septum. The system was then pierced with a needle for blowing argon from an argon cylinder, a needle for removing the blown argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 5% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.14 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.5 mg, with a purity of 46%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0107] Example 7 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.50 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The system was then pierced with a needle for blowing argon from an argon cylinder, a needle for removing the blown argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 10% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.14 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (13.0 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.4 mg, with a purity of 45%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0108] Example 8 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.50 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced through the septum. The system was purged with argon by flowing argon, resulting in a 15% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.11 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.3 mg, with a purity of 44%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0109] (Reference example 2) Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.51 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The oxygen concentration in the gas phase was measured by piercing the septum with an oxygen meter needle and finding a value of 21%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.10 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.5 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KDScientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.3 mg, with a purity of 43%. The purity of the resulting crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0110] (Reference example 3) Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.51 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The oxygen concentration in the gas phase was measured using an oxygen meter needle piercing the septum, which was 21%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.10 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.5 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute using a syringe. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.3 mg, with a purity of 43%. The purity of the resulting crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above.

[0111] Example 9 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) using an AKTA oligopilot plus 100. Subsequently, the CPG support loaded with 30.06 μmol of oligonucleotide was collected, and the oligonucleotide was released from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.21 g of dimethyl sulfoxide, and then 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 6.04 μmol solution was collected in a 100 mL, 29 mm diameter eggplant-shaped flask, and a 15 mm diameter stir bar and 0.26 g of acetonitrile were added thereto, and then the flask was sealed with a 29 mm diameter septum. Further, a needle for blowing argon from an argon cylinder into the system, a needle for removing the blown argon, and an Oxygen Meter measurement needle were pierced into the septum, and argon was flowed into the system to replace the air with argon, and the oxygen concentration in the gas phase was set to 0%. Here, the oxygen concentration in the gas phase was measured using the method described in the above-mentioned measurement method 3. This solution was further stirred at 0°C under ice cooling for 20 minutes, and a mixture of 4.49 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.8 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A and 0.90 g of acetonitrile was added dropwise to the surface of the oligonucleoside solution over 1 hour at 0°C using a KDScientific syringe pump while stirring with a stirrer. After the addition, the temperature was raised to 33°C, and the mixture was kept at this temperature for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 52.4 mg, and the purity was 58%. The purity of the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1945% and 0.0064%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0112] Example 10 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) using an AKTA oligopilot plus 100. Subsequently, the CPG support loaded with 30.06 μmol of oligonucleotide was collected, and the oligonucleotide was released from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered off, and the filtrate containing the free oligonucleotide was concentrated to dryness. Next, the free oligonucleotide was dissolved in 13.21 g of dimethyl sulfoxide, and then 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. 0.99 μmol of the solution was collected in a 50 mL, 29 mm diameter eggplant-shaped flask, and then a 15 mm diameter stir bar and 0.12 g of acetonitrile were added thereto, and then the flask was sealed with a 29 mm diameter septum. Furthermore, a needle for blowing argon from an argon cylinder into the system, a needle for removing the blown argon, and an Oxygen Meter measurement needle were pierced into the septum, and argon was flowed into the system to replace the air with argon, and the oxygen concentration in the gas phase was set to 0%. Here, the oxygen concentration in the gas phase was measured using the method described in the above-mentioned measurement method 3. This solution was then stirred at 0°C under ice cooling for 20 minutes, dehydrated using molecular sieves 4A, and then ice-cooled. A mixture of 0.81 g of a 1 M tetra-n-butylammonium fluoride (TBAF) solution in dimethyl sulfoxide (TBAF) (14.0 moles per mole of protecting group) and 0.20 g of acetonitrile was poured onto the surface of the oligonucleoside solution using a syringe within 1 minute under stirring at 0°C. After stirring for 1 hour at 0°C, the temperature was raised to 33°C, and the mixture was incubated for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.5 mg, with a purity of 58%. The purity of the resulting crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1150% and 0.0052%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0113] Example 11 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. 