Compounds and methods for specifically targeting the HAX1 gene

Abstract

The present invention relates to "single guide RNA" (sgRNA) molecules and combinations of two sgRNA molecules targeting the gene encoding HCLS1-associated protein X-1 (HAX1 gene) in an organism; "repair template nucleic acid molecules" for correcting a mutation in the HAX1 gene in an organism; vectors comprising said sgRNA or the combination of two sgRNA molecules or said repair template nucleic acid molecule; compositions comprising said sgRNA molecule or the combination of two sgRNA molecules or said repair template nucleic acid molecule; in vitro methods for targeting the HAX1 gene in biological material comprising genetic material encoding the HAX1 gene; methods for preventing, treating and / or testing for disease in an organism; and methods for editing and / or correcting a mutant allele of the HAX1 gene in a cell.

Description

[Technical Field]

[0001] The present invention relates to "single guide RNA" (sgRNA) molecules and combinations of two sgRNA molecules that target the gene encoding the HCLS1-associated protein X-1 (HAX1 gene) in an organism; "repair template nucleic acid molecules" for correcting mutations in the HAX1 gene in an organism; vectors comprising said sgRNA or combinations of two sgRNA molecules or said repair template nucleic acid molecules; compositions comprising said sgRNA molecule or combinations of two sgRNA molecules or said repair template nucleic acid molecules; in vitro methods for targeting the HAX1 gene in biological material comprising genetic material encoding the HAX1 gene; methods for preventing, treating and / or testing for disease in an organism; and methods for editing and / or correcting mutant alleles of the HAX1 gene in a cell.

[0002] The present invention relates to the field of molecular medicine, more particularly to the field of genetic engineering applications, preferably to targeting disease-related genes. [Background technology]

[0003] Neutropenia is a disease characterized by abnormally low levels of neutrophils in the blood and bone marrow. Neutrophils make up the majority of circulating white blood cells and provide the primary defense against infection by destroying bacteria, their fragments, and viruses bound to immunoglobulins in the blood. Patients with neutropenia are susceptible to bacterial infections, which, if not promptly treated, can become life-threatening (neutropenic sepsis). Neutropenia can be acute (transient) or chronic (long-term). The term "neutropenia" is sometimes used interchangeably with "leukopenia" ("decreased white blood cell count").

[0004] Neutropenia can be divided into acquired and congenital forms. There are two main types of congenital neutropenia: severe congenital neutropenia (CN or SCN) and cyclic neutropenia (CyN).

[0005] Cyclic neutropenia is characterized by neutrophil counts ranging from normal to zero, whereas severe congenital neutropenia is characterized by a significantly reduced absolute neutrophil count (ANC) at birth (<500 cells / ml), arrest of myelopoiesis maturation in the bone marrow at the promyelocyte / myelocyte stage, and early onset of bacterial infections.

[0006] Severe congenital neutropenia can be diagnosed by a very low absolute blood neutrophil count and a bone marrow aspirate showing arrested myeloid cell maturation. Severe congenital neutropenia is usually diagnosed shortly after birth, whereas cyclic neutropenia typically presents at various ages and is primarily characterized by recurrent acute oral disease. Bone marrow examination is often required to rule out malignant hematopoietic transformation, measure cellularity, assess bone marrow maturation, and detect signs of the precise etiology. Currently, cytogenetic bone marrow examination is crucial when severe congenital neutropenia (CN / SCN) is suspected. Antineutrophil antibody assays, immunoglobulin assays (Ig GAM), lymphocyte immunophenotyping, pancreatic markers (serum trypsinogen and fecal elastase), and fat-soluble vitamin levels (vitamin A, vitamin E, and vitamin D) are also important when evaluating severe congenital neutropenia (CN / SCN) and cyclic neutropenia (CyN).

[0007] Some patients with severe congenital neutropenia have mutations in the gene encoding HCLS1-associated protein X-1 (HAX1 gene). Patients with severe congenital neutropenia with autosomal recessive HAX1 mutations (HAX1-CN / SCN) typically exhibit suppression of granulocyte maturation at the promyelocyte / myelocyte stage in the bone marrow. HAX1 mutations are frequently found in patients with familial severe congenital neutropenia, including those with Kostmann syndrome.

[0008] The majority of CN / SCN patients with HAX1 mutations have a loss-of-function mutation, p.W44X, which shifts the reading frame and creates a premature stop codon, resulting in the loss of HAX1 protein expression. A small proportion of CN / SCN patients with HAX1 mutations have deletions of exons 4-7 of the HAX1 gene, affecting two isoforms of the HAX1 protein expressed in hematopoietic and neural tissues, resulting in severe neutropenia and neurological abnormalities such as developmental delay, cognitive impairment, and / or epilepsy.

[0009] Furthermore, CN / SCN patients with HAX1 mutations are at increased risk of developing myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML).In HAX1-mutated CN / SCN patients with overt MDS / AML, somatic mutations in CSF3R and RUNX1 and the co-occurrence of trisomy 21 were detected at a frequency similar to that of CN patients with ELANE mutations.

[0010] Currently, neutropenia is treated with granulocyte-colony stimulating factor (G-CSF), a hematopoietic growth factor. G-CSF stimulates neutrophil production and delays their apoptosis. Recombinant G-CSF preparations, such as filgrastim, may be effective in patients with various forms of neutropenia, including severe congenital neutropenia and cyclic neutropenia. The dose required to induce neutrophil production varies significantly depending on the individual patient's condition. Although the overall survival rate for patients with severe congenital neutropenia is currently estimated to exceed 80%, 10% of patients with severe congenital neutropenia still die from severe bacterial infections or sepsis. Although treatment with G-CSF has been successful in preventing death from sepsis, prolonged treatment with G-CSF in patients with severe congenital neutropenia adversely affects signaling downstream of defective G-CSFR due to inherited HAX1 or ELANE mutations, ultimately leading to leukemogenic transformation and myelodysplastic syndromes (MDS).

[0011] Hematopoietic stem cell transplantation (HSCT) is an alternative curative treatment for patients who do not respond to G-CSF therapy or who have developed acute myeloid leukemia or myelodysplastic syndromes (MDS). However, patients with congenital neutropenia who undergo HSCT are at increased risk of developing infectious complications, including fungal infections, and graft-versus-host disease.

[0012] Morishima et al. (2014), Genetic correction of HAX1 in induced pluripotent stem cells from a patient with severe congenital neutropenia improves defective granulopoiesis, Haematologica 99(1), pp. 19-27, describes that HAX1 gene deficiency can be corrected by transducing HAX1 cDNA into iPS cells derived from an HAX1 mutant patient using lentivirus.

[0013] Pittermann et al. (2017), Gene correction of HAX1 reversed Kostmann disease phenotype in patient-specific induced pluripotent stem cells, Blood Adv. 14, pp. 903-914, reported that HAX1 expression in immature myeloid progenitor cells W44X The use of CRISPR / Cas9 technology to experimentally correct the nonsense mutation is described. According to the authors, lentiviral expression of HAX1 did not restore granulocytic differentiation.

[0014] Ritter et al. (2020), Efficient correction of HAX1 mutations in primary HSPCS of severe congenital neutropenia patients using CRISPR / Cas9 gene-editing, European Hematology Association (Abstract) (EP1479), reported CD34 from CN patients with HAX1 mutations. + A study has described the combined application of CRISPR / Cas9 gene editing and rAAV6-mediated delivery of a homology-directed repair (HDR) template to a mutant HAX1 gene in primary bone marrow mononuclear cells (HSPCs), but the document does not disclose the use of specific compounds in the proposed method.

[0015] Under these circumstances, the present invention aims to provide new compounds and methods that enable targeted prevention, treatment, and / or testing of HAX1 gene-related diseases. Furthermore, the present invention provides compounds that can specifically and targetedly address the HAX1 gene or a mutant HAX1 gene. In particular, the present invention provides compounds that address frequently observed mutations in the HAX1 gene.

[0016] The present invention fulfills these and other needs. Summary of the Invention [Means for solving the problem]

[0017] The present invention provides a single guide RNA (sgRNA) molecule that targets a gene encoding HCLS1-associated protein X-1 (HAX1 gene) in an organism for use in the prevention, treatment, and / or testing of disease, the sgRNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 553.

[0018] The present invention also relates to a combination of two types of sgRNA molecules, each of which is an sgRNA molecule and is configured to bind to a nucleic acid containing the HAX1 gene in a PAMout positional relationship.

[0019] Furthermore, the present invention provides a repair template nucleic acid molecule for correcting a mutation in the HAX1 gene in an organism for use in the prevention, treatment and / or testing of a disease, the repair template nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 565.

[0020] In one embodiment, the object underlying the present invention is fulfilled by providing a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 565, preferably a nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 554 and 556 to 565.

[0021] The present inventors have discovered that the sgRNA nucleic acid molecules of the present invention can be used to specifically edit the HAX1 gene (preferably a mutant allele thereof). For example, in one embodiment of the present invention, an sgRNA molecule comprising or consisting of the nucleotide sequence set forth in SEQ ID NO: 552 is configured to specifically target the p.W44X (c.131insA) mutation in exon 2 of the human HAX1 gene (detailed description of the p.W44X mutation: DNA = NC_000001.11: g. 154273412_154273413insA; RNA = NM_006118.4: c.130_131insA; protein = NP_006109.2: p. (Trp44*)). In this mutation in the HAX1 protein, the tryptophan at amino acid position 44 is replaced with another amino acid. According to the findings of the present inventors, this mutation can be frequently found in HAX1 gene-related diseases such as severe congenital neutropenia / SCN (CN / SCN).

[0022] The inventors have also found that the number of undesired indels in a nucleic acid comprising or encoding a targeted HAX1 gene can be minimized by using a combination of two of the above-described sgRNA molecules configured to bind to related Cas9 enzymes or nickases and / or to direct the related Cas9 enzymes or nickases to bind to a nucleic acid comprising an HAX1 gene in a PAM-out relationship.

