Methods for improving the therapeutic properties of stem cells

Abstract

To provide a method for improving therapeutic properties of stem cells.SOLUTION: In one aspect, a method of preconditioning stem cells comprising exposing stem cells to low dose radiation (LDR) is provided. In another aspect, a population of preconditioned stem cells is provided, where the population of five preconditioned stem cells is obtained by exposing stem cells to LDR. Uses of the preconditioned stem cells are also provided. In other aspects, the stem cells are muscle stem cells.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 534,905, filed July 20, 2017, entitled "Methods for Improving the Therapeutic Properties of Stem Cells," which is incorporated herein by reference in its entirety.

[0002] The present disclosure relates to methods for improving the regenerative and therapeutic properties of stem cells, and stem cells obtained using the disclosed methods. Specifically, the present disclosure relates to methods for improving the regenerative and therapeutic properties of stem cells by exposing the stem cells to low-dose radiation (LDR). The present disclosure also relates to stem cells exposed to LDR and methods of use thereof. [Background technology]

[0003] Skeletal muscle is the largest organ in the human body, and its long-term maintenance relies on muscle stem cells (also known as satellite cells). Muscle stem cells represent the major population of resident stem cells in adult skeletal muscle [Sambasivan and Tajbakhsh, 2007]. These adult stem cells drive postnatal growth, remodeling, and repair of muscle tissue. Upon muscle injury (which humans routinely experience during any physical activity), satellite cells relocate from the surface of muscle fibers across the muscle mass to the damaged area and proliferate extensively [Charge et al., 2004]. During this proliferation period, satellite cells adopt one of two fates: 1) switch to a self-renewing and standby mode (in this case, satellite cells can be referred to as reserve cells) or 2) differentiate to form myoblasts, which will fuse with damaged muscle fibers to repair the muscle. Indeed, the regenerative capacity of skeletal muscle makes such differentiation one of the best-studied examples of mammalian tissue regeneration. As a result, the use of satellite cells to treat muscle diseases holds great promise [Aziz et al., 2012].

[0004] Muscle diseases can be broadly divided into a) genetic (e.g., Duchenne muscular dystrophy, facioscapulohumeral muscular dystrophy), b) age-related (e.g., sarcopenia), and c) other disease-related (e.g., cachexia associated with cancer, renal failure, or chronic obstructive pulmonary disease). Collectively, the diverse group of muscular dystrophies represents a major medical problem, for which there is currently no cure. Intensive efforts are being directed toward developing regenerative therapeutic strategies, including the use of satellite cells [Bengal et al., 2017; Crist, 2017].

[0005] Over the past decade, various methods for the isolation and moderate enrichment of satellite cells have been developed. However, due to numerous limitations, these approaches have yet to translate into effective therapies for treating muscle diseases. For example, one limitation relates to the low yield of satellite cells, which is insufficient for therapeutic transplantation purposes [Kuang and Rudnicki, 2008]. Ex vivo expansion can improve the final yield. However, multiple subcultures typically result in loss of stemness, accumulation of DNA damage, increased immunogenicity, and other undesirable consequences. These may subsequently lead to immunological rejection and inefficient myofiber formation / regeneration after transplantation. In addition, muscle stem cells cannot migrate long distances from the injection point, which contributes to their poor integration into host muscle. It is not surprising that clinical trials using satellite cells or myoblasts to treat muscle diseases have yet to be successful [Tedesco et al., 2010]. Alternative approaches include the use of pluripotent human embryonic stem cells (hES) or induced human pluripotent stem cells (ihPS) [Maffioletti et al., 2015]. Nevertheless, lengthy protocols for the directed generation of satellite cells from hES or ihPS cells can still suffer from problems associated with in vitro growth and proliferation [Chal et al., 2015]. Therefore, there is a need for preconditioning of muscle stem cells maintained in vitro or ex vivo that will help preserve and / or improve their muscle and stem cell identity and other properties or functions that are important for successful therapy. Summary of the Invention

[0006] Although the existence of multipotent entities that give rise to all cells in the body or to specific tissue lineages (e.g., blood) was postulated by Russian scientist Alexander Maximow in 1909, the concept of adult tissue stem cells (SCs) has only recently been recognized and accepted. 1 It is now known that nearly every tissue in the body harbors a small subset of multipotent, quiescent cells capable of self-renewal, proliferation, and differentiation into mature cell subtypes. These cells are activated upon tissue injury, mobilized, divide, and differentiate to replace diseased, aged, or damaged tissue. The discovery of these unique properties of stem cells and their regenerative potential has made it possible to harness these cells for therapeutic purposes.

