Nucleic Acid Concentration and Detection
The pyrophosphorolysis-based hybridization method addresses inefficiencies in NGS by selectively enriching low-frequency variants, improving detection sensitivity and reducing sequencing reads, thus overcoming the limitations of current hybridization capture methods.
Patent Information
- Application Number
- JP2023564030
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-08-06
- Filing Date
- 2022-04-15
- Publication Date
- 2025-10-27
- Estimated Expiration
- 2042-04-15
AI Technical Summary
Current hybridization capture methods for next-generation sequencing (NGS) are inefficient in enriching low-frequency variants due to the majority of sequencing reads coming from wild-type molecules, leading to high costs and difficulty in detecting rare variants below 0.1%, while modified library preparation methods reduce sensitivity.
A pyrophosphorolysis-based hybridization method that utilizes probes with differential complementarity to selectively enrich or deplete nucleic acid molecules, allowing for efficient enrichment of low-frequency variants by pyrophosphorolysis reactions.
Enhances the detection of low-frequency variants by reducing sequencing reads and improving specificity, enabling detection of variants below the current NGS limit through selective enrichment.
Smart Images

Figure 0007760607000003 
Figure 0007760607000004 
Figure 0007760607000005
Abstract
Description
[Technical Field]
[0001] This application claims priority to UK Patent Application Nos. 2105405.1 filed April 15, 2021, 2105388.9 filed April 15, 2021, and 2111381.6 filed August 6, 2021, the disclosures of which are incorporated herein by reference in their entireties.
[0002] Sequence Listing The text of the computer readable sequence listing submitted herewith, entitled "40018-601_SEQUENCE_LISTING_ST25", created on April 15, 2022, with a file size of 15,464 bytes, is incorporated herein by reference in its entirety. [Background technology]
[0003] Targeted detection of low-frequency variants in a pool of wild-type molecules is clinically important for early cancer detection, cancer progression monitoring, cancer therapy targeting, noninvasive prenatal testing, monitoring T cell populations targeting specific (neo)antigens, and early warning of organ transplant rejection. Hybridization capture combined with next-generation sequencing (NGS) is the most commonly applied method for targeted and multiplexed detection of low-frequency variants, but it has several suboptimal characteristics. Generally, hybridization capture enriches for the target region of interest but not for variant molecules. This results in the majority of sequencing reads coming from wild-type molecules rather than variant molecules. This is wasteful, costly, and makes it difficult to detect rare variants against a background of errors from storage, library preparation, and sequencing. This results in NGS with insufficient specificity for routine detection of variants below approximately 0.1%. Modified library preparation methods (e.g., duplex sequencing) can increase specificity and enable accurate sequencing data to be obtained from single molecules. Unfortunately, methods such as dual sequencing (e.g., by modifying library preparation methods to avoid end repair and by intentionally imposing molecular bottlenecks) also reduce sensitivity. The methods described herein enable enrichment of variant molecules located within a target region of interest, for example, using a modified hybridization capture method based on pyrophosphorolysis (PPL). This both reduces the number of sequencing reads required but opens the door to multiplexed detection of low-frequency variant molecules that are below the current detection limit of NGS. Summary of the Invention
[0004] In some embodiments, provided herein are pyrophosphorolysis-based hybridization methods that take advantage of the double-stranded specificity of pyrophosphorolysis, a reaction that does not proceed efficiently with single-stranded oligonucleotide substrates or double-stranded substrates that contain nucleotide mismatch blocking groups.
[0005] For example, in some embodiments, provided herein are methods that include contacting a sample (e.g., containing two or more different nucleic acid molecules) with a probe and a pyrophosphorolysis reagent, and enriching or depleting a first nucleic acid molecule relative to a second nucleic acid molecule based on the different complementarities of the probe to the first and second nucleic acid molecules, resulting in different levels of pyrophosphorolysis of the probe when hybridized to the first and second nucleic acid molecules.
[0006] For example, in some embodiments, the method includes enriching or depleting a first nucleic acid molecule in a sample containing a mixture of nucleic acid molecules by contacting the first nucleic acid molecule with a probe that has a different complementarity to a target region on the first nucleic acid molecule compared to other nucleic acid molecules in the sample; performing a pyrophosphorolysis reaction; and enriching or depleting the first nucleic acid molecule. In some embodiments, the probe is more complementary to the target region of the first nucleic acid molecule than it is to the corresponding target region of a second nucleic acid in the sample. In some embodiments, the probe is less complementary to the target region of the first nucleic acid molecule than it is to the corresponding target region of the second nucleic acid in the sample. In some embodiments, the first and second nucleic acids differ by sequence variation (e.g., point mutation, deletion, insertion, multi-nucleotide change, fusion, etc.). In some embodiments, the probe comprises a sequence that is fully complementary to the target region of the larger complementary sequence and has one or more mismatches to sequence variations found in the corresponding target region of the smaller complementary sequence. In some embodiments, the probe contains one or more mismatches to the target region of both the first and second nucleic acid molecules, but contains more mismatches to the target region of the less complementary nucleic acid. In particular, the probe is designed to undergo a different degree of pyrophosphorolysis when the probe hybridizes to the first nucleic acid compared to the second nucleic acid, allowing for selective enrichment or depletion of the first nucleic acid relative to the second nucleic acid based on the different reaction products generated by pyrophosphorolysis.
[0007] For example, in some embodiments, provided herein are methods for increasing or decreasing the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the methods comprising: a) exposing a sample containing the first and second nucleic acid sequences to probes that differ in complementarity to the first and second nucleic acid sequences; b) performing a pyrophosphorolysis reaction; and c) enriching or depleting the first nucleic acid sequence relative to the second nucleic acid sequence.
[0008] In some embodiments of the invention, there is provided a method for increasing the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the sample comprising at least a first and a second sequence, the method comprising the steps of: a. A sample containing one or more nucleic acid analytes i. introducing into a first reaction mixture a single-stranded probe oligonucleotide A0 having differential complementarity to a first and a second nucleic acid sequence (e.g., the 3' end of the probe is perfectly complementary to one of the first or second sequences but imperfectly complementary to the other); b. The reaction mixture produced by step (a) is ii. pyrophosphorolytic enzyme; and iii. introducing into a second reaction mixture comprising a source of pyrophosphate ions, A0 anneals (e.g., completely) to one of the nucleic acid sequences, 0( a step in which one of the sequences (e.g., the 3' end of A0) forms a double-stranded complex with the sequence, generating an at least partially double-stranded intermediate product in which A0 is pyrophosphorolyzed in the 3'-5' direction from its 3' end, and A0 that is less perfectly (e.g., incompletely) annealed to the other sequence is pyrophosphorolyzed to a lesser extent in the 3'-5' direction due to its less perfect (e.g., incomplete) annealing; c. Separating more fully (e.g., completely) annealed A0 sequence complexes by: iv. separating (e.g., melt-separating) the strands of the complex as a result of pyrophosphorolysis; or v. dissociating the reaction mixture by heating to a temperature sufficient to separate (e.g., melt-separate) the strands of the complex, but lower than the temperature required for any A strands to be less completely annealed (e.g., incompletely) to separate (e.g., melt and separate); and d. Separating A0, and thus any nucleic acid sequences that remain annealed to it, from any nucleic acid sequences that are not annealed to A0.
[0009] The probe may be provided with one or more components that are removed before or during the pyrophosphorolysis reaction. For example, a non-complementary flap or other blocking group may be provided at the 3' end of the probe that prevents pyrophosphorolysis or initiation of the polymerase reaction until the blocking group is removed. The blocking group may be removed by any suitable mechanism (e.g., enzymatic cleavage, chemical reaction, temperature shift, etc.). The sequence of the probe that provides differential pyrophosphorolysis products when hybridized to different nucleic acid molecules may be located at any suitable position in the initial probe. For example, a mismatch sequence may be located at the 3'-most base at the 3' end of the probe. A mismatch sequence may be located internally at the 3' end of the probe. A mismatch sequence may be located in the center of the probe. A mismatch sequence may be located within the 5' half of the probe.
[0010] The 5' end of the probe may include a region (e.g., a 5' tail) that acts as an identifier (e.g., a sample identifier). Such a sequence may be used, for example, to selectively pull down captured molecules from a specific sample or specific region one by one from a mixed sample. Such an identifier may find particular use in multiplexed regions where multiple different targets are reacted in the same sample or the same reaction vessel.
[0011] The analytes / sequences to which the methods of the present invention can be applied are nucleic acids, such as natural or synthetic DNA or RNA molecules, that contain the target polynucleotide sequence(s) being sought. In some embodiments, the analyte / sequence is typically present in an aqueous solution containing it and other biological material, and in some embodiments, the analyte / sequence is present along with other background nucleic acid molecules that are not of interest for testing purposes. In some embodiments, the analyte / sequence is present in small amounts relative to these other nucleic acid components. Preferably, for example, if the analyte is derived from a biological specimen containing cellular material, some or all of these other nucleic acids and unrelated biological material will have been removed using sample preparation techniques (e.g., filtration, centrifugation, chromatography, or electrophoresis) before performing step (i) of the method.
[0012] The compositions and methods of the present invention can be used with any type of sample, including, but not limited to, environmental (e.g., water, soil, air, etc.) samples and biological samples. Biological samples can be from any source, including plants, animals, infectious pathogens, etc. Suitably, in some embodiments, the analytes / sequences are derived from biological samples collected from mammalian subjects (particularly human patients), such as blood, plasma, sputum, urine, skin, biopsy, or surgical resection. In some embodiments, the biological sample is subjected to lysis to release the analytes / sequences by disrupting any cells present. In other embodiments, the analytes / sequences may already be present in a free form within the sample itself, such as, for example, cell-free DNA circulating in blood or plasma.
[0013] The compositions and methods of the present invention find particular application with historically challenging sample types where the allelic fraction of the analyte of interest may be low, including blood, urine, cytosponge-collected samples (e.g., esophageal samples), bronchoalveolar lavage (BAL)-derived samples, pleural effusions, and cerebrospinal fluid (CSF).
[0014] In some embodiments, the sample is a pooled sample. Pooled samples involve mixing multiple samples in a batch where the pooled collection is tested. This approach increases the number of individual samples that can be tested using more limited resources. Pooled samples of interest include, but are not limited to, donated blood samples, agricultural samples, food samples, sperm samples, and biological samples tested for the presence of infectious pathogens (e.g., SARS-CoV-2, HIV, HCV, etc.). In some embodiments, pooled samples are environmentally collected samples (e.g., wastewater samples) that, by the nature of their generation, have pooled samples from multiple different sources. Pooling samples may reduce the allelic fraction of variants as samples dilute with each other, but can result in a dramatic increase in screening efficiency. The techniques provided herein are particularly well-suited for analyzing pooled samples, as they enable detection at very low allelic fractions. In some embodiments, fractions of each initial sample are pooled and the pooled sample is tested without the use of barcodes or other complex preparation steps. If a positive result is obtained, the remaining fraction of the unpooled sample can be tested individually.
[0015] Also provided herein are compositions (e.g., reagents, kits, reaction mixtures, equipment, software) that find use with the methods described herein. For example, in some embodiments, provided herein are compositions comprising one or more reagents necessary, sufficient, or useful for carrying out the methods described herein. For example, in some embodiments, the composition comprises: one or more oligonucleotides A0, where A0 comprises a sequence (e.g., 3' end) that is differentially complementary to a known first sequence and a known second sequence (e.g., perfectly complementary to the known first sequence but imperfectly complementary to the known second sequence); one or more pyrophosphorolytic enzymes; and one or more sources of pyrophosphate ions. In some embodiments, the composition further comprises a target nucleic acid isolation component that separates target nucleic acid molecules that are more fully (e.g., perfectly) complementary to the probe (e.g., the 3' end of the probe) from nucleic acid molecules that are less fully (e.g., imperfectly) complementary to the probe (e.g., the 3' end of the probe) after the pyrophosphorolysis reaction. In some embodiments, the composition comprises one or more solid supports. In some embodiments, the composition comprises one or more buffers. In some embodiments, A0 comprises a 5' tail region that is not complementary to either the known first sequence or the known second sequence. In some embodiments, A0 further comprises a capture moiety. In some embodiments, the composition further comprises one or more capture oligonucleotides C0 comprising a capture moiety, wherein the 5' tail region of A0 is complementary to a region of C0. In some embodiments, the capture moiety is biotin and the solid support comprises streptavidin. In some embodiments, the solid support comprises a capture oligonucleotide C0, wherein the 5' tail region of A0 is complementary to a region of C0. In some embodiments, the solid support is a bead (e.g., a magnetic bead or a paramagnetic bead). In some embodiments, the composition further comprises one or more epigenetic modification-sensitive or -dependent restriction enzymes. In some embodiments, the composition further comprises one or more restriction endonucleases. In some embodiments, the composition further comprises one or more transposomes. In some embodiments, the composition comprises a Cas protein (e.g., Cas9).In some embodiments, the composition further comprises one or more transposases. In some embodiments, the composition further comprises one or more ligases. In some embodiments, the composition further comprises one or more blocking oligonucleotides. In some embodiments, the one or more blocking oligonucleotides are resistant to pyrophosphorolysis. In some embodiments, the composition further comprises reagents for performing an amplification (e.g., PCR), sequencing (e.g., next-generation sequencing), or detection reaction. In some embodiments, the composition further comprises one or more molecular probes. In some embodiments, the one or more molecular probes are fluorescently labeled. In some embodiments, A0 (e.g., the 3' end of A0) is more complementary (e.g., perfectly complementary) to a wild-type sequence in the human genome and less complementary (e.g., incompletely complementary) to a mutant allele of the wild-type sequence. In some embodiments, A0 (e.g., the 3' end of A0) is less complementary (e.g., incompletely complementary) to a wild-type sequence in the human genome and more complementary (e.g., perfectly complementary) to a mutant allele of the wild-type sequence. In some embodiments, the composition further comprises components for transcription of RNA into cDNA.
[0016] In some embodiments, the composition is a reaction mixture comprising a reaction at a particular time point of any of the methods described herein. In some embodiments, the reaction mixture is present before pyrophosphorolysis. In some embodiments, the reaction mixture is present during pyrophosphorolysis. In some embodiments, the reaction mixture is present after pyrophosphorolysis. In some embodiments, the reaction mixture comprises a probe / nucleic acid hybridization complex of the methods described herein. In some embodiments, the reaction mixture comprises a captured nucleic acid molecule of the methods described herein. In some embodiments, the reaction mixture comprises a region containing a higher or lower concentration of the desired target nucleic acid than the concentration of the desired target nucleic acid present in the sample that underwent the pyrophosphorolysis reaction. For example, in some embodiments, provided herein is a reaction mixture comprising: a sample; a pyrophosphorolysis reagent at a pyrophosphorolysis concentration (i.e., a reagent concentration that favors pyrophosphorolysis); a first nucleic acid molecule from the sample hybridized to a probe having a sequence, where the identifier region of the probe is complementary to the first nucleic acid molecule; and a second nucleic acid molecule from the sample hybridized to a probe having the sequence, where the identifier region of the probe is not perfectly complementary to the second nucleic acid molecule. In some embodiments, provided herein is a reaction mixture comprising: a sample; a pyrophosphorolysis reagent at a pyrophosphorolysis concentration; and a first nucleic acid molecule in a first region of the reaction mixture, where the nucleic acid molecule has a concentration in the first region that is higher or lower than the concentration of the first nucleic acid in the sample.
[0017] Uses of the compositions (e.g., use of kits, use of reaction mixtures, use of reagents, use of instruments, use of software) are also provided herein, e.g., use of the compositions to enrich or deplete target nucleic acids in a sample.
[0018] In some embodiments, provided herein are devices and instruments that find use in the methods described herein. In some embodiments, the devices and instruments find use in collecting and distributing samples to reaction vessels. In some embodiments, the devices and instruments provide a reaction chamber for carrying out the methods. In some embodiments, the devices and instruments provide multiple zones or regions (e.g., wells, channels, etc.) for containing reactants and / or for isolating enriched desired target nucleic acids or for depleting desired target nucleic acids. In some embodiments, the devices and instruments find use in amplifying or sequencing nucleic acid molecules. In some embodiments, the devices and instruments find use in detecting nucleic acid molecules. In some embodiments, the devices and instruments find use in receiving or transmitting information from a user. For example, the devices and instruments can include a user interface for receiving user instructions and a display for visually presenting results to a user.
