Compositions and methods for microbial treatment of skin disorders
Yarrowia-based compositions and methods target Malassezia-induced dandruff by consuming free fatty acids and inhibiting biofilms, providing an effective treatment for scalp disorders.
Patent Information
- Application Number
- JP2022546388
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-11-20
- Filing Date
- 2021-01-29
- Publication Date
- 2025-12-10
- Estimated Expiration
- 2041-01-29
AI Technical Summary
There is a need for effective methods and compositions to treat scalp disorders, particularly dandruff, by addressing the imbalance in the scalp microbiome caused by Malassezia species, which produce irritating fatty acids leading to inflammation and skin irritation.
Compositions and methods utilizing microorganisms of the genus Yarrowia, or fragments, cell lysates, fermentation products, and metabolites thereof, to consume free fatty acids produced by Malassezia species, thereby reducing their growth and biofilm formation, and alleviating dandruff conditions.
Yarrowia microorganisms effectively reduce the production and accumulation of free fatty acids, alleviating dandruff symptoms by inhibiting Malassezia species growth and biofilms, thus reducing inflammation and skin irritation.
Smart Images

Figure 0007783821000001 
Figure 0007783821000002 
Figure 0007783821000003
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to skin care compositions, skin care formulations, and methods for providing treatment for scalp disorders. More particularly, the present disclosure relates to methods for treating scalp disorders, such as dandruff, and compositions comprising at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0002] Reference to an electronically submitted sequence listing The contents of the Sequence Listing (Name: 20210127_NB41714PCT_ST25; Size: 2KB; Creation Date: January 27, 2021) submitted electronically with this application as an ASCII text file constitutes part of this application and is incorporated herein by reference in its entirety. [Background technology]
[0003] The skin functions as a barrier that not only protects the organism from drying out but also from the penetration of foreign substances, which are often harmful.
[0004] The skin is also home to a diverse community of microorganisms, the majority of which are commensal (nonpathogenic permanent residents) or transient (temporary residents). When interacting with pathogens, only the microorganisms benefit, while the host is ultimately harmed. Many skin pathogens that live on the skin can usually be viewed as commensals, but can change from commensal to pathogenic forms triggered by microbial dysbiosis (or microbial imbalance), host genetic mutations, and immune status (Non-Patent Document 1).
[0005] The epidermis constitutes the outermost region of the skin tissue and, as such, forms the actual protective outer layer against the environment. The outer layer of the epidermis (Stratum corneum, Horny layer) is the part that comes into contact with the environment, and its unique structure protects the skin and stabilizes its flexibility by binding a certain amount of water (Non-Patent Document 2).
[0006] Spatially, the skin microbiota may extend to the lower compartments of the epidermis (Non-Patent Document 3). Areas with a high density of sebaceous glands, such as the face, chest, and back, promote the proliferation of fat-loving microorganisms such as Propionibacterium and Malassezia.
[0007] Malassezia is a major fungus in the skin microbiome and is found on the scalp of almost everyone. It is involved in the most common skin diseases, including, but not limited to, seborrheic dermatitis, dandruff, and tinea versicolor. Dandruff is the commonly used term for seborrhea of the skin. The main fungi involved are Malassezia restricta (M. restricta) and Malassezia globosa (M. globosa), with a very high prevalence of nearly 50% of the population (Non-Patent Document 4). Treatment with antifungal agents rather than antibacterial agents can improve the disease. The underlying pathogenic mechanisms are not fully understood. Impaired skin barrier function accelerates the disease process (Non-Patent Document 5).
[0008] Malassezia species (Malassezia spp.) lack fatty acid synthases and must rely on sebum lipids for their carbon source. They also lack delta-2,3-enoyl-CoA isomerase, which is required for the efficient utilization of unsaturated fatty acids (e.g., oleic acid). Malassezia species feed on sebum lipids (by secreting one or more lipases that break down triglycerides into irritating fatty acids). When sebum lipids are broken down, fatty acids (e.g., oleic acid) are released as by-products. Many individuals are sensitive to free fatty acids because they can induce overgrowth and scaling, as well as the release of arachidonic acid, which is also involved in inflammation, causing the scalp to react with irritation. In response to this irritation, the scalp begins to swell, become red, and itch, and skin cells slough off more rapidly than usual as the body attempts to remove the irritant. This peeling of the skin causes visible flakes to appear on the scalp - this is dandruff. [Prior art documents] [Non-patent literature]
[0009] [Non-Patent Document 1] Findley, K. and Grice, EA, The Skin Microbiome: A Focus on Pathogens and Their Association with Skin Disease.PLoS Pathog.2014,10 [Non-patent document 2] PMElias,Structure and Function of the Stratum Corneum Permeability Barrier,Drug Dev.Res.13,1988,97,105 [Non-patent document 3] Nakatsuji,T et al.,The Microbiome Extends to Subepidermal Compartments of Normal Skin.Nat.Commun.2013,4 [Non-patent document 4] Schommer,NN;Gallo,RL,Structure and Function of the Human Skin Microbiome.Trends Microbiol.2013,21,660,668 [Non-Patent Document 5] Harding,C.Ret al.,Dandruff:a condition characterized by decreased levels of intercellular lipids in scalp stratum corneum and impaired barrier function.Arch.Dermatol.Res.2002,294,221,230 Summary of the Invention [Problem to be solved by the invention]
[0010] There remains a need to find methods and skin care compositions for providing treatment for scalp disorders, including, but not limited to, methods and compositions for treating flaky scalp conditions. [Means for solving the problem]
[0011] The present disclosure relates to compositions and methods for providing treatment for scalp disorders. More particularly, the present disclosure relates to methods and compositions for treating scalp disorders, including dandruff, comprising at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0012] The present inventors have unexpectedly found that microorganisms, particularly microorganisms of the genus Yarrowia, can consume the free fatty acids produced by the lipolytic activity of dandruff-causing Malassezia species, particularly Malassezia globosa, thereby alleviating the dandruff condition in subjects in need thereof. Furthermore, the present inventors have unexpectedly found that microorganisms of the genus Yarrowia and / or fragments thereof and / or cell lysates thereof and / or fermented products thereof and / or metabolites thereof can reduce the growth of Malassezia species, remove biofilms of Malassezia species, and prevent or reduce biofilm formation of Malassezia species.
[0013] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder.
[0014] In one aspect, the scalp disorder is selected from the group consisting of any one of excessive scalp dandruff (seborrheic dermatitis), scalp ecoflora imbalance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or a combination thereof.
[0015] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder, and the composition degrades lipids selected from the group consisting of sapienic acid (C16:1 cis-6), palmitic acid (C16:0), myristic acid (C14:0), petroselinic acid (C18:1 cis-6), pentadecylic acid (C15:0), stearic acid (C18:0), lauric acid (C12:0), leic acid, and any one of combinations thereof.
[0016] In one embodiment, the composition is a skin care composition comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof for use in treating a scalp disorder, wherein the composition alleviates and / or treats the scalp disorder, and the composition reduces the growth of Malassezia species.
[0017] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder, and the composition removes biofilms of Malassezia species.
[0018] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder, and the composition prevents or reduces biofilm formation of Malassezia species.
[0019] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one microorganism of the genus Yarrowia selected from the group consisting of any one of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or combinations thereof, and / or fragments thereof and / or cell lysates thereof and / or fermentation products thereof and / or metabolites thereof.
[0020] In one embodiment, the composition is a skin care product comprising an effective amount of a skin care composition for use in treating a scalp disorder, the skin care composition comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and one or more dermatologically or skin care acceptable ingredients, wherein the composition alleviates and / or treats the scalp disorder.
[0021] In one embodiment, the composition is a skin care product selected from the group consisting of a lotion, serum, jelly, cream, gel, emulsion, mask, patch, or stick comprising one or more dermatologically or skin care acceptable ingredients and at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and up to 10% of the skin care formulation described herein, based on the total weight of the skin care formulation.
[0022] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering to the subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0023] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0024] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising topically administering to the subject a skin care product comprising a skin care composition described herein.
[0025] Also provided herein are kits for treating skin conditions, comprising a composition described herein and instructions for use thereof. In some embodiments, the kit further comprises one or more applicators configured to apply the composition. DETAILED DESCRIPTION OF THE INVENTION
[0026] The features and advantages of the present disclosure will be more readily understood by those skilled in the art upon reading the following detailed description. It should be understood that certain features of the present disclosure, which are described above and below in the context of separate embodiments for clarity, may also be combined to provide a single component. Conversely, various features of the present disclosure, which are described for brevity in the context of a single embodiment, may also be provided separately or in any subcombination. It will be understood that, hereinafter, embodiments referred to in the context of one broad aspect of the present invention are equally applicable to each of the other broad aspects of the invention described above. It will be further understood that, unless the context dictates otherwise, the embodiments described below may be combined.
[0027] scalp disorders The term "scalp disorder" for the purposes of this disclosure includes excessive scalp dandruff (seborrheic dermatitis), scalp flora disturbance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or any combination thereof.
[0028] The term "dandruff condition" for the purposes of this disclosure refers to a condition that is manifested by excessive dryness of the scalp or excessive sebum secretion and may be characterized in some cases by the presence of dry or greasy or oily dandruff or even itching and / or inflammation of the epidermis.
[0029] Excessive dry dandruff indicates a dry scalp, which may be combined with an excessively rapid renewal of the stratum corneum. Dry dandruff flakes are generally in the form of small white or gray flakes that spread all over the scalp and on clothing, creating an unpleasant appearance.
[0030] The itchy, dry scalp can cause erythema, pruritus, or even inflammation.
[0031] Excessive greasy or oily dandruff is a form of seborrheic dermatitis. Individuals with seborrheic dermatitis have an erythematous scalp covered with large, greasy or oily yellow scales that accumulate and form patches. The scalp is itchy and often causes a burning sensation in the affected areas. This phenomenon can be amplified by the presence of pathogenic microorganisms, particularly Malassezia species (Malassezia spp.). Malassezia species as described herein include, but are not limited to, Malassezia restricta (M. restricta) and Malassezia globosa (M. globosa). These microorganisms, which release fatty acids from sebum, can damage the epidermal barrier and cause inflammation.
[0032] When the scalp is in a flaky state, the skin barrier becomes unbalanced, its integrity and hydration are compromised, and the environmental flora is disrupted: the scalp skin becomes irritated and itchy, fragile, dehydrated and prone to infection.
[0033] The present inventors unexpectedly discovered that microorganisms, particularly those of the genus Yarrowia, can consume free fatty acids produced by the lipolytic activity of dandruff-causing Malassezia species. According to the present disclosure, the use of microorganisms, particularly those of the genus Yarrowia, can reduce the free fatty acids produced by the lipolytic activity of dandruff-causing Malassezia species, particularly Malassezia globosa, thereby alleviating the dandruff condition in subjects in need thereof. Fatty acids may also be produced by other fat-loving bacteria. Reducing the production of fatty acids can alleviate dandruff and other skin disorders caused by free fatty acids.
[0034] This reduction may be manifested by a reduction in scalp scratching episodes and consequently reduced barrier function damage, which in turn reduces skin irritation and itching, and reduces or even eliminates existing dandruff.
[0035] Microorganisms, their fragments, their cell lysates, their fermentation products, and their metabolites Surprisingly and unexpectedly, the results described herein demonstrate that growing Y. lipolytica and M. globosa together significantly reduces the growth of M. globosa in the presence of Y. lipolytica (e.g., Y. lipolytica inhibits Malassezia sp.), indicating that Yarrowia microorganisms can be used as a microbial treatment for dandruff conditions. As described herein (Table 2, Example 3), M. globosa expressed lipase activity in cell-free medium (indicating that it secreted lipase), whereas Y. lipolytica did not exhibit significant lipase activity in the cell-free supernatant. This is presumably because the majority of lipase activity in Yarrowia microorganisms is cell-bound or cell-associated, which is surprising and a favorable characteristic for microbial treatment, since lipase activity would not remain on the skin after microbial treatment was completed, thereby preventing the accumulation of free fatty acids. As described herein, free fatty acids (FFAs) of oleic acid produced by lipase activity in Malassezia globosa were efficiently consumed by Yarrowia lipolytica but not by M. globosa (Example 5, Table 4). This is consistent with the results showing that M. globosa cannot utilize oleic acid (and therefore cannot or only grows poorly on oleic acid), whereas oleic acid was efficiently taken up by Yarrowia lipolytica (Example 2, Table 1).Because oleic free fatty acids (FFAs) are considered pro-inflammatory, the efficient scavenging of FFAs by Yarrowia microorganisms is an important property of microbial treatments to combat dandruff or other skin disorders caused by pro-inflammatory oleic FFAs.
[0036] Furthermore, the inventors have unexpectedly found that a microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof can reduce the growth of Malassezia species, remove biofilms of Malassezia species, and prevent or reduce biofilm formation of Malassezia species.
[0037] As used herein, "microorganism" refers to bacteria, fungi, viruses, protozoa, and other microscopic organisms.
[0038] In some embodiments, at least one Yarrowia microorganism can be subjected to a treatment to render it replication-defective, such as heat exposure, desiccation, gamma irradiation, or ultraviolet irradiation. Non-replicating Yarrowia microorganisms can be dead cells or viable cells that are no longer capable of cell division. Non-replicating Yarrowia microorganisms can be intact cells or cells that have undergone partial or complete cell lysis. In some embodiments, the non-replicating cells can comprise a mixture of intact cells and cell lysates.
[0039] As used herein, the terms "probiotic" or "probiotic microorganism" are used interchangeably herein and refer to live microorganisms (including, for example, bacteria or yeasts) that, when administered (topically or orally) in sufficient amounts, have a beneficial effect on a host organism, i.e., confer one or more demonstrable benefits, such as reducing the host organism's dandruff condition.
[0040] In one embodiment, microorganisms suitable for use in the present invention include those of the genus Yarrowia.
[0041] In one embodiment, the at least one microorganism of the genus Yarrowia is at least one microorganism selected from the group consisting of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or any combination thereof.