[0007] Although very promising, stem cell therapy is hampered by the challenge of obtaining SCs in sufficient numbers to support the development of therapeutics. Stem cells constitute a very small percentage (on the order of 0.01% to 0.001%) of all adult cells in a given tissue. Therefore, stem cells must be expanded in vitro using specialized media formulations. Unfortunately, this ex vivo manipulation of stem cells leads to their premature aging, loss of stemness, and significantly reduced functional and regenerative capacity. 4 As a result, the only currently approved stem cell therapy in North America is hematopoietic stem cell transplantation, which does not require any ex vivo stem cell expansion. Therefore, methods to delay stem cell aging after in vitro expansion and improve the functional and regenerative capacity of SCs are highly desirable.

[0008] The present disclosure describes improving the regenerative and therapeutic properties of stem cells by exposing them to low-dose radiation (LDR). In some instances, the methods described herein can be used to help slow the aging of a particular stem cell type and the age-related deterioration of one or more attributes and / or properties of that stem cell type. That is, aged irradiated stem cells may exhibit less age-related deterioration of one or more target attributes than aged non-irradiated stem cells when compared to younger stem cells. For example, irradiated stem cells may exhibit a slower decline in one or more of their attributes (e.g., proliferation, differentiation, fusion index, etc.) as the cells age than non-irradiated stem cells of the same type.

[0009] In one example, the inventors have shown that irradiated muscle stem cells may exhibit less age-related deterioration of one or more attributes. For example, irradiated muscle stem cells have an increased efficiency in their ability to differentiate myoblasts into muscle fibers if the cultures are exposed to an LDR. The inventors have also shown that the techniques described herein may, in some cases, and for some types of stem cells, help to enhance the functional capacity of stem cells and / or help to slow at least some aspects of the age-related decline in function. The inventors have also shown that, upon stimulation, myogenic differentiation markers are increased in cultures of myoblasts exposed to an LDR compared to non-irradiated controls.

[0010] In other examples, the inventors have shown that irradiated mesenchymal stem / stromal and progenitor cells (MSCs / MSPCs) may exhibit less age-related deterioration in one or more attributes (e.g., proliferation and / or differentiation) when compared to non-irradiated stem cells of the same type and similar cell age / state.

[0011] In another example, the inventors have shown that irradiated endothelial colony forming cells (ECFCs) / endothelial stem cells (ESCs) may exhibit less age-related deterioration of one or more attributes (e.g., proliferative potential and / or migratory potential) when compared to non-irradiated stem cells of the same type and similar cell age / state.

[0012] Consistent with one broad aspect of the teachings described herein, a method of preconditioning stem cells can include exposing stem cells to low-dose radiation (LDR), which can help provide preconditioned stem cells, which can, for example, enhance the functional capacity of the stem cells and help slow the age-related decline in stem cell function as compared to similar stem cells that are not irradiated.

[0013] The radiation may be ionizing radiation, optionally gamma radiation or x-ray radiation.

[0014] The cells may be exposed to 1 mGy to 500 mGy of radiation, and optionally 5 mGy to 200 mGy of radiation or 8 mGy to 150 mGy of radiation.

[0015] The stem cells may be muscle stem cells.

[0016] The stem cells may be mesenchymal stem / stromal cells and progenitor cells.

[0017] The stem cells may be endothelial colony forming cells / endothelial stem and progenitor cells.

[0018] The stem cells may be hematopoietic stem and progenitor cells.

[0019] The stem cells may be human stem cells, or optionally, may be murine stem cells.

[0020] The stem cells may be exposed to the LDR in vitro or ex vivo.

[0021] Preconditioned muscle stem cells may in some cases exhibit increased differentiation into muscle fibers compared to muscle stem cells that have not been exposed to an LDR.

[0022] Preconditioned muscle stem cells may optionally have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c compared to muscle stem cells that have not been exposed to an LDR.

[0023] The method may include administering the preconditioned stem cells to a subject in need thereof.

[0024] The subject may be a human.

[0025] The subject may have a muscle disorder.

[0026] A population of preconditioned stem cells may be provided and may be obtained by exposing the stem cells to low dose radiation (LDR).

[0027] The radiation may be ionizing radiation and may optionally include gamma radiation or x-ray radiation.

[0028] The cells may be exposed to about 1 mGy to about 500 mGy of radiation, and optionally about 5 mGy to about 200 mGy of radiation or about 8 mGy to about 150 mGy of radiation. The stem cells may be muscle stem cells.

[0029] The stem cells may be mesenchymal stem / stromal cells and progenitor cells.

[0030] The stem cells may be endothelial colony forming cells / endothelial stem cells / progenitor cells.

[0031] The stem cells may be human stem cells, or optionally, may be murine stem cells.