[0023] The present inventors have also discovered that the repair template nucleic acid molecule of the present invention can repair or correct a mutated and / or edited HAX1 gene via homology-directed repair (HDR). For example, because the repair template contains a sequence homologous to the cleavage site previously introduced by the sgRNA molecule, it functions as a matrix for the cellular repair machinery and can synthesize a disrupted and / or mutated HAX1 gene. Preferably, the HAX1 gene is a human HAX1 gene containing the p.W44X (c.131insA) mutation in exon 2. By using the repair template of the present invention, the mutated HAX1 gene is repaired to an unmutated HAX1 gene. The repair template nucleic acid molecule contains five silent mutations between the HAX1 mutation and the cleavage site, thereby preventing re-cleavage of the correctly edited allele and incomplete homology-directed repair, thereby improving gene editing efficiency. Therefore, the present invention can provide a causal therapy for HAX1 gene-related diseases. In one embodiment of the present invention, the repair template nucleic acid can be provided and / or delivered as a single-stranded oligonucleotide DNA (ssODN). In another embodiment, the repair template nucleic acid can be provided in a recombinant vector, such as an rAAV vector or an rAAV6 vector, or an integrase-deficient lentiviral (IDLV) vector. In yet another embodiment, the repair template nucleic acid can be provided and / or delivered encapsulated in a nanoparticle.

[0024] Furthermore, the present inventors demonstrated that the present invention can re-express HAX1 protein in primary hematopoietic stem and progenitor cells (HSPCs) expressing mutant HAX1 protein with a correction efficiency of over 65% using CRISPR / Cas9 technology. This technology also significantly improved ex vivo granulocytic differentiation and significantly reduced H2O2-induced apoptosis in HAX1-corrected HSPCs.

[0025] This finding by the inventors was surprising and unexpected. DETAILED DESCRIPTION OF THE INVENTION

[0026] According to the present invention, a "single guide RNA (sgRNA)" or "guide RNA" is a component of the CRISPR complex that serves to guide the CRISPR endonuclease Cas9 to its target (i.e., the HAX1 gene). The sgRNA is a short non-coding ribonucleic acid (RNA) sequence that binds to a complementary target DNA sequence. The sgRNA guides the CRISPR endonuclease enzyme Cas9 to a specific location on the DNA of the HAX1 gene, where the CRISPR endonuclease enzyme Cas9 makes a double-stranded break.

[0027] As used herein, the term "nucleic acid molecule" encompasses both single-stranded and double-stranded deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) molecules in which natural nucleotides and / or chemically modified nucleotides are linearly linked. Modified nucleotides preferably contain, for example, 2'OMe bases, which enhance stability, potency, and resistance to nucleases.

[0028] By convention, all nucleotide sequences of the present invention are understood to be presented as DNA sequences, but the nucleotide sequences of the present invention also include RNA sequences. In the RNA sequences corresponding to the DNA sequences described herein, all thymines (T, t) are substituted with uracils (U, u). In particular, when referring to sgRNA molecules, such substitutions are made, but the DNA sequences are also explicitly described herein. This means, for example, that the nucleotide sequence represented by SEQ ID NO: 164: AGAAGAAGAAGGGGGCTCAT, described herein as a DNA sequence, includes the RNA nucleotide sequence represented by AGAAGAAGAAGGGGGCUCAU.

[0029] According to the present invention, the "HAX1 gene" encodes "HCLS1-related protein X-1." HCLS1-related protein X-1 is a protein known to bind to HCLS1, a substrate of Src family tyrosine kinases. HCLS1-related protein X-1 also interacts with the PKD2 gene product, and mutations in the PKD2 gene are associated with autosomal dominant polycystic kidney disease. Furthermore, HCLS1-related protein X-1 also interacts with cortactin, an F-actin-binding protein. Human variants of HCLS1-related protein X-1 are identified by gene ID (Entrez): 10456; Enseml: ENSG00000143575; uniProt: O00165, Q5VYD6.

[0030] According to the present invention, "targeting" or "targeting" or "addressing" refers to specifically and selectively interacting with the HAX1 gene at the molecular level. In one embodiment, "targeting" or "targeting" also includes "gene editing" or "genome editing," which is a type of genetic engineering technique that inserts, deletes, modifies, or replaces DNA in the genome of a living organism. Furthermore, "targeting" or "targeting" includes repairing or correcting the HAX1 gene, preferably repairing or correcting a mutated HAX1 gene.

[0031] In the context of the present invention, "gene editing" refers to, for example, the modification of the HAX1 gene in a living cell. Thus, according to the present invention, "gene editing" includes downregulation, knockout (KO), knockdown, or correction of the HAX1 gene, preferably downregulation, knockout (KO), knockdown, or correction of a mutated HAX1 gene. In one embodiment of the present invention, the gene editing results in targeted knockdown of expression of the mutated HAX1 gene and specific loss of function of the expression of the mutated HAX1 gene.

[0032] According to the present invention, "PAM" refers to a "protospacer adjacent motif," i.e., a 2-6 base pair DNA sequence immediately downstream of the DNA sequence targeted by Cas9 nuclease. A "PAMout" positioning relationship means that the two PAM sequences face outward from each other.

[0033] According to the present invention, "indel" is a term that refers to the insertion or deletion of bases in the genome of an organism.

[0034] Regarding the combination of two sgRNA molecules of the present invention, those skilled in the art will fully understand how to select two sgRNA molecules to minimize the number of undesired indels.Details of the design rules are described in Yan et al. (2017), "Applications of Cas9 nickases for genome engineering," Application Note, Genome Editing, Intergated DNA Technologies (IDT) and Tran et al. (2022), "Precise CRISPR-Cas-mediated gene repair with minimal off-target and unintended on-target mutations in human hematopoietic stem cells," Sci. Adv. 8, eabm9106, 1-11.A brief description is provided below. 1. The two sgRNA molecules must be selected so that the two Cas9 nickases bind to the DNA in a PAM-out orientation, meaning that the two PAM sequences must be oriented facing outward from each other. 2. One of the two sgRNA molecules in a combination must bind to the sense DNA strand and the other must bind to the antisense DNA strand. 3. The distance between one single-strand break and the other single-strand break can vary from a minimum of 20 nucleotides to a maximum of 500 nucleotides (relative to the PAM-out position).

[0035] According to the present invention, an "organism" includes any organism into which the HAX1 gene has been incorporated, including, for example, mammals, preferably humans.

[0036] The object underlying the present invention can be fully achieved as described herein.

[0037] In one embodiment of a combination of two sgRNA molecules of the invention, at least one of the two sgRNA molecules set forth in the table below is combined. [Table 1]

[0038] The inventors have successfully tested these 13 exemplary combinations of sgRNA molecules associated with Cas9 nickase and have obtained good results using these combinations. Each combination (C1, C2, ... C13) in the table above indicates that a first sgRNA molecule containing the sequence shown in the center column is combined with a second sgRNA molecule containing the nucleotide sequence shown in the right column.

[0039] In one embodiment, the sgRNA molecules, combinations of sgRNA molecules and / or repair template nucleic acid molecules of the present invention are configured for use in the prevention, treatment and / or testing of a disease, preferably a HAX1 gene-associated disease, more preferably congenital neutropenia, and even more preferably severe congenital neutropenia (CN / SCN) and / or cyclic neutropenia (CyN).

[0040] This method has the advantage that by utilizing the present invention, it is possible to address the underlying causes of HAX1 gene-related diseases, particularly severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN), as well as emphysema or emphysematous changes.

[0041] In another embodiment, the disease is myelodysplastic syndrome (MDS) and / or myeloid leukemia (AML).

[0042] CN / SCN patients with HAX1 mutations are at increased risk of developing myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML). In this embodiment, the present invention further provides effective treatments for these two diseases.

[0043] Another subject of the present invention is a vector comprising an sgRNA molecule of the invention, a combination of said sgRNA molecules, and / or a repair template nucleic acid molecule of the invention.

[0044] According to the present invention, a "vector" includes any DNA molecule used as a vehicle to artificially deliver a nucleic acid molecule, such as an sgRNA, to another cell capable of replicating and / or expressing the nucleic acid molecule. Viral vectors are particularly preferred because they are characterized by a virus-specific molecular mechanism that efficiently transports the genome into infected cells. In a preferred embodiment of the present invention, the viral vector may be an adeno-associated viral vector (AAV) or other viral vector.

[0045] The features, characteristics, advantages, and embodiments described for the sgRNA molecules, combinations of sgRNA molecules, and / or repair template nucleic acid molecules of the invention also apply to the vectors of the invention.

[0046] In one embodiment of the present invention, the vector is a recombinant adeno-associated vector (rAAV), preferably a recombinant adeno-associated vector serotype 6 (rAAV6).

[0047] This approach has the advantage that when such vectors are used with CRISPR / Cas9 technology, better gene editing can be achieved, especially due to the widespread distribution of CRISPR / Cas9 components.

[0048] The present invention also relates to compositions comprising an sgRNA molecule of the present invention, a combination of sgRNA molecules, a repair template nucleic acid molecule of the present invention, and / or a vector of the present invention.

[0049] In one embodiment of the invention, the composition further comprises CRISPR-associated protein 9 (Cas9) and / or a vector encoding said Cas9, preferably Cas9 from Streptococcus pyogenes (Sp Cas9), more preferably Sp Cas9 V3, even more preferably Sp HiFi Cas9 V3, and particularly preferably Cas9 nickase.