[0042] As used herein, the terms "fraction" or "fraction of at least one microorganism of the genus Yarrowia" or "fragment of at least one microorganism of Yarrowia" or "fragment thereof" refer more specifically to a fraction of the microorganism, by analogy with the intact microorganism, that exhibits efficacy in treating scalp dandruff conditions. Fragments of at least one microorganism of the genus Yarrowia include metabolites (also referred to as metabolites of a microorganism of the genus Yarrowia) obtained from the at least one microorganism of the genus Yarrowia. In one embodiment, the fraction of at least one microorganism of the genus Yarrowia includes one or more metabolites (active compounds) derived from the metabolism of a microorganism of the genus Yarrowia that also exhibit efficacy in treating scalp disorders.
[0043] As used herein, the terms "metabolite" or "metabolite of at least one Yarrowia microorganism" or "metabolite thereof" or "Yarrowia microorganism metabolite" or "active metabolite" are used interchangeably and refer to any substance derived from the metabolism of a Yarrowia microorganism that also exhibits efficacy in treating scalp disorders. In one aspect, the one or more metabolites are produced during the cultivation (fermentation) of at least one Yarrowia microorganism for use in treating scalp disorders. Such metabolites of at least one Yarrowia microorganism for use in treating scalp disorders include, but are not limited to, primary metabolites (metabolites directly involved in normal growth, development, and reproduction), soluble metabolites, peptides, proteins, nucleotides, secondary metabolites, polynucleotides, and polysaccharides.
[0044] It will be apparent that the fragments may be used directly in the formulations of the invention or the active substance(s) (metabolites) may be isolated from the fragments by any suitable means prior to use.
[0045] According to one embodiment, Yarrowia microorganism metabolites and / or fragments suitable for use in the present invention may be administered in the form of a lysate.
[0046] The term "cell lysate" or "lysate" as used herein refers to cells lysed by any suitable means. The term "cell lysate" or "lysate" traditionally refers to a substance obtained by disrupting or dissolving biological cells through a phenomenon known as lysis, thus releasing the intracellular biological components naturally contained within the cells of the target microorganism. For the purposes of this disclosure, the term "lysate" is used indiscriminately to refer to the entire lysate obtained by lysis of the target microorganism, or only a fragment thereof. Thus, the lysate used may be formed, in whole or in part, from intracellular biological components as well as from cell wall and membrane components. Advantageously, the lysate used in the present invention may be a whole cell lysate obtained by lysis of the target microorganism. This cell lysis can be achieved by any suitable means, including, but not limited to, osmotic shock, heat shock, ultrasonication, homogenization, shearing, chemical lysis, or mechanical stress of the centrifugation type.
[0047] In one embodiment, the cell lysate of at least one Yarrowia microorganism comprises one or more metabolites (active compounds) derived from the metabolism of the Yarrowia microorganism that are also effective in treating scalp disorders.
[0048] It will be apparent that the cell lysate may be used directly in the formulations of the invention or one or more of the active substances (metabolites) may be isolated from the cell lysate by any suitable means prior to use.
[0049] The lysate can be used in various forms, in the form of a solution or in powder form. The microorganisms can be included in the composition according to the invention in live, semi-active or inactivated form, or dead form.
[0050] "Inactivated" or "dead" microorganisms within the meaning of the present invention are microorganisms that are no longer able to form colonies in culture. Dead or inactivated microorganisms may have intact or destroyed cell membranes. Dead or inactivated microorganisms may be obtained by any method known to those skilled in the art.
[0051] In some embodiments, cell debris is removed prior to use. In one embodiment, the cell lysate is filtered prior to use. In one embodiment, the cells are lysed, for example, by sonication, homogenization, shearing, or chemical lysis.
[0052] As used herein, the term "fermentate" should be understood as a composition in which one or more live microbial strains are grown in a nutrient medium. In one aspect, "fermentate" refers to the supernatant from a cell culture of at least one Yarrowia microorganism. In one embodiment, the cells are removed by centrifugation. In one embodiment, the fermentate (cell culture supernatant) is obtained by filtering a culture medium in which cells of a Yarrowia microorganism have been cultured.
[0053] In one embodiment, the fermentation product of at least one Yarrowia microorganism comprises one or more metabolites (active compounds) derived from the metabolism of the Yarrowia microorganism, which are also effective in treating scalp disorders.
[0054] It will be apparent that the fermentate may be used directly in the formulations of the present invention or one or more of the active substances (metabolites) may be isolated from the fermentate by any suitable means before use.
[0055] In one embodiment, the fermentate can include one or more metabolites, such as, but not limited to, soluble metabolites produced during the fermentation of at least one microorganism of the genus Yarrowia.
[0056] In one embodiment, a fermentate resulting from the cultivation (fermentation) of at least one microorganism of the genus Yarrowia may be used in the methods and / or uses of the present invention.
[0057] The nutrient medium used to prepare the fermentate is any medium containing the necessary nutrients suitable for growing the selected microorganism. Suitable nutrients include, but are not limited to, aminopeptides, peptides, yeast extract, and / or vitamins. The medium can be based on dairy products such as milk, cereals, fruits, and / or vegetables.
[0058] As used herein, the term "soluble metabolites" refers to metabolites or metabolites present in the supernatant of a cell culture from which the cells have been removed. In one embodiment, the culture is maintained at least at OD 600 The cells are grown to a cell density of about 0.5. In one embodiment, the cells are removed by centrifugation. In one embodiment, the supernatant is filtered. It will be apparent that the supernatant may be used directly in the formulations of the invention, or one or more of the metabolites may be isolated from the supernatant by any suitable means prior to use.
[0059] In some embodiments, the compositions of the present invention can include a fermentation product of a Yarrowia microorganism from which all or substantially all of the cells of the Yarrowia microorganism have been removed. Methods for separating cells from growth medium are well known in the art and can utilize physical methods, such as centrifugation to produce a cell pellet and a culture supernatant, filtration, ultrafiltration, tangential flow filtration, dead-end filtration, or reverse osmosis. Alternatively, or in addition, the separation method can be ligand-based, for example, involving an antibody that specifically binds to the Yarrowia microorganism. The antibody can be bound to a solid support, such as magnetic beads.
[0060] In some embodiments, compositions of the present invention comprise Yarrowia microorganisms partially or substantially separated from the medium in which they were grown. The Yarrowia microorganisms may be viable or non-replicating (e.g., inactivated, e.g., by heat treatment). The cells may be lyophilized, i.e., freeze-dried, under conditions that preserve cell viability. Methods of lyophilization are well known in the art.
[0061] In one embodiment, the fermentate can include a Yarrowia microorganism that consists essentially of nonviable cells (eg, intact cells).
[0062] In other embodiments, the fermentate can include a Yarrowia microorganism consisting essentially of viable cells (eg, intact, non-culturable cells).
[0063] The term "consisting essentially of" in reference to a fermentation includes at least 90% of the Yarrowia microorganisms having the specified characteristic (e.g., intact nonviable cells) or being viable cells (e.g., intact nonculturable cells). Preferably, at least 95% have the specified characteristic. Preferably, at least 97% have the specified characteristic. Preferably, at least 99% have the specified characteristic. In some embodiments, at least 100% have the specified characteristic.
[0064] As used herein, the term "cell-free fermentate" (synonymous with "fermentate supernatant") means that the fermentate is substantially free of viable cells of microorganisms of the genus Yarrowia.
[0065] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of a fermentate supernatant derived from the fermentation of at least one microorganism of the genus Yarrowia, wherein said composition alleviates and / or treats said scalp disorder.
[0066] In one embodiment, the fermentate for use in the compositions and methods and / or uses of the present invention may be substantially free of viable cells of a microorganism of the genus Yarrowia, typically having 0 (or substantially 0) viable cells per mL of fermentate.
[0067] Skin care compositions and products for treating skin conditions such as dandruff As used herein, the term "skin care composition" refers to a composition that includes at least one skin care benefit agent that is capable of providing a skin care benefit.
[0068] As used herein, the terms "skin care benefit agent" or "active agent" are used interchangeably and refer to a microorganism of the genus Yarrowia and / or a fragment of said microorganism and / or a cell lysate of said microorganism and / or a fermentation product of said microorganism and / or a metabolite of said microorganism that can provide a skin care benefit.
[0069] The term "skin care benefit" as used herein refers to the beneficial effect provided by an active agent (or a skin care composition and / or skin care product comprising an effective amount of said active agent) when topically applied to the skin. In one aspect of the present invention, the skin care benefit is selected from the group consisting of: prevention of excessive dandruff, relief of excessive dandruff, treatment of excessive dandruff, reduction of the occurrence of Malassezia species on the skin (scalp), removal of biofilms formed by Malassezia species on the skin (scalp), prevention or reduction of biofilm formation of Malassezia species on the skin (scalp), improvement of skin barrier function, skin moisturization (protection from dehydration by maintaining, restoring, and / or enhancing skin moisturization), or any combination thereof.
[0070] As used herein, the term "biofilm" refers to a community of microorganisms embedded in an extracellular polymeric matrix attached to a surface. The extracellular polymeric matrix is generally a polymeric mass composed of extracellular DNA, proteins, and polysaccharides. A biofilm may have one or more species of microorganisms and may further contain water and other trapped particulate matter. The microorganisms may be gram-positive or gram-negative bacteria (aerobic or anaerobic); algae, protozoa, and / or yeast or filamentous fungi. In one embodiment, a biofilm is a living cell population comprising one or more species of Malassezia.
[0071] As used herein, the term "surface" refers to any structure having sufficient mass to allow the attachment of a biofilm. Surfaces include hard and soft surfaces. Hard surfaces include, but are not limited to, metal, glass, ceramics, wood, minerals (rock, stone, marble, granite), aggregates such as concrete, plastics, composite materials, hard rubber materials, and plaster. Other surfaces may be biological surfaces such as skin, scalp, or keratin.
[0072] Further skin care benefit agents can include anti-dandruff actives.
[0073] Anti-dandruff actives include, for example, keratolytic agents such as salicylic acid and sulfur in its various forms, keratinization regulators such as zinc pyrithione, pyridinethione salts, trihalocarbamides, triclosan, azole compounds, antifungal polymers, allantoin, steroids such as topical corticosteroids, tar or polytar (coal tar), undecylenic acid, fumaric acid, allylamine, and mixtures thereof, ciclopirox, octopirox, piroctone olamine, clobetasol propionate, betamethasone valerate, tea tree oil, thyme and catnip oil mixtures, topical antifungals such as selenium sulfide, imidazoles (e.g., ketoconazole), hydroxypyridones (e.g., ciclopirox), naturopathic agents such as Melaleuca sp. oil, aloe vera, and probiotic microorganisms (Indian J. Dermatol, 2010 Apr-Jun;55(2):130-134).
[0074] In one embodiment, the skin care benefit agent (active agent) comprises at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof. The skin care benefit agent may include at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof that inhibits the growth of dandruff-inducing microorganisms through lipid consumption competition, a lipase inhibitor, a small molecule, or a combination thereof. The skin care benefit agent of at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof further comprises an agent (active agent) that eliminates Malassezia species biofilms and an agent (active agent) that prevents or reduces Malassezia species biofilm formation.
[0075] In one embodiment, a skin care benefit agent (active agent) comprising at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof is formulated into a skin care composition.
[0076] It will be understood that the skin care compositions for use in the present invention can include at least one Yarrowia microorganism, at least one metabolite of a Yarrowia microorganism, and / or at least one cell lysate of a Yarrowia microorganism.
[0077] Skin care compositions for use in accordance with the present invention may, for example, contain at least about 0.01 wt.%, about 0.05 wt.%, about 0.1 wt.%, about 0.2 wt.%, about 0.3 wt.%, about 0.4 wt.%, about 0.5 wt.%, about 0.6 wt.%, about 0.7 wt.%, about 0.8 wt.%, about 0.9 wt.%, about 1.0 wt.%, about 1.5 wt.%, about 2.0 wt.%, about 3.0 wt.%, about 4.0 wt.%, about 5.0 wt.%, about 6.0 wt.%, about 7.0 wt.%, about 8.0 wt.%, about 9.0 wt.%, about 10.0 wt.%, about 11.0 wt.%, about 12.0 wt.%, about 13.0 wt.%, about 14.0 wt.%, about 15.0 wt.%, about 16.0 wt.%, about 17.0 wt.%, about 18.0 wt.%, about 19.0 wt.%, about 20.0 wt.%, about 21.0 wt.%, about 22.0 wt.%, about 23.0 wt.%, about 24.0 wt.%, about 25.0 wt.%, about 26.0 wt.%, about 27.0 wt.%, about 28.0 wt.%, about 29.0 wt.%, about 30.0 wt.%, about 31.0 wt.%, about 32.0 wt.%, about 33.0 wt.%, about 34.0 wt.%, about 35.0 wt.%, about 36.0 wt.%, about 37.0 wt.%, about 38.0 wt.%, about 39.0 wt.%, about It will be further apparent that the composition may contain about 4.0% by weight, about 5.0% by weight, about 6.0% by weight, about 7.0% by weight, about 8.0% by weight, about 9.0% by weight, about 10.0% by weight, about 11.0% by weight, about 12.0% by weight, about 13.0% by weight, about 14.0% by weight, about 15.0% by weight, about 16.0% by weight, about 17.0% by weight, about 18.0% by weight, about 19.0% by weight, about 20.0% by weight, about 25.0% by weight, about 30.0% by weight, about 35.0% by weight, about 40.0% by weight, about 45.0% by weight, or about 50.0% by weight.
[0078] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder.
[0079] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder.
[0080] In one aspect, the scalp disorder is selected from the group consisting of any one of excessive scalp dandruff (seborrheic dermatitis), scalp flora imbalance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or a combination thereof.