[0032] Preconditioned muscle stem cells may exhibit increased differentiation into muscle fibers compared to muscle stem cells that have not been exposed to an LDR.

[0033] The preconditioned muscle stem cells may have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c compared to muscle stem cells that have not been exposed to LDR.

[0034] Consistent with another broad aspect of the teachings described herein, a pharmaceutical composition may include a cell population of preconditioned stem cells, including the preconditioned stem cells described herein, and a carrier.

[0035] Consistent with another broad aspect of the teachings described herein, a method of treating a muscle disease in a subject can include administering to a subject in need thereof at least some of the preconditioned stem cells described herein. The preconditioned stem cells can be muscle stem cells.

[0036] The preconditioned muscle stem cells described herein may be used to treat muscle diseases in subjects in need thereof.

[0037] Consistent with another broad aspect of the teachings set forth herein, a method of preconditioning stem cells may include the steps of: a) providing a sample comprising a plurality of target stem cells; b) irradiating the target stem cells with a first dose of radiation emitted from a radiation source during a radiation exposure period to convert the target stem cells into irradiated preconditioned stem cells that are suitable for use in a subsequent therapeutic treatment process.

[0038] Irradiating the target stem cells may reduce the age-related decline in at least a first cellular function of each target stem cell.

[0039] The first cell function may have an initial performance value and may define an aged performance value at a threshold aging time. The preconditioned stem cells may have an as-treated performance value at a threshold aging time that may be between, and in some cases may be greater than, the aged performance value and the initial performance value.

[0040] The treated performance values ​​may be closer to the initial performance values ​​than the aged performance values.

[0041] The target stem cells may each have a second initial performance value and include a second cell function defining a second aged performance value at a second threshold aging time. The preconditioned stem cells may have a second treatment performance value at the second threshold aging time, and the second treatment performance value may be between the second aged performance value and the second initial performance value.

[0042] The second threshold aging time may be different from the first threshold aging time.

[0043] The second treated performance value may be closer to the second initial performance value than the second aged performance value.

[0044] At least one of the threshold aging time and the second threshold aging time may be determined by completing a threshold number of cell passages.

[0045] The threshold number of cell passages may be greater than 4 and may be between 4 and 23.

[0046] At least one of the threshold aging time and the second threshold aging time may be determined by time spent in cell culture.

[0047] The target stem cells may include muscle stem cells, the first cell function may include cell fusion, the initial performance value may include an initial fusion index, the aged performance value may include an aged fusion index, and the treated performance value may include a treated fusion index.

[0048] The fusion index at treatment may be greater than the fusion index at age.

[0049] The treated fusion index may be at least twice the aged fusion index.

[0050] The fusion index at treatment may be greater than 50%, and may be greater than 60% and greater than 70%.

[0051] Preconditioned stem cells may exhibit increased differentiation into muscle fibers compared to non-irradiated target stem cells.

[0052] The preconditioned stem cells may have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c compared to non-irradiated target stem cells.

[0053]

[0054] The target stem cells may include mesenchymal stem cells, the first cell function may include proliferation, the initial performance value may include an initial doubling time, the aged performance value may include an aged doubling time, and the treatment performance value may include a treatment doubling time.

[0055] The doubling time during treatment may be less than the doubling time during aging.

[0056] The treatment doubling time may be less than 50% of the age doubling time.

[0057] The doubling time during treatment may be less than three times the initial doubling time.

[0058] The threshold number of cell passages may be between 12 and 15.

[0059] The threshold number of cell passages may be 14 or 15, and may be 15 if desired.

[0060] The target stem cells may comprise a second cell function, which is chondrogenic differentiation. The second initial performance value may comprise an initial differentiation capacity, the second aged performance value may comprise an aged differentiation capacity at a second threshold aging time, and the second treatment performance value may comprise a treatment differentiation capacity at a second threshold aging time.

[0061] The target stem cells may include mesenchymal stem cells, the first cell function may be chondrogenic differentiation, the initial performance value may include initial differentiation potential, the aged performance value may include aged differentiation potential, and the treated performance value may include treated differentiation potential.

[0062] The differentiation potential during treatment may be greater than that during aging.

[0063] The differentiation potential upon treatment may be greater than the initial differentiation potential.

[0064] The differentiation potential upon treatment may be at least 60% of the initial differentiation potential.

[0065] The differentiation capacity at treatment may be at least 150% of the differentiation capacity at age.

[0066] The difference between the differentiation potential during treatment and the initial differentiation potential may be smaller than the difference between the differentiation potential during aging and the initial differentiation potential.