0.99 μmol of the solution was collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter measurement needle were pierced into the septum, and argon was flowed into the system to replace the air with argon, bringing the oxygen concentration in the gas phase to 0%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. This solution was then stirred at 10°C for 20 minutes, dehydrated using molecular sieves 4A, and cooled to 10°C. A mixture of 0.77 g of a 1 M tetra-n-butylammonium fluoride (TBAF) dimethyl sulfoxide solution (the amount of TBAF was 13.2 moles per mole of protecting group) and 0.18 g of acetonitrile was then poured onto the surface of the oligonucleoside solution using a syringe within 1 minute at 10°C while stirring with a stirrer. After stirring at 10°C for 1 hour, the temperature was raised to 33°C, and the mixture was then incubated for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.5 mg, and the purity was 58%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1972% and 0.0056%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0114] Example 12 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.00 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 0% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. The solution was then stirred at 20°C for 20 minutes, dehydrated using molecular sieves 4A, and then 0.82 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (14.0 moles per mole of protecting group) adjusted to 20°C was poured onto the surface of the oligonucleoside solution using a syringe within 1 minute while stirring at 20°C. After stirring for 1 hour at 20°C, the temperature was raised to 33°C, and the mixture was then incubated for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.2 mg and the purity was 57%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.3364% and 0.0246%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0115] Example 13 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. 1.03 μmol of the solution was collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced into the septum. The system was replaced with argon by flowing argon, bringing the oxygen concentration in the gas phase to 0%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. This solution was then stirred at 25°C for 20 minutes, dehydrated using molecular sieves 4A, and then 0.77 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (the amount of TBAF was 12.8 moles per mole of protecting group) adjusted to 25°C was poured onto the surface of the oligonucleoside solution using a syringe within 1 minute while stirring at 25°C. After stirring for 1 hour at 25°C, the temperature was raised to 33°C, and the mixture was incubated for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 8.4 mg and the purity was 56%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1564% and 0.0351%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0116] Example 14 Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.53 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was then placed in the flask, and the flask was sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 0% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.13 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was added dropwise to the surface of the oligonucleoside solution at 33°C over 1 hour using a KD Scientific syringe pump while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 13.0 mg, with a purity of 58%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1401% and 0.0245%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0117] (Reference example 4) Solid-phase synthesis of sequence (I) was performed using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A8), formula (A9), formula (A10), formula (A11), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.06 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.03 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.47 g of acetonitrile were added to the solution. A 1.55 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. The system was then pierced with a needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle. The system was then purged with argon by flowing argon, resulting in a 0% oxygen concentration in the gas phase. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. The solution was then stirred at 33°C, and 1.14 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution using a syringe within 1 minute while stirring. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-EMM protecting group. The crude product was obtained by precipitation. The yield was 13.2 mg, with a purity of 54%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.1927% and 0.1252%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0118] Example 15 Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. 5.94 μmol of the solution was collected in a 100 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was added, and the flask was then sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced into the septum. The system was replaced with argon by flowing argon, bringing the oxygen concentration in the gas phase to 0%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 4.48 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (13.0 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 25°C with stirring within 1 minute using a syringe. The mixture was then incubated at 25°C for 1 hour, then heated to 33°C and maintained at that temperature for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 52.0 mg, with a purity of 50%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.4413% and 0.0253%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0119] (Reference example 5) Solid-phase synthesis of sequence (I) was carried out using 77.89 μmol of guanosine derivative-loaded CPG and the amidites shown in formula (A15), formula (A16), formula (A17), formula (A18), or formula (A12) on an AKTA oligopilot plus 100. Subsequently, 30.04 μmol of oligonucleotide-loaded CPG support was collected, and the oligonucleotides were liberated from the solid support using 10.17 g of aqueous ammonia and 3.06 g of ethanol. The support was then filtered, and the filtrate containing the free oligonucleotide was concentrated to dryness. The free oligonucleotide was then dissolved in 13.21 g of dimethyl sulfoxide, and 0.22 g of nitromethane and 2.42 g of acetonitrile were added to the solution. A 1.53 μmol solution was then collected in a 50 mL, 29 mm diameter eggplant-shaped flask. A 15 mm diameter stir bar was then placed in the flask, and the flask was sealed with a 29 mm diameter septum. A needle for spraying argon from an argon cylinder, a needle for removing the sprayed argon, and an oxygen meter needle were pierced through the septum. The system was replaced with argon by flowing argon, bringing the oxygen concentration in the gas phase to 0%. The oxygen concentration in the gas phase was measured using the method described in Measurement Method 3 above. Furthermore, 1.13 g of a 1 M dimethyl sulfoxide solution of tetra-n-butylammonium fluoride (TBAF) (12.7 moles of TBAF per mole of protecting group) that had been dehydrated using molecular sieves 4A was poured onto the surface of the oligonucleoside solution at 33°C with stirring within 1 minute. The mixture was then incubated at 33°C for 4 hours to deprotect the 2'-cyanoethoxymethoxy (CEM) protecting group. The crude product was obtained by precipitation. The yield was 13.5 mg, with a purity of 48%. The purity of the oligonucleotide in the obtained crude product was measured using the method described in Measurement Method 1 above, and the yield of the oligonucleotide was measured using the method described in Measurement Method 2 above. GoThe nucleotides were decomposed using the method described in the enzymatic decomposition method, and the HPLC area percentage values of formula (A15) and formula (A16) were obtained as 31.3067% and 0.0395%, respectively, using the method described in Measurement Method 4. Since the number of adenosines in the target oligonucleotide was 13, the impurity contents were calculated using the above formula and are shown in Table 4.