[0081] In one embodiment, the composition is a skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the composition alleviates and / or treats the scalp disorder, and the composition degrades lipids selected from the group consisting of sapienic acid (C16:1 cis-6), palmitic acid (C16:0), myristic acid (C14:0), petroselinic acid (C18:1 cis-6), pentadecylic acid (C15:0), stearic acid (C18:0), lauric acid (C12:0), leic acid, and any one of combinations thereof.
[0082] In one embodiment, the composition is a skin care composition comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof for use in treating a scalp disorder, wherein the composition alleviates and / or treats the scalp disorder, and the composition reduces the growth of Malassezia species.
[0083] In one embodiment, the skin care composition or formulation is a lotion, serum, jelly, cream, gel, emulsion, mask, patch, or stick comprising one or more dermatologically or skin care acceptable ingredients and at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and up to 10% by weight of the skin care formulation described herein, based on the total weight of the skin care formulation.
[0084] In some embodiments, the compositions of the present invention can include a combination of isolated Yarrowia microorganisms and a carrier that is one or more dermatologically or skin care acceptable ingredients. The Yarrowia microorganisms can be live or non-replicating (e.g., inactivated, e.g., by heat treatment). Dosages can vary, but are generally about 10 2 ~about 10 12 cfu / g dry weight equivalent, e.g., 1 x 10 2 cfu / g, 5 × 10 2 cfu / g, 1 × 10 3 cfu / g, 5 × 10 3 cfu / g, 1 × 10 4 cfu / g, 5 × 10 4 cfu / g, 1 × 10 5 cfu / g, 5 × 10 5 cfu / g, 1 × 10 6 cfu / g, 5 × 10 6 cfu / g, 1 × 10 7 cfu / g, 5 × 10 7 cfu / g, 1 × 10 8 cfu / g, 5 × 10 8 cfu / g, 1 × 10 9 cfu / g, 5 × 10 9 cfu / g, 1 × 10 10 cfu / g, 5 × 10 10 cfu / g, 1 × 10 11 cfu / g, 5 × 10 11 cfu / g, 1 × 10 12 The range of cfu / g dry weight can be as follows:
[0085] In some embodiments, the Yarrowia microorganisms can be stabilized using conventional stabilization techniques before or after mixing with one or more dermatologically or skin care acceptable ingredients.
[0086] In one embodiment, the skin care composition is formulated into a skin care product / formulation for administration to the skin.
[0087] It will further be appreciated that the skin care compositions for use in the present invention may further comprise, in addition to one or more probiotic bacteria, a microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0088] The skin care composition may include additional compounds selected from the group consisting of preservatives, pH adjusters, antioxidants, and chelating agents.
[0089] Preservatives include, but are not limited to, parabens, sodium benzoate, potassium sorbate, phenylethyl alcohol, lauryl ethyl arginate (LAE), and any combination thereof.
[0090] pH adjusters include, but are not limited to, weak acids, strong acids, any compound capable of adjusting pH, such as, but not limited to, citric acid, or any combination thereof.
[0091] The skin care compositions described herein or any effective amount of said skin care compositions can be used in the formulations and products.
[0092] As used herein, "skin care product" refers to a product comprising an effective amount of the skin care composition described herein, including, but not limited to, any one of a cosmetic product, an aqueous solution, an emulsion, a serum, a jelly, a mask, a patch, a lotion, a topical moisturizer, a cream, a paste, a scented balm, an ointment, a pomade, a gel, a liquid, a spray, a foam, a kit, or a combination thereof.
[0093] In one embodiment, the skin care product is formulated for topical application to the skin / scalp.
[0094] In one embodiment, the composition is a skin care product comprising an effective amount of a skin care composition for use in treating a scalp disorder, the skin care composition comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and one or more dermatologically or skin care acceptable ingredients, wherein the composition alleviates and / or treats the scalp disorder.
[0095] In one embodiment, the skin care product is a lotion, serum, jelly, cream, gel, emulsion, mask, patch, or stick comprising one or more dermatologically or skin care acceptable ingredients and at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and up to 10% by weight of the skin care formulation described herein, based on the total weight of the skin care formulation.
[0096] In one embodiment, the skin care product comprises at least one microorganism of the genus Yarrowia, wherein the microorganism and / or skin care composition comprising said microorganism is formulated in at least one form selected from the group consisting of a gel, an emulsion, a hydrogel, a loose or compact powder, a suspension or solution, a spray, or any combination thereof.
[0097] Topical formulations for use in the present invention can be in any form suitable for application to the scalp or skin surface, such as creams, lotions, sprays, solutions, gels, ointments, pastes, plasters, paints, bioadhesives, suspensions, etc., and / or can be prepared to contain liposomes, micelles, and / or microspheres. Formulations of this type can be used in conjunction with an occlusive overlayer to retain moisture within the formulation as it evaporates from the body surface during and after application of the formulation to the body surface.
[0098] Topical formulations include those in which the active ingredient is dissolved or dispersed in a dermatological vehicle known in the art (e.g., aqueous or non-aqueous gel, ointment, water-in-oil or oil-in-water emulsion).Components of this type of vehicle can include water, aqueous buffer solution, non-aqueous solvent (e.g., ethanol, isopropanol, benzyl alcohol, 2-(2-ethoxyethoxy)ethanol, propylene glycol, propylene glycol monolaurate, glycofurol, or glycerol), oil (e.g., mineral oil such as liquid paraffin, natural or synthetic triglyceride, or silicone oil such as dimethicone). In particular, depending on the nature of the formulation as well as its intended use and site of application, the dermatological vehicle employed may contain one or more ingredients (e.g., ingredients other than water when formulated into an aqueous gel) selected from the following list: solubilizers or solvents (e.g., αβ-cyclodextrin, e.g., hydroxypropyl β-cyclodextrin, or alcohols or polyols, e.g., ethanol, propylene glycol, or glycerol); thickeners (e.g., hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, or carbomer); gelling agents (e.g., polyoxyethylene-polyoxypropylene copolymers); preservatives (e.g., benzyl alcohol, benzalkonium chloride, chlorhexidine, chlorbutol, benzoates, potassium sorbate, or EDTA or a salt thereof); and pH buffers (such as a mixture of dihydrogen phosphate and hydrogen phosphate or a mixture of citric acid and hydrogen phosphate).
[0099] Skin care products include liquid lotions (true solutions) containing water as a solvent and water-soluble additives (solutes) such as, but not limited to, any one of an active agent, fragrance, colorant, preservative, pH adjuster, chelating agent, or combinations thereof.
[0100] Skin care products include dispersions such as emulsions (including, but not limited to, liquid-in-liquid [water-in-oil W / O, O / W, W / O / W], suspensions [solid / liquid or liquid / solid], aerosols [liquid / gas or solid / gas], and foams / mousses [gas / liquid or gas / emulsion or gas / solid]). Examples of oil-in-water [O / W] emulsions include, but are not limited to, a combination of an aqueous phase, an emulsifier, a fatty phase, and at least one additive. The aqueous phase can include water, a humectant, and a stabilizer (such as, but not limited to, a synthetic polymer, a carbomer, a natural polymer, xanthan gum, acacia gum, carrageenan, gellan, or any combination thereof). Emulsifiers include, but are not limited to, anionic emulsifiers, cationic emulsifiers, nonionic emulsifiers, amphoteric emulsifiers, silicone emulsifiers, and auto-emulsifying agents. Fatty phases (lipophilic components) include, but are not limited to, waxes, butters, fatty acid esters, triglycerides, vegetable oils, mineral oils (paraffins), silicones, and thickeners / oil gelling agents. Additives include, but are not limited to, preservatives, fragrances (mostly lipophilic), colorants, antioxidants, chelating agents, active agents, pH adjusters (citric acid, lactic acid, AHA), neutralizers / strong base agents such as NaOH, trimethylamine (to gel acrylic polymers), and powders.
[0101] Skin care products include aqueous gels that include an aqueous phase (including water, humectants, and active agents), a gelling agent (including but not limited to synthetic polymers, natural polymers, xanthan gum, acacia gum, carrageenan, gellan, and the like), and additives (including but not limited to fragrances, high HLB surfactants, colorants, active agents, preservative systems, pH adjusters, neutralizers, powders, and the like).
[0102] Skin care products include cleansers / surfactant systems (such as, but not limited to, shampoos, shower gels, micellar waters) that contain an aqueous phase (water, humectants), surfactants, additives (such as, but not limited to, fragrances, high HLB surfactants, colorants, active agents, preservative systems, pH adjusters, neutralizers, powders, and the like), and optional gelling agents (such as, but not limited to, synthetic polymers, natural polymers, xanthan gum, acacia gum, carrageenan, gellan, and the like).
[0103] As described herein, skin care products or formulations comprising at least one Yarrowia microorganism and / or fragments thereof and / or cell lysates thereof and / or fermentates thereof and / or metabolites thereof as described herein provide a skin care benefit selected from the group consisting of any one of the following: prevention of excessive dandruff, relief of excessive dandruff, treatment of excessive dandruff, reduction of the occurrence of Malassezia species (Malassezia spp.) on the skin / scalp, improvement of skin barrier function, skin moisturization (protection from skin dehydration by maintaining, restoring, and / or enhancing skin moisturization), or a combination thereof.
[0104] The skin care products (formulations) of the present invention may also incorporate a dermatologically or skin care acceptable carrier, which may be any carrier used in the art, including, for example, water, lower alcohols, higher alcohols, polyhydric alcohols, monosaccharides, disaccharides, polysaccharides, hydrocarbon oils, fats and oils, waxes, fatty acids, silicone oils, nonionic surfactants, ionic surfactants, silicone surfactants, and aqueous and emulsion-based mixtures of such carriers.
[0105] As used herein, the terms "dermatologically acceptable" or "dermatologically acceptable carrier" or "skin care acceptable" or "skin care acceptable carrier" refer to compounds or compositions that can be incorporated into dermatological or skin care formulations without causing undesired biological effects or undesired interactions with other ingredients of the formulation.
[0106] As used herein, "carrier" or "vehicle" refers to a carrier material suitable for incorporation into a topically applied composition. Carriers and vehicles useful herein include any material known in the art that is non-toxic and does not adversely interact with other components of the formulation in which it is contained.
[0107] The term "aqueous" refers to a formulation that contains water or that becomes water-containing after application to the skin or mucosal tissue.
[0108] The skin care products described herein can further comprise one or more known dermatologically or skin care acceptable ingredients or other ingredients effective for skin care use, provided that the optional ingredients are physically and chemically compatible with the essential ingredients described herein or do not otherwise unduly impair the stability, aesthetics, or performance of the product. Non-limiting examples of such optional ingredients are disclosed in the International Skin Care Ingredient Dictionary, Ninth Edition, 2002, and the CTFA Skin Care Ingredient Handbook, Tenth Edition, 2004.
[0109] In one embodiment, the dermatologically or skincare acceptable ingredient is a dermatologically acceptable carrier, comprising about 10% to about 99.9% by weight, alternatively about 50% to about 95% by weight, or alternatively about 75% to about 95% by weight of the dermatologically acceptable carrier. Suitable carriers for use with the composition include, for example, those used in formulating mousses, tonics, gels, skin moisturizers, and lotions. Carriers include water; organic oils; silicones, such as volatile silicones, amino or non-amino silicone gums or oils, and mixtures thereof; mineral oils; vegetable oils, such as olive oil, castor oil, rapeseed oil, palm oil, wheat germ oil, almond oil, avocado oil, macadamia oil, apricot oil, safflower oil, kukui oil, camellia oil, calendula seed oil, lemon oil, and mixtures thereof; waxes; and organic compounds, such as C2-C6 10 Alkanes, acetone, methyl ethyl ketone, volatile organic compounds C1-C 12 Alcohols, C1-C 20 Esters of acids and C1-C8 alcohols, such as methyl acetate, butyl acetate, ethyl acetate, and isopropyl myristate, dimethoxyethane, diethoxyethane, C 10 ~C 30 Fatty alcohols, such as lauryl alcohol, cetyl alcohol, stearyl alcohol, and behenyl alcohol; C 10 ~C 30Fatty acids, such as lauric acid and stearic acid; 10 ~C 30 Fatty amides, such as lauric acid diethanolamide; C 10 ~C 30 Fatty alkyl esters, such as C 10 ~C 30 The carrier may include fatty alkyl benzoates; hydroxypropyl cellulose; and mixtures thereof. In one embodiment, the carrier includes water, fatty alcohols, volatile organic alcohols, and mixtures thereof. Other carriers can be formulated by those skilled in the art.
[0110] The skin care products described herein may further comprise from about 0.1% to about 10%, alternatively from about 0.2% to about 5.0%, of a gelling agent to help impart a desired viscosity to the composition. Non-limiting examples of suitable optional gelling agents include crosslinked carboxylic acid polymers; non-neutralized crosslinked carboxylic acid polymers; non-neutralized crosslinked modified carboxylic acid polymers; crosslinked ethylene / maleic anhydride copolymers; non-neutralized crosslinked ethylene / maleic anhydride copolymers (e.g., EMA 81 available from Monsanto); non-neutralized crosslinked alkyl ether / acrylate copolymers (e.g., SALCARE™ SC90 available from Allied Colloids); non-neutralized crosslinked copolymers of sodium polyacrylate, mineral oil, and PEG-1 trideceth-6 (e.g., SALCARE™ SC91 available from Allied Colloids); non-neutralized crosslinked copolymers of methyl vinyl ether and maleic anhydride (e.g., STABILEZE™ QM-PVM / MA copolymer available from International Specialty Products); hydrophobically modified nonionic cellulose polymers; hydrophobically modified ethoxylated urethane polymers (e.g., UCARE™ Polyphobe, an alkali-swellable polymer available from Union Carbide). Series); and combinations thereof. The related term "unneutralized" means that the optional polymer and copolymer gellant materials contain unneutralized acid monomers.