[0019] In some embodiments, a computing device is provided herein. The computing device finds use in controlling an instrument or apparatus to facilitate the methods described herein. In some embodiments, the computing device collects, analyzes, and reports data. In some embodiments, the computing device comprises one or more processors that execute computer programs. In some embodiments, the computing device includes a non-transitory computer-readable medium (e.g., software) that includes instructions that direct the processor to perform one or more computing steps. [Brief explanation of the drawings]
[0020] [Figure 1]
[0023] Figure 1 is a schematic diagram of one embodiment of the present invention in which biotinylated probes are pre-bound to streptavidin-coated paramagnetic beads. The bead-bound probes are then hybridized to target DNA and subjected to pyrophosphorolysis. In this example, the bead-bound probes are perfectly complementary to the wild-type sequence and imperfectly complementary / mismatched to the variant sequence. The probe hybridized to the wild-type sequence is pyrophosphorolyzed, releasing the wild-type DNA from the beads into solution, while the probe hybridized to the variant sequence is mismatched and therefore not pyrophosphorolyzed to the same extent as the wild-type sequence, leaving the variant sequence bound to the beads. The variant sequence can then be identified, in one example, by sequencing. [Figure 2] 1 is a schematic diagram of one embodiment of the present invention, in which a biotinylated probe is hybridized to target DNA, subjected to pyrophosphorolysis, and then captured on streptavidin paramagnetic beads. In this example, the probe is perfectly complementary to the wild-type sequence and imperfectly complementary / mismatched to the variant sequence. The probe hybridized to the wild-type sequence is pyrophosphorolyzed, and the wild-type DNA is released from the probe, while the probe hybridized to the mismatched variant is not pyrophosphorolyzed to the same extent as the wild-type sequence, and therefore the variant sequence remains probe-bound. The probe is then captured on streptavidin paramagnetic beads, with only the variant sequence being bead-bound. The variant sequence can then be identified, in one example, by sequencing. [Figure 3] 1 is a schematic diagram of one embodiment of the present invention according to that described in FIG. 1, in which the target DNA undergoes adapter tagging and amplification by PCR prior to hybridization of the probe with the target DNA. After hybridization, the probe undergoes pyrophosphorolysis, leaving the adapter-tagged variant sequences bound to the beads. The bead-bound variants are then amplified by PCR. [Figure 4]This shows pyrophosphorolysis-dependent release of target molecules. The lower the Cq value, the more target sequence was released from the beads into the supernatant. The Cq value was lower for target sequences that were perfectly complementary to the enrichment probe when the pyrophosphorolysis reaction was performed, indicating that the desired target was released from the beads. There was no difference in the Cq value of mismatched target sequences, regardless of whether pyrophosphorolysis was performed. This indicates that the mismatched target remained on the beads and was not released into the supernatant. [Figure 5] EGFR exon 20 T790M variant. The graph shows PPi-dependent detection of T790M. Increasing the temperature of the hybridization step to 60°C recovers more T790M variant molecules. Increasing the temperature of the hybridization step to 60°C reduces the recovery of WT (wild-type) molecules. Under the given conditions, 0.2 fM of T790M variant molecules can be detected. [Figure 6] EGFR exon 20 T790M variant at different mutant allele fractions (VAF). PPi-dependent detection as low as 0.1% VAF is shown. In Figure 6A, the graph shows T790M variants from 0-50% VAF. In Figure 6B, detection at 0.1% VAF is expanded. [Figure 7] Effect of hybridization buffer and hybridization time on the detection of the EGFR exon 20 T790M variant at 0.1% VAF. In this particular experiment, 1 hour of hybridization is not sufficient to detect the variant of interest. The best performance when using a 3 hour hybridization step is achieved with Buffer 2 (see Example 3). [Figure 8] Figure 1 shows the enrichment factor of the EGFR exon 20 T790M variant. The graph shows the enrichment factor of 0.1 and 1% VAF and its dependence on which buffer is used during the hybridization step. The increase in enrichment factor depends on the presence of PPi. The highest enrichment factors are achieved with buffer 2 and buffer 5 (see Example 3). DETAILED DESCRIPTION OF THE INVENTION
[0021] In some embodiments, the method uses pyrophosphorolysis as a method for enriching or depleting desired nucleic acid sequences. The pyrophosphorolysis reaction relies on complementarity between hybridized strands and therefore digests only strands, regardless of whether they contain mismatches. This reaction selectively shortens specific sequences that are complementary, while leaving mismatched sequences less digestible. The reaction can be performed so that molecules hybridized to the shortened sequences are recovered and analyzed. Alternatively, the reaction can be performed so that shorter sequences are analyzed. Alternatively, the reaction can be performed so that sequences that have not undergone any pyrophosphorolysis are analyzed.
[0022] Enrichment or depletion can be repeated one or more times to further enrich a sample for a sequence of interest. For example, in some embodiments, a first round is completed using the same reagents as the first round, followed by a second round of enrichment or depletion. In other embodiments, different probes selective for different sequences of the target nucleic acid to be enriched or removed are used. This approach is particularly well-suited when the sequence to be enriched or depleted differs from the sequence to be removed by at least two base positions. For example, a target nucleic acid containing two polymorphisms compared to the wild-type may undergo a first round of enrichment or depletion based on the first polymorphism and a second round of enrichment or depletion based on the second polymorphism. Exponential levels of enrichment or depletion can be achieved by using multiple rounds. In some embodiments, the target nucleic acid is modified to generate a synthetic sequence (e.g., by adding a polymorphism) prior to enrichment or depletion, such that the synthetic sequence is targeted for enrichment or depletion compared to a sequence that does not contain the synthetic sequence. In some embodiments, more than one nucleic acid can be enriched or depleted in any given reaction round by using multiple probes. In some embodiments, a specific nucleic acid can be enriched while a second nucleic acid can be depleted in one or more reactions.
[0023] In one aspect of the invention, there is provided a method for altering the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the sample comprising at least a first and a second sequence, the method comprising the steps of: a. A sample containing one or more nucleic acid analytes i. a single-stranded probe oligonucleotide A0, wherein the probe is differentially complementary to the first and second sequences (e.g., the 3' end or other region of the probe is perfectly complementary to one of the first or second sequences but imperfectly complementary to the other); ii. pyrophosphorolytic enzyme; and iii. introducing into a first reaction mixture comprising a source of pyrophosphate ions; A step in which A anneals (e.g., perfectly) to a first nucleic acid sequence such that A (e.g., the 3' end of A) forms a double-stranded complex with said sequence, generating an at least partially double-stranded intermediate product in which A is pyrophosphorolyzed in the 3'-5' direction from its 3' end, while A that anneals less well (e.g., incompletely) to a second sequence is pyrophosphorolyzed to a lesser extent in the 3'-5' direction due to said less (e.g., incomplete) annealing; b. selectively denaturing any truncated A0 sequence complexes that anneal better (e.g., completely) to the first sequence; and c. Separating A0, and thus the second nucleic acid sequence that remains annealed to A0, from the first nucleic acid sequence that is not annealed to A0, thereby changing the ratio of the first nucleic acid sequence to the second nucleic acid sequence.
[0024] In one aspect of the invention, there is provided a method for increasing the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the sample comprising at least a first and a second sequence, the method comprising the steps of: a. A sample containing one or more nucleic acid analytes is subjected to one of the following: i. introducing a probe (e.g., the 3' end or other region of the probe) into a first reaction mixture containing a single-stranded probe oligonucleotide A0 that is more complementary (e.g., perfectly complementary) to one of a first or second sequence but less complementary (e.g., incompletely complementary) to the other; b. Reconstituting the reaction mixture produced by step (a) with one of the following: ii. pyrophosphorolytic enzyme; and iii. introducing into a second reaction mixture comprising a source of pyrophosphate ions, A0 anneals (e.g., completely) to one of the nucleic acid sequences, such that A0 (e.g., the 3' end of A0) forms a double-stranded complex with said sequence, generating an at least partially double-stranded intermediate product in which A0 is pyrophosphorolyzed in the 3'-5' direction from its 3' end, and A0 that is less completely (e.g., incompletely) annealed to the other sequence is pyrophosphorolyzed to a lesser extent in the 3'-5' direction due to said less (e.g., incomplete) annealing; c. Separating better (e.g., fully) annealed A0 sequence complexes by: i. separating (e.g., melt-separating) the strands of the complex as a result of pyrophosphorolysis; or ii. dissociating the reaction mixture by heating to a temperature sufficient to separate (e.g., melt-separate) the strands of the complex, but lower than the temperature required for any A strands that are not well annealed (e.g., incompletely) to separate (e.g., melt and separate); and d. Separating A0, and thus any nucleic acid sequences that remain annealed to it, from any nucleic acid sequences that are not annealed to A0.
[0025] In some embodiments, separation of any more (e.g., fully) annealed A0 sequence complexes occurs by using reaction conditions that favor more (e.g., fully) annealed A0 sequence complexes over less (e.g., incompletely) annealed A0 sequence complexes, which can take the form of changing the temperature of the reaction mixture and / or changing the pH of the reaction mixture and / or changing the salinity of the reaction mixture.
[0026] In some embodiments, the first and second reaction mixtures are combined such that the first reaction mixture of step (a) further comprises a pyrophosphatase and a source of pyrophosphate ions.
[0027] In some embodiments, A0 that anneals better (e.g., perfectly) to one of the nucleic acid sequences to form a double-stranded complex is pyrophosphorolyzed to the extent that the double-stranded complex dissociates (e.g., melts), separating the truncated A0 from the nucleic acid sequence. A0 that anneals less well (e.g., incompletely) to the other sequence remains in a double-stranded complex with said sequence.
[0028] In some embodiments, the reaction mixture can be heated to denature, such that double-stranded complexes containing better (e.g., fully) annealed and therefore more completely pyrophosphorolyzed A0 sequences separate (e.g., melt apart), while double-stranded complexes containing less well annealed (e.g., incompletely annealed) and less pyrophosphorolyzed A0 remain double-stranded due to the higher melting temperature of such complexes as a result of the more remaining complementary base pairs.
[0029] In some embodiments, the pH of the reaction mixture can be increased to denature. Thus, double-stranded complexes containing better (e.g., fully) annealed and therefore more completely pyrophosphorolyzed A0 sequences will denature, while duplexes containing less well annealed (e.g., incompletely annealed) and less pyrophosphorolyzed A0 will remain double-stranded because such complexes have more complementary base pairs and require a higher pH to denature.
[0030] In some embodiments, the salt concentration of the reaction mixture is decreased, such that double-stranded complexes containing better (e.g., fully) annealed and therefore more completely pyrophosphorolyzed A0 sequences are denatured, while double-stranded complexes containing less well annealed (e.g., incompletely annealed) and less pyrophosphorolyzed A0 remain double-stranded because such complexes have more complementary base pairs and require even lower salt concentrations to denature.
[0031] In some embodiments, chemical agents (eg, dimethyl sulfoxide (DMSO), formamide, etc.) are used to denature nucleic acids to facilitate concentration or depletion.
[0032] In some embodiments, the nucleic acid molecule (displacement oligonucleotide) and the enzyme or protein use separate hybridized nucleic acid molecules.
[0033] In some embodiments, two or more of the following characteristics of the reaction mixture are altered so that separation of double-stranded complexes containing better (e.g., perfectly) annealed A0 sequences occurs, while double-stranded complexes containing less well-annealed (e.g., incompletely annealed) A0 sequences remain hybridized: - pH of the reaction mixture; - temperature of the reaction mixture; - salt concentration of the reaction mixture; -Addition of chemical denaturants.
[0034] In some embodiments, capture of A0 onto a solid support is performed before or after step (a). In some embodiments, separation in step (d) is performed by capturing A0 onto a solid support before or after step (a).
[0035] In some embodiments, A0 further comprises a 5' tail region that is not complementary to any of the sequences.
[0036] In some embodiments, two probes are used, one for the forward strand of the target and one for the reverse strand. In some embodiments, it is beneficial to design the probes so that they do not hybridize to each other to form constructs that can undergo pyrophosphorolysis (e.g., they have 3' overhangs when hybridized to each other).
[0037] In some embodiments, capture onto a solid support is achieved by hybridization of the 5' tail region of A0 to another oligo, C0, which contains a capture moiety through which it is bound to the solid support either before or after hybridization with A0.
[0038] In some embodiments, A0 further comprises a capture moiety through which it binds to a solid support.
[0039] In some embodiments, the capture moiety is biotin and the solid support comprises streptavidin.
[0040] In some embodiments, A0 is extended in a reaction with a biotinylated nucleotide for subsequent capture.
[0041] In some embodiments, a diphosphohydrolase enzyme (e.g., apyrase) is provided in a method or composition of the invention. The diphosphohydrolase enzyme hydrolyzes nucleotides released from the pyrophosphorolysis reaction and maintains optimal pyrophosphorolysis reaction conditions.
[0042] In some embodiments, an inorganic pyrophosphatase enzyme is provided in a method or composition of the invention. The inorganic pyrophosphatase removes pyrophosphate ions after pyrophosphorolysis and before subsequent steps in which the presence of pyrophosphate ions may be undesirable or suboptimal.
[0043] This technique is not limited to the use of capture to separate or concentrate nucleic acid molecules of interest. Molecules can be separated or concentrated based on differences in size, charge, or shape, or other physical or chemical properties. In some embodiments, a moiety is added to the nucleic acid of interest (e.g., via click chemistry modification), thereby conferring selectable distinguishing properties to the nucleic acid of interest.
[0044] In some embodiments, the solid support is a bead.
[0045] In some embodiments, the beads are magnetic or paramagnetic beads.
[0046] In some embodiments, one or more washing steps are performed between one or more steps.
[0047] In some embodiments, the washing and hybridization steps are carried out at elevated temperatures between 25 and 95°C.
[0048] In some embodiments, the sample is an adaptor-tagged library of nucleic acid analytes.
[0049] In some embodiments, following step (d), either nucleic acids that remain annealed to A0 or nucleic acids that are not annealed to A0 are identified.
[0050] In some embodiments, the sequences are identified by an amplification reaction (e.g., polymerase chain reaction (PCR), nucleic acid sequence-based amplification (NASBA), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), nicking and extension amplification reaction (NEAR), etc.).
[0051] In some embodiments, the sequence is identified by isothermal identification.
[0052] In some embodiments, the sequence is identified by PCR.
[0053] In some embodiments, the sequences are identified by microarray analysis.
[0054] In some embodiments, the sequence is identified by sequencing.
[0055] In some embodiments, the sequence is identified by next generation sequencing (NGS) (e.g., bridge amplification sequencing (Illumina), SMRT sequencing (PacBio), Ion Torrent sequencing, nanopore sequencing, pyrosequencing, etc.).
[0056] In some embodiments, multiple different probe oligonucleotides A0 are used, each having a different sequence (e.g., 3' end sequence) designed to anneal (e.g., anneal perfectly) to a different target sequence, and the concentrations of the multiple target sequences are simultaneously increased relative to the non-target sequences.
[0057] In some embodiments, the different probe oligonucleotide A0 has a sequence (e.g., a 3' terminal sequence) that anneals (e.g., perfectly anneals) to a sequence in the human genome that contains a genetic variant associated with the presence, treatment, or monitoring of a disease.
[0058] In some embodiments, after step (d), the presence or absence of said genetic variant in the sample analyte is inferred by identification of the nucleic acid sequence that anneals to A0 and is then released, thereby inferring the presence or absence of disease.
[0059] In some embodiments, after step (d), the presence or absence of said genetic variant in the sample analyte is inferred by identification of the nucleic acid sequence that anneals to A and is subsequently released, thereby inferring appropriate treatment for the disease.
[0060] In some embodiments, after step (d), the presence or absence of said genetic variant in the sample analyte is inferred by identification of the nucleic acid sequence that anneals to A and is subsequently released, thereby inferring the patient's response to a particular disease treatment.
[0061] In some embodiments, after step (d), the presence or absence of said genetic variant in the sample analyte is inferred by identification of the nucleic acid sequence that anneals to and is subsequently released from A0, and one or more patient treatment decisions are made based on the presence or absence of said genetic variant.
[0062] In some embodiments, the sample is a human blood or tissue sample.
[0063] In some embodiments, the disease is cancer.
[0064] In some embodiments, the cancer is lung cancer.
[0065] In some embodiments, one or more hybridization steps are performed between one or more steps.
[0066] In some embodiments, the nucleic acid being analyzed is a methylated sequence or is derived from a methylated sequence. This technique is used to distinguish the methylation state at any specific position or positions within a target nucleic acid. Methylated sequences can be first modified using chemical treatment (e.g., oxidation, reduction, bisulfite treatment), or by exposure to a methylation-dependent restriction enzyme or any other suitable approach, followed by enrichment and / or identification of modified sequences.
[0067] In some embodiments, the nucleic acid sequences present in the sample are bisulfite treated prior to step (a) of the method.
[0068] In some embodiments, the nucleic acid sequences present in the sample are bisulfite treated after step (a) of the method.
[0069] In some embodiments, nucleic acid sequences present in the sample are enzymatically treated to convert cytosines to uracils prior to step (a) of the method.
[0070] In some embodiments, the nucleic acid sequences present in the sample are enzymatically treated to convert cytosines to uracils after step (a) of the method.
[0071] In some embodiments, the nucleic acid sequences present in the sample are exposed to an epigenetic-dependent / sensitive restriction enzyme prior to step (a) of the method.
[0072] In some embodiments, the nucleic acid sequences present in the sample are exposed to an epigenetic-dependent / sensitive restriction enzyme after step (a) of the method.
[0073] In some embodiments, the target region of RNA present in the sample is transcribed into DNA prior to step (a) of the method.
[0074] In some embodiments, the target region of RNA present in the sample is transcribed into DNA after step (a) of the method.