[0050] This approach establishes the requirements for using CRISPR / Cas9 technology. Cas9 (CRISPR-associated protein 9; previously known as Cas5, Csn1, or Csx12) is a 160-kilodalton protein that cleaves phosphodiester bonds within polynucleotide chains and is a component of the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) complex. Therefore, Cas9 can specifically bind to sgRNA, which guides the endonuclease to target nucleic acids. CRISPR Cas9 from Streptococcus pyogenes (Sp Cas9) is a well-characterized Cas9 ortholog with established uses in gene editing. Sp Cas9 V3 is a recombinant endonuclease purified from an Escherichia coli strain and contains a nuclear localization sequence (NLS) and a 6-His tag at the C-terminus. Sp HiFi Cas9 is a Cas9 variant with improved specificity, due to reduced off-target effects while retaining high on-target activity. Therefore, Sp HiFi Cas9 is ideal for methods requiring high editing efficiency while being sensitive to off-target events. Sp Cas9 V3 and Sp HiFi Cas9 are available from Integrated DNA Technologies (Coralville, Iowa, USA). Other mini-Cas9s derived from Staphylococcus aureus, Staphylococcus auricularis, Campylobacter jejuni, or Neisseria meningitidis have been discovered in recent years and are similarly suitable for the present invention.

[0051] According to the present invention, when used with two sgRNA molecules or a combination of two sgRNA molecules of the invention, it is preferred to use a Cas9 nickase, particularly a D10A nickase such as spCas9 D10A nickase V3.

[0052] In another embodiment of the invention, the composition is a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

[0053] A "pharmaceutical composition" is a composition suitable for administration to animals and / or humans in a medical setting. Pharmaceutical compositions are preferably sterile and preferably manufactured according to GMP guidelines.

[0054] Pharmaceutically acceptable carriers or excipients are well known in the art and include, for example, nanocarriers; nanovectors; aqueous solutions such as water and buffered saline; or other solvents or vehicles such as glycols, glycerol, oils (e.g., olive oil), and injectable organic esters. In a preferred embodiment, when the pharmaceutical composition is intended for administration to humans, e.g., parenteral administration, the aqueous solution is pyrogen-free or substantially pyrogen-free. For example, the excipient can be selected to enable delayed release of the drug or to selectively target one or more cells, tissues, or organs. The pharmaceutical composition may be in the form of an injection, tablet, capsule (including sprinkle capsules and gelatin capsules), granules, powder, syrup, suppository, or other dosage form. The pharmaceutical composition may be in the form of a solution suitable for topical administration. Alternatively, the pharmaceutical composition may be in the form of an aerosol that can be administered by inhalation.

[0055] "Pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that are suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio. Suitable pharmaceutical carriers or excipients and pharmaceutical additives for use in pharmaceutical formulations are described in Remington - The Science and Practice of Pharmacy, 23rd edition, 2020, and the United States Pharmacopeia (USP / NF: United States Pharmacopeia and the National Formulary), well-known reference texts in the art. Other sources of information are also available to those skilled in the art.

[0056] The pharmaceutical compositions of the invention and methods of the invention described below may be used to treat an organism in need thereof, hi certain embodiments, the organism is a mammal, such as a human, or other non-human mammal.

[0057] In one embodiment, the composition of the present invention is configured for use in the prevention, treatment and / or testing of a disease, preferably a HAX1 gene-associated disease, more preferably congenital neutropenia, and even more preferably severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN), myelodysplastic syndrome (MDS) and / or myeloid leukemia (AML).

[0058] The features, characteristics, advantages and embodiments described for the sgRNA molecules of the invention, the combinations of sgRNA molecules, the repair template nucleic acid molecules of the invention and / or the vectors of the invention also apply to the compositions of the invention.

[0059] Another subject of the present invention is an in vitro method for targeting the HAX1 gene in biological material comprising genetic material encoding the HAX1 gene, the method comprising a step of introducing into the biological material an sgRNA molecule of the invention, a repair template nucleic acid molecule of the invention, a vector of the invention and / or a composition of the invention, preferably wherein said editing is performed using CRISPR / Cas9 technology.

[0060] According to the present invention, "biological material containing genetic material encoding the HAX1 gene" includes biological cells, tissues and parts of organisms.

[0061] In one embodiment of the present invention, the biological material comprises hematopoietic stem and progenitor cells (HSPCs).

[0062] This approach has the advantage of being able to target the HAX1 gene in biological materials in which mutations are pathologically expressed. For example, HSPCs from patients with severe congenital neutropenia (CN / SCN) have reduced granulocyte differentiation, but the present inventors have found that the reduced granulocyte differentiation can be restored by the nucleic acid molecules of the present invention.

[0063] Another subject of the present invention is a method for preventing, treating and / or diagnosing a disease in an organism, comprising: targeting or editing the HAX1 gene in an organism by introducing into a biological material an sgRNA molecule of the invention, a combination of sgRNA molecules of the invention, a repair template nucleic acid molecule of the invention, a vector of the invention and / or a composition of the invention; Preferably, said targeting or gene editing is carried out using CRISPR / Cas9 technology, Preferably, the disease is selected from the group consisting of congenital neutropenia, preferably severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN); myelodysplastic syndrome (MDS); and myeloid leukemia (AML). Regarding the method.

[0064] The present invention further provides a method for editing and / or correcting a mutant allele of a HAX1 gene in a cell, comprising: CRISPR-associated protein 9 (Cas9) or a sequence encoding the Cas9; an sgRNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 553; or A combination of two sgRNA molecules each containing a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 553, configured to bind to a nucleic acid containing the HAX1 gene in a PAMout positional relationship. by introducing into the cell a composition comprising generating a double-stranded break in the mutant allele of the HAX1 gene with a complex of the Cas9 and the sgRNA molecule; or generating two single-strand breaks in the mutant allele of the HAX1 gene using a complex consisting of the Cas9 and the two types of sgRNA molecules; Including, Preferably, the HAX1 gene has a mutation associated with congenital neutropenia, severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN), the HAX1 gene of the cell has a mutation at the nucleotide position c.131insA; the product of the HAX1 gene has a mutation at the amino acid position p.W44X; A method is provided.

[0065] In the variant using a combination of two sgRNA molecules, it is preferred to use a Cas9 nickase, and the two sgRNA molecules are selected so that the two sgRNA molecules direct the associated Cas9 nickases to bind to a nucleic acid molecule containing a mutant HAX1 gene in a PAM-out relationship.

[0066] In one embodiment of the method, the composition further comprises a repair template nucleic acid molecule comprising the nucleotide sequence set forth in SEQ ID NO: 565, wherein the repair template nucleic acid molecule repairs the mutant allele of the HAX1 gene.

[0067] The present invention provides a recombinant cell obtained by the method of the present invention.

[0068] The present invention also provides a method for preparing a composition comprising recombinant cells, in vitro or ex vivo, comprising: a) isolating or preparing HSPCs from cells obtained from an organism (preferably a human) that has a mutated HAX1 gene associated with severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN), myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML), preferably characterized in that the HAX1 gene has a mutation at the nucleotide position c.131insA and / or the product of the HAX1 gene has a mutation at the amino acid position p.W44X; and b) a CRISPR nuclease or a sequence encoding the CRISPR nuclease; An sgRNA molecule or a combination of two of the sgRNA molecules, which is configured to bind to the CRISPR nuclease or to cause the CRISPR nuclease to bind to a nucleic acid containing the mutant HAX1 gene in a PAMout positional relationship, and which comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 553. by introducing into the cells of step (a) a composition comprising A process in which a complex consisting of the CRISPR nuclease and the sgRNA molecule or a combination of the two sgRNA molecules generates a double-strand break or two single-strand breaks in the mutant HAX1 gene of one or more cells, thereby inactivating the mutant HAX1 gene of one or more cells, thereby obtaining a recombinant cell. Including, The method may further comprise the step of c) expanding the recombinant cell of step (b); the recombinant cells are capable of engraftment and thus can give rise to progeny cells after engraftment; A method is provided.

[0069] In one embodiment of the method according to the invention, the composition further comprises a repair template nucleic acid molecule, preferably comprising the nucleotide sequence set forth in SEQ ID NO: 565, which repairs the mutant allele of the HAX1 gene.

[0070] In another embodiment of the method according to the invention, the method further comprises the step of d) administering the cells of step (b) or step (c) to the organism to treat severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN), myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML) in the subject.

[0071] Thus, the present invention provides a method for treating an organism (preferably a human) suffering from severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN), comprising administering a therapeutically effective amount of the recombinant cells.

[0072] The features, characteristics, advantages and embodiments described for the sgRNA molecules, combinations of sgRNA molecules, repair template nucleic acid molecules, vectors and compositions of the invention also apply to the methods of the invention described above.

[0073] The features mentioned above and the features to be described below can be used not only in the combinations shown in the respective embodiments, but also in other combinations or alone without departing from the scope of the present invention.

[0074] The present invention will be further described in detail by reference to the following embodiments, which describe additional features, characteristics, and advantages of the present invention. Furthermore, the following embodiments are for illustrative purposes only and are not intended to limit the spirit or scope of the present invention. Features described in specific embodiments are general features of the present invention and are not only applicable to specific embodiments, but also applicable alone and to all embodiments of the present invention. [Brief explanation of the drawings]