[0111] A dermatologically or skincare acceptable medium can contain fatty substances, generally in a proportion of about 10 to about 90% by weight based on the total weight of the product, where the fatty phase contains at least one liquid, solid, or semisolid fatty substance. Fatty substances include, but are not limited to, oils, waxes, gum-like substances, and so-called pasty fatty substances. Alternatively, the product may be in the form of a stable dispersion, such as a water-in-oil or oil-in-water emulsion. In addition, the skincare product may contain one or more conventional skincare or dermatological additives or adjuvants, such as, but not limited to, antioxidants, preservatives, fillers, surfactants, UVA and / or UVB sunscreens, fragrances, thickeners, humectants, and anionic, nonionic, or amphoteric polymers, as well as dyes or pigments (colorants).
[0112] The dermatologically acceptable carrier may be a moisturizing formulation containing at least one emulsifier, at least one surfactant, or any combination thereof.
[0113] In one embodiment, the skin care product comprises a first skin care composition and a second skin care composition, wherein the first skin care composition comprises an effective amount of a first active agent consisting of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and the second skin care composition comprises at least an effective amount of at least one second active agent for topical administration (e.g., an anti-dandruff active, a skin conditioning agent, a skin care active ingredient material, etc.).
[0114] The skin care compositions and products may further comprise ingredients of skin care active ingredients including sunscreens, moisturizers, humectants, skin benefit agents, adhesion promoters such as surfactants, occlusive agents, moisture barriers, lubricants, emollients, anti-aging agents, antistatic agents, abrasives, antimicrobial agents, conditioners, exfoliants, fragrances, viscosity modifiers, salts, lipids, phospholipids, vitamins, foam stabilizers, pH adjusters, preservatives, suspending agents, silicone oils, silicone derivatives, essential oils, oils, fats, fatty acids, fatty acid esters, fatty alcohols, waxes, polyols, hydrocarbons, and mixtures thereof.
[0115] Other ingredients that may be included in the skin care composition or product include at least one active ingredient for treating or preventing a skin condition, for providing a skin care benefit, or for providing a moisturizing benefit to the skin, such as zinc oxide, petrolatum, white petrolatum, mineral oil, cod liver oil, lanolin, dimethicone, hard fat, vitamin A, allantoin, calamine, kaolin, glycerin, or colloidal oatmeal, and combinations thereof, one or more natural moisturizing factors (e.g., ceramides, hyaluronic acid, glycerin, squalane, amino acids, cholesterol, The following list may be omitted: fatty acids, triglycerides, phospholipids, glycosphingolipids, urea, linoleic acid, glycosaminoglycans, mucopolysaccharides, sodium lactate, or sodium pyrrolidone carboxylate), glycerides, apricot kernel oil, canola oil, squalane, squalene, coconut oil, corn oil, jojoba oil, jojoba wax, lecithin, olive oil, safflower oil, sesame oil, shea butter, soybean oil, almond oil, sunflower oil, tea tree oil, shea butter, coconut oil, cholesterol, cholesterol esters, wax esters, fatty acids, and orange oil.
[0116] Any number of dermatologically acceptable materials commonly used in skin care products can also be incorporated into the present skin care products, such as skin conditioning agents and skin colorants.
[0117] Skin conditioning agents as defined herein include, but are not limited to, astringents that tighten skin; exfoliants that remove dead skin cells; emollients that help maintain smooth, soft and supple appearance; humectants that increase the moisture content of the skin's surface; occlusive agents that slow the evaporation of water from the skin's surface; and various compounds that improve the appearance of dry or damaged skin, or reduce peeling and restore suppleness.Skin conditioning agents are well known in the art (see, for example, Green et al. (International Publication No. 01 / 07009)), and are commercially available from various sources. Suitable examples of skin conditioning agents include, but are not limited to, lactobionic acid, gluconic acid, alpha-hydroxy acids, beta-hydroxy acids, polyols, hyaluronic acid, D,L-panthenol, polysalicylates, vitamin A palmitate, vitamin E acetate, glycerin, sorbitol, silicones, silicone derivatives, lanolin, natural oils, xylitol, fucose, rhamnose, and triglyceride esters. Skin conditioning agents include polysalicylic acid, propylene glycol (CAS No. 57-55-6, Dow Chemical, Midland, MI), glycerin (CAS No. 56-81-5, Proctor & Gamble Co., Cincinnati, OH), glycolic acid (CAS No. 79-14-1, DuPont Co., Wilmington, DE), lactic acid (CAS No. 50-21-5, Alfa Aesar, Ward Hill, MA), malic acid (CAS No. 617-48-1, Alfa Aesar), citric acid (CAS No. 77-92-9, Alfa Aesar), and tartaric acid (CAS No. 133-37-9, Alfa Aesar). Aesar), glucaric acid (CAS No. 87-73-0), galactaric acid (CAS No. 526-99-8), 3-hydroxyvaleric acid (CAS No. 10237-77-1), salicylic acid (CAS No. 69-72-7, Alfa Aesar), and 1,3 propanediol (CAS No. 504-63-2, DuPont Co., Wilmington, Del.).Polysalicylic acid can be prepared by the method described in U.S. Patent No. 4,855,483 by White et al., which is incorporated herein by reference. Glucaric acid can be synthesized by the method described by Merbouh et al. (Carbohydr. Res. 336:75-78 (2001)). 3-Hydroxyvaleric acid can be prepared as described in WO 02 / 012530 by Bramucci.
[0118] Skin care compositions and products may contain skin care additives such as, but not limited to, colorants / dyes, fragrances, active agents, preservatives, pH adjusters, chelating agents, and antioxidants.
[0119] In one embodiment, a skin care product comprises a first skin care composition and a second skin care composition, wherein the first skin care composition comprises an effective amount of a first active agent consisting of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and the second skin care composition comprises at least an effective amount of at least one second topical active agent selected from an anti-dandruff active. Anti-dandruff active agents of this type include, for example, keratolytic agents such as salicylic acid and sulfur in its various forms, keratinization regulators such as zinc pyrithione, pyridinethione salts, trihalocarbamides, triclosan, azole compounds, antifungal polymers, allantoin, steroids such as topical corticosteroids, tar or polytar (coal tar), undecylenic acid, fumaric acid, allylamine, and mixtures thereof, ciclopirox, octopirox, piroctone olamine, clobetasol propionate, betamethasone valerate, tea tree oil, thyme and catnip oil mixtures, topical antifungals such as selenium sulfide, imidazoles (e.g., ketoconazole), hydroxypyridones (e.g., ciclopirox), naturopathic agents such as Melaleuca sp. oil, aloe vera, and probiotic microorganisms (Indian J. Dermatol, 2010 Apr-Jun;55(2):130-134).
[0120] In one embodiment, a skin care product comprises a first skin care composition and a second skin care composition, wherein the first skin care composition comprises an effective amount of a first active agent consisting of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and the second skin care composition comprises at least an effective amount of at least one second active agent for topical administration selected from an anti-dandruff active, and the first skin care composition is formulated in at least one form selected from the group consisting of a gel, an emulsion, a hydrogel, a loose or compact powder, a suspension or solution, or a spray solution.
[0121] The skin care compositions and skin care products described herein can also be part of a kit that provides one or more skin care benefits, such as, but not limited to, a kit for preventing or alleviating excessive dandruff conditions.
[0122] In one embodiment, the kit includes at least one Yarrowia microorganism for treating a dandruff condition and written instructions for administering it to a subject in need thereof.
[0123] In one embodiment, the kit includes a skin care product for treating a dandruff condition in a subject in need thereof, said skin care product comprising at least one Yarrowia microorganism and written instructions for administering said skin care product to a subject in need thereof.
[0124] Methods for Microbiological Treatment of Scalp Disorders - Patent application Further provided herein is a method for treating a scalp disorder in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0125] In one aspect, the scalp disorder is selected from the group consisting of excessive scalp dandruff (seborrheic dermatitis), scalp flora imbalance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or any combination thereof.
[0126] In one embodiment, the microorganism is administered topically.
[0127] In one embodiment, the microorganism is a microorganism of the genus Yarrowia selected from the group consisting of any one of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or a combination thereof.
[0128] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering to the subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0129] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering to said subject Yarrowia lipolytica and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0130] The skin care compositions and products described herein can be used in methods for treating scalp disorders.
[0131] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering a skin care composition for use in treating a scalp disorder, wherein the skin care composition comprises an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and wherein the composition alleviates and / or treats the scalp disorder.
[0132] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering a skin care composition for use in treating a scalp disorder, said skin care composition comprising an effective amount of Yarrowia lipolytica and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein said composition alleviates and / or treats said scalp disorder.
[0133] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering a skin care product for use in treating the scalp disorder, wherein the skin care product comprises an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and wherein the skin care product alleviates and / or treats the scalp disorder.
[0134] In one embodiment, the method is for treating a scalp disorder in a subject in need thereof, comprising administering a skin care product for use in treating the scalp disorder, wherein said skin care product comprises an effective amount of at least one Yarrowia lipolytica and / or fragments thereof and / or cell lysates thereof and / or fermentates thereof and / or metabolites thereof, and wherein said skin care product alleviates and / or treats said scalp disorder.
[0135] In one embodiment, the skin care composition or product is administered topically.
[0136] Also provided herein are kits for treating skin conditions, comprising a composition described herein and instructions for use thereof. In some embodiments, the kit further comprises one or more applicators configured to apply the composition.
[0137] Methods for treating and / or alleviating dandruff conditions Further provided herein is a method for treating a dandruff condition in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0138] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0139] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one Yarrowia lipolytica and / or fragments thereof and / or cell lysates thereof and / or fermentation products thereof and / or metabolites thereof.
[0140] In one embodiment, the microorganism is administered topically.
[0141] In one embodiment, the microorganism and / or fragment thereof and / or cell lysate thereof and / or fermentation product thereof and / or metabolite thereof is a microorganism of the genus Yarrowia selected from the group consisting of any one of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or combinations thereof.
[0142] In one embodiment, a method is provided for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof are combined in a single composition.
[0143] In one embodiment, the microorganism and / or its fragments and / or its cell lysate and / or its fermentation product and / or its metabolites are administered locally.
[0144] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp of a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof are combined into a single composition, and the composition is administered to the skin or scalp of the subject.
[0145] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one Yarrowia microorganism and / or fragments thereof and / or cell lysate thereof and / or fermentation product thereof and / or metabolites thereof, wherein the at least one Yarrowia microorganism and / or fragments thereof and / or cell lysate thereof and / or fermentation product thereof and / or metabolites thereof are formulated into a single composition, and the composition further comprises a compound selected from the group consisting of any one of skin care excipients, butyric acid, glucose, glycogen, magnesium ascorbyl phosphate, cetyl alcohol, dimethicone, isopropyl myristate, glycerol, propylene glycol, quaternium-52, ethanol, or a combination thereof.
[0146] The skin care compositions and products described herein can be used in methods for treating dandruff conditions.
[0147] In one embodiment, a method is for treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, comprising administering a skin care composition for use in treating a dandruff condition, said skin care composition comprising at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentate thereof and / or a metabolite thereof, wherein said composition alleviates and / or treats said dandruff condition.
[0148] In one embodiment, a method is for treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, comprising administering a skin care product for use in treating a dandruff condition, wherein said skin care composition comprises an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentate thereof and / or a metabolite thereof, and wherein said composition alleviates and / or treats said dandruff condition.
[0149] In one embodiment, a method is provided for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof reduces the proliferation of Malassezia species.
[0150] In one embodiment, a method is provided for treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof removes biofilms of Malassezia species.
[0151] In one embodiment, a method is provided for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof prevents or reduces biofilm formation of Malassezia species.
[0152] In one aspect, the method is a method of treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, comprising topically administering a skin care product comprising a skin care composition described herein.
[0153] In one aspect, a method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising topically administering a skin care product comprising the skin care composition described herein, wherein the skin care product is selected from the group consisting of a lotion, serum, jelly, cream, gel, emulsion, solid cosmetic, mask, patch, and stick, comprising at least 1%, 2%, 3%, 4%, or at most 5% of the skin care composition by weight, based on the total weight of the skin care product.
[0154] In one embodiment, the method is for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0155] In one aspect, the methods for treating a dandruff condition described herein inhibit Malassezia species.
[0156] In one aspect, the method described is a method wherein the at least one Yarrowia microorganism degrades lipids selected from the group consisting of sapienic acid (C16:1 cis-6), palmitic acid (C16:0), myristic acid (C14:0), petroselinic acid (C18:1 cis-6), pentadecylic acid (C15:0), stearic acid (C18:0), lauric acid (C12:0), oleic acid, and any combination thereof.
[0157] General definition The disclosures of all cited patent and non-patent publications are incorporated herein by reference in their entirety.
[0158] In this disclosure, a number of terms and abbreviations are used. The following definitions apply unless specifically stated otherwise.
[0159] As used herein, the articles "a," "an," and "the" preceding an element or component of the invention are intended to be open-ended regarding the number of instances (i.e., occurrences) of that element or component. Thus, "a," "an," and "the" should be read to include one or at least one, and the singular form of an element or component also includes the plural unless the number is clearly intended to be singular.
[0160] When an amount, concentration, or other value or parameter is given as a range, a preferred range, or a list of upper and lower preferred values, this should be understood to specifically disclose any range formed by any pairing of any range upper limit or preferred upper value and any range lower limit or preferred lower value, regardless of whether the ranges are separately disclosed. When a range of numerical values is given herein, unless otherwise specified, the range is intended to include the endpoints thereof, and all integers and fractions within the range. It is not intended that the scope of the invention be limited to the specific values recited when defining a range.
[0161] The use of numerical values in the various ranges set forth in this application, unless expressly indicated otherwise, is stated as approximations, as if both the minimum and maximum values within the stated range were preceded by the word "about." Thus, slight variations above and below the stated range can be used to achieve substantially the same results as values within the range. The disclosure of these ranges also contemplates continuous ranges, including each and every value between the minimum and maximum values. As used herein, the term "about" modifying the amount of a component or reactant used refers to variations in numerical quantity that may occur, for example, through typical measuring and liquid handling procedures used in the real world to create concentrates or use solutions; through incidental errors in these procedures; through differences in the manufacture, source, or purity of components used to create the compositions or carry out the methods; and the like. The term "about" also encompasses amounts that differ due to different equilibrium conditions for compositions resulting from a particular initial mixture. Whether modified by the term "about," the claims include equivalents of the quantities.