[0075] In some embodiments, a method for capturing a target nucleic acid sequence of interest from a sample comprising at least a first and a second sequence comprises the steps of: a. A sample containing one or more nucleic acid analytes i. introducing into a first reaction mixture the probe comprising a single-stranded probe oligonucleotide A0, the probe comprising a sequence (e.g., at the 3' end or elsewhere) that is complementary (e.g., perfectly complementary) to one of the first or second sequences but less complementary (e.g., imperfectly complementary) to the other; b. Reconstituting the reaction mixture produced by step (a) with one of the following: i. pyrophosphorolytic enzyme; and ii. introducing into a second reaction mixture containing a source of pyrophosphate ions, A step in which A0 anneals (e.g., perfectly anneals) to one of the nucleic acid sequences, such that A0 (e.g., the 3' end of A0) forms a double-stranded complex with said sequence, generating an at least partially double-stranded intermediate product in which A0 is pyrophosphorolyzed in the 3'-5' direction from its 3' end, and A0 that is less well (e.g., imperfectly) anneals to the other sequence and is pyrophosphorolyzed to a lesser extent in the 3'-5' direction due to its less well (e.g., incomplete) annealing; c. Separating the annealed (e.g., fully annealed) A0 sequence complexes by: i. separating (e.g., melt-separating) the strands of the complex as a result of pyrophosphorolysis; or ii. dissociating the reaction mixture by heating to a temperature sufficient to separate (e.g., melt-separate) the strands of the complex, but lower than the temperature required for any strands of A0 that are not well (e.g., incompletely) annealed to separate (e.g., melt and separate); and d. Separating A0, and thus any nucleic acid sequences that remain annealed to it, from any nucleic acid sequences that are not annealed to A0.
[0076] In some embodiments, the solid support is a polymer and / or resin-coated solid surface.
[0077] In some embodiments, the solid support is a polystyrene solid support.
[0078] In some embodiments, n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, Polystyrene (C8H8), a polymer, wherein n is 11,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or n is any integer between any of these points, or n is within any range derivable between any two of these points. n is used.
[0079] In some embodiments, the polystyrene solid support is a particle, a microparticle, a magnetic bead, a magnetic microparticle, a paramagnetic bead, a paramagnetic microparticle, a resin, or any microparticle including a polystyrene polymer.
[0080] In some embodiments, the polystyrene support is modified to include one or more of the following functional groups: amine, carboxylate, sulfonate, trimethylamine, and / or epoxide.
[0081] In some embodiments, the solid support is a magnetic or paramagnetic bead.
[0082] In some embodiments, the magnetic or paramagnetic beads are shaped to maximize the surface area of the beads.
[0083] In some embodiments, the magnetic or paramagnetic beads are regularly shaped.
[0084] In some embodiments, the magnetic or paramagnetic beads are irregularly shaped.
[0085] In some embodiments, the magnetic or paramagnetic beads have a diameter of less than or equal to 1000 microns, 900 microns, 800 microns, 700 microns, 600 microns, 500 microns, 400 microns, 300 microns, 200 microns, 100 microns, 90 microns, 80 microns, 70 microns, 60 microns, 50 microns, 40 microns, 30 microns, 20 microns, 10 microns, 5 microns, 2.5 microns, 1 micron, 0.5 microns, 0.25 microns, or 0.1 microns.
[0086] In some embodiments, the solid support is a magnetic or paramagnetic polystyrene bead.
[0087] In some embodiments, the magnetic or paramagnetic polystyrene beads comprise iron oxide.
[0088] In some embodiments, the magnetic or paramagnetic polystyrene beads are streptavidin-linked.
[0089] In some embodiments, the solid support is streptavidin-conjugated Dynabeads (RTM).
[0090] In some embodiments, the solid support is a dextran-modified surface.
[0091] In some embodiments, the dextran-modified surface is a particle, a microparticle, a magnetic or paramagnetic bead, a resin, or any particle including a dextran polymer.
[0092] In some embodiments, the dextran polymer has an approximate molecular weight of 1,000 to 410,000.
[0093] In some embodiments, the dextran polymer has an approximate molecular weight of 25,000 to about 100,000.
[0094] In some embodiments, the modified dextran surface is further modified to include one or more functional groups.
[0095] In some embodiments, the dextran-modified surface is modified to include one or more of the following functional groups: amine, carboxylate, sulfonate, trimethylamine, and / or epoxide.
[0096] In some embodiments, the solid support is a magnetic or paramagnetic bead.
[0097] In some embodiments, the magnetic or paramagnetic beads are shaped to maximize the surface area of the beads.
[0098] In some embodiments, the magnetic or paramagnetic beads are regularly shaped.
[0099] In some embodiments, the magnetic or paramagnetic beads are irregularly shaped.
[0100] In some embodiments, the magnetic or paramagnetic beads have a diameter of less than or equal to 1000 microns, 900 microns, 800 microns, 700 microns, 600 microns, 500 microns, 400 microns, 300 microns, 200 microns, 100 microns, 90 microns, 80 microns, 70 microns, 60 microns, 50 microns, 40 microns, 30 microns, 20 microns, 10 microns, 5 microns, 2.5 microns, 1 micron, 0.5 microns, 0.25 microns, or 0.1 microns.
[0101] In some embodiments, the magnetic or paramagnetic beads are dextran magnetic beads selected from Nanomag® Dextran (ND); Nanomag® Dextran-SO3H (ND-SO3H); BioMag® Dextran Coated Charcoal; or BioMag® Plus Dextran.
[0102] In some embodiments, the solid support is a polyethylene glycol (PEG) or PEG-modified surface.
[0103] In some embodiments, the polyethylene glycol (PEG) or PEG-modified surface is a particle, microparticle, magnetic or paramagnetic bead, resin, or any particle that includes PEG.
[0104] In some embodiments of the invention, n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, PEG, (CHO) is a polymer in which n is 0, 11,000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or n is any integer between any of these points, or n is in any range derivable between any two of these points. n is used.
[0105] In some embodiments, the PEG utilized is PEG-200, PEG-300, PEG-400, PEG-600, PEG-1000, PEG-1300-1600, PEG-1450, PEG-3000-3700, PEG-3500, PEG-6000, PEG-8000, or PEG-17500.
[0106] In some embodiments where the polyethylene glycol (PEG) or PEG-modified surface is a magnetic or paramagnetic microparticle or bead, the microparticle or bead is selected from Nanomag® PEG-300 (Plain) or Nanomag®-D.
[0107] In some embodiments, the solid support is polyvinylpyrrolidone (PVP) or a PVP-modified surface.
[0108] In some embodiments, the PVP or PVP-modified surface is a particle, microparticle, magnetic or paramagnetic bead, resin or any particle comprising PVP.
[0109] In some embodiments of the invention, n is 10, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,250, 1,500, 1,750, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, 10,000, 11, 000, 12,000, 12,500, 15,000, 16,000, 17,000, 17,500, 18,000, 19,000, 20,000, 25,000, 30,000, 40,000, 50,000, 60,000, 70,000, 80,000, 90,000, 100,000 or more, or where n is any integer between any of these points, or where n is any range derivable between any two of these points, PVP, n-vinylpyrrolidone is utilized.
[0110] In some embodiments, the solid support is a polysaccharide or a polysaccharide-modified surface.
[0111] In some embodiments, the polysaccharide or polysaccharide-modified surface is a particle, microparticle, magnetic or paramagnetic bead, resin or any particle comprising a polysaccharide.
[0112] In some embodiments, the polysaccharide is selected from one or more of dextran, ficoll, glycogen, gum arabic, xanthan gum, carrageenan, amylose, agar, amylopectin, xylan, and / or beta-glucan.
[0113] In some embodiments, the solid support is a chemical resin or a chemical resin-modified surface.
[0114] In some embodiments, the chemical resin or chemical resin-modified surface is selected from one or more of the following resins: isocyanate, glycerol, piperidino-methyl, polyDMAP (polymer-bound dimethyl 4-aminopyridine), DIPAM (diisopropylaminomethyl), aminomethyl, polystyrene aldehyde, tris(2-aminomethyl)amine, morpholino-methyl, BOBA (3-benzyloxybenzaldehyde), triphenyl-phosphine, or benzylthiomethyl.
[0115] In some embodiments, the capture moiety is covalently attached to the solid support via a chemically cleavable linker, for example, a disulfide, allyl, or azide-masked hemiaminal ether linker.
[0116] In some embodiments, the capture moiety is covalently attached to the solid support via an amide bond or a phosphorothioate bond.
[0117] Those skilled in the art will appreciate that numerous techniques exist for covalently and non-covalently immobilizing oligonucleotides to solid supports; see, for example, "Strategies for Attaching Oligonucleotides to Solid Supports" (2014) prepared by Integrated DNA Technologies (IDT®).
[0118] In some embodiments, the capture moiety comprises an oligonucleotide sequence and the solid support comprises an oligonucleotide having a complementary sequence.
[0119] In some embodiments, the oligonucleotide sequence contains one or more modified bases to alter the melting temperature and / or other such modifications known to those of skill in the art.
[0120] In some embodiments, the presence of one or more modified bases and / or other such modifications known to those of skill in the art results in a decrease in the melting temperature.
[0121] In some embodiments, the presence of one or more modified bases and / or other such modifications known to those of skill in the art results in an increase in the melting temperature.
[0122] In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50, 100, 150 and 200 bases.
[0123] In some embodiments, the length of the complementary sequence is between 10, 20, 30, 40, 50 and 100 bases.
[0124] In some embodiments, the length of the complementary sequence is 10 to 20, 10 to 30, 10 to 40, and 10 to 50 bases.
[0125] In some embodiments, the length of the complementary sequence is 10 to 20, 10 to 30, and 10 to 40 bases.
[0126] In some embodiments, the length of the complementary sequence is 10-20 and 10-30 bases.
[0127] In some embodiments, the length of the complementary sequence is 10 to 20 bases.
[0128] In some embodiments, the capture moiety comprises a chemical modification and is attached to the solid support via an interaction between the chemical modification and the solid support.
[0129] In some embodiments, the chemical modification is biotin and the solid support further comprises streptavidin.
[0130] In some embodiments, the captured oligonucleotide sequences are released from the solid support.
[0131] In some embodiments, the captured oligonucleotide sequences are released from the solid support by chemical modification.
[0132] In some embodiments, chemical modification is achieved by the use of an appropriate concentration of base.
[0133] In some embodiments, 0.1 M NaOH can be used.
[0134] In some embodiments, the oligonucleotide sequences are released from the solid support by cleavage of the chemical linker by the addition of tris(2-carboxyethyl)phosphine (TCEP) or dithiothreitol (DTT) for disulfide linkers; palladium complex or allyl linkers; or TCEP for azide-masked hemiaminal ether linkers.
[0135] In some embodiments, the oligonucleotide sequence is released from the solid support by removing a non-canonical base from the oligonucleotide sequence and cleaving at the resulting abasic site. In some embodiments, the non-canonical base is uracil, which is removed by uracil DNA glycosylase. In an alternative embodiment, the non-canonical base is 8-oxoguanine, which is removed by formamidopyrimidine DNA glycosylase (Fpg).
[0136] In some embodiments, the capture moiety is an oligonucleotide region and the release is achieved by heating the reaction mixture.
[0137] In some embodiments, the reaction mixture is heated to between 37° C. and 100° C. for 1 to 20 minutes.
[0138] In some embodiments, the reaction mixture is heated for 1 to 15 minutes.
[0139] In some embodiments, the reaction mixture is heated for 1 to 10 minutes.
[0140] In some embodiments, the reaction mixture is heated for 1 to 5 minutes.
[0141] In some embodiments, the reaction mixture is heated for 5 minutes.
[0142] In some embodiments, the reaction mixture is heated to between 37°C and 85°C.
[0143] In some embodiments, the reaction mixture is heated to between 37°C and 75°C.
[0144] In some embodiments, the reaction mixture is heated to between 37°C and 65°C.
[0145] In some embodiments, the reaction mixture is heated to between 37°C and 55°C.
[0146] In some embodiments, the reaction mixture is heated to between 37°C and 45°C.
[0147] Those skilled in the art will understand that the temperature to which the reaction mixture is heated to cause release of the complementary oligonucleotide regions will depend on the length of said regions.
[0148] In some embodiments, release is achieved by cleavage of one or more oligonucleotide sequences, which can be achieved by any of the means described above or below, or by any means known to those of skill in the art.
[0149] In some embodiments, the oligonucleotide sequence is chemically cleaved.
[0150] In some embodiments, the oligonucleotide sequence is enzymatically cleaved.
[0151] In some embodiments, the oligonucleotide sequence is cleaved by a restriction enzyme.
[0152] In some embodiments, the oligonucleotide sequence is cleaved by an epigenetic modification-sensitive or -dependent restriction enzyme.
[0153] In some embodiments, the oligonucleotide sequence is cleaved by a methylation-sensitive or methylation-dependent restriction enzyme.
[0154] In some embodiments, the oligonucleotide sequence is cleaved by a methylation-sensitive or hydroxymethylation-dependent restriction enzyme.
[0155] In some embodiments, before or after enrichment of variant or wild-type sequences, the sequences are enzymatically or chemically converted to allow for detection of their methylation state. Those skilled in the art will understand that the term "enrichment" refers to the selective isolation of target sequences from a mixture of target and non-target sequences, as described above or below.
[0156] In some embodiments, the restriction enzyme is an endonuclease.
[0157] In some embodiments, the oligonucleotide sequence is cleaved by a flap endonuclease.
[0158] In some embodiments, the oligonucleotide sequence comprises a photocleavable linker, and the oligonucleotide sequence is released from the solid support by cleavage of the linker.
[0159] In some embodiments, the oligonucleotide sequence is released from the solid support by cleavage of the linker.
[0160] In some embodiments, digestion continues until A lacks sufficient complementarity with the sequence for pyrophosphorolysis enzyme to bind or for the pyrophosphorolysis reaction to continue. This typically occurs when 6 to 20 complementary nucleotides remain between the sequence and the probe. In some embodiments, this occurs when 6 to 40 complementary nucleotides remain.
[0161] Without being bound by theory, there are several different ways in which the pyrophosphorolysis reaction can be terminated in addition to those described above or elsewhere.
[0162] If pyrophosphorylase has the ability to "read ahead," digestion can terminate 3' of the mismatch or base modification. Such activity has been observed in archaeal DNA polymerases.
[0163] In some embodiments, the pyrophosphorolysis reaction may be abolished due to the presence of modifications in the backbone of A0.
[0164] The modification can be a modified base. The base can be resistant to pyrophosphorolysis.
[0165] The modification may be a chemical backbone modification.
[0166] In some embodiments, the pyrophosphorolysis reaction may stop due to the presence of a mismatch at A. The location of this mismatch may be intentionally designed so that digestion stops at this defined point.
[0167] In some embodiments, the temperature of the reaction mixture can be increased to heat inactivate the pyrophosphorylase, hi some embodiments, the temperature is increased to melt apart the probe-target duplex.
[0168] In some embodiments, any reagent that can cause inactivation of pyrophosphatase can be added to the reaction mixture.
[0169] In some embodiments, the pH concentration can be modified to inactivate the pyrophosphatase.
[0170] In some embodiments, the salt concentration can be modified to inactivate the pyrophosphatase.
[0171] In some embodiments, the detergent concentration can be modified to inactivate the pyrophosphatase.
[0172] In some embodiments, ion concentrations can be altered to inactivate pyrophosphatase.
[0173] Those skilled in the art will appreciate that there are many additional ways in which enzyme-catalyzed reactions can be stopped, and the above disclosure is not intended to limit the scope of the present invention.
[0174] Suitably, pyrophosphorolysis is carried out in a reaction medium in the presence of a polymerase exhibiting at least pyrophosphorolytic activity and a source of pyrophosphate ions at a temperature in the range of 20 to 90° C. Further information regarding the pyrophosphorolysis reaction as applied to the digestion of polynucleotides can be found, for example, in J. Biol. Chem. 244 (1969) pp. 3019-3028.
[0175] In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess of a polypyrophosphate source, a suitable source including compounds containing three or more phosphorus atoms.
[0176] In some embodiments, the pyrophosphorolysis step is driven by the presence of an excess source of modified pyrophosphate. Suitable modified pyrophosphates include those in which other atoms or groups are substituted for the bridging oxygens, or pyrophosphates (or polypyrophosphates) with substitutions or modifying groups on other oxygens. Those skilled in the art will recognize that there are many such examples of modified pyrophosphates suitable for use in the present invention, a non-limiting selection of which is as follows: [ka]
[0177] In a preferred embodiment, the pyrophosphate ion source is PNP, PCP, or tripolyphosphate (PPPi).
[0178] Further, non-limiting examples of pyrophosphate ion sources for use in the pyrophosphorolysis step can be found in WO 2014 / 165210 and WO 00 / 49180.
[0179] In some embodiments, the source of excess modified pyrophosphate can be represented as YH, where Y is a compound of the general formula (XO)P(=B)-(ZP(=B)(OX)) n -, where n is an integer from 1 to 4; each Z- is independently selected from -O-, -NH-, or -CH2-; each B is independently either O or S; and each X group is independently selected from -H, -Na, -K, an alkyl, an alkenyl, or a heterocyclic group, with the proviso that when both Z and B correspond to -O- and n is 1, at least one X group is not H.