[0075] The present invention will be described and explained in more detail with reference to the following examples and figures, but the present invention is not limited to these examples and figures. [Figure 1] Experimental design and gene editing efficiency in healthy donor-derived HSPCs are shown. A) Schematic diagram of the HAX1 gene, HAX1 cDNA, and HAX1 protein. The p.W44X mutation, which causes congenital neutropenia (CN), is shown. B) Schematic diagram of the adeno-associated virus serotype 6 DNA donor template and the sgRNA design targeting the HAX1 gene. Sanger sequencing traces of the patient sequence show adenosine-generating mutations in red and SNPs in blue. Silent mutations introduced during gene correction are indicated by their respective colors. C) Sequencing traces of an exemplary patient and corrected template aligned with the reference sequence. Differences in the consensus sequence from the reference sequence are highlighted in pink. D) Schematic diagram of the experimental workflow. This experimental workflow begins with HSPC culture, followed by electroporation delivery of CRISPR / Cas9 RNPs, transduction with an AAV HDR template, and subsequent genetic analysis and evaluation of granulocytic differentiation. E) Gene editing efficiency in healthy HSPCs 72 hours after gene editing and 14 days after differentiation induction (n=2). *=p<0.05, **=p<0.01. [Figure 2]In silico off-target predictions are shown. A) Off-target predictions for sgRNA HD based on the human chromosome 19 genome show the absolute number of off-targets with up to four mismatches. Additionally, the relative frequency of off-targets within 30 base pairs upstream or downstream of the targeted mutation is shown compared to all other guide RNA candidates. Stacked bar graphs show the frequency of mismatches observed at each guide RNA position. B) Off-target comparisons for sgRNAs containing matching bases as SNP rs are shown. This analysis was performed based on the human chromosome 19 genome. Comparisons are made between guides within a group of sgRNAs that guide Cas9 to induce double-strand breaks within 30 base pairs of the pathogenic mutation. [Figure 3] AAVS1 sgRNA sequencing and gene editing efficiency are shown. A) The sequence of the guide RNA used for the AAVS1 locus is shown. B) Gene editing efficiency is shown for each condition and all time points separately for each healthy donor. Gene editing efficiency was measured by deconvolution of Sanger sequencing traces using the ICE algorithm. [Figure 4]A, B) Differentiation of HAX1 knockout cells mimicking those of a patient with congenital neutropenia harboring a HAX1 mutation (HAX1-CN). Granulocytic differentiation on day 14 of ex vivo differentiation was analyzed by flow cytometry. Based on the expression of differentiation markers, the distribution of viable cells was shown as myeloblasts (CD45+CD34DIM / -CD33+CD66b-), promyelocytes (CD45+CD34DIM / -CD33+ / highCD66b+CD11b- / +), metamyelocytes (CD45+CD34-CD33DIM / -CD66b+CD11b+CD16-), and neutrophils (CD45+CD34-CD33DIM / -CD66b+CD11b+CD16+). Each healthy donor is shown in a separate graph. The gene editing efficiency on day 14 of in vitro differentiated myeloid cell differentiation is also shown (n = 2). C) Exemplary images of cytospin specimens prepared from ex vivo differentiated neutrophils on day 14, taken at 63x magnification. D,E) Percentage distribution of immature myeloid cells, intermediately mature myeloid cells, mature neutrophils, macrophages, and dead cells. [Figure 5] Gene editing efficiency in HSPCs derived from HAX1-CN patients is shown. A) Gene editing efficiency in HAX1-CN HSPCs was measured by deconvolution analysis of Sanger sequences using the ICE algorithm 72 hours after electroporation and 14 days after ex vivo differentiation (n=5). B) Sanger sequencing traces of HSPCs from all five patients who underwent gene correction in this study. The red arrow indicates the adenosine that creates a stop codon in the HAX1 gene, resulting in the loss of HAX1 protein. The green arrow indicates the silent mutation introduced by the HDR template. The blue arrow indicates SNP rs13796 (dbSNP build 150), which is present in all patients with the p.W44X mutation. C) Protein expression analysis by Western blot demonstrated expression of the HCLS1-associated protein X-1 after gene editing. Prior to this analysis, cells were differentiated into neutrophils. This analysis was performed on two separate patients. [Figure 6]Evaluation of ex vivo differentiation of gene-corrected cells is shown. A) Proliferation of gene-edited AAVS1 control cells and gene-corrected HAX1 cells is shown as the fold change in cell number counted each day from day 1 to day 14 of liquid culture. Statistical differences were assessed by Student's t-test (n=5). B) Representative images of Wright-Giemsa-stained cytospin preparations of differentiated HSPCs at day 14 of differentiation are shown. Cells from each patient and condition are shown (n=5). Differences in cellular composition after 14 days of in vitro differentiation are shown as a percentage of all cells counted in Wright-Giemsa-stained cytospin preparations. C) Granulocyte differentiation after 14 days of ex vivo induction was analyzed by flow cytometry and shown as the distribution of viable cells classified based on the expression of differentiation markers into myeloblasts (CD45+CD34DIM / -CD33+CD66b-), promyelocytes (CD45+CD34DIM / -CD33+ / highCD66b+CD11b- / +), metamyelocytes (CD45+CD34-CD33DIM / -CD66b+CD11b+CD16-), and neutrophils (CD45+CD34-CD33DIM / -CD66b+CD11b+CD16+). *=p<0.05, **=p<0.01. [Figure 7]Functionality of neutrophils generated ex vivo from HAX1-CN patients is shown. A) Induction of apoptosis by oxidative stress in control-edited and gene-corrected cells from patients with HAX1 mutations (n=3). Apoptosis was detected by inducing green fluorescence cleaved by caspase 3 / 7 and measured by live cell imaging. Data for each patient are shown individually with the mean error of three technical replicates per patient. B) Phagocytosis of differentiated cells toward pHrodo Green E. coli bioparticles was measured by live cell imaging. Phagocytosis is shown as the numerical difference between corrected and control differentiated cells, representing the number of green fluorescent cells. Error bars indicate the standard error of the replicate experiments. C) Formation of neutrophil extracellular traps (NETs) was measured by DNA staining with live cell imaging. The green area was normalized to the area in the phase image at the start of the experiment, and results are shown as the fold change between unstimulated and PMA-stimulated cells. D) The ROS production capacity of in vitro induced myeloid cells is shown as the fold change between unstimulated and f-MLP-stimulated myeloid cells. ROS production is measured by luminescence using the ROS-Glo kit (Promega) (n = 2). [Figure 8] Live cell analysis of phagocytosis of E. coli bioparticles. A) Phagocytosis of pHrodo Green E. coli bioparticles by ex vivo formed neutrophils from two patients. The mean and standard error of three technical replicates of control-edited and gene-corrected cells are shown per patient, as the area of ​​the green object normalized to the area of ​​the phase image. [Figure 9] Live-cell analysis of neutrophil extracellular trap (NET) production. A) NET production by differentiated cells stimulated with PMA is shown per patient as the sum of the area of ​​the phase image object measured at the bottom (µm² / well). Measurements are shown up to 24 hours after equilibrium was reached. Experiments were performed on two donors, with each condition tested in triplicate per donor. B) Differences between PMA-stimulated and placebo-treated cells are shown. Error bars indicate the standard error for each time point (n = 2). [Figure 10] Live cell analysis of chemotaxis of differentiated cells. A) Chemotaxis of differentiated cells is shown as the sum of the area of ​​the phase image object measured at the bottom of the well (µm² / well) for each patient. Measurements are shown up to 6 hours to reach equilibrium. 50 nM fMLP was used as the chemoattractant. Experiments were performed on four donors, with each condition tested in triplicate for one donor. [Figure 11] Genotoxicity studies are shown. A) GUIDE-Seq analysis measured in cells illustrates off-target sites found in HSPCs from healthy donors (n=2). B,C) CAST-Seq detected large deletions at on-target sites and translocations between on-target and off-target sites in HSPCs from healthy donors (n=3). Results are shown as bar graphs quantifying each site and as circos plots showing the chromosomal location of the translocation. [Figure 12] Correction of the HAX1 gene in iPSCs. A) Sanger sequencing traces of unedited clones FA_L5 and SS_C8 compared to gene-corrected clones FA_L5 and SS_C8. Guanine bases are displayed in gray, cytosine bases in blue, thymine bases in red, adenine bases in green, deleted bases in orange, and residues changed from the reference sequence during the correction process in pink. B) Flow cytometry analysis of iPSCs differentiated into neutrophils at day 14. **=p<0.01, *=p<0.05 as assessed by Student's t-test. [Figure 13]Modeling gene therapy in iPSCs. A) In two independent experiments, day 14 differentiation of iPSCs into neutrophils was performed by plating and culturing in cytokine-supplemented methylcellulose medium. Significant rescue of CFU-GM and CFU-G colony formation was observed. Concomitantly, gene-corrected iPSC clones derived from iPSCs derived from two HAX1-CN patients showed a significant reduction in CFU-M colonies. B) Flow cytometry analysis of day 28 differentiation of iPSCs into neutrophils revealed that HAX1 gene correction increased co-expression of the neutrophil differentiation markers CD15 and CD16. C) Representative images of Wright-Giemsa-stained cytospin samples from day 28 of differentiation are shown. D) Heatmap showing significant differentially expressed genes from specialized granules, gelatinase granules, and secretory vesicles analyzed by RNA-seq analysis of suspension cells from day 14 of differentiation. [Figure 14] Methods for minimizing unwanted indels are shown. A) Nickase and guide RNA combinations and the location of the p.W44X mutation in the HAX1 gene are illustrated. B) Editing efficiency of two guide and nickase combinations (c) is shown as a percentage of all alleles, as measured by deconvolution analysis using DECODR. Experiments were performed in healthy donor (HD)-derived HSPCs with three biological replicates. C) The ratio of homology-directed repair (HDR) to non-homologous end joining (NHEJ) is shown as a measure of unintended indel reduction. [Example]

[0076] 1. Introduction Recent improvements in the CRISPR / Cas9 gene editing platform have enabled precise genome editing of human cells (e.g., HSPCs) with unprecedented efficiency, making it widely used in translational laboratories. CRISPR / Cas9 is an excellent tool for knocking out disease-causing genes, restoring reading frames, and knocking in full-length genes. It can also be used to specifically alter, insert, or delete single nucleotides or sequences of nucleotides that cause disease. Targeted base editing in HSPCs using CRISPR / Cas9 is achieved by introducing a double-strand break using Cas9 and then inducing homology-directed repair (HDR) by repairing the resulting break with a homologous homology-directed repair (HDR) template. Homologous recombination repair using CRISPR / Cas9 in combination with a repair template delivered by recombinant adeno-associated virus serotype 6 (rAAV6) has proven highly efficient and reproducible in ex vivo gene therapy for inherited bone marrow failure syndromes using autologous cells. The first clinical trial using this therapeutic approach for sickle cell disease was recently approved by the FDA. Here, we demonstrate that CRISPR / Cas9-mediated indel insertion into exon 2 of the HAX1 gene in HSPCs derived from healthy donors resulted in an ex vivo inhibition of granulocytic differentiation, mimicking the phenotype of congenital neutropenia. This phenotype could be corrected with an HAX1 HDR repair template delivered via rAAV6. Based on this model, we developed an ex vivo gene therapy approach to correct the p.W44X mutation (c.131insA) in the HAX1 gene and successfully restored granulocytic differentiation in cells derived from patients with congenital neutropenia. Because the p.W44X mutation in the HAX1 gene has been reported frequently in patients with congenital neutropenia and HAX1-CN (HAX1-CN), our approach may be broadly applicable to this patient population.