[0162] As used herein, the term "administer" or "administering" refers to the act of introducing one or more microorganisms (strains of microorganisms), skin care compositions, skin care formulations, and / or skin care products to a subject in need of treatment for a scalp disorder.
[0163] Administering one or more microorganisms (strains of microorganisms), skin care compositions, formulations, and / or skin care products to a subject includes applying or introducing one or more microorganisms (strains of microorganisms), skin care compositions, formulations, and / or skin care products to the scalp, skin surface, and skin cells in vitro or in vivo.
[0164] As used herein, the term "biological contaminant" refers to one or more unwanted and / or pathogenic biological entities, including, but not limited to, microorganisms, spores, viruses, prions, and mixtures thereof.
[0165] As used herein, the term "comprising" denotes the presence of the stated features, integers, steps, or ingredients recited in the claim, but does not exclude the presence or addition of one or more other features, integers, steps, ingredients, or groups thereof. The term "comprising" is intended to include embodiments encompassed by the terms "consisting essentially of" and "consisting of." Similarly, the term "consisting essentially of" is intended to include embodiments encompassed by the term "consisting of."
[0166] As used herein, the terms "embodiment" or "disclosure" are not meant to be limiting and apply generally to any of the embodiments defined in the claims or described herein. These terms are used interchangeably herein.
[0167] As used herein, the term "excipient" refers to an inert substance used as a carrier for an active ingredient in a formulation. An excipient may be used to stabilize the active ingredient in the formulation, such as to improve the shelf stability of the active ingredient. An excipient may also be used to extend the weight of a formulation containing an active ingredient. "Active ingredients" include skin care benefit agents as described herein.
[0168] As used herein, the term "effective amount" refers to an amount sufficient to achieve a desired effect, including the prevention, relief, and / or treatment of scalp disorders, such as the prevention, relief, and / or treatment of dandruff conditions.
[0169] As used herein, "prevent," "preventing," "prevention," and grammatical variations thereof refer to a method of partially or completely delaying or preventing the onset or recurrence of a disorder or condition (such as a scalp disorder) and / or one or more of its associated symptoms, or a method of preventing a subject from acquiring or re-acquiring a disorder or condition, or a method of reducing the risk of a subject acquiring or re-acquiring a disorder or condition and / or one or more of its associated symptoms.
[0170] As used herein, the terms "reducing," "reducing," and grammatical variations thereof, when used with respect to a particular trait, characteristic, feature, biological process, or phenomenon, refer to the particular trait, characteristic, feature, biological process, or phenomenon being lessened. The trait, characteristic, feature, biological process, or phenomenon may be lessened by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100%.
[0171] The terms "weight percent," "weight percentage (wt%)," and "weight-to-weight percentage (% w / w)" are used interchangeably herein. Weight percent refers to the percentage of a material based on its mass in a composition, mixture, solution, or product.
[0172] "16S rRNA" or "16S ribosomal RNA" refers to the rRNA that constitutes the small subunit of the prokaryotic ribosome. In bacteria, this sequence can be used to identify and characterize taxonomic operational units.
[0173] The term "ITS" or "internal transcribed spacer" refers to a region within a ribosomal transcript that is excised and degraded during maturation. These sequences can be used for phylogenetic analysis and / or identification of fungi or yeast.
[0174] The terms moisturizer, lotion, or body lotion refer to low-to-medium viscosity emulsions of oil and water, most of which are oil-in-water, but some are water-in-oil, whose primary function in skin care applications is to hydrate the skin or reduce skin moisture loss. Almost all moisturizers contain a combination of emollients, occlusive agents, and humectants. Emollients are primarily lipids and oils that hydrate and improve the appearance of skin. A wide variety of suitable emollients are known and can be used herein (International Skin Care Ingredient Dictionary and Handbook, eds. Wenninger and McEwen, pp. 1656-61, 1626, and 1654-55 (The Skin Care, Toiletry, and Fragrance Assoc., Washington, DC, 7th Edition, 1997)) (referred to as the "ICI Handbook") contains many examples of suitable materials). Occlusive agents, such as petrolatum, lanolin, and beeswax, create a hydrophobic barrier on the skin, thereby reducing transepidermal water loss. Humectants, such as glycerol and urea, can attract water from the external environment and enhance its absorption from the dermis to the epidermis. In addition, moisturizing formulations contain emulsifiers to maintain emulsion stability, and thickeners can be used to achieve the desired viscosity and skin feel. A wide variety of other ingredients, such as fragrances, dyes, preservatives, therapeutic agents, proteins, and stabilizers, are commonly added to impart other consumer-pleasing attributes.
[0175] As used herein, the terms "percent (%) sequence identity" or "percent (%) sequence similarity" with respect to a reference sequence are defined as the percentage of nucleotide residues in a candidate sequence that are identical with the residues in a reference polynucleotide sequence, after optimal alignment of the sequences, with gaps inserted if necessary to maximize sequence identity.
[0176] As used herein, a microbial "strain" refers to a microorganism (such as a bacterium or fungus) that remains genetically unchanged as it grows or multiplies. Varieties of the same microorganism are also encompassed.
[0177] As used herein, the term "biologically pure strain" means a strain that is free of other microbial strains in amounts sufficient to prevent the strain from replicating or to be detected by conventional techniques. "Isolated," as used in reference to the organisms and cultures described herein, encompasses not only biologically pure strains, but also any culture of an organism that is grown or maintained in a manner different from that found in nature.
[0178] In one aspect, the skin cells described herein are mammalian skin cells, such as human skin cells or animal skin cells.
[0179] As used herein, the term "sequence identity" or "sequence similarity" means that two polynucleotide sequences, i.e., a candidate sequence and a reference sequence, are identical (i.e., 100% sequence identity) or similar (i.e., on a nucleotide-by-nucleotide basis) over the entire length of the candidate sequence. In comparing a candidate sequence to a reference sequence, when the two sequences are optimally aligned, the candidate sequence may contain additions or deletions (i.e., gaps) compared to the reference sequence (which contains no additions or deletions). Optimal alignment of sequences to determine sequence identity can be performed using or by inspection of any number of publicly available local alignment algorithms known in the art, such as ALIGN or Megalign (DNASTAR).
[0180] It is intended that every numerical upper limit given throughout this specification will include every lower numerical limit, as if such lower numerical limit were expressly stated herein. Every numerical lower limit given throughout this specification will include every higher numerical limit, as if such higher numerical limit were expressly stated herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly stated herein.
[0181] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0182] Non-limiting examples of the compositions and methods disclosed herein include those set forth below.
[0183] 1. A skin care composition for use in treating a scalp disorder, comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, said composition alleviating and / or treating said scalp disorder.
[0184] 2. The skin care composition of embodiment 1, wherein the scalp disorder is selected from the group consisting of excessive scalp dandruff (seborrheic dermatitis), scalp flora imbalance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or any combination thereof.
[0185] 3. The skin care composition of embodiment 1, further comprising one or more anti-dandruff actives.
[0186] 4. The skin care composition of embodiment 1, wherein the composition degrades lipids selected from the group consisting of sapienic acid (C16:1 cis-6), palmitic acid (C16:0), myristic acid (C14:0), petroselinic acid (C18:1 cis-6), pentadecylic acid (C15:0), stearic acid (C18:0), lauric acid (C12:0), oleic acid, and any one of combinations thereof.
[0187] 5. The skin care composition of embodiment 1, wherein the composition reduces the growth of Malassezia species.
[0188] 6. The skin care composition of claim 1, wherein the composition removes biofilms of Malassezia species.
[0189] 7. The skin care composition of claim 1, wherein the composition prevents or reduces biofilm formation of Malassezia species.
[0190] 8. The skin care composition of embodiment 1, further comprising at least one additional compound selected from the group consisting of excipients, preservatives, and pH adjusters.
[0191] 9. The skin care composition of embodiment 1, comprising at least one Yarrowia microorganism selected from the group consisting of any one of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or combinations thereof.
[0192] 10. Use of an effective amount of the skin care composition according to any one of embodiments 1 to 9 in a skin care product.
[0193] 11. A skin care product comprising an effective amount of the skin care composition of any one of embodiments 1-9 and one or more dermatologically or skin care acceptable ingredients.
[0194] 11b. The skin care product of embodiment 11, wherein the product is formulated for topical administration.
[0195] 12. The skin care product of embodiment 11, wherein the effective amount of skin care composition is at least about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, and up to 10% by weight, based on the total weight of the skin care product.
[0196] 12b. A skin care product comprising a first skin care composition and a second skin care composition, wherein the first skin care composition comprises an effective amount of a first active agent consisting of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof, and the second skin care composition comprises at least an effective amount of at least one second active agent for topical administration selected from anti-dandruff actives.
[0197] 12c. A skin care product according to embodiment 10b, wherein the first skin care composition is formulated in at least one form selected from the group consisting of a gel, an emulsion, a hydrogel, a loose or compact powder, a suspension or solution, or a spray solution.
[0198] 12d. The skin care product of embodiment 10b, wherein the at least one second composition is at least one member selected from the group consisting of hair lotions, shampoos, hair conditioners, detanglers, hair creams or gels, hair styling sprays, hair setting lotions, treating lotions, dye compositions, hair restructuring lotions, permanent wave compositions, anti-hair loss lotions or gels, anti-parasitic or medicated shampoos, and scalp care products.
[0199] 13. A method for treating a scalp disorder in a subject in need thereof, comprising administering to the subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0200] 13b. A method for treating a scalp disorder in a subject in need thereof, comprising administering to the subject an effective amount of at least one Yarrowia lipolytica and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0201] 13c. A method for treating a scalp disorder in a subject in need thereof, comprising topically administering to the subject a skin care product comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0202] 14. The method of embodiment 13, wherein the scalp disorder is selected from the group consisting of excessive scalp dandruff (seborrheic dermatitis), scalp flora imbalance, scalp discomfort, tinea versicolor, dry skin, skin irritation, or any combination thereof.
[0203] 15. The method according to embodiment 13, wherein the microorganism and / or its fragments and / or its cell lysate and / or its fermentation product and / or metabolites are administered topically.
[0204] 15B. The method of embodiment 13c, wherein the microorganism and / or its fragment and / or its cell lysate and / or its fermentation product and / or its metabolite is administered locally.
[0205] 16. A method for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising administering to said subject an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0206] 16b. A method for treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising topically administering to the subject a skin care product comprising an effective amount of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0207] 17. The method according to embodiment 16, wherein the microorganism and / or its fragments and / or its cell lysate and / or its metabolites are administered topically.
[0208] 18. The method of embodiment 16, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof are combined in a single composition.
[0209] 18b. The method of embodiment 16, wherein the at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof and / or a metabolite thereof is in a composition further comprising at least one or more dermatologically or skin care acceptable ingredients.
[0210] 19. The method of embodiment 16, wherein the composition is administered to the skin or scalp of the subject.
[0211] 20. The method of embodiment 16, wherein the at least one microorganism of the genus Yarrowia is selected from the group consisting of any one of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073, Yarrowia lipolytica Phaff#50-47, or a combination thereof.
[0212] 21. The method of embodiment 16, wherein the at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof inhibits Malassezia species.
[0213] 21b. The method of embodiment 16, wherein at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof reduces the growth of Malassezia species.
[0214] 21c. The method of embodiment 16, wherein the fragment of at least one Yarrowia microorganism reduces the growth of Malassezia species.
[0215] 21d. The method of embodiment 16, wherein the cell lysate of at least one Yarrowia microorganism reduces the growth of Malassezia species.
[0216] 1921e. The method of embodiment 16, wherein the fermentation of at least one Yarrowia microorganism reduces the growth of Malassezia species.
[0217] 21f. The method of embodiment 16, wherein the metabolite of at least one Yarrowia microorganism reduces the growth of Malassezia species.
[0218] 22. The method of embodiment 16, wherein at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof eliminates biofilms of Malassezia species.
[0219] 22b. The method of embodiment 16, wherein the fragments of at least one Yarrowia microorganism eliminate biofilms of Malassezia species.
[0220] 22c. The method of embodiment 16, wherein the cell lysate of at least one Yarrowia microorganism removes biofilms of Malassezia species.
[0221] 22d. The method of embodiment 16, wherein the fermentation of at least one Yarrowia microorganism eliminates biofilms of Malassezia species.
[0222] 22e. The method of embodiment 16, wherein a metabolite of at least one Yarrowia microorganism eliminates a biofilm of a Malassezia species.
[0223] 23. The method of embodiment 16, wherein at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof prevents or reduces biofilm formation of Malassezia species.
[0224] 23b. The method of embodiment 16, wherein the fragment of at least one Yarrowia microorganism prevents or reduces biofilm formation of Malassezia species.
[0225] 23c. The method of embodiment 16, wherein the cell lysate of at least one Yarrowia microorganism prevents or reduces biofilm formation of Malassezia species.
[0226] 23d. The method of embodiment 16, wherein the fermentation of at least one Yarrowia microorganism prevents or reduces the formation of Malassezia species.
[0227] 23e. The method of embodiment 16, wherein a metabolite of at least one Yarrowia microorganism prevents or reduces biofilm formation of Malassezia species.
[0228] 24. The method of embodiment 16, wherein the at least one Yarrowia microorganism and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof degrades lipids selected from the group consisting of sapienic acid (C16:1 cis-6), palmitic acid (C16:0), myristic acid (C14:0), petroselinic acid (C18:1 cis-6), pentadecylic acid (C15:0), stearic acid (C18:0), lauric acid (C12:0), oleic acid, and any one of combinations thereof.
[0229] 25. The method of any one of embodiments 16-24, wherein the composition is administered as a skin care product, and the skin care product is a lotion, serum, jelly, cream, gel, emulsion, mask, patch, or stick, comprising at least 1%, 2%, 3%, 4%, and at most 5% by weight of the skin care composition, based on the total weight of the skin care product.