[0067] The target stem cells may comprise endothelial colony forming cells. The first cell function may be proliferation, the initial performance value may comprise an initial doubling time, the aged performance value may comprise an aged doubling time, and the treatment performance value may comprise a treatment doubling time.

[0068] The doubling time during treatment may be less than the doubling time during aging.

[0069] The doubling time during treatment may be less than the doubling time during aging.

[0070] The threshold aging time may be defined by a threshold number of cell passages, which may be between 5 and 8, between 6 and 8, 7 or 8, optionally at least 5 or at least 8.

[0071] The second cell function can be migration. The second initial performance value can include an initial time to achieve a predetermined cell confluency, the second aged performance value can include an aged time to achieve the predetermined cell confluency at a second threshold time, and the second treatment performance value can include a treatment time to achieve the predetermined cell confluency at a second threshold time.

[0072] The predetermined cell confluency may be at least 60%.

[0073] The treatment time to achieve a given cell confluency may be less than the aging time to achieve a given cell confluency.

[0074] The treatment time to achieve a given cell confluency may be between about 1.4 and 1.8 times the initial time to achieve the given cell confluency.

[0075] The target stem cells may include endothelial colony forming cells, the cell function may include migration, the initial performance value may include an initial time to achieve a predetermined cell confluency, the aged performance value may include an aged time to achieve a predetermined cell confluency, and the treatment performance value may include a treatment time to achieve a predetermined cell confluency.

[0076] The predetermined cell confluency may be at least 60%.

[0077] The treatment time to achieve a given cell confluency may be less than the aging time to achieve a given cell confluency.

[0078] The treatment time to achieve a given cell confluency may be between about 1.4 and 1.8 times the initial time to achieve the given cell confluency.

[0079] The target stem cells may be human stem cells.

[0080] The target stem cells may be mouse stem cells.

[0081] The radiation may include ionizing radiation.

[0082] The radiation may include low linear energy transfer (LET) ionizing radiation.

[0083] The radiation may include gamma radiation and / or X-ray radiation, and may optionally be gamma radiation.

[0084] The first dose of radiation may include between about 1 mGy and about 500 mGy of radiation.

[0085] The first dose of radiation may include between about 2 mGy and about 200 mGy of radiation.

[0086] The first dose of radiation comp may include an escalation of radiation between about 2 mGy and about 200 mGy.

[0087] The first dose of radiation may include between about 10 mGy and about 100 mGy of radiation.

[0088] The first dose of radiation may be about 10 mGy.

[0089] The first dose of radiation may be about 50 mGy.

[0090] The first dose of radiation may be about 100 mGy.

[0091] The target stem cells may be irradiated while in vitro within the body of the subject to be treated.

[0092] The target stem cells may be irradiated while ex vivo.

[0093] The method may include using the preconditioned stem cells in a subsequent therapeutic process.

[0094] The method can include administering preconditioned stem cells to a subject in need thereof. The subject can be a human and can optionally have a muscle disorder.

[0095] Consistent with another broad aspect of the teachings described herein, a population of preconditioned stem cells may be obtained by using the methods described herein.

[0096] Preconditioned stem cells may include muscle stem cells and may exhibit increased differentiation into muscle fibers at a threshold aging time when compared to target stem cells that have not been exposed to an LDR.

[0097] The preconditioned muscle stem cells may have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c compared to muscle stem cells that have not been exposed to LDR.

[0098] Consistent with another broad aspect of the teachings described herein, a pharmaceutical composition may comprise preconditioned stem cells obtained by using the methods described herein in combination with any suitable carrier.

[0099] Consistent with another broad aspect of the teachings described herein, a method of treating a muscle disease can include administering preconditioned stem cells obtained by using the methods described herein to a subject in need thereof.

[0100] Consistent with another broad aspect of the teachings described herein, the use of preconditioned stem cells produced according to the methods described herein may be used to treat muscle diseases in subjects in need thereof.

[0101] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the present disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description.

[0102] The disclosure will now be described with reference to the drawings. [Brief explanation of the drawings]

[0103] [Figure 1] Muscle stem cells are presented as a model for muscle aging and regeneration. This cycle, repeated multiple times throughout the lifespan, represents muscle stem cell aging through exhaustion of regenerative potential and loss of muscle memory. Specifically, muscle stem cells undergo several divisions, leading to proliferative expansion. A portion of the dividing stem cells undergo a self-renewal process and become reserve stem cells. Upon receiving an external signal, the stem cells differentiate and fuse to form muscle fibers containing the reserve cells as stem cells [Yaffe and Saxel, 1997]. The reserve cells can undergo this cycle again. Multiple such cycles and depletion of the stem cell pool result in the characteristics of aging. This process can be modeled in vitro using C2C12 cells.