[0077] 2. Materials and Methods Cloning of the HAX1 genomic sequence A 3009-bp genomic DNA fragment was amplified using Hot Start Phusion II (Thermo Fisher Scientific, #F549L) and the HAX1 AAV template primers (Table 1 in the Supplementary Material). A 2406-bp fragment was obtained from the first PCR product by nested PCR using the phosphorylated primer phos-HAX1-AAV HDR (Table 1). The pAAV-CMV plasmid (Takara, #6234) was digested with EcoRV (NEB, #R0195S) and BglII (Thermo Fisher Scientific, #D0083) to remove the CMV expression cassette. The overhanging ends were then blunted with T4 DNA polymerase (Thermo Fisher Scientific, #EP0061), and the resulting PCR product was then cloned between the ITRs at both ends. Blunt-end cloning was performed using T4 DNA ligase (Thermo Fisher Scientific, #EL0014). After ligation, the plasmid was treated with ATP-dependent DNase (Lucigene, E3101K). The newly constructed plasmid was then transformed into Stellar cells (Takara, #636763). Clones were selected and the entire insert was sequenced using Sanger sequencing primers. Using a site-directed mutagenesis kit (Agilent, #200521), five silent mutations were introduced into the corrected allele that suppress Cas9-mediated double-strand break induction without altering the translated protein sequence (Figure 1B, Figure 1C). The full-length sequenced plasmid (AAV-HAX1-HDR-p.R50) was used to produce AAV particles.

[0078] Production of recombinant adeno-associated viruses Adeno-associated viruses were produced as described in Bak et al. (2018), CRISPR / Cas9 genome editing in human hematopoietic stem cells. Nature Protocols 13(2), pp. 358-376, or by subcontracting to Vigene Biosciences. Briefly, HEK293T cells (70-90% confluency) were transduced with the AAV-HAX1-HDR-p.R50 and pDGM6 plasmids (Addgene, #110660) using polyethyleneimine (PEI). After 48 hours, transduced cells were harvested by adding 6.25 mM EDTA to the medium. The harvested cells were lysed by repeated freezing in a dry ice / ethanol bath and thawing at 37°C, followed by digestion with benzonase (Biovision, #7680). The lysed cells were centrifuged to remove debris. Viral particles were purified from the supernatant by density gradient ultracentrifugation using iodixanol. The band containing viral particles was collected, dialyzed overnight, and titered by real-time PCR (Takara, #6233).

[0079] Design of sgRNA and HAX1 modified template A single guide RNA (sgRNA) specific for the HAX1 gene (containing a break site on chromosome 1 [GCTGAGGACTATGGAACCTT (HAX1 gene exon 2; SEQ ID NO: 553), +154273431:-154273432; Table 1], NM_006118.4 exon 2, 244 bp; NP_006109.2 p.R50) was selected. All HAX1-CN patient-derived cells used in this study contained the SNP rs13796 (dbSNP build 150) at the binding site of the sgRNA of the present invention. In the exemplary experiments, a patient-specific sgRNA was utilized that recognizes the cleavage site containing this SNP (GCTGAGGGCTATGGAACCTT (sgHAX1.PS-SNP; SEQ ID NO: 552; Table 1). The sgRNA targeting the AAVS1 region, a safe harbor site, was selected based on previous studies (containing the cleavage site on chromosome 19 [CTCCCTCCCAGGATCCTCTC (AAVS1; SEQ ID NO: 554, +55115580:-55115581; Table 1]). Chemically modified sgRNAs were obtained from IDT.

[0080] CRISPR / Cas9 RNP delivery and AAV-mediated transduction After 2–4 days of growth, HSPCs were electroporated with sgRNA (sgHAX1.PS-SNP; SEQ ID NO: 552) and sp.Cas9 V3 (IDT, #1081059) using the Amaxa 4D Nucleofector (Lonza, #AAF-1002X) and the P3 Primary Cell Kit (#V4XP-3024) with the CA-137 program. Within 1 hour of electroporation, HSPCs were transduced with the repair template vector (SEQ ID NO: 565) or control AAV at an MOI of 100,000 and cultured for an additional 48 hours.

[0081] Gene editing analysis Gene editing efficiency was measured 72 hours after electroporation and transduction and 14 days after differentiation induction. Genomic DNA was extracted using QuickExtract solution (Lucigen, #QE09050). A 3007-bp genomic DNA fragment was amplified using Hot Start Phusion II (Thermo Fisher Scientific, #F549L) and the HAX1 AAV template primer (Table 2) and sequenced by Sanger sequencing. Control gene editing at the AAVS1 locus was measured by amplifying a 655-bp fragment (AAVS1 primer 1; Table 2). Gene editing efficiency was calculated from the Sanger sequencing trace using ICE synthego. The HAX1 locus was detected by amplifying only the genomic sequence with primers outside the repair template.

[0082] HSPC isolation and culture CD34+ hematopoietic stem and progenitor cells (HSPCs) were isolated from bone marrow biopsy samples. Briefly, mononuclear cells were collected by Ficoll gradient centrifugation (GE Healthcare, #17-1440-03) and CD34+ HSPCs were isolated using magnetic beads (Miltenyi, #130-046-703). + Purified CD34 cells. + Cells were grown at 2.5 × 10 in StemSpan SFEM II supplemented with 20 ng / ml interleukin 3 (IL-3), 50 ng / ml stem cell factor (SCF), 20 ng / ml interleukin 6 (IL-6), 20 ng / ml thrombopoietin (TPO), 50 ng / ml FMS-like tyrosine kinase 3 ligand (Flt-3L), 2 mM L-glutamine, 100 U / ml penicillin, and 0.1 mg / ml streptavidin. 5 ~5×10 5 The cells were cultured at a density of 1000 cells / ml.

[0083] Analysis of ex vivo neutrophil differentiation Gene-edited cells were cultured at 5 × 10 in RPMI 1640 Glutamax supplemented with 10% FCS, 2 mM L-glutamine, 5 ng / ml SCF, 5 ng / ml IL-3, 5 ng / ml GM-CSF, 1 ng / ml G-CSF, 100 U / ml penicillin, and 0.1 mg / ml streptavidin. 5 Cells were differentiated into neutrophils by culturing at a density of 1000 cells / ml. Half of the medium was changed every other day. After 7 days, cells were counted, centrifuged, and seeded in RPMI 1640 Glutamax supplemented with 10% FCS, 2 mM L-glutamic acid, 1 ng / ml G-CSF, 100 U / ml penicillin, and 0.1 mg / ml streptavidin. Cells were replated at the same density, and the frequency of medium changes was maintained until day 14.

[0084] Cell morphology analysis 1 x 10 cells suspended in 100 μl PBS 4 Cytospin preparations were prepared by centrifugation at 250 rpm for 3 minutes on glass microscope slides. After air drying, the slides were stained with May-Grünwald-Giemsa solution. Cell morphology was assessed at 63x magnification using a Nikon Eclipse TS100 microscope, and 100 cells were counted per slide.

[0085] Analysis of cell surface markers for myeloid and granulocytic cells The differentiated cells were stained with anti-CD45 (Biolegend, BV510 #304036), anti-CD11b (Biolegend, APC-Cy7 #301322), anti-CD66b (Biolegend, FITC #305104), anti-CD16 (BD Biosciences, APC #561248), anti-CD33 (Biolegend, BV421 #303416), anti-CD34 (BD Biosciences, PECy-7 #128618), and live / dead cell depletion reagent (BD Biosciences, 7AAD #559925). Cells were incubated in PBS supplemented with 0.5% BSA (FACS buffer) in a final volume of 100 μl, and each antibody was used at a final concentration of 1:50. After a 20-minute incubation, cells were washed twice with 1 ml of FACS buffer and analyzed on a BD FACSCanto II. Data were collected using DIVA software and analyzed using FlowJo 10.

[0086] Analysis of apoptosis using live cell imaging A 96-well plate was coated with 0.001% poly-L-lysine (Merck, #A-005-C). 1 × 10 cells were cultured in phenol red-free RPMI (GIBCO, #11835105) supplemented with 0.5% BSA. 4 Cells were seeded at a density of 1000 cells / well. Caspase 3 / 7 Green Apoptosis Assay Reagent (Sartorius, #4440) was added to each well at a final concentration of 5 μM. Cells were stimulated with 2 mM H2O2 (Merck, #H1009) or PBS as a solvent control. Phase-contrast and green fluorescence images of cells were captured every 30 minutes at 10x magnification using an IncuCyte S3 Live Cell Analysis System.

[0087] Measurement of phagocytosis of live cells On day 14 of ex vivo differentiation, cells were plated at 10 in 96-well plates containing phenol red-free RPMI supplemented with 0.5% BSA. 4Cells were seeded at a density of 1000 cells / well. Ten micrograms of Green E. coli Bioparticles (IncuCyte pHrodo, Essen Bioscience, #4616) were added per well according to the manufacturer's recommendations. Images of each well were acquired every 30 minutes at 10x magnification in the green channel of an IncuCyte S3 Live Cell Analysis System. Images were analyzed using IncuCyte's base software according to the manufacturer's recommendations.

[0088] Quantitative analysis of NETosis formation 2 × 10 ex vivo differentiated cells were plated onto poly-L-lysine-coated 96-well plates. 4 Cells were seeded at a density of 1000 cells / well. Cells were cultured in phenol-red-free RPMI supplemented with 250 nM final concentration of Incucyte® Cytotox Green Dye (Incucyte #4633) and 0.5% BSA. NETosis was induced by adding 0.5 μM phorbol-12-myristate-13-acetate (PMA). Cells were analyzed every 30 minutes at 20x magnification in an Incucyte S3 Live Cell Analysis System. Data analysis was performed using Incucyte Basic software according to the manufacturer's recommendations.