[0230] 26. A method of treating and / or alleviating a dandruff condition of the scalp in a subject in need thereof, comprising topically administering to the subject a skin care product comprising the skin care composition of any one of embodiments 1-9.
[0231] 27. The method of claim 26, wherein the skin care product is selected from the group consisting of lotions, serums, jellies, creams, gels, emulsions, cosmetic bars, masks, patches, and sticks, and comprises at least 1%, 2%, 3%, 4%, and at most 5% by weight of the skin care composition, based on the total weight of the skin care product.
[0232] 28. A method for treating and / or alleviating a dandruff condition of the scalp of a subject in need thereof, comprising administering an effective amount of a first cosmetic active agent and an effective amount of at least one second cosmetic active agent, wherein the first cosmetic active agent consists of at least one microorganism of the genus Yarrowia and / or a fragment thereof and / or a cell lysate thereof and / or a fermentation product thereof and / or a metabolite thereof.
[0233] 29. The method of embodiment 28, wherein the first and second cosmetic active agents are administered to the skin or scalp of the subject.
[0234] 30. The method of embodiment 28, wherein the first cosmetically active agent and the at least one second cosmetically active agent are combined in a single composition.
[0235] 31. The method of embodiment 28, wherein the first cosmetic active agent and the at least one second active agent are formulated in separate compositions.
[0236] 32. The method of embodiment 28, wherein the at least one second cosmetic active agent comprises at least one anti-dandruff active agent.
[0237] 33. According to embodiment 28, the at least one second cosmetic active agent comprises at least one member selected from the group consisting of zinc pyridinethione, salicylic acid, selenium disulfide, mixed oils of thyme and catnip, octopirox, and probiotic microorganisms.
[0238] 34. The at least one second cosmetic active agent is a keratolytic agent, such as salicylic acid and sulfur in its various forms, a keratinization regulator, such as zinc pyrithione, pyridinethione salts, trihalocarbamides, triclosan, azole compounds, antifungal polymers, allantoin, a steroid, such as a topical corticosteroid, tar or polytar (coal tar), undecylenic acid, fumaric acid, allylamine, and mixtures thereof, ciclopirox, octopirox, piroctone olamine, clobetasol propionate, betamethasone valerate, tea tree oil, a mixture of thyme and catnip oils, a topical antifungal agent, such as selenium sulfide, an imidazole (e.g., ketoconazole), a hydroxypyridone, such as (e.g., ciclopirox), a naturopathic agent, such as Melaleuca 29. The method of claim 28, comprising at least one component selected from the group consisting of aloe sp. oil, aloe vera, and probiotic microorganisms.
[0239] 35. The method of embodiment 16, wherein the flaky scalp condition is accompanied by dandruff, dry scalp, scalp hyperseborrhoea, imbalance of the scalp flora, itching, scalp inflammation, or imbalance of the scalp barrier function.
[0240] 36. A method for preparing a cosmetic or dermatological composition for treating dandruff conditions, comprising combining an effective amount of at least one microorganism of the genus Yarrowia and / or fragments thereof and / or cell lysates thereof and / or fermentations thereof and / or metabolites thereof and / or fragments thereof with at least one cosmetic or dermatological excipient.
[0241] 37. A skin care composition for use in treating a scalp disorder, comprising a fermentation product of cells of a microorganism of the genus Yarrowia, wherein the composition alleviates and / or treats the scalp disorder.
[0242] 38. The skin care composition of embodiment 37, wherein all or substantially all of the cells of the Yarrowia microorganism have been removed from the fermentate.
[0243] 39. The composition of embodiment 37, wherein the fermentate is a culture supernatant.
[0244] 40. The composition of embodiment 37, further comprising one or more dermatologically or skin care acceptable ingredients.
[0245] 41. A skin care product comprising the skin care composition of any one of embodiments 37-40.
[0246] 42. A fermented product of a Yarrowia microorganism for use in treating scalp disorders.
[0247] 43. A fermentation product of a Yarrowia microorganism for use according to embodiment 36, wherein all or substantially all of the cells of the Yarrowia microorganism have been removed from the fermentation product.
[0248] 44. A Yarrowia microorganism fermentation product for use according to embodiment 36, wherein the fermentation product is a culture supernatant.
[0249] 45. A skin care product comprising the fermented product according to any one of embodiments 42 to 44.
[0250] 46. A skin care composition for use in treating a scalp disorder, comprising a metabolite of a cell of a Yarrowia microorganism, wherein the metabolite is derived from the metabolism of a Yarrowia microorganism and also exhibits efficacy in treating the scalp disorder, and wherein the composition alleviates and / or cures the scalp disorder.
[0251] 47. The skin care composition of embodiment 40, further comprising one or more dermatologically or skin care acceptable ingredients.
[0252] 48. A skin care product comprising the skin care composition of embodiment 46 or 47.
[0253] 49. A metabolite of a Yarrowia microorganism for use in the treatment of a scalp disorder, said metabolite being derived from the metabolism of a Yarrowia microorganism and also exhibiting efficacy in the treatment of said scalp disorder. [Example]
[0254] In the following examples, unless otherwise specified, parts and percentages are by weight and degrees are Celsius. It should be understood that these examples, while illustrating embodiments of the present disclosure, are provided for illustrative purposes only. From the above discussion and these examples, one skilled in the art can make various changes and modifications to the present disclosure to adapt it to various uses and conditions. Such modifications are also intended to be encompassed within the scope of the appended claims.
[0255] The following abbreviations used herein correspond to units of measurement, procedures, properties, or compounds as follows: "sec" or "s" means seconds, "min" means minutes, "h" or "hr" means hours, "μL" means microliter, "mL" means milliliter, "L" means liter, "mM" means millimolar, "M" means molar, "mmol" means millimole, "ppm" means parts per million, "wt" means weight, "wt%" means weight percent, "g" means gram, "mg" means milligram, "μg" means microgram, "ng" means nanogram, "conc." means concentration, and "Trt" means treatment.
[0256] Example 1 Materials and Methods yeast strains Yeast strains used were from the American Type Culture Collection (ATCC), the CBS-KNAW culture collection, or the Phaff Yeast Culture Collection (UC Davis). The strains used were Malassezia globosa (CBS 7966), Malassezia furfur (CBS 1878), and Yarrowia lipolytica (ATCC 20362, ATCC 9773, ATCC 18942, ATCC 20177, CBS 2073, and Phaff #50-47).
[0257] Growth medium Cells were cultured in modified Leeming & Notman (mLN) medium containing 10 g / L Bacto-peptone, 2 g / L yeast extract, 8 g / L dried bovine bile, 10 ml / L glycerol, 0.5 g / L glycerol monostearate, 5 ml / L Tween-60, and 20 ml / L olive or palm oil. For synthetic growth media, 6.7 g / L yeast nitrogen base (amino acid-free), 6 g / L dipotassium phosphate, 4 g / L potassium dihydrogen phosphate, and various amounts of lipid as a carbon source and Tween-40, -60, or -80 as an emulsifier were added. For solid media, 15 g / L agar was added. The media were sterilized in an autoclave at 110°C for 20 minutes.
[0258] Lipase activity measurement 4-Methylumbelliferyl oleate (Sigma-Aldrich, St. Louis, MO) was used as a lipase substrate and dissolved in DMSO at 5 mg / ml stock solution. This was then dissolved in DMSO at 0.5 mg / ml and 50 μl was used per reaction in a 96-well plate. 100 μl of filtered (0.22 micron filter) cell culture was added to each well and mixed by pipetting five times. Fluorescence intensity was measured every 10 minutes for 1 hour at 37°C using a Tecan Spark® microplate reader. The excitation and emission wavelengths were 355 and 460 nm, with a gain of 55.
[0259] Cell counting by qPCR Quantitative PCR (qPCR) was used to quantify Yarrowia lipolytica and Malassezia globosa under both monoculture and combined culture conditions at three time points: days 1, 4, and 7. To detect all Malassezia globosa species, the qPCR assay described by Clavaud et al. (2013) PLOS One, 8:10 was used. The primers / probes used were as follows: forward primer 1: 5' CTAAATATCGGGGAGAGACCGA (SEQ ID NO: 1), reverse primer 2: 5' GTACTTTTAACTCTCTTTCCAAAGTGCTT (SEQ ID NO: 2), and MGB probe 1: FAM-TTCATCTTTCCCTCACGGTAC-MGB (SEQ ID NO: 3). The qPCR assay for Yarrowia lipolytica targeted the SNF1 gene and contained the following primer / probe: forward primer 3: 5' ACACCATTCCCCCCTATCTGT (SEQ ID NO: 4), reverse primer 4: 5' TGACCACCAGCATCTGTTGAA (SEQ ID NO: 5), and probe 2: 5' 6FAM-TGCCGGCGCAAAACACCTG-TAMRA (SEQ ID NO: 6). Genomic DNA from representative strains of both Malassezia globosa and Yarrowia lipolytica was used to generate a standard curve for absolute quantification.
[0260] One ml of the culture of Yarrowia lipolytica and Malassezia globosa, either alone or in combination, was centrifuged at each time point to pellet the yeast. Genomic DNA was then extracted from the cell pellet using the Qiagen DNeasy PowerSoil Pro DNA kit (Qiagen TMDNA was extracted using a PCR kit (ABI, Germantown, MD) according to the manufacturer's instructions. 1.5 μl of purified genomic DNA from each sample was mixed with the following in two separate reactions to detect Malassezia globosa or Yarrowia lipolytica: 10 μl ABI Universal TaqMan Mix w / o UNG, 0.2 μl 100 μM forward and reverse primers, 0.05 μl TaqMan probe, and 8.05 μl molecular biology-grade water. qPCR reactions were performed in triplicate for each sample using a Quantstudio 7 Instrument: 10 min, 95°C + 40 cycles (95°C, 15 sec + 60°C, 60 sec). Fluorescence data were collected during amplification.
[0261] For both Malassezia globosa and Yarrowia lipolytica, standard curves were constructed using linear regression analysis based on known amounts of genomic DNA (gDNA) and their corresponding Ct values obtained from qPCR. These standard curves were then used to determine the copy number of each organism in samples obtained from each of the three time points. Average values from triplicate qPCR reactions are reported.
[0262] Identification and quantification of lipids in culture media by gas chromatography (GC) Analytical standards for oleic acid and palmitic acid were U46A (C18:1) and N16A (C16:0) from NuCheck Pharmaceuticals, Inc. Calibration curves were generated for each compound for subsequent quantification; standards were prepared by weight in hexane. To compensate for variations in the amount injected during GC analysis, myristic acid (C14:0, Sigma #70079) was added to the hexane solvent as an internal standard (62 mg added per 100 mL of hexane).
[0263] Separation and quantification of free fatty acids were performed using an Agilent Technologies 7890A gas chromatograph equipped with a 7683B dual injector tower (front / back), a G2614A autosampler, and a flame ionization detector (FID). Helium was used as the carrier gas, and the fuel and support gases for the FID were supplied by a VWR 26000-034 hydrogen generator.
[0264] The analysis was performed using an Agilent J&W DB-FFAP column, a nitroterephthalic acid-modified polyethylene glycol (PEG) column (30 m × 0.25 mm ID × 0.25 μm). The measurement method was as follows: the inlet was set to 250 °C, the septum was purged at 3 mL / min, and 1 μL was injected in 100:1 split mode. The temperature program was 80 °C for 2 min, then increased to 250 °C at 8 °C / min and held for 10 min (with a 3-min post-run at 50 °C). Helium carrier gas was used at a flow rate of 1.8 mL / min, the FID was set to 300 °C, and the H2 and air flow rates were 40 mL / min and 450 mL / min, respectively. The makeup gas flow rate was 41.5 mL / min.
[0265] Malassezia globosa and Yarrowia lipolytica were cultured for 7 days, and multiple culture aliquots were analyzed. 1 mL aliquots were frozen at -80°C until analysis by GC-FID for C16:0 and C18:1 content. At the time of analysis, the samples were allowed to thaw at ambient temperature. Each sample was vigorously vortexed for 30–60 seconds, and 250 μL was then transferred to a 2 mL microcentrifuge tube. These were then extracted with 250 μL of hexane. To control for variability during GC injection, the hexane was spiked with C14:0 as an internal standard. Using a microcentrifuge tube carousel, the samples were vortexed for 10 minutes; then, the samples were allowed to stand at ambient temperature for 15 minutes, followed by centrifugation at 1900 × g for 5 minutes. The upper hexane phase containing the extracted free fatty acids was transferred to a glass vial for subsequent analysis by GC-FID. This method allowed for the separation and quantification of palmitic and oleic acids with retention times of 19.4 and 21.6 min, respectively. The accuracy of the GC analysis was verified using the internal standard myristic acid, which appears at 17.8 min. The peak area variation throughout the experiment was within 2-5%.
[0266] Example 2 Cultivation of Malassezia spp. and Yarrowia lipolytica on Different Lipid Media. This example demonstrates the growth phenotypes of Malassezia globosa and Yarrowia lipolytica on different growth media using lipids as the carbon source. As shown in Table 1, all Yarrowia lipolytica strains grew very well on the lipids tested, while M. furfur grew well or moderately. On the other hand, M. globosa showed poor growth under all conditions tested, particularly on oleic acid (no growth) or olive oil (weak or no growth), and only poor growth on palm oil or ethyl palmitate. Olive oil is primarily composed of unsaturated fatty acids (86%), particularly oleic acid (78%). Palm oil is composed primarily of palmitic acid (44%) and oleic acid (40%).
[0267] Table 1 shows the growth phenotype of yeast strains on different lipid plates. The lipids and emulsifiers used are indicated on the top row. Cells were streaked onto the plates and grown at 32°C for 3 days. +++ good growth; ++ moderate growth; + weak growth; - no growth.