[0180] In some embodiments, Y has the general formula (XO)P(=B)-(ZP(=B)(OX)) n-, where n is 1, 2, 3, or 4. In another embodiment, the Y group corresponds to the general formula (XO)2P(=O)-ZP(=O)(OH)-, where one of the X groups is -H. In yet another preferred embodiment, Y corresponds to the general formula (XO)2P(=O)-ZP(=O)(OX)-, where at least one of the X groups is selected from methyl, ethyl, allyl, or dimethylallyl.
[0181] In alternative embodiments, Y corresponds to either the general formula (HO)P(=O)-ZP(=O)(OH)- (where Z is either -NH- or -CH) or (XO)P(=O)-ZP(=O)(OX)- (where all X groups are either -Na or -K and Z is either -NH- or -CH-).
[0182] In another embodiment, Y corresponds to the general formula (HO)P(=B)-OP(=B)(OH)-, where each B group is independently either O or S, and at least one is S.
[0183] Specific examples of preferred embodiments of Y include those of the formula (X1-O)(HO)P(=O)-ZP(=O)(O-X2), where Z is O, NH, or CH2, and (a) X1 is γ,γ-dimethylallyl and X2 is -H, or (b) X1 and X2 are both methyl; or (c) X1 and X2 are both ethyl; or (d) X1 is methyl and X2 is ethyl, or vice versa.
[0184] Those skilled in the art will appreciate that there are several techniques that can be used to fragment DNA, including sonication, needle shearing, nebulization, point-sink shearing, passage through a pressure cell (French press), and enzymatic methods.
[0185] In some embodiments, fragmentation is achieved by sonication.
[0186] In some embodiments, a Bioruptor® (Denville, NJ) device can be used.
[0187] In some embodiments, fragmentation is achieved by acoustic shear.
[0188] In some embodiments, a Covaris® instrument (Woburn, Mass.) can be used.
[0189] In some embodiments, fragmentation is achieved by nebulization, which forces the DNA through small holes in a nebulizer unit, forming a fine mist that is collected. Fragment size is determined by the pressure of the gas used to force the DNA through the nebulizer, the speed at which the DNA solution passes through the holes, the viscosity of the solution, and the temperature.
[0190] In some embodiments, fragmentation is achieved by hydrodynamic shear.
[0191] In some embodiments, Hydroshear from Digilab (Marlborough, MA) can be used.
[0192] In some embodiments, fragmentation is achieved by point-sink shearing.
[0193] In some embodiments, fragmentation is achieved by needle shearing.
[0194] In some embodiments, fragmentation is accomplished by use of a French press.
[0195] In some embodiments, fragmentation is achieved by enzymatic fragmentation.
[0196] In some embodiments, fragmentation is achieved by restriction endonuclease digestion.
[0197] In some embodiments, the fragmentation is transposome-mediated fragmentation.
[0198] In some embodiments, fragmentation is achieved by Cas9.
[0199] In some embodiments, fragmentation is achieved by Cas9, as described in U.S. Pat. No. 1,057,7644, which is incorporated by reference in its entirety.
[0200] In some embodiments, one or more different fragmentation techniques can be used.
[0201] In some embodiments, one or more of the same or different fragmentation techniques may be used at one or more different points in the method.
[0202] In some embodiments, fragmentation of sequences and adapter tagging occur at the same time or in the same step of the method, one such example being the Nextera DNA Library Prep Kit by Illumina.
[0203] Those skilled in the art will appreciate that there are multiple techniques that can be used to prepare adaptor-tagged sequences / libraries.
[0204] In some embodiments, after fragmentation, the ends of the nucleic acid can be polished and A-tailed before ligation to one or more adaptors.
[0205] In some embodiments, after fragmentation, the ends of the nucleic acids can be polished and ligated to adapters in a blunt-end ligation reaction.
[0206] In some embodiments, after fragmentation, adaptors are ligated to the single-stranded DNA.
[0207] In some embodiments, after fragmentation, a terminal transferase enzyme is used to add non-template bases to the 3' ends of the fragments to provide sites for priming the fragments to become double-stranded.
[0208] In some embodiments, a topoisomerase can be used in place of a DNA ligase.
[0209] In some embodiments, TOPO cloning can be used to add adapters to the fragmented DNA.
[0210] In some embodiments, after fragmentation, a transposase can be used to add adapter sequences to the nucleic acids.
[0211] In some embodiments, after fragmentation, a standard transposon can be used, but modified to create Y-shaped adapters using oligonucleotide substitution.
[0212] In some embodiments where the sample is an adaptor-tagged library, blocking oligonucleotides are used to prevent cross-hybridization of library molecules (so-called "daisy-chaining").
[0213] In some embodiments, the blocking oligonucleotide is resistant to pyrophosphorolysis, which resistance can be as described above or below.
[0214] If the library is adaptor-tagged and PCR amplified, the double-stranded molecules have strands 5'-adaptor1-insert-adaptor2'-3' and 5'-adaptor2-insert-adaptor1'-3'.
[0215] During hybridization, the 5'-adapter 1-3' sequence on one strand could hybridize to the 5'-adapter 1'-3' sequence on the second strand. Similarly, the 5'-adapter 2'-3' sequence on one strand could hybridize to the 5'-adapter 2-3' sequence on the second strand. These hybridization events can be linked together, generating a so-called "daisy chain" of molecules, including both target and non-target molecules.
[0216] In the context of pyrophosphorolysis, hybridization of 5'-adapter1-3' to 5'-adapter1'-3' or hybridization of 5'-adapter2-3' to 5'-adapter2'-3' both generates a 3' end that can undergo pyrophosphorolysis.
[0217] In this context, pyrophosphorolysis can remove bases from the 3' end of the target molecule, potentially preventing its amplification during PCR. Blocking oligonucleotides are typically used in hybridization capture to mitigate daisy-chaining.
[0218] In the context of the above molecules, these can be sequences complementary to adapter 1' and sequences complementary to adapter 2'. Blocking oligonucleotides can protect against pyrophosphorolysis by the addition of a 3' phosphorothioate linkage or by ensuring that the 3' of the adapter-tagged molecule is non-complementary to the blocking oligonucleotide. In another example, α-thio-dNTPs, which introduce phosphorothioate linkages that inhibit pyrophosphorolysis, can be included in PCR or primer extension reactions prior to pyrophosphorolysis.
[0219] Thus, embodiments are provided in which a blocking oligonucleotide as described above or below is used in the method.
[0220] In some embodiments, the sample comprises one or more blocking oligonucleotides.
[0221] In some embodiments, the first reaction mixture comprises one or more blocking oligonucleotides.
[0222] In some embodiments, the second reaction mixture comprises one or more blocking oligonucleotides.
[0223] In some embodiments, one or more blocking oligonucleotides are introduced into the first reaction mixture prior to step (b).
[0224] In some embodiments, the sequencing of the method is Maxam-Gilbert sequencing.
[0225] In some embodiments, the sequencing of the method is Sanger sequencing.
[0226] In some embodiments, the sequencing of the method is shotgun sequencing.
[0227] In some embodiments, the sequencing of the method is single molecule real-time sequencing.
[0228] In some embodiments, the sequencing of the method is ion semiconductor sequencing.
[0229] In some embodiments, the sequencing of the method is pyrosequencing.
[0230] In some embodiments, the sequencing of the method is sequencing-by-synthesis.
[0231] In some embodiments, the sequencing method is combinatorial probe anchor synthesis (cPAS).
[0232] In some embodiments, the method sequencing is sequencing by ligation.
[0233] In some embodiments, the sequencing of the method is nanopore sequencing.
[0234] In some embodiments, the sequencing method is GenapSys sequencing.
[0235] In some embodiments, the sequencing is next generation sequencing (NGS).
[0236] In some embodiments, a method of screening a patient is provided, comprising use of any of the foregoing or following embodiments of the method to detect the presence or absence of one or more specific nucleic acid sequences in a sample derived from the patient.
[0237] Those skilled in the art will appreciate that such screening is useful for monitoring transplant recipient patients.
[0238] Those skilled in the art will appreciate that such screening is useful for monitoring patients undergoing treatment for one or more conditions whose treatment status can be ascertained by the level of one or more nucleic acid sequences in a patient sample.
[0239] For example, the treatment status of a patient undergoing one or more cancer treatments can be confirmed by the level of one or more nucleic acid sequences and / or the presence and / or absence of one or more specific variants in the patient's blood.The presence and / or absence of high levels of circulating tumor nucleic acid sequences and / or one or more specific variants can be used to predict whether a particular treatment has the desired effect.Therefore, a method for monitoring the success or non-success of a particular treatment is provided, in which such success can be inferred by the presence or absence of specific nucleic acid sequences and / or their respective levels in a sample derived from the patient.
[0240] In some embodiments, methods are provided for monitoring patients in remission to detect disease recurrence.
[0241] In some embodiments, methods are provided for screening nominally healthy people to detect the presence of one or more disease states, including but not limited to cancer.
[0242] In some embodiments, methods are provided for detecting the presence and / or absence of one or more genetic markers in a patient diagnosed with one or more disease states, and using the presence and / or absence of the one or more markers to determine which treatment should be administered.
[0243] In some embodiments, methods are provided for diagnosing and / or monitoring one or more cancers in a patient, comprising use of any of the foregoing or following embodiments of a method for detecting the presence or absence of one or more specific nucleic acid sequences in a sample derived from the patient.
[0244] Those skilled in the art will understand that one or more specific nucleic acid sequences may be specific to an individual (e.g., identified from a tissue biopsy or surgical resection by an identification method such as sequencing), and in such cases, a panel specific to the individual patient may be used.
[0245] Those skilled in the art will further appreciate that in some embodiments, the panel covers known hotspot regions of the human genome, hotspot regions that are recursively mutated in a given cancer type.
[0246] In some embodiments, methods are provided for non-invasive prenatal testing (NIPT) comprising use of any previously or subsequently described embodiment of a method for detecting the presence or absence of one or more specific nucleic acid sequences in a sample derived from a patient, wherein the patient is a pregnant patient. In some embodiments, the sample is plasma and / or serum from the pregnant patient's blood. In some embodiments, the methods provided herein are used to enrich and / or quantify the fetal fraction of a sample using a panel of common SNPs associated with such a sample.
[0247] In some embodiments, a method of treating a patient comprises the steps of: - carrying out any of the foregoing or following embodiments of the invention to detect the absence or presence of one or more specific nucleic acid sequences in a sample derived from a patient; - making one or more treatment decisions based on the presence or absence of said sequence.
[0248] In some embodiments, the treatment decision is the initiation of a particular treatment.
[0249] In some embodiments, the treatment decision is to discontinue a particular treatment.
[0250] In some embodiments, the treatment decision is to increase the dose of a particular treatment.
[0251] In some embodiments, the treatment decision is a reduction in the dose of a particular treatment.
[0252] In some embodiments, the treatment decision is to increase the frequency of administration of a particular treatment.
[0253] In some embodiments, the treatment decision is to reduce the frequency of administration of a particular treatment.
[0254] In some embodiments, the treatment decision is to add an additional drug to an existing treatment regimen.
[0255] In some embodiments, the treatment decision is the removal of a drug from an existing treatment regimen.
[0256] In one aspect of the invention, an apparatus is provided for carrying out the method of the invention.
[0257] In some embodiments, an apparatus is provided for carrying out steps (a)-(c) of the method.
[0258] In some embodiments, an apparatus is provided for carrying out steps (a)-(b) of the method.
[0259] In one aspect of the invention, there is provided a kit comprising, in one or more embodiments, one or more oligonucleotides, enzymes, reagents or components as described above or below.
[0260] In some embodiments, one or more oligonucleotides A0 (A0 being Contains a sequence (e.g., at the 3' end of A0 or elsewhere) that is complementary (e.g., perfectly complementary) to a known first sequence but not complementary (e.g., imperfectly complementary) to a known second sequence; one or more pyrophosphorylating enzymes; and - Kits are provided that include one or more sources of pyrophosphate ions.
[0261] In some embodiments, the kit further comprises one or more solid supports, which may be as described above or below.
[0262] In some embodiments, the kit further comprises one or more buffers, which may be as described above or below.
[0263] In some embodiments, the kit further comprises one or more crow's feet (eg, polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), dextran sulfate, etc.).
[0264] In some embodiments, the kit further comprises one or more detergents (eg, sodium dodecyl sulfate (SDS), TWEEN 20, etc.).
[0265] In some embodiments, the kit further comprises one or more solvents (eg, formamide, ethylene carbonate, etc.).
[0266] In some embodiments, the kit further comprises a phosphohydrolase (eg, apyrase).
[0267] In some embodiments, the kit further comprises a pyrophosphatase (eg, thermostable inorganic pyrophosphatase (TIPP) (New England Biolabs)).
[0268] In some embodiments, one or more buffers may contain additives that hybridize with repetitive sequences, such as C0t-1 DNA, salmon sperm DNA, oligonucleotides that block ribosomal RNA, etc.
[0269] In some embodiments, A0 further comprises a 5' tail region that is not complementary to either the known first sequence or the known second sequence. A0 can be as described above or below.
[0270] In some embodiments, A0 further comprises a capture moiety.
[0271] In some embodiments, the kit further comprises one or more capture oligonucleotides (C0), as described above or subsequently.
[0272] In some embodiments, the kit further comprises one or more capture oligonucleotides C0 that comprise a capture moiety, wherein the 5' tail region of A0 is complementary to a region of C0.
[0273] In some embodiments, the capture moiety is biotin and the solid support comprises streptavidin.
[0274] In some embodiments, the solid support comprises a capture oligonucleotide C0, wherein the 5' tail region of A0 is complementary to a region of C0.
[0275] In some embodiments, the solid support is a bead.
[0276] In some embodiments, the beads are magnetic or paramagnetic beads.
[0277] In some embodiments, the kit further comprises one or more epigenetic modification-sensitive or -dependent restriction enzymes.
[0278] In some embodiments, the kit further comprises one or more transposomes.
[0279] In some embodiments, the kit further comprises Cas9.
[0280] In some embodiments, the kit further comprises one or more transposases.
[0281] In some embodiments, the kit further comprises one or more ligases.
[0282] In some embodiments, the kit further comprises one or more metal ions.
[0283] In some embodiments, the kit further comprises one or more blocking oligonucleotides.
[0284] In some embodiments, one or more blocking oligonucleotides are resistant to pyrophosphorolysis.
[0285] In some embodiments, the kit further comprises isothermal amplification reagents.
[0286] In some embodiments, the kit further comprises polymerase chain reaction (PCR) reagents (eg, a thermostable DNA polymerase, primers, dNTPs, buffers).
[0287] In some embodiments, the kit further comprises sequencing reagents.
[0288] In some embodiments, the kit further comprises next generation sequencing (NGS) reagents (e.g., polymerase, dNTPs, buffers).
[0289] In some embodiments, the kit further comprises a DNA library preparation kit (eg, optionally containing a polymerase, ligase, adaptors, dNTPs, buffers).
[0290] In some embodiments, the kit further comprises one or more molecular probes.
[0291] In some embodiments, the kit further comprises one or more fluorescently labeled molecular probes.
[0292] In some embodiments, a region of A0 (e.g., the 3' end) is more complementary (e.g., perfectly complementary) to a wild-type sequence in the human genome and less complementary (e.g., incompletely complementary) to a mutant allele of said wild-type sequence.
[0293] In some embodiments, a region of A0 (e.g., the 3' end) is less complementary (e.g., imperfectly complementary) to a wild-type sequence in the human genome and more complementary (e.g., perfectly complementary) to a mutant allele of said wild-type sequence.
[0294] In some embodiments, the kit further comprises one or more components for transcribing RNA into cDNA.
[0295] In some embodiments, the kit further comprises one or more kits for preparing an adaptor-tagged library for sequencing, as described above, or below, or by other methods known to those of skill in the art.
[0296] In some embodiments, the kit further comprises one or more components for fragmenting nucleic acids, as described above or below, or by other methods known to those of skill in the art.
[0297] In some embodiments, the kit further comprises one or more devices for physical fragmentation of nucleic acids, as previously or later described or otherwise known to those of skill in the art.
[0298] In some embodiments, the kit further comprises one or more components for enzymatic fragmentation of nucleic acids, alternatively as described above or below, or by other methods known to those of skill in the art.
[0299] In some embodiments, the kit further comprises one or more components for physical fragmentation of nucleic acids and one or more components for enzymatic fragmentation of nucleic acids.
[0300] In some embodiments, a kit is provided that includes a plurality of A0, as described above or below.
[0301] In some embodiments, kits are provided that include 1 to 1,000,000 individual A0 probes, each having a sequence (e.g., at the 3' end) that is perfectly complementary to an individual mutation, and the same sequence (e.g., at the 3' end or elsewhere) that is imperfectly complementary to the wild-type sequence of said mutation. In some embodiments, kits are provided that include 1 to 100,000 individual A0 probes. In some embodiments, kits are provided that include 1 to 10,000 individual A0 probes. In some embodiments, kits are provided that include 1 to 1,000 individual A0 probes.