[0104] [Figure 2] Experimental design: C2C12 myoblasts were exposed to LDR (0 mGy, 10 mGy, or 100 mGy) and maintained for 30, 60, and 90 days by sequentially repeating the differentiation and isolation of reserve cells (as described in Figure 1).

[0105] [Figure 3] LDR exposure reverses the decline in myogenic potential over time in culture. A: Immunostaining for muscle-specific myosin heavy chain (MHC) with anti-MHC antibody of cultures maintained in differentiation medium for 4 days (magnification, 40X). B: Quantification of fusion index in differentiated C2C12 cultures of various culture ages with or without LDR. Values ​​are the average of three independent experiments.

[0106] [Figure 4]LDR exposure restores myogenic protein and gene levels in muscle fibers formed by long-term cultures of C2C12 myoblasts. A: Untreated control and irradiated cultures (10 mGy and 100 mGy) of various ages, as well as young cells, were incubated in 2% horse serum for 72 hours to form myotubes. Western blot analysis of whole cell lysates showed that myogenin and Myh3 were decreased in untreated control cultures, but levels were partially restored in irradiated cells. B: 60-day-old cultures of untreated control and irradiated cells (10 mGy and 100 mGy), as well as young cells, were incubated in 2% horse serum for 48 hours. RNA was extracted, and RT-qPCR analysis was performed to quantify mRNA levels of various gene markers of muscle differentiation and fusion. Data show that differentiation markers Myogenin and Myh3 and fusion genes TKS5 and TMEM8c (Myomaker) declined sharply over time in untreated controls, but mRNA levels were partially restored in irradiated cells. Values ​​are means + / - SD of three technical replicates from a single experiment.

[0107] [Figure 5] Global gene expression profiling in mouse muscle cells using next-generation sequencing. A. Schematic of the experimental design for RNA-seq by NGS. Young mouse muscle cells were acutely irradiated at doses of 10 mGy and 100 mGy, aged in culture for 60 days, and differentiated to form myofibers. Samples were subjected to RNA-seq analysis using NGS technology. B. Gene expression in 10 mGy- and 100 mGy-treated cells was compared to untreated control cells using the Cuffdiff NGS analysis tool, and differentially expressed genes were displayed as a Venn diagram.

[0108] [Figure 6A] FIG. 5C is a graph showing gene ontology analysis for differentially expressed genes from the Venn diagram in FIG. 5B. [Figure 6B]5B is a graph showing gene ontology analysis of differentially expressed genes from the Venn diagram in FIG. 5B. Treated cells showed greater expression of genes required for myofiber formation via myogenic pathways and processes. See Table 1.

[0109] [Figure 7] Figure 1 shows the observed beneficial effects from experiments performed on biopsy-derived human muscle stem cells. A: Graphical representation of the experimental design, in which young human muscle stem cells were exposed to LDR (0 mGy, 10 mGy, or 100 mGy), maintained in growth medium for 14 days, and differentiated in differentiation medium containing 2% horse serum for 3 days to form myofibers. B: Representative immunofluorescence microscopy images of myofibers derived from treated and untreated stem cells. The graphical representation shows a 60%-70% increase in the fusion index in treated stem cells compared to untreated control stem cells (n=3 experiments).

[0110] [Figure 8] Delayed aging in cultures of irradiated MSPCs is shown. A: As the cultures aged from p4 to p15, doubling time increased from 24.4 to 95.5 hours for MSPCs. B: p4 cells were irradiated at 10, 50, and 100 mGy and aged to p14 and p15. Doubling time measurements were taken and plotted against the doubling time of untreated p4 controls. Irradiated groups were compared to untreated controls at the same passage. *Asterisks indicate significant changes (p<0.5).

[0111] [Figure 9]Delayed aging in irradiated ECFC cultures is shown. A: As cells aged in culture from p4 to p8, doubling time increased from 20.0 h to 71.9 h for ECFC clone 13. B: p4 cells were irradiated at 10 mGy, 50 mGy, and 100 mGy and aged to p8. Doubling time measurements were taken and plotted against the doubling time of untreated p4 controls. Irradiated groups were compared to untreated controls at the same passage. *Asterisks indicate significant changes (p<0.5).

[0112] [Figure 10] Figure 1 shows enhanced chondrogenic differentiation of irradiated aged MSPCs. Young p4 cells were acutely irradiated with 10 mGy, 50 mGy, and 100 mGy of gamma rays and aged to 5 and 15 passages. p5 and p15 irradiated cells were then differentiated along the chondrogenic lineage for 14 days in chondrogenic differentiation medium. The resulting chondrocyte pellets were processed, sectioned, and stained for aggrecan as described in Materials and Methods. A: Total fluorescence intensity of pellet sections was quantified using ImageJ's raw integrated density calculation. All values ​​were normalized to the untreated p5 control. *Asterisks indicate statistically significant (p<0.05) changes. B: Representative stained chondrocyte sections from aged p15 untreated (UT) cell pellets and 10 mGy irradiated cell pellets. Experiments were performed in duplicate. White bars represent 400 μm.