[0120] The measurement results are shown in Table 3 below. [Table 3]

[0121] [Table 4]

[0122] As shown in Table 2 above, when the deprotection reaction of the protecting group of the ribose hydroxyl group contained in the oligonucleotide described in the specification was carried out in an inert gas atmosphere with an oxygen concentration of 15% or less, the deprotection reaction proceeded more efficiently than when the reaction was carried out at an oxygen concentration higher than 15%. Furthermore, by contacting with TBAF at a temperature of 25°C or less in the reaction system, the deprotection reaction proceeded more efficiently than when contacting with TBAF at a temperature higher than 25°C. Furthermore, by adding TBAF for 30 minutes or more, the deprotection reaction proceeded more efficiently than when added for 1 minute or less, and as a result, the purity of the resulting deprotected oligonucleotide was found to be higher. [Industrial Applicability]

[0123] The present invention provides an efficient method for producing a nucleic acid oligomer, which is expected to improve the purity of the nucleic acid oligomer produced by the method. [Sequence List Free Text]

[0124] SEQ ID NOs: 1 to 13 in the sequence listing represent the base sequences of oligonucleotides produced according to the production method of the present invention.

Claims

1. In an inert gas atmosphere having an oxygen concentration of 15% or less, a reaction mixture of the formula (3): 【Chemical 1】 (In the formula, G ４ represents a protecting group for a hydrogen atom or a hydroxyl group, G ９ represents an ammonium ion, an alkylammonium ion, an alkali metal ion, a hydrogen ion, or a hydroxyalkylammonium ion, B ｃ each independently represents the same or different nucleobase, R are independently the same or different and each represent a hydrogen atom, a fluorine atom, or an OQ group; Q are each independently the same or different and represent a tert-butyldimethylsilyl group, a methyl group, a 2-methoxyethyl group, a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position of ribose, an ethylidene group bonded to the carbon atom at the 4' position of ribose, or a group represented by formula (1): 【Chemistry 2】 (In the formula, The bond marked with * indicates a bond with the oxygen atom of the OQ group. n represents an integer of 0 or more. represents a protecting group of the formula Y's are independently the same or different and represent an oxygen atom or a sulfur atom; m represents an integer of 2 to 200; W and X are defined as either (a) or (b) below: (a) When W is a hydroxyl group, X has the same definition as the R group above. (b) when X is a hydroxyl group, W represents an OV group; V represents a tert-butyldimethylsilyl group or a group of the formula (1). However, at least one group among the R, W, and X represents a hydroxyl group protected by a protecting group of the formula (1). When m is an integer of 3 or greater, the nucleic acid oligomer represented by formula (3) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer satisfying the formula: m-1>p) between the 5'-terminal and 3'-terminal nucleotides. A nucleic acid oligomer represented by formula (4): 【Chemistry 3】 (In the formula, each R' is independently the same or different and represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group; Q' are independently the same or different and represent a methylene group bonded to the carbon atom at 4' position of ribose, an ethylene group bonded to the carbon atom at 4' position, or an ethylidene group bonded to the carbon atom at 4' position of ribose, Substituent G in formula (4) ４ , G ９ , Y, B ｃ and m are defined as in the formula (3). W ０ is a hydroxyl group, X ０ has the same definition as the R' group above. When m is an integer of 3 or greater, the nucleic acid oligomer represented by formula (4) is a nucleic acid oligomer in which a non-nucleotide linker may be incorporated in place of p nucleotides (where p is a positive integer that satisfies the formula: m-1>p) between each of the 5'-terminal and 3'-terminal nucleotides. A method for producing a nucleic acid oligomer represented by the formula:

2. The method according to claim 1, wherein n in formula (1) is 0 or 1.

3. The method according to claim 1, wherein n in formula (1) is 0.

4. The method according to claim 1, wherein n in formula (1) is 1.

5. The method according to any one of claims 1 to 4, wherein the non-nucleotide linker is a linker comprising an amino acid backbone.

6. The method according to claim 5, wherein the linker comprising an amino acid skeleton has a structure represented by the following formula (A14-1), (A14-2), or (A14-3): 【Chemistry 4】 (In the formula, 5' and 3' represent the 5'-end and 3'-end of the nucleic acid oligomer, respectively.)

7. W is a hydroxyl group, X is an R group, and W ０ is a hydroxyl group, and X ０ The method according to any one of claims 1 to 6, wherein is an R' group.

8. The method according to any one of claims 1 to 7, wherein the fluoride ion source is a tetraalkylammonium fluoride.

9. The method according to any one of claims 1 to 8, wherein the fluoride ion source is tetra-n-butylammonium fluoride (TBAF).

10. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 10% or less.

11. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 5% or less.

12. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 4% or less.

13. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 3% or less.

14. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 2% or less.

15. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 1% or less.

16. The method according to any one of claims 1 to 9, wherein the contact with fluoride ions is carried out in an inert gas atmosphere having an oxygen concentration of 0%.

17. The method according to any one of claims 1 to 16, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 25°C or lower.

18. The method according to any one of claims 1 to 16, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 20°C or lower.

19. The method according to any one of claims 1 to 16, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 15°C or lower.

20. The method according to any one of claims 1 to 16, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 10°C or lower.

21. The method according to any one of claims 1 to 16, wherein the temperature in the reaction system when the nucleic acid oligomer represented by formula (3) is brought into contact with fluoride ions is 5°C or lower.

22. The method according to any one of claims 1 to 16, wherein the time required for contacting the nucleic acid oligomer represented by formula (3) with the total amount of fluoride ions is 30 minutes or more.

23. The method according to any one of claims 1 to 16, wherein the time required for contacting the nucleic acid oligomer represented by formula (3) with the total amount of fluoride ions is 1 hour or more.

24. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 10% or more, and the nucleic acid chain length is 10 or more.

25. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 20% or more, and the nucleic acid chain length is 10 or more.

26. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 30% or more, and the nucleic acid chain length is 10 or more.

27. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 40% or more, and the nucleic acid chain length is 10 or more.

28. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 50% or more, and the nucleic acid chain length is 10 or more.

29. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 60% or more, and the nucleic acid chain length is 10 or more.

30. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 70% or more, and the nucleic acid chain length is 10 or more.

31. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 80% or more, and the nucleic acid chain length is 10 or more.

32. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 90% or more, and the nucleic acid chain length is 10 or more.

33. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 95% or more, and the nucleic acid chain length is 10 or more.

34. The method according to any one of claims 1 to 23, wherein the ratio of the protecting group of formula (1) among R, W, and X of the nucleic acid oligomer represented by formula (3) is 100%, and the nucleic acid chain length is 10 or more chain lengths.

35. The method according to any one of claims 1 to 34, wherein the nucleic acid chain length is 20 or more chain lengths.

36. The method according to any one of claims 1 to 34, wherein the nucleic acid chain length is 30 or more chain lengths.

37. The method according to any one of claims 1 to 34, wherein the nucleic acid chain length is 40 or more chain lengths.

38. The method according to any one of claims 1 to 34, wherein the nucleic acid chain length is 50 or more chain lengths.

Images