[0302] In some embodiments, kits are provided that include 1 to 1,000,000 individual A0 probes, each having a sequence (e.g., at the 3' end or elsewhere) that is imperfectly complementary to an individual mutation, and the same sequence (e.g., at the 3' end or elsewhere) that is perfectly complementary to the wild-type sequence of said mutation. In some embodiments, kits are provided that include 1 to 100,000 individual A0 probes. In some embodiments, kits are provided that include 1 to 10,000 individual A0 probes. In some embodiments, kits are provided that include 1 to 1,000 individual A0 probes.
[0303] In some embodiments, a kit is provided that includes a plurality of capture oligonucleotides (C0) as described above or below.
[0304] In some embodiments, a kit is provided that includes a plurality of solid supports, as described above or below.
[0305] In some embodiments, a panel is provided that includes multiple A0s that have sequences (eg, at their 3' ends) that are perfectly complementary to a known sequence.
[0306] In some embodiments, a panel is provided that includes multiple A0s that have sequences that are incompletely complementary to a known sequence (eg, at their 3' ends).
[0307] In some embodiments, a panel is provided that includes multiple A0s that have sequences (e.g., at their 3' ends) that are perfectly complementary to known variants of a given cancer type or within a range of cancer types.
[0308] In some embodiments, a panel is provided that includes a plurality of A0s that have sequences (e.g., at their 3' ends) that are imperfectly complementary to known variants of a given cancer type or within a cancer type, where the sequences (e.g., at their 3' ends) are perfectly complementary to the wild-type sequence.
[0309] In some embodiments, a panel is provided that includes multiple A0s, some of which have sequences (e.g., at their 3' ends) that are perfectly complementary to known variants of a given cancer type or range of cancer types, while others are imperfectly complementary.
[0310] In some embodiments, the panel further comprises one or more capture oligonucleotides (C0), as described above or below.
[0311] In some embodiments, the panel further comprises one or more blocking oligonucleotides as described above or below.
[0312] The polymorphism (eg, mutation) can be selected from any polymorphism (eg, mutation) previously or subsequently described or known.
[0313] Thus, those skilled in the art will understand that within the scope of the present invention are included panels that may be useful for the detection of one or more polymorphisms (e.g., mutations) in any of the proto-oncogenes, oncogenes, or genetic markers for one or more previously or subsequently described or known disease states. Those skilled in the art will further appreciate that within the scope of the present invention are included panels that may be used in determining the presence or absence of genetic markers for one or more disease states, or may be useful in detecting more variants specific to a given patient, tissue, or cell, for example, for tumor-informed monitoring.
[0314] Those skilled in the art will further understand that the scope of the present invention includes panels that can be useful for detecting one or more variants that are not yet known, but can nevertheless be used to determine the presence, absence, or one or more disease states.For example, there are known mutation signatures for many different cancer types, and these are the preferred modes of mutagenesis, such as excessive C>T at CpG dinucleotides.Panels can include probes designed to detect these types of events that occur.
[0315] In some embodiments, the panel includes between 1 and 1,000,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing a target mutation.
[0316] In some embodiments, the panel includes 10,000 to 1,000,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing the target mutation.
[0317] In some embodiments, the panel includes 100,000 to 1,000,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing the target mutation.
[0318] In some embodiments, the panel includes 200,000 to 1,000,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing the target mutation.
[0319] In some embodiments, the panel includes 10,000 to 100,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing the target mutation.
[0320] In some embodiments, the panel includes 1,000 to 100,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a particular target region containing the target mutation.
[0321] In some embodiments, the panel includes 1,000 to 10,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a specific target region containing the target mutation.
[0322] In some embodiments, the panel includes 500 to 10,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a specific target region containing the target mutation.
[0323] In some embodiments, the panel includes 500 to 1,000 individual probe molecules, each having a sequence (e.g., at their 3' end) that can be complementary to a specific target region containing the target mutation.
[0324] In some embodiments, the panel includes between 5 and 500 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 400 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 300 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 200 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 100 individual probe molecules, each complementary to a specific target mutation. In some embodiments, the panel includes between 5 and 50 individual probe molecules, each complementary to a specific target mutation.
[0325] In some embodiments, there may be multiple probe molecules specific for the same mutation, hi some embodiments, there may be only one probe molecule specific for each mutation in the panel.
[0326] In some embodiments, a panel is provided that includes a plurality of probe molecules, wherein one or more probes are complementary to EGFR mutations, one or more probes are complementary to KRAS mutations, one or more probes are complementary to ERBB2 / HER2 mutations, one or more probes are complementary to EML4-ALK mutations, one or more probes are complementary to ROS1 mutations, one or more probes are complementary to RET mutations, and one or more probes are complementary to MET mutations.
[0327] In some embodiments, a panel is provided that includes a plurality of probe molecules, wherein one or more probes may be complementary to an EGFR mutation, one or more probes may be complementary to a KRAS mutation, one or more probes may be complementary to an ERBB2 / HER2 mutation, one or more probes may be complementary to an EML4-ALK mutation, one or more probes may be complementary to a ROS1 mutation, one or more probes may be complementary to a RET mutation, and one or more probes may be complementary to a MET mutation.
[0328] In some embodiments, a probe panel selective for one or more of EGFR, KRAS, BRAF, ERBB2 / HER2, EML4-ALK, ROS1, RET, MET mutations is provided.
[0329] In some embodiments, a panel of probe molecules selective for EGFR mutations is provided.
[0330] In some embodiments, a panel of probe molecules selective for KRAS mutations is provided.
[0331] In some embodiments, a panel of probe molecules selective for BRAF mutations is provided.
[0332] In some embodiments, a panel of probe molecules selective for ERBB2 / HER2 mutations is provided.
[0333] In some embodiments, a panel of probe molecules selective for EML4-ALK mutations is provided.
[0334] In some embodiments, a panel of probe molecules selective for ROS1 mutations is provided.
[0335] In some embodiments, a panel of probe molecules selective for RET mutations is provided.
[0336] In some embodiments, a panel of probe molecules selective for NTRK mutations is provided.
[0337] In some embodiments, a panel of probe molecules selective for ROS1 mutations is provided.
[0338] In some embodiments, a panel of probe molecules selective for MET exon 14 mutations is provided.
[0339] In some embodiments, a panel is provided that includes a plurality of probe molecules selective for one or more coding sequences (CDS).
[0340] In some embodiments, methods are provided for detecting one or more mutations using one or more of the aforementioned panels.
[0341] In some embodiments, methods are provided for detecting the presence or absence of one or more mutations using one or more of the foregoing panels.
[0342] In some embodiments, kits are provided that include a panel, as may be described above or below, in combination with one or more reagents, as may be described above or below.
[0343] Those skilled in the art will understand that the terms "DNA" and "nucleic acid" are used interchangeably in this application. Thus, disclosure of an embodiment referring to "DNA" can be understood to encompass and disclose embodiments in which "DNA" is replaced with "nucleic acid." Those skilled in the art will understand that disclosure of an embodiment referring to "DNA" can be understood to encompass and disclose embodiments in which "DNA" is replaced with "RNA."
[0344] While the present invention has been described by way of example with reference to certain embodiments, it will be further appreciated by those skilled in the art that the invention is not limited to the disclosed embodiments and that alternative embodiments may be constructed without departing from the scope of the invention as defined in the appended claims.
[0345] As used herein, "magnetic microparticles" are magnetically responsive microparticles that are attracted by a magnetic field. The magnetic microparticles that can be used in the methods of the present invention comprise a magnetic metal oxide core, which is generally surrounded by a polymer coating that forms a surface that can bind to DNA, RNA, or PNA. The magnetic metal oxide core is preferably iron oxide, where the iron is Fe 2+ and Fe 3+ The preferred Fe 2+ / Fe 3+ The ratio is preferably 2 / 1, but can vary from about 0.5 / 1 to about 4 / 1.
[0346] Bioinformatics approach is used to analyze sequencing data.In some embodiments, the presence or absence of specific variant is called.In other embodiments, the data from multiple variants is combined to derive the probabilistic estimate of the presence or absence of tumor DNA.
[0347] For example, Illumina sequencing data analysis involves converting BCL files to FASTQ format and demultiplexing using tools such as bcl2fastq. In some embodiments, the sequencing reads include molecular identifiers. In this case, the molecular identifiers can be extracted from the sequencing reads, added to the FASTQ header, and the sequencing reads can be excised. In some embodiments, barcodes with non-canonical bases (not A, C, G, or T) can be filtered. The resulting reads can then be aligned using tools such as bwa mem using the -C option, and the barcode sequence can be added to the alignment.
[0348] Alignments can then be sorted by coordinate, duplicate reads marked, and reads annotated with read coordinates, mate coordinates, and optical duplicate auxiliary tags using biobambam2 bamsormadup and bammarkduplicatesopt. Reads can be filtered if they are not marked as a proper pair or if they are marked as optical duplicates, complements, QC failed, unmapped, or secondary alignments. Each read can then be marked with auxiliary tags consisting of a reference name, sorted read and mate fragmentation breakpoints, forward and reverse read barcodes, and read strand.
[0349] In some embodiments, sequencing data is analyzed using a variant calling algorithm that does not use auxiliary tag data. In this case, the analysis of sequencing data compares the probability of observing data under two models. The first is a null model that specifies the distribution of sequencing artifacts. The second is a model that allows for true variants. In this case, if the probability under the alternative model exceeds the probability under the null model, the variant is called. In some embodiments, a panel of pre-characterized samples can be useful for modeling the error distribution of (the first model).
[0350] In some embodiments, auxiliary tags can be used to identify reads that are likely to originate from the same input molecule and / or the same strand of the same input molecule, hi some embodiments, a consensus-based quality score can be derived from reads that share the same auxiliary tag.
[0351] In some embodiments, the deformations are identified using artificial intelligence algorithms such as convolutional neural networks.
[0352] In some embodiments, sequencing data can be further filtered to remove artifacts.Exemplary filters include: the number of mismatches present in a given sequencing read; alignment score and next-best alignment score; base quality score or consensus base quality score; the minimum number of reads covering a given variant site; the location of the variant within the sequencing read; whether the read is 5'-clipped; whether the read is improperly paired; whether the read contains indels; and the variant allele fraction of a given variant.In some embodiments, the region of the genome that contains common SNPs or is prone to alignment artifacts is filtered.There are many other filters known to those skilled in the art.
[0353] In some embodiments, control samples are sequenced to remove variants.For example, DNA from oral epithelium or other tissue sources can be sequenced to remove germline variants.In another embodiment, buffy coat or leukocyte DNA can be sequenced to remove somatic mutations derived from clonal hematopoiesis.
[0354] The compositions, methods, and kits of the present invention find use in a diverse range of applications and settings. In some embodiments, they find use in any methodology in which it is desired to detect a sequence in a sample. In some embodiments, they find use in any methodology in which there is a desire to detect low-abundance (e.g., rare) sequences in a complex sample. In addition to the exemplary uses above, some additional exemplary uses are provided below. In some embodiments, the compositions, methods, and kits find use in the analysis and treatment of infectious diseases. This technique is particularly valuable for detecting low-frequency mutations that may be present in a sample. For example, this technique is used to detect low-frequency mutations associated with treatment resistance (e.g., antibiotic resistance, antiviral resistance, etc.) in infectious diseases (e.g., HIV, tuberculosis, etc.). This technique further finds use in selective pull-down of bacterial or viral DNA or RNA for sequencing.
[0355] As noted above, this technology is particularly well suited for the analysis and / or enrichment of analytes in complex samples. One area of growing research and clinical interest is microbiome analysis, where this technology finds application to provide much more specific selection of desired bacterial DNA for sequencing or other analysis.
[0356] This technology is also used for high-throughput analysis as well as multiplexed analysis of many different samples. These advantages find use in a wide variety of genotyping applications, including forensic analysis, paternity / maternity testing, disease analysis (e.g., cancer, infectious diseases), drug susceptibility testing, and agricultural and food testing (e.g., to aid selective breeding, to identify trace contaminants).
[0357] This technology is used for error correction of synthetic nucleic acids (e.g., DNA). Synthetic nucleic acids are used in research, diagnostics, and clinical applications. In many cases, it is important to avoid or minimize the use of nucleic acid molecules with unintended or undesired sequences. This technology is used to identify and isolate desired molecules from undesired molecules.
[0358] Nucleic acid editing has emerged as an important process in research, synthetic biology, and clinical applications. For example, CRISPR / CAS editing of nucleic acids and related processes have emerged as important processes. Many of these editing techniques result in a mixed population of molecules, including intended edited products, unedited products, and unintended edited products. The techniques provided herein facilitate the identification, selection, and isolation of intended edited products.
[0359] This technique is also used for environmental monitoring. In addition to agricultural applications, this technique is particularly well suited for the analysis of environmental samples that may contain trace amounts of analytes of interest. Such samples include, but are not limited to, the analysis of native and invasive organisms, early detection of invasive species, air and water contamination, and ancient DNA analysis. Sample types include, but are not limited to, soil, water, snow, feces, mucus, gametes, shed skin, carcasses, hair, and air.
[0360] This technique is used to isolate desired subsets of nucleic acids from other subsets from a particular sample. For example, this technique is used to isolate and analyze chloroplast and mitochondrial genomes.
[0361] This technology is used for cell line screening of engineered and natural cells, including, but not limited to, cell cultures (primary and immortalized), stem cells (embryonic, induced pluripotent, dedifferentiated, etc.), differentiated cells for cell therapy purposes, ex vivo modified cells for research or clinical use (e.g., CAR T cells), and genetically engineered cells.
[0362] This technique finds use in removing damaged or other undesired nucleic acids from undamaged or desired nucleic acids. For example, the technique can be used to remove damaged DNA from a sample prior to methylation analysis.
[0363] This technology is used for preimplantation screening of cells (e.g., embryos, eggs, sperm), liposomes, exosomes, nucleic acid vectors (e.g., gene therapy vectors), etc. prior to administration to a subject.
[0364] This technique is used for drug toxicity screening and is particularly well suited to identifying DNA damage, mutations, methylation changes, etc. that may be associated with the use of a particular drug.
[0365] This technique can be used for fragmentomics analysis of nucleic acids, for example, by using probes that lie on or align with breakpoints to associate specific sequences with relevant correlation information (e.g., tissue of origin, association with diseases such as cancer, etc.).
[0366] This technology can be used in any application where nucleic acid complexity reduction is desired.For example, this technology can be used for whole genome complexity reduction.In some such embodiments, restriction enzyme digestion or other nucleic acid fragmentation process is used, followed by using a probe that matches the known end sequence to extract only the cleaved molecules.
[0367] This technique is useful for assessing microsatellite instability (MSI). Target nucleic acid molecules that differ in the presence, number, or nature of repeated nucleotides (e.g., GT / CA repeats) are enriched and / or identified in a sample. MSI is associated with many diseases and conditions, including, but not limited to, colon cancer, gastric cancer, endometrial cancer, ovarian cancer, hepatobiliary cancer, urinary tract cancer, brain cancer, and skin cancer.
[0368] This technology is also used to assess tumor mutation burden (TMB). TMB has emerged as a predictive biomarker for immune checkpoint therapy, among other uses. Currently, next-generation whole-exome sequencing is used to assess TMB, or gene panels that provide sequences for a subset of genes are evaluated. The technology provided herein allows for more sensitive, significantly lower-cost, and less burdensome TMB assessment.
[0369] This technology finds application in haplotyping. Genomic information reported as haplotypes rather than genotypes is increasingly important for personalized medicine and a wide variety of research applications. Haplotypes are more specific than less complex variants, such as single nucleotide variants, and are also applied to prognosis, tumor analysis, and tissue classification for transplantation. Currently, sequencing is the most common form of molecular haplotyping. The error rate of sequencing technology is an obstacle to obtaining accurate information. The technology provided herein enables efficient and highly accurate haplotyping.
[0370] The ability of this technology to enrich any desired sequence or object allows this technology to enhance existing nucleic acid methodology.For example, many nucleic acid sequencing approaches have difficulties when there is repetitive sequence region in target nucleic acid.The technology provided herein can remove repetitive region, making this sequencing reaction more accurate and efficient. [Example]
[0371] Example 1: Pyrophosphorolysis-dependent release of a target sequence of interest 1. Bead Preparation 1 ul of beads (ThermoFisher Dynabeads MyOne Streptavidin T1 catalog 65601) per sample was placed in a 1.5 ml Eppendorf tube. Up to 100 ul of beads can be blocked with 1 ml of blocking solution. The tube was then placed on a magnet, followed by removal of the storage buffer. 1 mL of blocking buffer (1x PBS containing 1 μg / mL tRNA) was then added to the tube, followed by rotation (40 rpm) at room temperature (RT) for 30 minutes.
[0372] 2. Oligonucleotide Annealing Dilutions of oligonucleotides were prepared in 1x AB buffer (Tris HCl pH=7.5 1 mM, NaCl 50 mL, EDTA 0.2 mM). Probe A020nM 20 nM of perfectly complementary oligonucleotide or mismatched oligonucleotide Max 50uL
[0373] The resulting mixture was then incubated at 95° C. for 5 minutes and then allowed to cool slowly to room temperature.
[0374] After the oligonucleotide mixture was cooled, the mixture was diluted 1000-fold.