[0089] ROS production after stimulation with fMLP Measurement of ROS was performed following stimulation with 50 nM N-formylmethionine-leucyl-phenylalanine (fMLP) (Merck, #47729) according to the manufacturer's recommendations (Promega, #G8820) and measured on a GloMax-Multidetection microplate reader (Promega).

[0090] GUIDE-Seq Briefly, RNPs and dsODNs were electroporated into HSPCs. Four days after electroporation, DNA was isolated using the QIAamp DNA Mini Kit (QIAGEN, #51304) according to the manufacturer's recommendations. Library preparation and data analysis were performed according to the protocol described by Palani et al. Sequencing was performed on an Illumina NovaSeq 6000 in paired-end mode with amplicon lengths of 150 bp.

[0091] CAST-Seq Briefly, HSPCs were electroporated with RNPs. Four days after electroporation, DNA was isolated using the QIAamp DNA Mini Kit according to the manufacturer's recommendations. Library preparation, sequencing, and data analysis for the CAST-seq assay were performed as previously reported by Turchiano et al.

[0092] Nano-OTS Nano-OTS of sgRNA HAX1-PS was performed as previously reported by Hoijer et al. Briefly, high-molecular-weight DNA was isolated from patient bone marrow mononuclear cells using the Monarch HMW DNA Extraction Kit (NEB, #T3050). DNA was sheared to an average length of 20,000 bp using the Megaruptor 3 (Diagenode, #B06010003). Fragments of the desired size were selected from the sheared DNA using Blue Pippin and a High Pass Plus cassette (Sage Science, #BPlus10). The selected DNA fragments were dephosphorylated and then incubated with an RNP consisting of spCas9 HiFi V3 (IDT) and sgRNA HAX1-PS. After digestion at 37°C for 15 minutes, sequencing primers were ligated. The final sample was loaded onto a MinIon flow cell (R10.4, Oxford Nanopore, #FLO-MIN112) and sequenced. Sequencing data were analyzed according to the pipeline by Hoijer et al.

[0093] iPSC differentiation To evaluate the differentiation of iPSCs derived from HAX1-CN patients into myeloid cells, we employed a slightly modified in vitro embryoid body-based iPSC differentiation method developed by Lachmann et al., which can generate hematopoietic and mature myeloid cells over a 30-day period. Individually isolated iPSCs (20,000 cells per embryoid body) were seeded into round-bottom 96-well plates containing APEL serum-free differentiation medium supplemented with basic fibroblast growth factor (bFGF) and Rho kinase inhibitor (ROCK) and centrifuged to form embryoid bodies. On day 1, bone morphogenetic protein 4 (BMP4) was added to induce mesodermal differentiation. To induce hematopoietic differentiation, embryoid bodies were seeded (10 cells / well) into Matrigel-coated 6-well plates containing APEL medium supplemented with vascular endothelial growth factor (VEGF), stem cell factor (SCF), and interleukin-3 (IL-3) on day 4. After 3 days, the cytokines were replaced with IL-3 and G-CSF to initiate neutrophil differentiation.

[0094] RNA-Seq analysis To identify key signaling pathways required for the suppression of granulocyte maturation in HAX1-CN patients, we performed transcriptome profiling of HSPCs differentiated from various isogenic iPSCs. Using the nf-core RNA-seq pipeline, a community-curated bioinformatics pipeline framework, we extracted gene-level count matrices for each sample. Differential analysis of the count data was performed using the DESeq2 R package to obtain differentially expressed genes (DEGs).

[0095] CRISPR / Cas9 nickase RNP delivery and transduction by AAV After 2–4 days of proliferation, HSPCs were electroporated with sgRNA and sp.Cas9 D10A Nickase V3 (IDT, #1081063) using the Amaxa 4D Nucleofector (Lonza, #AAF-1002X) and the P3 Primary Cell Kit (#V4XP-3024) with the CA-137 program. Within 1 hour of electroporation, HSPCs were transduced with the repair template vector or control AAV at an MOI of 100,000. Cells were then cultured for an additional 48 hours as described above.

[0096] statistical analysis Statistical analysis was performed using GraphPad Prism 7 software. Unless otherwise stated, statistical significance was tested using an unpaired, two-tailed Student's t-test. 3. result sgRNA, primers and repair template [Table 2] TIFF0007782881000003.tif235161 TIFF0007782881000004.tif235160 TIFF0007782881000005.tif235161 TIFF0007782881000006.tif236161 TIFF0007782881000007.tif236161 TIFF0007782881000008.tif235161 TIFF0007782881000009.tif236161 TIFF0007782881000010.tif236161 TIFF0007782881000011.tif236161 TIFF0007782881000012.tif236161 TIFF0007782881000013.tif235161 TIFF0007782881000014.tif236161 TIFF0007782881000015.tif157161 [Table 3] [Table 4]

[0097] An ex vivo gene therapy method using CRISPR / Cas9 gene editing to correct the p.W44X mutation in the HAX1 gene without cell selection We developed an ex vivo gene therapy method to correct the p.W44X mutation (c.131insA) in the HAX1 gene (Figure 1A). To achieve this gene correction, we used a chemically modified sgRNA (sgHAX1.PS-SNP; SEQ ID NO: 552) and Cas9 nuclease to introduce a double-stranded break near the mutation site in the HAX1 gene in HSPCs. This custom-synthesized guide RNA targets a cut within the codon at the p.R50 amino acid position of the wild-type protein sequence. Next, we used rAAV6 to deliver a designed homology-directed repair (HDR) template (SEQ ID NO: 565). This HDR template contains five silent mutations between the HAX1 mutation and the cut site, improving gene editing efficiency by preventing re-cutting of the correctly edited allele and incomplete homology-directed repair (HDR) (Figure 1B, Figure 1C). The method we developed does not require cell selection because the guide RNA targets the mutation downstream and deletes the adenosine that causes the HAX1-CN stop codon (Figure 1B, Figure 1C). The stop codon prevents new protein synthesis resulting from the indel, so the unwanted indel remains silent. This method results in in situ correction of the HAX1 gene, maintaining the timing and splicing of gene expression.

[0098] Knockout of HAX1 using CRISPR / Cas9 in healthy donor-derived HSPCs: a novel in vitro model of HAX1-CN Because congenital neutropenia with HAX1 mutations (HAX1-CN) is a rare disease, obtaining primary cells from such patients is difficult. Therefore, developing a suitable model for drug testing or gene therapy development is an important step toward clinical translation. We hypothesized that editing exon 2 of the HAX1 gene with Cas9 gene editing could induce the HAX1-CN phenotype in healthy HSPCs, and that combining Cas9 with a repair template could rescue this phenotype in the gene-edited HSPCs. Based on this, we first generated HAX1 knockout (KO) HSPCs derived from healthy donors (HD) to test our ex vivo gene therapy method. To generate these HAX1 KO HSPCs, we used CRISPOR to design several sgRNAs targeting exon 2 of the HAX1 gene (HAX1 Ex 2; SEQ ID NO: 553) (Concordet JP, Haeussler M. (2018), CRISPOR: intuitive guide selection for CRISPR / Cas9 genome editing experiments and screens. Nucleic Acids Research 46(W1): W242-W5). We then used CRISPRitz to select the sgRNA with the lowest off-target activity from all guide candidates within 30 base pairs of the mutation site (Cancellieri et al. (2019), CRISPRitz: rapid, high-throughput, and variant-aware in silico off-target site identification for CRISPR genome editing. Bioinformatics 2019; 36(7): 2001-8.) (Figure 2A). All HAX1-CN patients previously screened in our laboratory and all patients utilized in this study carried the single nucleotide polymorphism (SNP) rs13796 (dbSNP build 150).Based on this, we designed an sgRNA (sgHAX1.PS-SNP; SEQ ID NO: 552) with the base corresponding to that position (Figure 1B, Figure 1C, and Figure 2B; Table 2).

[0099] Given our success in establishing HAX1 KO in HSPCs using CRISPR / Cas9, we further tested the HAX1 gene editing method in HSPCs derived from healthy donors (Figure 1D). To control for homologous recombination via double-strand break-independent repair templates, we transduced cells with rAAV6 containing a corrected template (sequence number 565) targeting the AAVS1 safe harbor locus (HD AAVS1 control) (Figure 3A). HSPCs were electroporated with a HAX1-targeting sgRNA (sgHAX1.PS-SNP) and transduced with either a control rAAV6 containing the HAX1 HDR template (HD HAX1 corrected) or a control rAAV6 without the HDR template (HD HAX1 KO). Seventy-two hours after transduction, gene editing efficiency was measured using Sanger sequencing traces and the ICE web tool (Analysis SP. ICE Analysis. 2019 (accessed September 29, 2020)). The overall editing efficiency (TE) was 82.0% (±1.41%) in HD AAVS1 control cells, 86.0% (±5.66%) in HD HAX1 KO cells, and 88.5% (±0.71%) in gene-corrected HD HAX1 cells (Figure 1E). The knockout (KO) frequency in HD HAX1 KO cells was 80.0% (±4.24%), and the knock-in (KI) frequency in gene-corrected HD HAX1 cells was 33.5% (±6.36%) (Figure 1E).

[0100] Next, gene-edited CD34 +We evaluated the efficiency of this method by differentiating HSPCs ex vivo. The overall editing efficiency in HD AAVS1 control cells remained constant at 80.3% (±0.99%) over 14 days of ex vivo differentiation. In contrast, in HD HAX1 KO cells, after 14 days of differentiation, the overall editing efficiency decreased to 71.5% (±0.7%, p=0.0693) and the knockout efficiency decreased to 55.0% (±5.66%, p=0.037). In the HD HAX1 correction group, the overall editing efficiency decreased significantly to 76.5% (±0.71%, p=0.0035) after 14 days of differentiation, but the knockin efficiency only decreased slightly to 29.5% (±4.95%, p=0.556), demonstrating a clonal advantage for gene-corrected HAX1 cells over HAX1 KO cells (Figure 1E).