[0113] [Figure 11]Figure 1 shows increased migration of irradiated aged ECFCs. Data represent scratch wound assays. Wounds were created in cell monolayers. Cells were monitored for 24 hours, and their migration capacity was estimated by the rate of wound closure. A: Wound confluency was measured 10 hours after scratching for aged untreated and treated cells and expressed relative to the confluency achieved by young (p4) untreated cells. B: The time to achieve 60% confluency was estimated for aged untreated and treated cells and expressed relative to the confluency achieved by young (p4) untreated cells. *Asterisks indicate significant changes (p<0.5). DETAILED DESCRIPTION OF THE INVENTION

[0114] Various devices or processes will be described below to provide an example of one embodiment of each claimed invention. No embodiment described below limits any claimed invention, and any claimed invention may encompass a process or device different from the process or device described below. The claimed invention is not limited to devices or processes having all of the features of any one device or process described below, or to features common to several or all of the devices described below. It is possible that a device or process described below is not an embodiment of any claimed invention. Any inventions disclosed in the devices or processes described below that are not claimed herein may be the subject of a separate document (e.g., a continuing patent application) for protection, and the applicant, inventor, or owner does not intend to abandon, disavow, or disclose any such invention by its disclosure herein.

[0115] The use of stem cells, including, for example, human stem cells, to treat a wide variety of human disorders and diseases in the clinic has expanded over the past decade, but these past uses have had some limitations, such as limitations related to various functional properties of stem cells (e.g., the ability to proliferate and differentiate efficiently and robustly, the ability to resist cell death and other inhibitory signals, etc.), which may generally decline as stem cells continue to be manipulated ex vivo or in vitro.

[0116] One challenge with some existing practices involving the use of stem cells for such therapeutic treatments can be the time delay or lag between the provision of the original young stem cells and their ultimate use in the therapeutic treatment. During this period, the stem cells may age, which may affect one or more functions of the cells. For example, one or more cellular functions of a given stem cell may experience an age-related decline in its function. This may result in aged stem cells with impaired cellular functions that may affect their usefulness and / or effectiveness in subsequent therapeutic treatments. As described herein, the inventors have discovered a method of preconditioning stem cells, including irradiating a population of untreated target stem cells, which can help alleviate at least some types of age-related decline in some cellular functions as the treated stem cells age, while still leaving the stem cells viable and suitable for use in therapeutic treatments. As used herein, the term "preconditioning" can refer to exposing stem cells to agents or stimuli to improve the regenerative and / or functional properties of the cells. For example, stem cells may be preconditioned prior to therapeutic transplantation.

[0117] Several protocols have been developed and proposed to attempt and aid in improving the therapeutic properties of a given stem cell to be used in such treatment (collectively referred to as preconditioning), including, for example, exposure to hypoxia, growth factors, and conditioned medium from other cells. Literature suggests that these methods may have varying degrees of improvement depending on the stem cell type, disease, and endpoint measured.

[0118] However, some of these preconditioning techniques may have limitations and / or drawbacks. For example, some evidence suggests that preconditioning stem cells with hypoxia can lead to relatively poorer differentiation. Exposure to growth factors may increase the cost of the treatment. Incubating stem cells with conditioned medium may require further culturing of "unaffected" stem cells, which may not be achieved in many cases or may not be therapeutically applicable.

[0119] Low-dose radiation is generally considered to be an additional health risk factor for the public. However, contrary to this common view, the present inventors have discovered that some cells may benefit from exposure to low-dose radiation, and that such exposure can actually improve the desired therapeutic properties of target cells. Specifically, as described herein, the present inventors have discovered low-dose radiation as a way to improve existing therapeutic methods when compared with some known radiobiology studies that focus on relatively high doses of radiation, and have revealed some improvements in the characteristics of stem cells exposed to low-dose radiation.

[0120] Based on this discovery, and as an alternative to such traditional preconditioning techniques, the inventors have discovered a method of preconditioning stem cells (e.g., cells intended for therapeutic transplantation into a patient-recipient or some other potential use) by exposing the cells to low doses of radiation (e.g., ionizing radiation emitted from a suitable radiation source). The inventors have found that such exposure helps preserve (i.e., slows the decline / deterioration of) certain cellular functions (e.g., cell proliferation, cell viability, tissue-specific memory, differentiation potential, and other functional properties associated with therapeutic efficacy or other uses) of a given stem cell or stem cell population, and can help mitigate the deterioration of such attributes or functions over time as the stem cells age. This may help aged preconditioned stem cells exhibit attributes relatively closer to those of young stem cells over a longer period of time than non-preconditioned (i.e., control) stem cells of the same type.