[0268] [Table 1]
[0269] Sebum, a product of the sebaceous glands, is a mixture of lipids, primarily triglycerides, free fatty acids, wax esters, and squalene. Among fatty acids, the major components of sebum lipids are sapienic acid and palmitic acid, each accounting for approximately 30%. Oleic acid is a minor component, accounting for approximately 2-5% (Akaza, et al. (2014), J. Dermatology 41:1069).
[0270] The results shown in Table 1 indicate that Malassezia globosa cannot utilize (and therefore cannot or only grows poorly on) oleate (oleic acid) and can grow poorly on palmitate.
[0271] In contrast, all strains of Y. lipolitca were able to grow on oleate and palmitate.
[0272] Example 3 Lipase activity of Malassezia spp. and Yarrowia lipolytica in different lipid media To measure the activity of secreted lipase, 1 ml aliquots of cell culture were harvested, cells were removed through a 0.22 micron filter, and activity was measured fluorometrically using 4-methylumbelliferyl oleate (Sigma-Aldrich, St. Louis, MO) as a substrate for lipase in the filtered culture supernatant.
[0273] Table 2 shows lipase activity in cell culture supernatants of Malassezia globosa (M. globosa) and Y. lipolytica (Y. lipolytica). Cells were grown with shaking at 32°C for 2 days (Y. lipolytica) or 5 days (M. globosa) in synthetic medium containing 1 ml / L ethyl palmitate and 0.5 ml / L Tween-40. Activity was measured by the fluorescence emitted by 4-methylumbelliferyl oleate hydrolyzed by lipase activity. A control without cells (medium) served as a background signal.
[0274] [Table 2]
[0275] As shown in Table 2, Malassezia globosa (M. globosa) showed the highest lipase activity in cell-free medium (secreted form). On the other hand, Y. lipolytica (ATCC 20362 and CBS 2073) strains did not show significant lipase activity in cell-free supernatants, suggesting that most of their lipase activity was cell-associated or intracellular. Y. lipolytica (Y. lipolytica) Phaff #50-47 strain showed some lipase activity in the culture supernatant.
[0276] Example 4 Competitive growth test of Malassezia globosa (M. globosa) and Yarrowia lipolytica (Y. lipolytica) This example describes the biomass changes over time when Malassezia globosa and Yarrowia lipolytica were grown together and separately. Because M. globosa lacks fatty acid synthase, it requires lipids in the medium for growth. However, adding lipids and emulsifiers to the medium causes the medium to form micelles, or lipid droplets, which make monitoring cell growth by optical density difficult. M. globosa also grows as clumps of cells in liquid medium, and therefore, plating aliquots of the culture and counting colonies is not an accurate measure of cell growth. To obtain a more accurate measurement of cell growth, we used qPCR to monitor cell growth by DNA content.
[0277] Table 3 shows the results of growing the yeasts Malassezia globosa and Y. lipolytica in combination or alone in modified Leeming & Notman medium containing palm oil. Aliquots were taken at three different time points over a 7-day period, and yeast growth was measured by qPCR. Results showed that M. globosa growth was unaffected / reduced by more than 10-fold when the two yeasts were grown together compared to M. globosa grown alone. Meanwhile, Y. lipolytica growth was virtually unaffected in the presence of M. globosa compared to Y. lipolytica grown alone.
[0278] Table 3 shows the qPCR-based cell counts of Malassezia globosa and Y. lipolytica (ATCC 20362) grown together or separately. A culture of Malassezia globosa grown for 7 days in 100 ml of mLN medium containing 20 ml / L palm oil was split into two 50 ml cultures, one of which was grown at OD of Y. lipolytica. 600 The "Y. lipolytica alone" culture was grown in 50 ml of Y. lipolytica until the OD reached 0.1 (co-culture), and in the other 50 ml aliquot it was not added (M. globosa alone). 600 50 ml of fresh mLN medium was inoculated to a .DELTA. of 0.1. Genomic DNA was prepared from 1 ml aliquots of each cell culture and used for qPCR analysis.
[0279] [Table 3]
[0280] Surprisingly and unexpectedly, as shown in Table 3, the presence of Y. lipolytica in media containing M. globosa significantly reduced the growth of M. globosa (e.g., Y. lipolytica inhibited Malassezia spp.), indicating that it can be used for the microbial treatment of dandruff conditions.
[0281] Example 5 GC analysis of lipid consumption by Yarrowia lipolytica This example describes the consumption of oleic acid and palmitic acid by Y. lipolytica and Malassezia globosa. This demonstrates that free fatty acids (FFA) from oleic acid, produced by lipase activity in M. globosa, were consumed by Y. lipolytica. Gas chromatography (GC) was used to measure the amount of FFA in the medium.
[0282] Cells were cultured in modified Leeming & Notman (mLN) medium containing palm oil. Malassezia globosa was cultured in 100 ml of mLN medium at 32°C for 7 days with shaking. The culture supernatant was collected by centrifugation, divided into two 50 ml portions, and transferred to a 250 ml flask. One of the 50 ml portions was diluted with 500 μl of an overnight culture of Y. lipolytica to a final OD of 1000 μl. 600The eluate was added until the pH reached 0.1. Samples (1 ml) were collected before and after centrifugation for GC analysis. Although the majority of M. globosa was removed by centrifugation, not all M. globosa cells were removed from the supernatant. M. globosa culture supernatants with or without Y. lipolytica were incubated with shaking at 32°C. After 1, 2, 3, 4, and 7 days of incubation, 1 ml aliquots were collected for GC analysis.
[0283] Table 4 shows the results of GC analysis. When most of the Malassezia globosa was removed by centrifugation, both palmitic acid and oleic acid significantly decreased. This may be due to the fact that some FFAs were intracellular and precipitated during centrifugation. The amounts of palmitic acid and oleic acid FFAs in the "Malassezia globosa supernatant" and "Malassezia globosa supernatant + Y. lipolytica" were compared after centrifugation (day 0).
[0284] In the case of "M. globosa supernatant," the amounts of palmitic and oleic FFAs remained almost unchanged until day 4 because most of the M. globosa cells were removed by centrifugation. However, there was a clear decrease in FFAs in the samples on day 7. On the other hand, when Y. lipolytica was added to "M. globosa supernatant," both palmitic and oleic acids were rapidly consumed, with oleic acid being consumed more rapidly than palmitic acid.
[0285] Table 4 shows the free fatty acids quantified by GC. Malassezia globosa was grown in 100 ml / L N medium containing 20 ml / L palm oil for 7 days, centrifuged, and then divided into two 50 ml supernatant aliquots. One 50 ml aliquot was incubated with Y. lipolytica at OD 100. 600 One 50 ml aliquot was diluted with Malassezia globosa supernatant and Y. lipolytica until the pH reached 0.1 (Malassezia globosa supernatant + Y. lipolytica), and the other 50 ml aliquot was diluted without Y. lipolytica (Malassezia globosa supernatant). During incubation at 32°C with shaking, samples were taken as indicated and analyzed for palmitic and oleic FFAs. The relative amounts of FFA compared to the day 0 sample are shown in parentheses.
[0286] [Table 4]
[0287] Surprisingly and unexpectedly, the results shown in Table 3 (Example 4) indicate that when Y. lipolytica and M. globosa were cultured together, the growth of M. globosa was significantly reduced in the presence of Y. lipolytica (e.g., Y. lipolytica inhibited Malassezia spp.), indicating that Yarrowia microorganisms can be used as a microbial treatment for dandruff conditions. As shown in Table 2, Malassezia globosa (M. globosa) showed lipase activity in cell-free medium (indicating that lipase was secreted), whereas Yarrowia lipolytica (Y. lipolytica) did not show significant lipase activity in cell-free medium, presumably because most of the lipase activity in Yarrowia microorganisms was cell-associated or intracellular. This is surprising and a favorable feature for microbial treatment, because lipase activity would not remain on the skin after microbial treatment was terminated, preventing the accumulation of free fatty acids. The results in Table 4 also show that oleic free fatty acids (FFAs) produced by lipase activity in Malassezia globosa were effectively consumed by Y. lipolytica but not by M. globosa. This is consistent with the results shown in Table 1, which show that M. globosa cannot utilize oleic acid (and therefore cannot or only grows poorly on oleic acid), but that Yarrowia lipolytica effectively uptakes them. Because oleic free fatty acids (FFAs) are considered proinflammatory, efficient scavenging of FFAs by Yarrowia microorganisms is an important characteristic of microbial treatments for dandruff and other skin diseases caused by proinflammatory oleic FFAs.
[0288] Example 6 Flow cytometric analysis of growth inhibition of Malassezia globosa by Yarrowia lipolytica cell-free culture supernatant (cell-free fermentate) Malassezia species (Malassezia spp.), which contribute to skin diseases, lack fatty acid synthase for lipid synthesis and therefore rely on the host's sebum lipids for growth (Xu et al., (2007) PNAS, 104:18730). The growth medium for Malassezia species was a modified Leeming & Notman (mLN) medium containing 10 g / L bactopeptone, 2 g / L yeast extract, 8 g / L dried ox bile, 10 ml / L glycerol, 0.5 g / L glycerol monostearate, 5 ml / L Tween-60, and 20 ml / L palm oil.
[0289] The presence of lipids and detergents in mLN medium results in a lipid emulsion. In addition, Malassezia spp. exhibit a cell clump phenotype, making it difficult to monitor cell growth by optical density measurements or by plating aliquots of the culture and counting colonies. To circumvent this problem, flow cytometry using a cell-staining dye was used to quantitatively measure cell growth in lipid emulsion medium. Flow cytometry analysis to monitor the growth of Malassezia globosa when challenged with Y. lipolytica cell-free culture supernatant was performed as follows.
[0290] First, to produce different types of fermentation products from Yarrowia lipolytica (Y. lipolytica) cultures, Yarrowia lipolytica (Y. lipolytica) ATCC 20362 strain was cultured at an initial OD of 1000 in YPD (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose), YPG (10 g / L yeast extract, 20 g / L peptone, 20 ml / L glycerol), mLN containing 20 ml / L palm oil, or mLN containing 20 ml / L olive oil. 600 The culture was adjusted to 0.1 and incubated at 32°C for 5 days with shaking at 250 rpm. The Yarrowia cell culture was filtered twice through a 0.22 μm filter to remove cells, to prepare a cell-free culture supernatant (also referred to as a cell-free fermentate) of Yarrowia, which was then frozen and stored at -20°C.
[0291] To monitor the growth inhibition of Malassezia globosa (M. globosa) by Y. lipolytica cell-free fermentation, a 3-day-old M. globosa inoculum culture was diluted 10-fold into fresh mLN medium containing 20 ml / L palm oil. The diluted culture was then further diluted 5-fold with 0.2 M sodium phosphate buffer (pH 6.0). 200 μl of Y. lipolytica cell-free culture supernatant or medium alone was added to 800 μl of diluted M. globosa culture in a deep-bottom 96-well plate (Biotix, San Diego, CA) and incubated at 32°C with constant humidity of 85% and shaking at 350 rpm.
[0292] At different time points, 50 μl aliquots from each culture were subjected to gentle sonication for 30 seconds at an amplitude of 5 with a 1-second on / off cycle using a Qsonica Q700 (Qsonica, Newtown, CT). Twenty μl of the sonicated cell culture was mixed with 50 μl of phosphate buffered saline (PBS) at pH 7.4, 10 μl of diluted (1:1,000 in PBS) Cyto BC Green (Invitrogen), 10 μl of diluted (1:1,000 in PBS) propidium iodide (Invitrogen), and 10 μl of diluted (1:200 in PBS) concanavalin A (Invitrogen) and incubated for 20 minutes at room temperature. Samples were analyzed by flow cytometry using a Novocyte Quanteon (Acea). SytoBC, a cell membrane-permeable DNA / RNA intercalating dye, was excited with a 488 nm laser and detected using a 530 nm / 30 bandwidth filter. Concanavalin A, a mannose-binding lectin labeled with alexaFluor 640, was excited with a 637 nm laser and detected using a 660 nm / 20 bandwidth filter. Events derived from emulsified droplets had relatively low signal intensity in these channels, whereas events with high mannose and nucleic acid content were identified as Malassezia cells. Malassezia cell counts were determined by gating on high sytoBC and high ConA events, and the events / µl value for each sample was recorded.
[0293] Table 5 shows flow cytometry analysis of various cell-free culture supernatants obtained from Y. lipolytica ATCC 20362 or Malassezia globosa cultures supplemented with the antifungal agent amphotericin B (2.5 μg / ml). The percent growth inhibition of M. globosa compared to each medium control is shown in Table 5. Values are the average of duplicate samples.
[0294] [Table 5]
[0295] For all tested Yarrowia fermentations, the addition of Y. lipolytica cell-free culture supernatant reduced the growth of Malassezia globosa over time compared to the respective medium-only controls. Among the Y. lipolytica cell-free culture supernatants, the YPD fermentation had the greatest effect on M. globosa growth after 3 days of incubation, reducing cell numbers by 81% compared to the medium control.
[0296] Example 7 Flow cytometric analysis of Malassezia globosa growth inhibition by cell-free culture supernatants from two different Yarrowia lipolytica strains Growth of Malassezia globosa in the presence of cell-free culture supernatant of Y. lipolytica was monitored by flow cytometry. Y. lipolytica ATCC 20362 or ATCC 9773 was grown at initial OD in YPD (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose), YPG (10 g / L yeast extract, 20 g / L peptone, 20 mL / L glycerol), 20 mL / L palm oil in mLN (10 g / L bactopeptone, 2 g / L yeast extract, 8 g / L dried ox bile, 10 mL / L glycerol, 0.5 g / L glycerol monostearate, 5 mL / L ween-60), or 20 mL / L olive oil in mLN. 600 The culture was adjusted to a pH of 0.1 and incubated at 32°C for 5 days with shaking at 250 rpm. The Yarrowia cell culture was filtered twice through a 0.22 μm filter to remove cells, to prepare a cell-free culture supernatant (also referred to as a cell-free fermentate) of Yarrowia and stored at -20°C.