[0101] Flow cytometry analysis of the distribution of differentiated cells revealed an increase in immature myeloid cells, consisting of myeloblasts and promyelocytes, in the HD HAX1 KO cells. Concomitantly, the number of metamyelocytes and mature neutrophils was reduced in the HD HAX1 KO cells compared to the HD AAVS1 control group (Figure 4A, Figure 4B). These changes observed in the HD HAX1 KO cells were restored to wild-type levels in the gene-corrected HAX1 cells (Figure 4A, Figure 4B). Furthermore, cell differentiation was assessed by morphological analysis of Wright-Giemsa-stained cytospin specimens. This analysis confirmed that while HAX1 knockout (KO) inhibited granulocyte differentiation and increased the number of immature or intermediately mature granulocytes, gene-corrected HD HAX1 cells restored granulocyte differentiation to the same level as wild-type cells (Figure 4C-E). These findings demonstrate that knockout of exon 2 of the HAX1 gene at amino acid position p.R50X can model the p.W44X mutation seen in HAX1-CN. Furthermore, these results demonstrate that this mutation can be corrected, thereby rescuing the congenital neutropenia (CN) phenotype, suggesting that this approach may be used as a gene therapy for HAX1-CN patients.

[0102] Efficient correction of HAX1 mutations in HSPCs from HAX1-CN patients To confirm the findings in HSPCs derived from healthy individuals, we further tested the HAX1 gene editing method described above in primary HSPCs derived from five CN patients with the p.W44X mutation in the HAX1 gene (Figure 5A, Figure 5B). In the control group, where gene editing was performed with sgRNA targeting the AAVS1 locus followed by transduction with the HAX1-HDR template (CN AAVS1 control group), the overall editing efficiency in HSPCs was 76.74% (±17.07%). In contrast, in the group where gene editing was performed with sgRNA HAX1.PS-SNP (SEQ ID NO: 552) followed by transduction with the HAX1-HDR template (CN HAX1 correction group), the overall editing efficiency was 84.4% (±4.2%) and the knock-in efficiency was 65.8% (±7.12%) (Figure 5A). After ex vivo differentiation of gene-edited cells into neutrophils, the overall editing efficiency in the CN AAVS1 control group remained constant at 73.3% (±15.47%) and in the CN HAX1-corrected group remained constant at 83.4% (±7.37%). Meanwhile, the absolute frequency of the corrected allele increased by 10% to 75.8% (±7.918%). To confirm that HAX1 gene editing restored HAX1 protein expression, Western blot analysis of differentiated gene-edited cells revealed that HAX1 protein expression was detected in CN HAX1-corrected cells, but not in CN AAVS1 cells (Figure 5C).

[0103] Improved in vitro granulocytic differentiation in gene-edited HSPCs from HAX1-CN patients To assess whether the editing efficiency was sufficient to rescue the congenital neutropenic phenotype, we investigated ex vivo differentiation of gene-edited cells into neutrophils. We observed that gene-corrected HSPCs gave rise to an average of twice the number of cells compared to control gene-edited cells. Compared to day 1 of culture, the number of CN AAVS1 control cells increased by an average of 2.78-fold (±1.04), while CN HAX1-corrected HSPCs showed a significantly higher increase of 5.6-fold (±2.82, p = 0.0424) compared to control cells (Figure 6A). Morphological analysis of cytospin preparations of differentiated cells by Wright-Giemsa staining revealed that the proportion of mature granulocytes in CN HAX1-corrected cells was significantly increased (p = 0.005) compared to CN AAVS1 controls, accompanied by a decrease in the amount of immature myeloid cells and apoptotic cells (Figure 6B, Figure 6C). Furthermore, flow cytometry analysis of granulocyte differentiation revealed a significant 2.5-fold increase in mature neutrophils (p = 0.008) and a significant 1.5-fold decrease in promyelocytes (p = 0.012) (Figure 6D). These data demonstrate that CRISPR / Cas9-mediated correction of the HAX1 mutation in HSPCs derived from CN patients successfully corrected the maturation suppression of granulopoiesis in vitro.

[0104] Protection of CN HSPCs from endogenous stress by correcting HAX1 mutations We recently reported that HAX1-CN HSPCs exhibit increased susceptibility to oxidative stress. To investigate whether correcting the HAX1 mutation and restoring HAX1 protein expression could protect HSPCs from oxidative stress, we performed live cell imaging of H2O2-induced caspase 3 / 7 activation. H2O2-induced apoptosis was significantly reduced in ex vivo differentiated HAX1-corrected HSPCs from CN patients compared with AAVS1 control cells from CN patients (Figure 7A).

[0105] We further investigated the functional characteristics of granulocytes differentiated from CN patients after correcting the HAX1 mutation. We observed that CN HAX1-corrected granulocytes from two HAX1-CN patients exhibited enhanced phagocytosis of E. coli bioparticles compared with CN AAVS1 control cells (Figures 7B and 8A). Furthermore, differentiated cells generated from CN HAX1-corrected cells showed enhanced production of neutrophil extracellular traps (NETs) when stimulated with phorbol myristate acetate (PMA) compared with differentiated CN AAVS control cells (Figures 7C, 9A, and 9B). CN HAX1-corrected cells also exhibited significantly increased chemotaxis (Figure 10A). We measured reactive oxygen species (ROS) production by cells after stimulation with N-formylmethionine-leucyl-phenylalanine (fMLP) using a luminescence assay that detects ROS-dependent luciferin activation. The amount of ROS produced in control cells after stimulation with fMLP was higher in CN HAX1-modified cells than in CN AAVS1-control samples (Figure 8B). However, the fold change in ROS production between control and fMLP-activated cells was not observed to differ between CN AAVS1-control and CN HAX1-modified cells (Figure 7D). In conclusion, modifying exon 2 of the HAX1 gene resulted in the production of functional mature neutrophils with enhanced resistance to H2O2-induced apoptosis, improved phagocytic ability, and enhanced NET production and chemotaxis compared to CN AAVS1-control edited cells.

[0106] Favorable genotoxicity profile of the guide RNA used To identify potential off-target or translocation sites, we performed three independent methods. To perform these experiments, we employed the GUIDE-Seq method, which performs in-cell measurements in healthy HSPCs (n = 2). Three potential off-target sites, one intergenic region, and two introns were found (Figure 11A). Using the CAST-Seq assay, which can detect large on-target deletions and translocations between on-target and off-target sites, we detected the majority of hits as large on-target deletions. Nine additional translocations between on-target and off-target sites were found (Figure 11B, Figure 11C). Furthermore, we screened potential off-target sites in DNA isolated from two HAX1-CN patients using Nano-OTS (data not shown). No potential off-target sites were found in oncogenes or tumor suppressor genes. The majority of off-target sites were located in intergenic or intronic regions. Nano-OTS found only low frequencies of off-target sites in protein-coding genes, and these genes were not associated with malignant tumors or hematological disorders.

[0107] Modeling the HAX1 p.W44X modification in iPSCs and its effect on differentiation Using the iPSC model established by the present inventors, we were able to correct the p.W44X mutation in the HAX1 gene with 100% efficiency in two independent iPSC cell lines derived from HAX1-CN patients (Fig. 12A). + Colony-forming unit assays of the cells (Figure 12B) showed that CFU-G and CFU-GM colony formation was rescued. CFU-M colony formation was normalized (Figure 13A). Furthermore, gene correction of p.W44X rescued neutrophil production from iPSCs in vitro (Figures 13B and 13C). Furthermore, RNA-Seq analysis of cells at day 14 of differentiation revealed that multiple genes essential for specialized granules, gelatinase granules, cell surface markers, and secretory vesicles were rescued (Figure 13D).

[0108] Minimizing unwanted indels by double nickase method To minimize the number of unwanted indels, we tested various combinations of sgRNAs (C) in combination with the D10A Cas9 nickase (Figure 14A and Table 4). All of these nickase and sgRNA combinations reduced the number of unwanted indels. Combination C2 most efficiently increased the HDR / NHEJ ratio while maintaining knock-in efficiency (Figure 15B, Figure 15C). Combinations C5 through C11 reduced indels to less than 5% or zero, but also reduced overall editing efficiency. Therefore, C2 was the most optimal combination. [Table 5]

[0109] 4. Consideration Herein, we report for the first time that CRISPR / Cas9 can be used to correct an autosomal recessive HAX1 mutation in primary HSPCs derived from a patient with congenital neutropenia (CN). High correction efficiency was achieved, and significant improvement in granulocytic differentiation was observed in ex vivo gene-corrected cells, restoring the desired HAX1 protein expression and function. In autosomal recessive diseases, correction of only one mutant allele is sufficient. Loss-of-function mutations (HAX1 mutations) that cause defective protein expression have a very low probability of introducing a pathological truncated protein as a by-product of non-homologous end joining (NHEJ). In our method, unwanted indels are located downstream of the stop codon and therefore are not translated. Our gene therapy method for HAX1-CN using homology-directed repair (HDR)-based mutation correction is highly efficient and safe, making it fully suitable for clinical application as an ex vivo gene therapy.

[0110] CRISPR / Cas9 may introduce new missense or in-frame mutations or large deletions not found in HAX1-CN. The role of these new HAX1 mutations in granulocyte development and leukemia induction remains to be assessed. Since no such mutations were detected in gene-edited cells, and concurrently, improved granulocyte differentiation and resistance to H2O2-induced apoptosis were observed, we speculate that the frequency of such mutations is negligible and does not affect the process mediated by the method of the present invention. The long-term effects of new missense or frameshift HAX1 mutations introduced by CRISPR / Cas9 editing should be evaluated in ex vivo experiments using long-term HSC (LT-HSC) cultures and in vivo experiments using HSPC engraftment in immunodeficient NSG mice.