[0121] This type of preconditioning can potentially be distinguished from other types that modify stem cell properties and / or attempt to enhance them beyond the standard or control properties of untreated young stem cells. For example, in some of the techniques disclosed herein, unmodified attributes of young stem cells are used as a baseline / reference, and the intent is to modify the stem cells so that the attributes exceed the baseline function of untreated young stem cell controls, thereby reducing the extent to which the attributes decline or deviate from these baseline values ​​as stem cells age.

[0122] That is, the disclosed methods may reduce age-related decline in at least a first cell function of each target stem cell for some cells and some functions. For example, a given cell function may have an initial performance value that can be measured for a population of young (i.e., non-aged) stem cells and can be considered to form a baseline or control value for the given function.

[0123] Aging at least a portion of the target stem cells without treatment as described herein can be used to define an aging performance value for untreated stem cells. This aging performance value can be measured at any suitable time during the aging process and determined at a threshold aging time that can serve as a reference time for comparing the properties of treated and untreated stem cells. This threshold aging time can be defined by the passage of time (e.g., it may be measured in seconds, minutes, hours, days, etc.), or by other characteristics, such as the number of subcultures or cell passages.

[0124] Stem cells preconditioned using the methods described herein can also be aged until a threshold aging time is reached, and at this time, relevant cell function measurements can be used to establish a treatment performance value.The inventors have discovered that treating cells with the methods described herein can reduce the deterioration of at least some cell functions, which can be understood as meaning that the treatment performance value remains closer to the initial performance value of the control than the aged performance value of untreated cells (for example, aged treated cells have functionality closer to the original young cells than aged untreated cells).That is, for most measurements, the treatment performance value can be between the aged performance value and the initial performance value.In some examples of the methods described herein, the treatment performance value may be closer to the initial performance value than to the aged performance value.

[0125] Although some aspects of the methods herein are described with respect to only one cell function and its associated performance value, some uses of the methods herein may help to maintain the values ​​of more than one cell function in a given stem cell. In such cases, a variety of different respective performance values ​​may be calculated for each cell function being monitored / compared. The effects of the methods on different cell functions may be similar (i.e., preconditioned cells tend to have better performance values ​​than untreated aged control cells), but the magnitude, ratio, relationship, etc. may differ based on the nature of the cell function being measured / compared.

[0126] Helping to maintain the functionality of preconditioned stem cells may allow them to be stored for longer periods of time before being utilized in a given therapeutic treatment. This may help accommodate travel / delivery times and / or allow a dose of stem cells to be prepared in advance of when the stem cells are needed and kept on hand until needed. Alternatively, if the treated stem cells are utilized in approximately the same time that untreated cells would be utilized, the treated stem cells may exhibit, display, or enhance performance and / or efficacy compared to untreated stem cells. This may also aid in expanding cells to relatively larger numbers suitable for therapeutic applications. For example, some stem cell therapies may require a minimum number of stem cells to achieve a relatively large therapeutic index, and a delay in aging may help facilitate expanding such cells for longer periods of time and to larger numbers.

[0127] As used herein, the term "stem cell" may refer to a cell that can differentiate into specialized cells and that can self-renew (i.e., divide to produce more stem cells). Various types of stem cells are well known in the art and are contemplated in the methods disclosed herein. Examples of stem cells include, but are not limited to, muscle stem cells, mesenchymal stem / stromal cells and progenitor cells (also known as mesenchymal stem cells or mesenchymal stem and progenitor cells), hematopoietic stem and progenitor cells (also known as hematopoietic stem cells), and endothelial colony-forming cells (also known as endothelial stem and progenitor cells).

[0128] For example, consistent with one broad aspect of the teachings described herein, which may be used alone and / or in combination with any of the other suitable aspects described herein, the inventors have shown that exposing C2C12 myoblasts to low-dose radiation (LDR) can help enhance muscle stem cell memory (i.e., suppress age-related decline in muscle stem cell memory function), which may help improve their potential to differentiate into muscle fibers. For example, exposure to LDR may enhance retention of muscle stem cells' ability to differentiate and form muscle fibers during prolonged in vitro growth. This property may help contribute to successful therapeutic applications of muscle stem cells in regenerative medicine and may also be inversely related to the length and / or age of cell culture. The inventors have also shown that various markers of muscle differentiation are increased in cultures of C2C12 myoblasts exposed to LDR compared to non-irradiated controls.