[0375] Probe A0 (SEQ ID NO: 1): 5'- / 5Biosg / TTTTTTTTTTTTTTTTTTACCTTATACACCGTGCCGAACGCACCGGAGCCCAGCACTTTG-3' (where / 5Biosg / represents biotin at the 5' end)
[0376] Perfectly complementary oligonucleotide (SEQ ID NO: 2): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3'
[0377] Mismatch oligonucleotide (SEQ ID NO: 3): 5'-CCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGCCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCC-3'
[0378] 3. Attachment of oligonucleotides to beads The blocked beads were spun down in a minicentrifuge at 2000 × g for 5 seconds, placed on a magnet, and the blocking solution was removed by aspiration. Then, 10 μL of 2× binding buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) was added to the tube for every 1 μL of beads.
[0379] The ratios of beads / oligomer and buffer were as follows: 2xBinding buffer 40uL 10 μL of beads 50 μL of 1000-fold diluted annealing oligonucleotide.
[0380] The tube was then rotated (40 rpm) at room temperature for 30 minutes.
[0381] 4. Cleaning process The beads were then washed once with 100 uL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%).
[0382] 5. Replace the bead wash buffer with 100uL of 1x BFF6 buffer containing 0.01% Triton-X. 1x BFF6 composition containing 0.01% Triton-X Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM TWEEN20 0.01%
[0383] 6. Pyrophosphorolysis The 1xBFF6 0.01% Triton-X buffer was then removed and the PPL mixture (stored at 4°C) was added to the beads. The PPL mixture consisted of: 1x BFF6 containing 0.1% TWEEN 20 10U / mL Klenow(exo-) 2U / mL apyrase 0.5mM PPi Total volume 10uL The resulting mixture was incubated at 45°C for 30 minutes.
[0384] 7. Inactivation of PPi 2.5 uL of the TIPP mixture was added to the inactivated PPi. The TIPP mixture consisted of: 1x BFF6 containing 0.1% TWEEN 20 TIPP 16U / mL 10uL of mixture from point 6. Total volume 12.5uL The resulting mixture was incubated at 37°C for 5 minutes.
[0385] 8. Release and Detection of Targets of Interest The mixture from point 7 was heated to 60°C for 5 minutes. To separate the magnetic beads from the supernatant, the tube containing the mixture was transferred to a magnetic rack placed on a hot plate set at 60°C.
[0386] 2 uL of the clear supernatant was added to a detection mixture consisting of: 1x Q5U buffer 0.4mM dNTP 0.2uM primer mixture 20U / mL Q5U DNA polymerase 10U / mL UDG 1x SybrGreenI Total volume: 12.5uL
[0387] Q5 buffer The Q5 buffer composition is not publicly available.
[0388] Primer mixture: Fwd (SEQ ID NO: 4): 5'-C*C*C*AACCAAGCTCTCTTGAGGATCTTG-3' Rev (SEQ ID NO: 5): 5'- / 5Phos / GGGACCTTACCTTATACACCGTGCCG-3' (In the formula, * represents a phosphorothioate bond, and / 5Phos / represents a 5'-terminal phosphate).
[0389] The resulting mixture was then incubated as follows: 37℃, 1 minute 55°C, 10 minutes 98℃, 1 minute (98℃, 10 seconds 63°C, 15 seconds 72℃, 15 seconds) x 50 72°C, 5 min 4℃ pause
[0390] Fluorescence readings were taken after each cycle in the fam channel and the results can be seen in Figure 4.
[0391] Example 2: Pyrophosphorolysis-dependent enrichment of target sequences of interest 1. Bead Preparation One microliter of beads (ThermoFisher Dynabeads MyOne Streptavidin T1 catalog 65601) per sample was placed in a 1.5 mL Eppendorf tube. Up to 100 μL of beads can be blocked with 1 mL of blocking buffer. The tube was placed on a magnet, followed by removal of the storage buffer. 1 mL of blocking buffer (1x PBS, Triton-X 0.1% containing 1 μg / mL tRNA) was added to the tube, followed by rotation (40 rpm) at room temperature (RT) for 30 minutes.
[0392] 2.1% MAF and 10% MAF sample preparation 1% MAF: 100 nM wild-type oligonucleotide was mixed with 1 nM mutant oligonucleotide in a final volume of 100 μL. 10% MAF: 100 nM wild-type oligonucleotide was mixed with 10 nM mutant oligonucleotide in a final volume of 100 μL.
[0393] Wild-type oligonucleotide (SEQ ID NO: 6): 5'-CATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATAT-3'
[0394] Mutant oligonucleotide (SEQ ID NO: 7): 5'-C*G*T*ACTGGTGAAAACACCGCAGGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTGGAAGAGAAAGAATACCATGCAGAAGG-3' (In the formula, * represents a phosphorothioate bond.)
[0395] 3. Oligonucleotide Annealing Dilutions of oligonucleotides were prepared in 1x AB buffer (Tris HCl pH=7.5 1 mM, NaCl 50 mM, EDTA 0.2 mM). Probe A020nM 10uL of 1% MAF or 10% MAF sample Make up to 50 uL with nuclease-free water. The resulting mixture was then incubated at 95° C. for 5 minutes and then allowed to cool slowly to room temperature. After the oligonucleotide mixture was cooled, the mixture was diluted 1000-fold.
[0396] Probe A0 (SEQ ID NO: 8): 5'- / 5Biosg / TTTTTTTTTTTTTTTTTTTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATG-3' (where / 5Biosg / represents biotin at the 5' end)
[0397] 4. dPCR Quantification of Target Pre-bead Preparations The concentrations of wild-type and mutant oligonucleotides in the annealed and diluted mixtures were quantified using dPCR. A 1000-fold dilution of the 1% MAF and 10% MAF samples (from point 3) was further diluted 20-fold, followed by six 1:1 serial dilutions to generate a standard curve.
[0398] The dPCR mixture consisted of: 1x Q5U buffer 0.4mM dNTP 0.2 μM primer mixture 20U / mL Q5U polymerase 10U / mL UDG 2 x EvaGreen 0.0003μg / mL Alexa 700 0.2% TWEEN 20 4 μL DNA template Total volume: 12 μL
[0399] Q5 buffer The Q5 buffer composition is not publicly available.
[0400] Primer mixture: FWD (SEQ ID NO: 9): 5'-G*C*C*TCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3' REV (SEQ ID NO: 10): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGA-3' or FWD (SEQ ID NO: 11): 5'-A*C*G*TACTGGTGAAAACACCGCAG-3' REV (SEQ ID NO: 12): 5'- / 5Phos / GCCTCCTTCTGCATGGTATTCTTT-3' (where * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and different primer mixtures were used for quantification of wild-type and mutant oligonucleotides.)
[0401] The resulting mixture was then incubated as follows: 37℃, 1 minute 55°C, 10 minutes 98℃, 1 minute (98℃, 10 seconds 63°C, 15 seconds 72℃ 15 seconds)×30 72°C, 5 min 35℃, rest
[0402] After incubation, a fluorescence reading was taken and the dPCR maker software was used to quantify the various oligomers.
[0403] 5. Attachment of Oligonucleotides to Beads The blocked beads were spun down in a minicentrifuge at 2000 × g for 5 seconds, placed on a magnet, and the blocking solution was subsequently removed by aspiration. For every 1 μL of beads, 10 μL of 2× binding buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) was added to the tube.
[0404] The ratios of beads / oligomer and buffer were as follows: 2xBinding buffer 40μL 10 μL of beads 50 μL of annealed oligonucleotides diluted 1000 times (from point 3). The tube was then rotated (40 rpm) at room temperature for 30 minutes.
[0405] 6. Cleaning process The beads were then washed once with 100 μL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%).
[0406] 7. Replace the bead wash buffer with 100 μL of 1x BFF6 buffer containing 0.01% TWEEN 20. 1x BFF6 composition containing 0.01% TWEEN 20 Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM TWEEN20 0.01%
[0407] 8. Pyrophosphorolysis The 1x BFF6 0.01% TWEEN20 buffer was then removed and the PPL mixture (stored at 4°C) was added to the beads. The PPL mixture consisted of: 1x BFF6 containing 0.1% TWEEN20 20U / mL Klenow(exo-) 2U / mL apyrase 0.5mM PPi Total volume 20 μL The resulting mixture was incubated at 40°C for 1 minute.
[0408] 1x BFF6 composition containing 0.1% TWEEN 20 Tris acetate pH=7.0 10mM Potassium acetate 30mM Magnesium acetate 17.125mM TWEEN20 0.1%
[0409] 9. Inactivation of PPi PPi was inactivated by adding 5 μL of TIPP mixture. The TIPP mixture consisted of: 1x BFF6 containing 0.1% TWEEN20 TIPP 16U / mL 20 μL of the mixture from point 8. Total volume 25 μL The resulting mixture was incubated at 37°C for 5 minutes.
[0410] 10. Release and Detection of Target of Interest The mixture from point 9 was heated to 60°C for 10 minutes. To separate the magnetic beads from the supernatant, the tube containing the mixture was transferred to a magnetic rack placed on a hot plate set at 60°C.
[0411] 11. dPCR Quantification of Targets Released from Beads The concentrations of wild-type and mutant oligonucleotides in the supernatant were then quantified using dPCR.
[0412] 4 μuL of the cleared supernatant was added to a detection mixture consisting of: 1x Q5U buffer 0.4mM dNTP 0.2 μM primer mixture 20U / mL Q5U DNA polymerase 10U / mL UDG 2 x EvaGreen 0.0003μg / mL Alexa 700 0.0003μg / mL 0.2% TWEEN20 Total volume: 12 μL
[0413] Q5 buffer The Q5 buffer composition is not publicly available.
[0414] Primer mixture: FWD (SEQ ID NO: 9): 5'-G*C*C*TCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3' REV (SEQ ID NO: 10): 5'- / 5Phos / GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGA-3' or FWD (SEQ ID NO: 11): 5'-A*C*G*TACTGGTGAAAACACCGCAG-3' REV (SEQ ID NO: 12): 5'- / 5Phos / GCCTCCTTCTGCATGGTATTCTTT-3' (where * represents a phosphorothioate bond, / 5Phos / represents a 5'-terminal phosphate, and different primer mixtures were used for quantification of wild-type and mutant oligonucleotides.)
[0415] The resulting mixture was then incubated as follows: 37℃, 1 minute 55°C, 10 minutes 98℃, 1 minute (98℃, 10 seconds 63°C, 15 seconds 72℃ 15 seconds)×30 72°C, 5 min 35℃, rest
[0416] After incubation, a fluorescence reading was taken and the dPCR maker software was used to quantify the various oligomers.
[0417] The results of the oligonucleotide quantification are shown in the table below. [Table 1]
[0418] Example 3: Analysis of the EGFR exon 20 T790M variant 1. Bead Preparation a. Bead blocking step - Take 1 μL of beads per sample and place them in a 1.5 mL Eppendorf tube (ThermoFisher Dynabeads MyOne Streptavidin C1 catalog 65001). Up to 100 μL of beads can be blocked with 1 mL of blocking solution. - Place the tube containing the beads on a magnet and wait until the beads separate and the solution becomes clear. - Remove the storage buffer. Add 1 mL of blocking buffer (1x PBS, 0.1% Tween-20, 1 μg / mL) to the tube containing the beads. t-RNA) is added. Rotate at 15 rpm for 30 min at -RT.
[0419] b.Buffer exchange -Spin down the beads and place on a magnet until the beads separate and the solution becomes clear. - Remove the blocking solution. Add 10 μL of 2× Binding Buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) for every 1 μL of beads. - Mix the beads by vortexing for 5 seconds.
[0420] 2. Oligonucleotide Hybridization - Prepare dilutions of oligonucleotides in 1x SSC buffer (5x SSC, 5x Denhardt's solution, 5mM EDTA, 0.1% SDS) -2 pM probe oligonucleotide -WT or mutant oligonucleotide 0.2 / 2 fM - 50 μL of oligonucleotide was prepared per 1 μL of beads. Incubate at -95°C for 5 minutes and at 50 / 60°C for 72 hours.
[0421] Probe oligonucleotide (SEQ ID NO: 13): 5'- / 5Biosg / TTTTTTTTTTTTTTTTTTTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATG-3' WT oligonucleotide (SEQ ID NO: 14): 5'-CTGGTCCCTCATTGCACTGTACTCCCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATGTGTCGAGAATATCCAAGAGACAGGTTTCT-3' Mutant oligonucleotide (SEQ ID NO: 15): 5'-CTGGTCCCTCATTGCACTGTACTCCACGTACTGGTGAAAACACCGCAGGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTGGAAGAGAAAGAATACCATGCAGAAGGAGGCGTGTCGAGAATATCCAAGAGACAGGTTTCT-3' ( / 5Biosg represents biotin at the 5' end.)
[0422] 3. Attachment of oligonucleotides to beads - Mix the beads and oligonucleotides in the following ratio: 2xBinding buffer 40uL 10 μL of beads from step 1 50 μL of oligonucleotide from step 2 Rotate at 15 rpm for 30 min at -RT.
[0423] 4. Bead Washing - After the attachment step is complete - spin down the sample and place it on the magnet for 7 minutes. Remove 80 μL of the 100 μL supernatant and add 100 μL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%). -Vortex the sample for 10 seconds and spin down. - Place the sample on the magnet and wait 2 minutes. Remove 90 µL of the 120 µL supernatant and add 100 µL of 1x wash buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant and add 100 μL of 1× Wash Buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant, remove the sample from the magnet and add 100 μL of 1x BFF6 buffer (Tris acetate pH=7.0 10 mM, potassium acetate 30 mM, magnesium acetate 17.125 mM, TWEEN 20 0.01%). -Spin down the sample, place the sample on the magnet and wait 2 minutes. Remove the 1x BFF6 buffer.
[0424] 5. PPL reaction The PPL mixture is added to the beads kept at -4°C. The PPL has the following composition: 1 x BFF6-0.1% Tween-20 20U / mL Klenow(exo-) 2U / mL apyrase + / -0.05mM PPi Total volume: 20 μL Incubate at -40 °C for 10 min and pause at 4 °C.
[0425] 6. TIPP Reaction -Once the PPL reaction has reached 4°C, add 5 μL of TIPP mixture with: 1 x BFF6-0.1% Tween-20 16U / mL TIPP 20 μL of the mixture from step 5. Total volume: 25 μL Incubate at -37°C for 5 minutes, 60°C for 10 minutes, and rest at 60°C.
[0426] 7. Preamplification - Place the sample from step 6 on a magnet held on a hot plate and heat to 60°C. - After the beads have separated, take 2 μL of the supernatant and add it to the following mixture: 1x Q5U buffer 0.4mM dNTPs Primer Mix 1 0.1 μM Q5U polymerase 20U / mL UDG 10U / mL Total volume: 12.5 μL Q5U buffer: Primer Mix 1 has the following: Forward primer (SEQ ID NO: 16): 5'-AGAAACCTGTCTCTTGGATATTCTCGACAC-3' Reverse primer (SEQ ID NO: 17): 5'-CTGGTCCCTCATTGCACTGTACTCC-3' - Place samples in a thermocycler and incubate covered at 105°C. 1.UDG 37℃, 1 minute 2. Denaturation starting temperature: 98℃, 1 minute 3. Denaturation: 98℃, 10 seconds 4. Annealing: 63°C, 15 seconds 5. Extension: 72°C, 15 seconds 6. Final extension, 72°C, 5 min 7. Cooling, maintain at 4℃ -Repeat steps 3 to 5 12 times
[0427] 8.dPCR Quantification - After the pre-amplification from step 7 is finished, add 2 μL of the mixture from step 7 to a reaction containing: 1x Q5U buffer 0.4mM dNTPs Primer Mix 2 or 3 0.2 μM Q5U polymerase 20U / mL EvaGreen dye 2x Alexa Fluor 700 dye 0.0003μg / μL TWEEN20 0.2% Total volume: 12 μL Primer Mix 2 has the following: Forward primer (SEQ ID NO: 18): 5'-GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGAC-3' Reverse primer (SEQ ID NO: 19): 5'-GCCTCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3' Primer Mix 3 has the following: Forward primer (SEQ ID NO: 20): 5'-ACGTACTGGTGAAAACACCGCAG-3' Reverse primer (SEQ ID NO: 21): 5'-GCCTCCTTCTGCATGGTATTCTTT-3' Place sample in a capped QIAcuity Digital PCR System at -105°C 1. Denaturation starting temperature: 98℃, 1 minute 2. Denaturation: 98℃, 10 seconds 3. Annealing: 63°C, 15 seconds 4. Extension: 72°C, 15 seconds 5. Final extension, 72°C, 5 min 6. Cool to 35℃ for 1 minute -Repeat steps 2 to 4 30 times Acquire images of the green and yellow channel partitions with exposure times of 600 ms and 700 ms, respectively, and gains of 6 and 8. The data obtained from such an experiment are shown in Figure 5.