[0297] The M. globosa inoculated culture was diluted 10-fold with fresh mLN medium containing 20 ml / L palm oil. The diluted culture was then further diluted 5-fold with 0.2 M sodium phosphate buffer (pH 6.0). 200 μl of Y. lipolytica cell-free culture supernatant or medium alone was added to 800 μl of diluted M. globosa culture in a deep-bottom 96-well plate (Biotix, San Diego, CA). The plate was incubated at 32°C with constant humidity of 85% and shaking at 350 rpm. After 3 days of incubation, 50 μl aliquots were taken from each culture and analyzed by flow cytometry using cell staining dyes as described in Example 6.
[0298] The percent growth inhibition of Malassezia globosa compared to each medium control is shown in Table 6. Values are the average of duplicate samples.
[0299] [Table 6]
[0300] The addition of cell-free fermentation supernatants of Y. lipolytica reduced the growth of Malassezia globosa compared to the respective medium-only controls. Among the cell-free culture supernatants of Y. lipolytica, those obtained from YPD fermentations of ATCC 20362 and ATCC 9773 had the greatest effect on M. globosa growth after 3 days of incubation, reducing it by approximately 65–69% compared to the medium control.
[0301] Example 8 Removal of Malassezia species biofilms by Yarrowia fermentation products The skin is a unique environment where microorganisms often exist as biofilms (Brandwein, et al., NPJ Biofilms Microbiomes 2:3, 2016). Biofilms can form on the epithelial surface of the skin or inside hair follicles. Biofilms are composed of cells and extracellular components such as exopolysaccharides, proteins, and DNA. This complex structure can provide a physical and chemical barrier to certain compounds. More importantly, however, the physiology of microorganisms in a biofilm state differs significantly from that of planktonic microorganisms. This is especially true regarding their ability to withstand environmental stresses and resist various antimicrobial treatments, posing a significant therapeutic challenge (Koo, et al., Nature Reviews Microbiology 15:740-755, 2017).
[0302] Malassezia species, yeasts isolated from both healthy and unhealthy skin, have been shown to form biofilms in vitro (Angiolella, et al., Med Mycol. 0:1-7, 2020). These isolates of Malassezia globosa (M. globosa) not only form biofilms but may also exhibit very high adherence and / or hydrophobicity. Malassezia species in biofilm formation have been shown to significantly reduce their susceptibility to antifungal agents (Figueredo, et al., Medical Mycology 8:863-867, 2013; Bumroogthai, et al., Medical Mycology 54:544-549, 2016). The adhesive and hydrophobic properties of biofilms have been suggested to be virulence factors for Malassezia (Allen, et al., J. of Clinical & Experimental Dermatology Research 6:311, 2015; Angiolella, et al., Medical Mycology 56:110-116, 2018). Thus, strategies to eliminate Malassezia biofilms may be beneficial for the treatment of various skin conditions caused by this group of organisms.
[0303] In this example, Malassezia globosa (M. globosa) ATCC MYA-4612 was used in the development of a biofilm test as described below.
[0304] Malassezia globosa (M. globosa) ATCC MYA-4612 was grown in mLN medium (described in Example 6) containing 20 ml / L palm oil at 32°C on a rotary shaker at 100 rpm. After 3 days of incubation, 25 μl of the culture was inoculated into wells of a 96-well polystyrene plate containing 150 μl of mLN medium with palm oil as the carbon source. The plates were incubated at 32°C for 48 hours without shaking, allowing M. globosa to grow both as suspended cells and as sessile biofilm cells attached to the well walls of the microtiter plate.
[0305] After biofilm formation, the growth medium and unattached cells were removed, and the wells were washed once with 1x phosphate-buffered saline (PBS). PBS is a mixture of pH-adjusted ultrapure-grade phosphate buffer and saline, diluted to a 1x working concentration containing 137 mM NaCl, 2.7 mM KCl, 8 mM NaHPO, and 2 mM KHPO. After washing, 250 μl of cell-free supernatant (cell-free fermentation) from two different strains of Yarrowia lipolytica (ATCC 20362 and ATCC 9773) was added to evaluate the effectiveness of the solution in removing biofilms. 250 μl of 1x PBS was also added as a control.
[0306] As described in Example 7, Y. lipolytica ATCC 20362 or ATCC 9773 was cultured at an initial OD in YPD (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose), YPG (10 g / L yeast extract, 20 g / L peptone, 20 ml / L glycerol), 20 ml / L palm oil-containing mLN (10 g / L bactopeptone, 2 g / L yeast extract, 8 g / L dried ox bile, 10 ml / L glycerol, 0.5 g / L glycerol monostearate, 5 ml / L Tween-60), or 20 ml / L olive oil-containing mLN. 600The Yarrowia cell culture was filtered twice through a 0.22 μm filter to remove cells, and the culture was grown at 32°C for 5 days with shaking at 250 rpm at a pH of 0.1. A cell-free culture supernatant (also referred to as a cell-free fermentate) of Yarrowia was prepared and stored at -20°C.
[0307] In this example, Yarrowia fermentation was performed in mLN medium containing 20 ml / L olive oil. After adding Yarrowia fermentation or 1x PBS, the biofilm plates were incubated at 32°C for 15 minutes without shaking to allow for biofilm removal. After incubation, the supernatant or PBS was removed. The amount of biofilm remaining in the wells was quantified after staining. Biofilm staining was performed by adding 250 μl of 0.1% crystal violet dissolved in water. The plates were incubated at room temperature for 3 minutes. After staining, 250 μl of 1x PBS was added to each well to remove unbound dye. This process was repeated once more. After washing, 250 μl of 70% ethanol was added to each well and incubated at room temperature for 5 minutes to release the dye. The dye intensity was measured at 570 nm using a microtiter plate reader. OD readings were used to quantify the amount of biofilm remaining after each treatment. The wells treated with PBS were used as a reference for calculating the biofilm removal rate.
[0308] Table 8 shows the results of removing biofilms formed by Malassezia using culture supernatants (fermented products) derived from Yarrowia strains.
[0309] [Table 7]
[0310] The addition of cell-free fermentation supernatant from Yarrowia lipolytica ATCC 20362 reduced biofilms by 52% compared to the PBS medium control, while the addition of supernatant from ATCC 9773 reduced biofilms by 73% compared to the PBS medium control. This experiment demonstrated the effectiveness of cell-free fermentation products from two different Yarrowia strains in eliminating Malassezia biofilms.
[0311] Example 9 Prevention and reduction of biofilm formation by Malassezia species using Yarrowia fermentation products As previously mentioned, the microbiota on the skin surface, including the scalp, exists primarily as a biofilm community. As described in Example 8, while it is important to remove already formed pathogenic biofilms, preventing and reducing biofilm growth of Malassezia species is another strategy for treating seborrheic dermatitis. In this example, the ability of Yarrowia fermentation products to prevent Malassezia biofilm formation was evaluated.
[0312] Malassezia globosa (M. globosa) ATCC MYA-4612 was used for biofilm growth studies. As described in Example 6, this strain was grown as a starting culture in mLN medium containing 20 ml / L of palm oil on a rotary shaker at 100 rpm for 3 days at 32°C. In a typical biofilm growth study, 10 μl of the culture was inoculated into wells of a 96-well polystyrene plate containing 90 μl of solution. This solution was mLN medium containing 20 ml / L of palm oil with or without Yarrowia fermentation. The final volume was 100 μl. The palm oil concentration was 20 ml / L.
[0313] As described in Example 7, Y. lipolytica ATCC 20362 or ATCC 9773 was cultured at an initial OD in YPD (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose), YPG (10 g / L yeast extract, 20 g / L peptone, 20 ml / L glycerol), 20 ml / L palm oil-containing mLN (10 g / L bactopeptone, 2 g / L yeast extract, 8 g / L dried ox bile, 10 ml / L glycerol, 0.5 g / L glycerol monostearate, 5 ml / L Tween-60), or 20 ml / L olive oil-containing mLN. 600 The Yarrowia cell culture was filtered twice through a 0.22 μm filter to remove cells, and the culture was grown at 32°C for 5 days with shaking at 250 rpm at a pH of 0.1. A cell-free culture supernatant (also referred to as a cell-free fermentate) of Yarrowia was prepared and stored at -20°C.
[0314] In this example, Yarrowia fermentation was performed using YPD. Different concentrations of fermentation (5, 10, and 20 μl) were used for the reduction test. Equivalent concentrations of YPD medium (5, 10, and 20 μl) were used as controls. Biofilm test plates were incubated at 32°C without shaking for 48 hours to grow Malassezia globosa biofilms on the well walls of the microtiter plates.
[0315] After biofilm formation, the growth medium and unattached cells were removed, and the wells were washed once with 1x phosphate-buffered saline (PBS). PBS is a mixture of pH-adjusted phosphate buffer and saline, diluted to a 1x working concentration containing 137 mM NaCl, 2.7 mM KCl, 8 mM NaHPO, and 2 mM KHPO. The amount of biofilm remaining in the wells was quantified by staining with 150 μl of 0.1% crystal violet in water. After dye addition, the wells were incubated at room temperature for 3 minutes. After staining, 150 μl of 1x PBS was added to each well to remove unbound dye. This process was repeated once more. After washing, 150 μl of 70% ethanol was added to each well and incubated at room temperature for 5 minutes to release the dye. The dye intensity was measured at 570 nm using a microtiter plate reader. OD readings were used to quantify the amount of biofilm remaining after each treatment. Wells treated with YPD medium control were used as a reference for calculating the biofilm removal rate by Yarrowia supernatant.
[0316] Table 9 shows the results of Malassezia biofilm formation when culture supernatant (fermentation product) derived from a Yarrowia strain was used.
[0317] [Table 8]
[0318] The addition of 5 μl of supernatant from a Yarrowia lipolytica strain inhibited biofilm formation by Malassezia globose by approximately 35%. The addition of 20 μl of supernatant inhibited biofilm formation by over 80%. This experiment demonstrates the potent efficacy of supernatant from a Yarrowia strain in treating conditions associated with Malassezia.
Claims
1. 1. A skin care composition for use in treating a dandruff condition of the scalp, comprising an effective amount of a culture comprising at least one microorganism of the genus Yarrowia and / or a culture supernatant thereof, wherein the composition alleviates and / or treats the condition, and wherein the microorganism of the genus Yarrowia is Yarrowia lipolytica.
2. 10. The skin care composition of claim 1, wherein the dandruff condition is seborrheic dermatitis.
3. 10. The skin care composition of claim 1, further comprising one or more anti-dandruff actives.
4. 10. The skin care composition of claim 1, wherein the composition degrades lipids selected from the group consisting of palmitic acid, oleic acid, and any one of combinations thereof.
5. 10. The skin care composition of claim 1, wherein the composition reduces the growth of Malassezia species.
6. 10. The skin care composition of claim 1, wherein the composition removes Malassezia species biofilms.
7. 10. The skin care composition of claim 1, wherein the composition prevents or reduces biofilm formation of Malassezia species.
8. 10. The skin care composition of claim 1, further comprising at least one additional compound selected from the group consisting of excipients, preservatives, and pH adjusters.
9. The at least one microorganism of the genus Yarrowia is selected from the group consisting of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 9774, Yarrowia lipolytica ATCC 9775, Yarrowia lipolytica ATCC 9776, Yarrowia lipolytica ATCC 9777, Yarrowia lipolytica ATCC 9778, Yarrowia lipolytica ATCC 9779 ...
2. The skin care composition of claim 1, wherein the selected strain is selected from the group consisting of any one of Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS 2073, Yarrowia lipolytica Phaff #50-47, or a combination thereof.
10. 1. A method for producing a skin care formulation for treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, the method comprising incorporating an effective amount of a culture containing at least one microorganism of the genus Yarrowia and / or a culture supernatant thereof, wherein the microorganism of the genus Yarrowia is Yarrowia lipolytica.
11. The method of claim 10, wherein the formulation is administered topically.
12. 11. The method of claim 10, wherein the cultures containing at least one microorganism of the genus Yarrowia and / or their culture supernatants are combined into a single composition.
13. 11. The method of claim 10, wherein the formulation is administered to the skin or scalp of the subject.
14. The at least one microorganism of the genus Yarrowia is selected from the group consisting of Yarrowia lipolytica ATCC 20362, Yarrowia lipolytica ATCC 9773, Yarrowia lipolytica ATCC 18942, Yarrowia lipolytica ATCC 20177, Yarrowia lipolytica CBS2073 ...
11. The method of claim 10, wherein the bacterium is selected from the group consisting of any one of Lactobacillus casei, Lactobacillus lipolytica, Lactobacillus casei Phaff #50-47, or a combination thereof.
15. 11. The method of claim 10, wherein the culture comprising at least one microorganism of the genus Yarrowia and / or its culture supernatant reduces the growth of Malassezia species.
16. 11. The method of claim 10, wherein the culture containing at least one microorganism of the genus Yarrowia and / or its culture supernatant eliminates biofilms of Malassezia species.
17. 11. The method of claim 10, wherein the culture comprising at least one microorganism of the genus Yarrowia and / or its culture supernatant prevents or reduces biofilm formation of Malassezia species.
18. 11. The method of claim 10, wherein the culture containing at least one microorganism of the genus Yarrowia and / or its culture supernatant degrades lipids selected from the group consisting of palmitic acid, oleic acid, and any one of combinations thereof.
19. 10. A skin care product for treating and / or alleviating a dandruff condition on the scalp of a subject in need thereof, the skin care product comprising the skin care composition of any one of claims 1 to 9.
20. 20. The skin care product of claim 19, wherein the skin care product is selected from the group consisting of lotions, serums, jellies, creams, gels, emulsions, solid cosmetics, masks, patches, and sticks, and comprises at least 1%, 2%, 3%, 4%, and at most 5% by weight of the skin care composition, based on the total weight of the skin care product.
Citation Information
Patent Citations
Dermatologically active yeast extract
JP2014520769A