[0111] Another more common gene editing method for correcting inherited gene mutations is based on disrupting the transcription start site of a mutated cDNA by introducing a full-length wild-type cDNA. However, this method is not suitable for restoring mutant HAX1 expression. This is because at least eight HAX1 isoforms are differentially expressed in various mature blood cell subtypes, and the functions of these isoforms remain unknown. Of these eight HAX1 isoforms, several are known to contribute to specific cancers. Instead of restoring the HAX1 reading frame, introducing a full-length wild-type HAX1 cDNA can express these HAX1 variants generated by alternative splicing. Exclusive expression of the full-length isoform may impair specific cellular functions dependent on a particular HAX1 isoform or promote or initiate malignant transformation of target cells. The importance of HAX1 isoforms is supported by inconsistent results in two iPSC studies testing ectopic expression of HAX1 using lentiviral vectors.

[0112] We used AAV transduction to deliver the HAX1 homologous recombination repair template into cells. This method has already been used in clinical trials for sickle cell anemia, where HSPCs were gene-edited and the gene-corrected cells were autologously transplanted, and extensive research has been conducted. AAV-mediated delivery is a relatively safe and currently the most efficient method for delivering homologous recombination repair templates without triggering the innate immune system of HSPCs; however, it may induce undesirable cellular and intracellular responses to AAV microparticles. Alternatively, other nucleic acid delivery methods, such as recombinant nucleic acids or nanoparticle- or extracellular vesicle-based cell transport, may be used. Furthermore, for patients already at high risk for developing hematologic malignancies, it may be crucial to consider the option of selecting p53-deficient HSCs using double-strand break-mediated editing. In this embodiment, our method can also be adapted to take advantage of recent advances in genome editing, which can improve clonality and suppress p53-mediated DNA damage responses and the innate immune response of HSCs. Alternatively, gene editing and other methods that can delete pathogenic adenosines without relying on double-strand breaks may be good options once refinement allows for more widespread use.

[0113] Gene-edited pluripotent long-term HSCs (LT-HSCs) are required to provide a curative treatment. LT-HSCs are crucial for long-term, multilineage hematopoietic reconstitution after gene therapy. A major obstacle is the slow proliferation rate of LT-HSCs, which is a crucial prerequisite for homologous recombination repair after CRISPR / Cas9 gene editing. Several methods have been proposed for targeting LT-HSCs with CRISPR / Cas9. One method involves maintaining cells in the G0-G1 cell cycle by transiently inhibiting intracellular pathways (e.g., the p53 pathway). This transient induction of the cell cycle allows for efficient gene editing. At the same time, whether short-term HSCs or more committed progenitor cells can be redifferentiated into LT-HSCs under specific stimuli, such as the bone marrow microenvironment or feedback humoral responses, requires scientific consideration. Furthermore, gene-edited hematopoietic cells, once mutations are corrected, exhibit improved fitness and advantages in survival and proliferation compared to unmodified cells. In vivo delivery of CRISPR / Cas9 complexes using AAV serotypes targeting HSCs or nanoparticles (ideal for LT-HSCs) is currently under scientific investigation. However, optimal in vivo delivery requires elucidating cell type-specific AAV serotypes, even those specific to cell differentiation stages, and methods to overcome immunological barriers. Determining whether congenital neutropenic patients have pre-existing adaptive immunity to Cas9 remains an important challenge, as patients often suffer from severe bacterial infections until optimal G-CSF doses are adjusted. Therefore, it is possible to speculate that congenital neutropenic patients may already have a higher level of immunity to Cas9 than healthy individuals.

[0114] Furthermore, it is important to estimate the minimum effective therapeutic threshold of gene editing required to correct the neutropenic phenotype and prevent leukemic transformation in HAX1-CN patients. This could be achieved by testing various ratios of gene-edited cells to control-edited cells in animal models using xenografts of gene-edited cells, but this approach is not optimal. Alternatively, in vivo granulocyte differentiation of xenografted primary HSPCs from HAX1-CN patients at various ratios to HSPCs from healthy donors should be evaluated in NSG mice. This testing may estimate the optimal amount of gene editing sufficient to maintain physiological concentrations of granulocytes in the bone marrow and peripheral blood.

[0115] Furthermore, because HAX1-CN is a preleukemic disease, premalignant or malignant HSC clones carrying leukemia-associated somatic gene mutations may already exist in young patients, making patient age crucial for gene therapy. To avoid the possibility of leukemic transformation of HSCs after gene editing, it is necessary to evaluate the patient's bone marrow, for example, using ultra-deep sequencing of a broad panel of leukemia-associated gene mutations. This reduces the possibility of genetically manipulating already transformed HSCs, which may be at increased risk for leukemic transformation. On the other hand, after the mutation causing congenital neutropenia is corrected by gene editing, G-CSF treatment is no longer required, significantly reducing the probability of developing leukemia. It is necessary to investigate whether HSCs that have acquired mutations in the CSF3R and / or RUNX1 genes remain clonal, even if they are no longer exposed to high-dose G-CSF.

[0116] Our platform can also be used to model HAX1-associated congenital neutropenia in vitro or in vivo. The underlying mechanism of the defect in downstream granulopoiesis in the absence of HAX1 expression remains largely unknown. No mouse model of HAX1 deficiency exists (Hax1). - / -Although HAX1-CN mice have normal neutrophil counts, only a small number of primary HSPCs from HAX1-CN patients are available for downstream investigation. Herein, we demonstrate that introducing HAX1 truncation into HSPCs from healthy donors in vitro reduces granulocytic differentiation. Therefore, modeling HAX1-CN using CRISPR / Cas9 in HSPCs from healthy donors for downstream analysis may advance our understanding of the mechanisms underlying granulopoiesis and leukemogenesis.

[0117] 6. conclusion By using the sgRNA and / or repair template nucleic acid molecules of the present invention, we have demonstrated impressive results that the HAX1 gene can be targeted or corrected in a specific manner. This targeting or correction can be achieved using CRIPSR / Cas9 technology. Therefore, the methods provided herein represent a promising tool for the causative therapy of congenital neutropenia and the resulting myelodysplastic syndromes (MDS) and / or myeloid leukemia (AML).

Claims

1. A combination of two single guide RNA (sgRNA) molecules, wherein at least one of the two sgRNA molecules listed in the table below is combined: A combination of two sgRNA molecules, each of which targets a gene encoding HCLS1-associated protein X-1 (HAX1 gene) in an organism for use in the prevention, treatment, and / or testing of a disease, and which is configured to bind to a nucleic acid containing the HAX1 gene in a PAMout positional relationship. Table 1

2. 2. The combination of claim 1, wherein the disease is congenital neutropenia.

3. The combination described in claim 2, wherein the disease is severe congenital neutropenia (CN / SCN) and / or cyclic neutropenia (CyN).

4. 2. The combination of claim 1, wherein the disease is myelodysplastic syndrome (MDS) and / or myeloid leukemia (AML).

5. A vector comprising the combination according to any one of claims 1 to 4.

6. The vector of claim 5, which is a recombinant adeno-associated virus vector (rAAV).

7. The vector described in claim 5, which is a recombinant adeno-associated virus vector serotype 6 (rAAV6).

8. A composition comprising a combination according to any one of claims 1 to 4 and / or a vector according to claim 5.

9. 9. The composition of claim 8, further comprising CRISPR-associated protein 9 (Cas9) and / or a vector encoding said Cas9.

10. The composition of claim 8, further comprising Cas9 from Streptococcus pyogenes (Sp Cas9), Sp Cas9 V3, Sp HiFi Cas9 V3, or Cas9 nickase.

11. The composition of claim 8, which is a pharmaceutical composition comprising a pharmaceutically acceptable carrier.

12. 1. An in vitro method for targeting the HAX1 gene in biological material containing genetic material encoding the HAX1 gene, comprising: A method comprising the step of introducing the combination according to any one of claims 1 to 4, the vector according to claim 5, and / or the composition according to claim 8 into a biological material.

13. The method described in claim 12, characterized in that editing is performed using CRISPR / Cas9 technology.

14. The method of claim 12 , wherein the biological material comprises hematopoietic stem and progenitor cells (HSPCs).

15. A method for testing for disease in vitro, comprising: A method comprising a step of targeting the HAX1 gene of an organism by introducing a combination described in any one of claims 1 to 4, a vector described in claim 5, and / or a composition described in claim 8 into a biological material.

16. The method described in claim 15, characterized in that editing is performed using CRISPR / Cas9 technology.

17. 16. The method of claim 15, wherein the disease is congenital neutropenia.

18. The method described in claim 17, wherein the disease is selected from the group consisting of severe congenital neutropenia (CN / SCN), cyclic neutropenia (CyN); myelodysplastic syndrome (MDS); and myeloid leukemia (AML).

19. A method for editing and / or correcting a mutant allele of a HAX1 gene in a cell in vitro, comprising: CRISPR-associated protein 9 (Cas9) or a sequence encoding said Cas9; an sgRNA molecule comprising the nucleotide sequence set forth in SEQ ID NO: 552, or A combination of two sgRNA molecules, which is a combination of at least one of the two sgRNA molecules listed in the table below, and which is configured to bind to a nucleic acid containing the HAX1 gene in a PAMout positional relationship. by introducing into the cell a composition comprising generating a double-stranded break in the mutant allele of the HAX1 gene with a complex of the Cas9 and the sgRNA molecule; or generating two single-strand breaks in the mutant allele of the HAX1 gene using a complex consisting of the Cas9 and the two types of sgRNA molecules; A method comprising: Table 2

20. The HAX1 gene has a mutation associated with congenital neutropenia, severe congenital neutropenia (CN / SCN) or cyclic neutropenia (CyN), the HAX1 gene of the cell has a mutation at nucleotide position c.131insA; and / or The method of claim 19, wherein the product of the HAX1 gene has a mutation at the amino acid position p.W44X.

Images