[0428] Example 4: Detection of EGFR exon 20 T790M variant in different mutant allele fractions (VAF) 1. Bead Preparation Bead Blocking Process - Take 1 μL of beads per sample and place them in a 1.5 mL Eppendorf tube (ThermoFisher Dynabeads MyOne Streptavidin C1 catalog 65001). Up to 100 μL of beads can be blocked with 1 mL of blocking solution. - Place the tube containing the beads on a magnet and wait until the beads separate and the solution becomes clear. - Remove the storage buffer. -Add 1 mL of blocking buffer (1x PBS, 0.1% Tween-20, 1 μg / mL t-RNA) to the tube containing the beads. Rotate at 15 rpm for 30 min at -RT. buffer exchange -Spin down the beads and place on a magnet until the beads separate and the solution becomes clear. - Remove the blocking solution. Add 10 μL of 2× Binding Buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) for every 1 μL of beads. - Mix the beads by vortexing for 5 seconds.
[0429] 2. Oligonucleotide Hybridization - Prepare dilutions of oligonucleotides in 1x SSC buffer (5x SSC, 5x Denhardt's solution, 5mM EDTA, 0.1% SDS) -2 pM probe oligonucleotide WT 0-200fM Mutant oligonucleotide 0.2-100 fM - 50 μL of oligonucleotide was prepared per 1 μL of beads. Incubate at -95°C for 5 minutes and at 60°C for 72 hours. Probe oligonucleotide (SEQ ID NO: 13): 5'- / 5Biosg / TTTTTTTTTTTTTTTTTTTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATG-3' WT oligonucleotide (SEQ ID NO: 14): 5'-CTGGTCCCTCATTGCACTGTACTCCCATCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAATATGTGTCGAGAATATCCAAGAGACAGGTTTCT-3' Mutant oligonucleotide (SEQ ID NO: 15): 5'-CTGGTCCCTCATTGCACTGTACTCCACGTACTGGTGAAAACACCGCAGGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTGGAAGAGAAAGAATACCATGCAGAAGGAGGCGTGTCGAGAATATCCAAGAGACAGGTTTCT-3' ( / 5Biosg represents biotin at the 5' end.)
[0430] 3. Attachment of oligonucleotides to beads - Mix the beads and oligonucleotides in the following ratio: 2xBinding buffer 40uL 10 μL of beads from step 1 50 μL of oligonucleotide from step 2 Rotate at 15 rpm for 30 min at -RT.
[0431] 4. Bead Washing - After the attachment step is complete - spin down the sample and place it on the magnet for 7 minutes. Remove 80 μL of the 100 μL supernatant and add 100 μL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%). -Vortex the sample for 10 seconds and spin down. - Place the sample on the magnet and wait 2 minutes. Remove 90 µL of the 120 µL supernatant and add 100 µL of 1x wash buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant and add 100 μL of 1× Wash Buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant, remove the sample from the magnet and add 100 μL of 1x BFF6 buffer (Tris acetate pH=7.0 10 mM, potassium acetate 30 mM, magnesium acetate 17.125 mM, TWEEN 20 0.01%). -Spin down the sample, place the sample on the magnet and wait 2 minutes. Remove the 1x BFF6 buffer.
[0432] 5. PPL reaction The PPL mixture is added to the beads kept at -4°C. The PPL has the following composition: 1 x BFF6-0.1% Tween-20 20U / mL Klenow(exo-) 2U / mL apyrase + / -0.05mM PPi Total volume: 20 μL Incubate at -40°C for 10 minutes and rest at 4°C.
[0433] 6. TIPP Reaction -Once the PPL reaction has reached 4°C, add 5 μL of TIPP mixture with: 1 x BFF6-0.1% Tween-20 16U / mL TIPP 20 μL of the mixture from step 5. Total volume: 25 μL Incubate at -37°C for 5 minutes, 60°C for 10 minutes, and rest at 60°C.
[0434] 7. Preamplification - Place the sample from step 6 on a magnet held on a hot plate and heat to 60°C. - After the beads have separated, take 2 μL of the supernatant and add it to the following mixture: 1x Q5U buffer 0.4mM dNTPs Primer Mix 1 0.1 μM Q5U polymerase 20U / mL UDG 10U / mL Total volume: 12.5 μL Q5U buffer: Primer Mix 1 has the following: Forward primer (SEQ ID NO: 16): 5'-AGAAACCTGTCTCTTGGATATTCTCGACAC-3' Reverse primer (SEQ ID NO: 17): 5'-CTGGTCCCTCATTGCACTGTACTCC-3' - Place samples in a thermocycler and incubate covered at 105°C. 1.UDG 37℃, 1 minute 2. Denaturation starting temperature: 98℃, 1 minute 3. Denaturation: 98℃, 10 seconds 4. Annealing: 63°C, 15 seconds 5. Extension: 72°C, 15 seconds 6. Final extension, 72°C, 5 min 7. Cooling, maintain at 4℃ -Repeat steps 3 to 5 12 times
[0435] 8.dPCR Quantification - After the pre-amplification from step 7 is finished, add 2 μL of the mixture from step 7 to a reaction containing: 1x Q5U buffer 0.4mM dNTPs Primer Mix 2 or 3 0.2 μM Q5U polymerase 20U / mL EvaGreen dye 2x Alexa Fluor 700 dye 0.0003μg / μL TWEEN20 0.2% Total volume: 12 μL Primer Mix 2 has the following: Forward primer (SEQ ID NO: 18): 5'-GCCTTGCCAGCCCGCTCAGATATTGTCTTTGTGTTCCCGGAC-3' Reverse primer (SEQ ID NO: 19): 5'-GCCTCCCTCGCGCCATCAGCATCTGCCTCACCTCCACCG-3' Primer Mix 3 has the following: Forward primer (SEQ ID NO: 20): 5'-ACGTACTGGTGAAAACACCGCAG-3' Reverse primer (SEQ ID NO: 21): 5'-GCCTCCTTCTGCATGGTATTCTTT-3' Place sample in a capped QIAcuity Digital PCR System at -105°C 1. Denaturation starting temperature: 98℃, 1 minute 2. Denaturation: 98℃, 10 seconds 3. Annealing: 63°C, 15 seconds 4. Extension: 72°C, 15 seconds 5. Final extension, 72°C, 5 min 6. Cool to 35℃ for 1 minute -Repeat steps 2 to 4 30 times Acquire images of the green and yellow channel partitions with exposure times of 600 ms and 700 ms, respectively, and gains of 6 and 8. The data obtained from such an experiment are shown in Figure 6.
[0436] Example 5: Effect of hybridization buffer and hybridization time on the detection of EGFR exon 20 T790M variant at 0.1% VAF. 1. Bead Preparation a. Bead blocking step - Take 1 μL of beads per sample and place them in a 1.5 mL Eppendorf tube (ThermoFisher Dynabeads MyOne Streptavidin C1 catalog 65001). Up to 100 μL of beads can be blocked with 1 mL of blocking solution. - Place the tube containing the beads on a magnet and wait until the beads separate and the solution becomes clear. - Remove the storage buffer. -Add 1 mL of blocking buffer (1x PBS, 0.1% Tween-20, 1 μg / mL t-RNA) to the tube containing the beads. Rotate at 15 rpm for 30 min at -RT.
[0437] b.Buffer exchange -Spin down the beads and place on a magnet until the beads separate and the solution becomes clear. - Remove the blocking solution. Add 10 μL of 2× Binding Buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) for every 1 μL of beads. - Mix the beads by vortexing for 5 seconds.
[0438] 2. Oligonucleotide Hybridization - Dilutions of oligonucleotides are prepared in: Buffer 1: 1x SSC buffer (5x SSC, 5x Denhardt's solution, 5x mM EDTA, 0.1% SDS) or Buffer 2: ULTRAhyb™ Ultrasensitive Hybridization Buffer (Cat. No. AM8670) or Buffer 3: 1x SSC+DS buffer (5x SSC, 5x Denhardt solution, 5mM EDTA, 0.1% SDS, 5% dextran sulfate) -2 pM probe oligonucleotide WT oligonucleotide mixture 198 fM Mutant oligonucleotide mixture 2 fM 380ng of genomic DNA - Prepare 50 μL of oligonucleotide per 1 μL of beads. Incubate at -95°C for 5 minutes and at 60°C for 1 / 3 hour. Probe oligonucleotide (SEQ ID NO: 12): 5'- / 5Biosg / TTTTTTTTTTTTTTTTTTTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATG-3' ( / 5Biosg represents biotin at the 5' end.) The WT oligonucleotide mix has: Forward strand 1 (SEQ ID NO: 22): 5'-AATGATACGGCGACCACCGAGATCTACACTGGTAATTACCGACGAAAACGGCCCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACCGCAAGACTGTAACCACGCGTATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 2 (SEQ ID NO: 23): 5’-CAAGCAGAAGACGGCATACGAGATACGCGTGGTTACAGTCTTGCGGTTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGCATGAGCTGCGTGATGAGCTGCACGGGCCGTTTTCGTCGGTAATTACCAGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 2 (SEQ ID NO: 24): 5’-AATGATACGGCGACCACCGAGATCTACACATGAAAGCTGGCTACAGGAAGGCTCAAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCCAATATTGAAACCCACGGCATGGTGATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 2 (SEQ ID NO: 25): 5’-CAAGCAGAAGACGGCATACGAGATCACCATGCCGTGGGTTTCAATATTGGGACCTTACCTTATACACCGTGCCGAACGCACCGGAGCCCAGCACTTTGATCTTTTTGAGCCTTCCTGTAGCCAGCTTTCATGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 3 (SEQ ID NO: 26): 5’-AATGATACGGCGACCACCGAGATCTACACCAGCCGCCGCGGTAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAGAATTGGCGGGGGAGCACATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 3 (SEQ ID NO: 27): 5’-CAAGCAGAAGACGGCATACGAGATGTGCTCCCCCGCCAATTCTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCCAGCCCAAAATCTGTGATCTTACCGCGGCGGCTGGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 4 (SEQ ID NO: 28): 5’-AATGATACGGCGACCACCGAGATCTACACGGAAGTGAAAAGTCGTAACAAGGCATGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTCTGCATCGATGAAGAACGCAGCATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 4 (SEQ ID NO: 29): 5’-CAAGCAGAAGACGGCATACGAGATGCTGCGTTCTTCATCGATGCAGAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCACTGTAGCTAGACCAAAATCATGCCTTGTTACGACTTTTCACTTCCGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 5 (SEQ ID NO: 30): 5’-AATGATACGGCGACCACCGAGATCTACACAGGCGCTGTTTGGTCTCTTAGCCAGGAAGCATACGTGATGGCTGGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCATCAGGAATCATTAGCGGTAGCGAATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 5 (SEQ ID NO: 31): 5’-CAAGCAGAAGACGGCATACGAGATTCGCTACCGCTAATGATTCCTGATGCCCAGAAGGCGGGAGACATATGGGGAGCCCACACCAGCCATCACGTATGCTTCCTGGCTAAGAGACCAAACAGCGCCTGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 6 (SEQ ID NO: 32): 5’-AATGATACGGCGACCACCGAGATCTACACGAGCCGGTAGTGTTGAAAGGAGGTCCATCATCTCTGCGGTGGTTGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGCTTTGCCTGCACTCATTGAAGGATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 6 (SEQ ID NO: 33): 5'-CAAGCAGAAGACGGCATACGAGATCCTTCAATGAGTGCAGGCAAAGCCAAAGACCACCCCCAAGACCACGACCAGCAGAATGCCAACCACCGCAGAGATGATGGACCTCCTTTCAACACTACCGGCTCGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 7 (SEQ ID NO: 34): 5'-AATGATACGGCGACCACCGAGATCTACACTGGCTCAGGAAGAACGCAGTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGATGGAGCATGTGGTTTAATTGCGAATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 7 (SEQ ID NO: 35): 5'-CAAGCAGAAGACGGCATACGAGATTCGCAATTAAACCACATGCTCCATCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACCAGCTCCAACTACCACAACTGCGTTCTTCCTGAGCCAGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 8 (SEQ ID NO: 36): 5'-AATGATACGGCGACCACCGAGATCTACACCCTTGGTCATTTAGAGGAAGTGGCTACTGGTCCCTCATTGCACTGTACTCCTCTTGACCTGCTGTGTCGAGAATATCCAAGAGACAGGTTTCTCCATGCATCGATGAAGAACGCAGCATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 8 (SEQ ID NO: 37): 5'-CAAGCAGAAGACGGCATACGAGATGCTGCGTTCTTCATCGATGCATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTAGCCACTTCCTCTAAATGACCAAGGGTGTAGATCTCGGTGGTCGCCGTATCATT-3' The mutant oligonucleotide mixture has: Forward strand 1 (SEQ ID NO: 38): 5'-AATGATACGGCGACCACCGAGATCTACACTGATTTCGGTGCGTCTGAATGCCCGTGCAGCTCATCATGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACCGAAACACGCTACGGCAGCATATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 1 (SEQ ID NO: 39): 5'-CAAGCAGAAGACGGCATACGAGATATGCTGCCGTAGCGTGTTTCGGTTCCCGGACATAGTCCAGGAGGCAGCCGAAGGGCATGAGCTGCATGATGAGCTGCACGGGCATTCAGACGCACGGAAATCAGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 2 (SEQ ID NO: 40): 5'-AATGATACGGCGACCACCGAGATCTACACGTTGAAAATGGTCTGCTGCTGTTCAAAAAGATCAAAGTGCTGGCCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCCTCTGTGGTGGATGAAGCCAATAATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 2 (SEQ ID NO: 41): 5’-CAAGCAGAAGACGGCATACGAGATTATTGGCTTCATCCACCACAGAGGGACCTTACCTTATACACCGTGCCGAACGCACCGGAGGCCAGCACTTTGATCTTTTTGAACAGCAGCAGACCATTTTCAACGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 3 (SEQ ID NO: 42): 5’-AATGATACGGCGACCACCGAGATCTACACGCGGTAATTCCAGCTCCAAGTGATCACAGATTTTGGGCGTGCCAAACTGCTGGGTGCGGAAGAGAAAGAATACCATGCAGAGAGAGGTGCAAATTCTGGGATCTATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 3 (SEQ ID NO: 43): 5’-CAAGCAGAAGACGGCATACGAGATAGATCCCAGAATTTGCACCTCTCTCTGCATGGTATTCTTTCTCTTCCGCACCCAGCAGTTTGGCACGCCCAAAATCTGTGATCACTTGGAGCTGGAATTACCGCGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 4 (SEQ ID NO: 44): 5’-AATGATACGGCGACCACCGAGATCTACACGCATCGATGAAGAACGCAGCTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCGCATATCAATAAGCGGAGGAATCTCGTATGCCGTCTTCTGCTTG-3’ Reverse strand 4 (SEQ ID NO: 45): 5’-CAAGCAGAAGACGGCATACGAGATTCCTCCGCTTATTGATATGCGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTCTCTGTAGCTAGACCAAAATCAGCTGCGTTCTTCATCGATGCGTGTAGATCTCGGTGGTCGCCGTATCATT-3’ Forward strand 5 (SEQ ID NO: 46): 5'-AATGATACGGCGACCACCGAGATCTACACTGGCTAGTGGCATTCTGATGCGGAAGCATACGTGATGGCTGTGTGTGTGGGCTCCCCATATGTCTCCCGCCTTCTGGGCATGCAAGGGCGGCTAAAGTATCAATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 5 (SEQ ID NO: 47): 5'-CAAGCAGAAGACGGCATACGAGATTGATACTTTAGCCGCCCTTGCATGCCCAGAAGGCGGGAGACATATGGGGAGCCCACACACAGCCATCACGTATGCTTCCGCATCAGAATGCCACTAGCCAGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 6 (SEQ ID NO: 48): 5'-AATGATACGGCGACCACCGAGATCTACACTGCAATGAGGACCGGTATATCTCTGTCCATCATCTCTGCGGTGGAAGGCATTCTGCTGGTCGTGGTCTTGGGGGTGGTCTTTGGTGGAATATTAACACGGGCGTGCATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 6 (SEQ ID NO: 49): 5'-CAAGCAGAAGACGGCATACGAGATGCACGCCCGTGTTAATATTCCACCAAAGACCACCCCCAAGACCACGACCAGCAGAATGCCTTCCACCGCAGAGATGATGGACAGAGATATACCGGTCCTCATTGCAGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 7 (SEQ ID NO: 50): 5'-AATGATACGGCGACCACCGAGATCTACACGAGGACAGGATTAGATACCCGGTTGTGGTAGTTGGAGCTTGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAGGAAGGTGGGGATGACGTATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 7 (SEQ ID NO: 51): 5'-CAAGCAGAAGACGGCATACGAGATACGTCATCCCCACCTTCCTCTGAATTAGCTGTATCGTCAAGGCACTCTTGCCTACGCCACAAGCTCCAACTACCACAACCGGGTATCTAATCCTGTCCTCGTGTAGATCTCGGTGGTCGCCGTATCATT-3' Forward strand 8 (SEQ ID NO: 52): 5'-AATGATACGGCGACCACCGAGATCTACACGCTCAGGAAGAACGCTGGTACTGGTCCCTCATTGCACTGTACTCCTCGTGACCTGCTGTGTCGAGAATATCCAAGAGACAGGTTTCTCCATCGAAGTACATGTGTAGCGGTGATCTCGTATGCCGTCTTCTGCTTG-3' Reverse strand 8 (SEQ ID NO: 53): 5'-CAAGCAGAAGACGGCATACGAGATCACCGCTACACATGTACTTCGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCACGAGGAGTACAGTGCAATGAGGGACCAGTACCAGCGTTCTTCCTGAGCGTGTAGATCTCGGTGGTCGCCGTATCATT-3'
[0439] 3. Attachment of oligonucleotides to beads - Mix the beads and oligonucleotides in the following ratio: 2xBinding buffer 40uL 10 μL of beads from step 1 50 μL of oligonucleotide from step 2 Rotate at 15 rpm for 30 min at -RT.
[0440] 4. Bead Washing - After the attachment step is complete - spin down the sample and place it on the magnet for 7 minutes. Remove 80 μL of the 100 μL supernatant and add 100 μL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%). -Vortex the sample for 10 seconds and spin down. - Place the sample on the magnet and wait 2 minutes. Remove 90 µL of the 120 µL supernatant and add 100 µL of 1x wash buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant and add 100 μL of 1× Wash Buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant, remove the sample from the magnet and add 100 μL of 1x BFF6 buffer (Tris acetate pH=7.0 10 mM, potassium acetate 30 mM, magnesium acetate 17.125 mM, TWEEN 20 0.01%). -Spin down the sample, place the sample on the magnet and wait 2 minutes. Remove the 1x BFF6 buffer.
[0441] 5. PPL reaction The PPL mixture is added to the beads kept at -4°C. The PPL consists of the following composition: 1 x BFF6-0.1% Tween-20 20U / mL Klenow(exo-) 2U / mL apyrase 0.05mM PPi Total volume: 20 μL Incubate at -40°C for 10 minutes and rest at 4°C.
[0442] 6. TIPP Reaction -Once the PPL reaction has reached 4°C, add 5 μL of TIPP mixture with: 1 x BFF6-0.1% Tween-20 16U / mL TIPP 20 μL of the mixture from step 5. Total volume: 25 μL Incubate at -37°C for 5 minutes, 60°C for 10 minutes, and rest at 60°C.
[0443] 7. Preamplification - Place the sample from step 6 on a magnet held on a hot plate and heat to 60°C. - After the beads have separated, take 2 μL of the supernatant and add it to the following mixture: 1x Q5U buffer 0.4mM dNTPs Primer Mix 4 0.1 μM Q5U polymerase 20U / mL UDG 10U / mL Total volume: 12.5 μL Q5U buffer: Primer Mix 4 has the following: Forward primer (SEQ ID NO: 54): 5'-AATGATACGGCGACCACCGAGATCTACAC-3' Reverse primer (SEQ ID NO: 55): 5'-AATGATACGGCGACCACCGAGATCTACAC-3' - Place samples in a thermocycler and incubate covered at 105°C. 1.UDG 37℃, 1 minute 2. Denaturation starting temperature: 98℃, 1 minute 3. Denaturation: 98℃, 10 seconds 4. Annealing: 63°C, 15 seconds 5. Extension: 72°C, 15 seconds 6. Final extension, 72°C, 5 min 7. Cooling, maintain at 4℃ -Repeat steps 3 to 5 12 times
[0444] 8.dPCR Quantification - After the pre-amplification from step 7 is finished, add 2 μL of the mixture from step 7 to a reaction containing: 1x Q5U buffer 0.4mM dNTPs Primer Mix 5 or 6 0.2 μM Q5U polymerase 20U / mL EvaGreen dye 2x Alexa Fluor 700 dye 0.0003μg / μL TWEEN20 0.2% Total volume: 12 μL Primer Mix 5 has the following: Forward primer (SEQ ID NO: 56): 5'-TGGTAATTACCGACGAAAACGGC-3' Reverse primer (SEQ ID NO: 57): 5'-ACGCGTGGTTACAGTCTTGCG-3' Primer Mix 6 has: Forward primer (SEQ ID NO: 58): 5'-TGATTTCCGTGCGTCTGAATGC-3' Reverse primer (SEQ ID NO: 59): 5'-ATGCTGCCGTAGCGTGTTTCG-3' Place sample in a capped QIAcuity Digital PCR System at -105°C 1. Denaturation starting temperature: 98℃, 1 minute 2. Denaturation: 98℃, 10 seconds 3. Annealing: 63°C, 15 seconds 4. Extension: 72°C, 15 seconds 5. Final extension, 72°C, 5 min 6. Cool to 35℃ for 1 minute -Repeat steps 2 to 4 30 times Acquire images of the green and yellow channel partitions with exposure times of 600 ms and 700 ms, respectively, and gains of 6 and 8. The data obtained from such an experiment are shown in Figure 7.
[0445] Example 6: Enrichment factors for the EGFR exon 20 T790M variant. 1. Bead Preparation a. Bead blocking step - Take 1 μL of beads per sample and place them in a 1.5 mL Eppendorf tube (ThermoFisher Dynabeads MyOne Streptavidin C1 catalog 65001). Up to 100 μL of beads can be blocked with 1 mL of blocking solution. - Place the tube containing the beads on a magnet and wait until the beads separate and the solution becomes clear. - Remove the storage buffer. -Add 1 mL of blocking buffer (1x PBS, 0.1% Tween-20, 1 μg / mL t-RNA) to the tube containing the beads. Rotate at 15 rpm for 30 min at -RT.
[0446] b.Buffer exchange -Spin down the beads and place on a magnet until the beads separate and the solution becomes clear. - Remove the blocking solution. Add 10 μL of 2× Binding Buffer (40 mM TrisHCl pH=7.5, 1 M NaCl, 2 mM EDTA, 0.02% TWEEN 20) for every 1 μL of beads. - Mix the beads by vortexing for 5 seconds.
[0447] 2. Oligonucleotide Hybridization - Dilutions of oligonucleotides are prepared in: Buffer 1: 1x SSC buffer (5x SSC, 5x Denhardt's solution, 5x mM EDTA, 0.1% SDS) or Buffer 2: ULTRAhyb™ Ultrasensitive Hybridization Buffer (Thermo Fisher catalog number AM8670) or Buffer 3: ULTRAhyb™-Oligo (Thermo Fisher catalog number AM8663) or Buffer 4: 1x SSC + 10% formamide buffer (5x SSC, 5x Denhardt's solution, 5mM EDTA, 0.1% SDS, 10% formamide), or Buffer 5: 1x SSC + 25% formamide buffer (5x SSC, 5x Denhardt's solution, 5mM EDTA, 0.1% SDS, 25% formamide), or Buffer 6: 1x SSC + 48% formamide buffer (5x SSC, 5x Denhardt's solution, 5mM EDTA, 0.1% SDS, 48% formamide) -2 pM probe oligonucleotide WT oligonucleotide mixture 198 / 199.8 fM Mutant oligonucleotide mixture 2 / 0.2 fM 380ng of genomic DNA - Prepare 50 μL of oligonucleotide per 1 μL of beads. Incubate at -95°C for 5 minutes and at 60°C for 1 / 3 hour. The WT oligonucleotide mixture has SEQ ID NOs: 22-37. The mutant oligonucleotide mixture has SEQ ID NOs: 38-53.
[0448] 3. Attachment of oligonucleotides to beads - Mix the beads and oligonucleotides in the following ratio: 2xBinding buffer 40uL 10 μL of beads from step 1 50 μL of oligonucleotide from step 2 Rotate at 15 rpm for 30 min at -RT.
[0449] 4. Bead Washing - After the attachment step is complete - spin down the sample and place it on the magnet for 7 minutes. Remove 80 μL of the 100 μL supernatant and add 100 μL of 1× wash buffer (TrisHCl pH=7.5 20 mM, NaCl 0.5 M, EDTA 1 mM, TWEEN20 0.1%). -Vortex the sample for 10 seconds and spin down. - Place the sample on the magnet and wait 2 minutes. Remove 90 µL of the 120 µL supernatant and add 100 µL of 1x wash buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant and add 100 μL of 1× Wash Buffer. - Mix the sample by changing the sample position on the magnet (10 times). Wait 2 minutes. - Remove the entire supernatant, remove the sample from the magnet and add 100 μL of 1x BFF6 buffer (Tris acetate pH=7.0 10 mM, potassium acetate 30 mM, magnesium acetate 17.125 mM, TWEEN 20 0.01%). -Spin down the sample, place the sample on the magnet and wait 2 minutes. Remove the 1x BFF6 buffer.
[0450] 5. PPL reaction The PPL mixture is added to the beads kept at -4°C. The PPL consists of the following composition: 1 x BFF6-0.1% Tween-20 20U / mL Klenow(exo-) 2U / mL apyrase 0.05mM PPi Total volume: 20 μL Incubate at -40°C for 10 minutes and rest at 4°C.
[0451] 6. TIPP Reaction -Once the PPL reaction has reached 4°C, add 5 μL of TIPP mixture with: 1 x BFF6-0.1% Tween-20 16U / mL TIPP 20 μL of the mixture from step 5. Total volume: 25 μL Incubate at -37°C for 5 minutes, 60°C for 10 minutes, and rest at 60°C.
[0452] 7. Preamplification - Place the sample from step 6 on a magnet held on a hot plate and heat to 60°C. - After the beads have separated, take 2 μL of the supernatant and add it to the following mixture: 1x Q5U buffer 0.4mM dNTPs Primer Mix 4 0.1 μM Q5U polymerase 20U / mL UDG 10U / mL Total volume: 12.5 μL Q5U buffer: Primer Mix 4 consists of: Forward primer (SEQ ID NO: 54): 5'-AATGATACGGCGACCACCGAGATCTACAC-3' Reverse primer (SEQ ID NO: 55): 5'-AATGATACGGCGACCACCGAGATCTACAC-3' - Place samples in a thermocycler and incubate covered at 105°C. 1.UDG 37℃, 1 minute 2. Denaturation starting temperature: 98℃, 1 minute 3. Denaturation: 98℃, 10 seconds 4. Annealing: 63°C, 15 seconds 5. Extension: 72°C, 15 seconds 6. Final extension, 72°C, 5 min 7. Cooling, maintain at 4℃ -Repeat steps 3 to 5 12 times
[0453] 8.dPCR Quantification - After the pre-amplification from step 7 is finished, add 2 μL of the mixture from step 7 to a reaction containing: 1x Q5U buffer 0.4mM dNTPs Primer Mix 5 or 6 0.2 μM Q5U polymerase 20U / mL EvaGreen dye 2x Alexa Fluor 700 dye 0.0003μg / μL TWEEN20 0.2% Total volume: 12 μL Primer Mix 5 has the following: Forward primer (SEQ ID NO: 56): 5'-TGGTAATTACCGACGAAAACGGC-3' Reverse primer (SEQ ID NO: 57) 5'-ACGCGTGGTTACAGTCTTGCG-3' Primer Mix 6 has: Forward primer (SEQ ID NO: 58): 5'-TGATTTCCGTGCGTCTGAATGC-3' Reverse primer (SEQ ID NO: 59): 5'-ATGCTGCCGTAGCGTGTTTCG-3' Place sample in a capped QIAcuity Digital PCR System at -105°C 1. Denaturation starting temperature: 98℃, 1 minute 2. Denaturation: 98℃, 10 seconds 3. Annealing: 63°C, 15 seconds 4. Extension: 72°C, 15 seconds 5. Final extension, 72°C, 5 min 6. Cool to 35℃ for 1 minute -Repeat steps 2 to 4 30 times Acquire images of the green and yellow channel partitions with exposure times of 600 ms and 700 ms, respectively, and gains of 6 and 8. The data obtained from such an experiment are shown in Figure 8.
Claims
1. 1. A method for increasing the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the sample comprising at least a first and a second nucleic acid molecule, the method comprising the steps of: a. separating the sample containing one or more nucleic acid analytes from one of the following: i. Single-stranded probe oligonucleotide A 0 wherein the probe has greater complementarity to one of the first or second nucleic acid molecules than to the other of the first or second nucleic acid molecules. 0 into a first reaction mixture comprising: b. The reaction mixture produced by step (a) is subjected to one of the following: i. pyrophosphorolytic enzyme; and ii. Pyrophosphate ion source into a second reaction mixture comprising A 0 anneals better to one of the nucleic acid molecules than to the other of the nucleic acid molecules, 0 forms a double-stranded complex with the nucleic acid molecule, and A 0 any A molecule that is pyrophosphorolyzed in the 3'-5' direction from its 3' end to produce an at least partially double-stranded intermediate product that anneals to a lesser extent than the other nucleic acid molecule. 0 A hybridized to the nucleic acid molecule 0 pyrophosphorolysis to a lesser extent in the 3'-5' direction; c. A formed with said nucleic acid molecule by: 0 Separating the sequence complex, comprising: i. separating the strands of said complex as a result of pyrophosphorolysis, or ii. The reaction mixture is heated to a temperature sufficient to separate the strands of the complex, but not to separate any A strands annealed to other strands of the nucleic acid molecule. 0 heating to a temperature below that required to separate the molecules; and d.A 0 , and thus any nucleic acid sequence that remains annealed thereto, is referred to as A 0 from any nucleic acid sequences not annealed to said nucleic acid sequence.
2. The separation in step (d) can be carried out by depositing A onto a solid support before or after step (a). 0 The method of claim 1 , wherein the method is carried out by capturing
3. A 0 2. The method of claim 1, further comprising a 5' tail region that is not complementary to either the first nucleic acid sequence or the second nucleic acid sequence.
4. The capture onto the solid support is 0 another oligo C containing a capture moiety via which it is bound to the solid support either before or after hybridization with 0 A to 0 and the hybridization of the 5' tail region of said A 0 3. The method of claim 2, wherein the 5' tail region of is not complementary to either the first nucleic acid sequence or the second nucleic acid sequence.
5. A 0 The method of claim 2, wherein said solid support further comprises a capture moiety via which said solid support is bound.
6. The method of claim 2 , wherein the solid support is a bead.
7. The method of claim 6, wherein the beads are magnetic or paramagnetic beads.
8. 1. A method for altering the ratio of a first nucleic acid molecule to a second nucleic acid molecule in a sample, the sample comprising at least the first and second nucleic acid molecules, the method comprising the steps of: a. A sample containing one or more nucleic acid analytes i. Single-stranded probe oligonucleotide A 0 the single-stranded probe oligonucleotide A, wherein the probe has greater complementarity to the first nucleic acid molecule than to the second nucleic acid molecule; 0 ; ii. pyrophosphorolytic enzyme; and iii. introducing into the first reaction mixture a pyrophosphate ion source, A 0 anneals better to the first nucleic acid molecule than to the second nucleic acid molecule, and A 0 The 3' end of A forms a double-stranded complex with the first nucleic acid molecule, 0 to generate an at least partially double-stranded intermediate product that is pyrophosphorolyzed in the 3'-5' direction from its 3' end, and any A that is annealed to the second nucleic acid molecule 0 A is annealed to the first nucleic acid molecule 0 the step of pyrophosphorolysis to a lesser extent in the 3'-5' direction; b. any truncated A that anneals to the first nucleic acid molecule 0 Selectively denaturing the sequence complex; and c.A 0 , and ultimately A 0 The second nucleic acid sequence, which remains annealed to A, 0 separating said first nucleic acid sequence from said first nucleic acid sequence that is not annealed to said second nucleic acid molecule, thereby changing the ratio of said first nucleic acid molecule to said second nucleic acid molecule.
9. 1. A method for increasing the ratio of a first nucleic acid sequence to a second nucleic acid sequence in a sample, the sample comprising at least a first and a second nucleic acid molecule, the method comprising the steps of: a. separating the sample containing one or more nucleic acid analytes from one of the following: i. Single-stranded probe oligonucleotide A 0 wherein the probe has greater complementarity to one of the first or second nucleic acid molecules than to the other of the first or second nucleic acid molecules. 0 ; ii. pyrophosphorolytic enzyme; and iii. a pyrophosphate ion source; into a first reaction mixture comprising A 0 anneals better to one of the nucleic acid molecules than to the other of the nucleic acid molecules, 0 forms a double-stranded complex with the nucleic acid molecule, and A 0 any A molecule that is pyrophosphorolyzed in the 3'-5' direction from its 3' end to produce an at least partially double-stranded intermediate product that anneals to a lesser extent than the other nucleic acid molecule. 0 A hybridized to the nucleic acid molecule 0 pyrophosphorolysis to a lesser extent in the 3'-5' direction; b. A formed using the nucleic acid molecule annealed by: 0 Separating the sequence complex, comprising: i. separating the strands of said complex as a result of pyrophosphorolysis, or ii. The reaction mixture is heated to a temperature sufficient to separate the strands of the complex, but to separate any A strands that have annealed to a lesser extent than the other strands of the nucleic acid molecule. 0 heating to a temperature below that required to separate the molecules; and c.A 0 , and thus any nucleic acid sequence that remains annealed thereto, is referred to as A 0 from any nucleic acid sequences not annealed to said nucleic acid sequence.
Citation Information
Patent Citations
Methods and systems related to 2'-terminator nucleotides
JP2007527217A
Methods of Enriching Mutated Nucleic Acids from a Mixture
JP2016539624A
Improved polynucleotide sequence detection method
WO2020016590A1