[0129] Accordingly, the present disclosure provides at least one example method of preconditioning stem cells that includes exposing the stem cells to low-dose radiation (LDR), thereby providing preconditioned stem cells with enhanced therapeutic properties when compared to similarly aged, non-preconditioned stem cells.

[0130] Attributes and / or therapeutic properties that may be enhanced by LDR preconditioning may, in some instances, include delayed aging of preconditioned stem cells (compared to the cellular function of similar, non-preconditioned stem cells) and a corresponding delay in age-related loss of proliferation. Note that this need not include improvements in the proliferation of relatively young stem cells (i.e., proliferation of young, LDR-preconditioned stem cells may not exceed proliferation of young, non-preconditioned stem cells). Other functional capabilities that may be enhanced by LDR preconditioning may, in some instances, include enhanced retention of the ability of muscle stem cells to differentiate and form myofibers during prolonged in vitro growth.

[0131] In some embodiments of the teachings described herein, the stem cells may be muscle stem cells. As used herein, the term "muscle stem cells" refers to stem cells present in skeletal muscle tissue that are capable of self-renewal and giving rise to skeletal muscle cells. Muscle stem cells are also referred to as satellite cells. These stem cells are activated in response to muscle injury and regenerate damaged muscle tissue.

[0132] Alternatively, the stem cells to be LDR-preconditioned may be mesenchymal stem / stromal and progenitor cells (MSCs / MSPCs). MSCs are multipotent stromal cells that can differentiate into a variety of cell types, including, but not limited to, adipocytes, chondrocytes, and osteocytes.

[0133] In some embodiments, the stem cells to be LDR-preconditioned can be endothelial colony-forming cells or endothelial stem and progenitor cells, which can give rise to the endothelial cells that line all blood vessels, the inner chambers of the heart, and lymphatic vessels.

[0134] Optionally, the stem cells to be LDR-preconditioned can be hematopoietic stem and progenitor cells (HSCs), which are located in the bone marrow and can give rise to all blood cell lineages and platelets.

[0135] Although experimental data are provided herein for irradiation of several exemplary types of stem cells, the inventors anticipate that other types of stem cells (e.g., cardiac stem cells, etc.) may exhibit similar delayed aging behavior when preconditioned according to the techniques described herein, including those via LDR irradiation. For example, various stem cells tend to have similar biology and function; that is, they are quiescent cells that reside in specialized niches and await physiological signals to initiate migration, division, and differentiation. Because the effects of delayed aging have been demonstrated for three different stem cell types with similar degrees of improvement, the inventors believe it is reasonable to assume that other stem cells may behave in a similar manner.

[0136] As used herein, the term "low-dose radiation" (LDR) refers to a low linear energy transfer (LET) ionizing radiation dose that is similar to or barely exceeds the natural background level of radiation. A radiation dose of less than 500mGy is understood to be a low-dose radiation level, and according to the teachings described herein, a low-dose radiation may be a dose of ionizing radiation less than about 500mGy, 400mGy, 300mGy, 200mGy, 150mGy, 125mGy, 110mGy, 100mGy, 75mGy, 50mGy, 25mGy, 12mGy or 10mGy. In the examples described herein, some specific radiation doses have been shown to help prevent age-related deterioration of stem cells.

[0137] The low-dose radiation described herein may be provided using any suitable irradiation source capable of emitting low linear energy transfer (LET) ionizing radiation in the dose ranges described herein. Gamma (γ) radiation and X-ray radiation are two examples of suitable LET radiation that can be used for preconditioning. As will be understood by those skilled in the art, LET is the amount of energy deposited in a material traversed per unit length (i.e., keV / um). Anything less than about 10 keV / um can be considered low LET for use with the methods described herein (e.g., γ radiation and X-ray radiation).

[0138] Thus, suitable types of ionizing radiation can include X-rays or gamma radiation, as appropriate. In one embodiment of the methods described herein, the ionizing radiation can be gamma radiation, and in another embodiment, it can be X-ray radiation. In the described methods, stem cells can be exposed to a dose of radiation between about 1 mGy and about 500 mGy, and in some instances, between about 2 mGy and about 200 mGy, between about 10 mGy and about 150 mGy, or between about 10 mGy and about 100 mGy. In some preconditioning processes, target stem cells can be exposed to about 10 mGy, 50 mGy, and / or about 100 mGy of ionizing radiation. In other embodiments, stem cells can be exposed to 8 mGy to 12 mGy of radiation, optionally 10 mGy of radiation, or 90 mGy to 110 mGy of radiation, optionally 100 mGy.

[0139] Sources of gamma radiation for exposing stem cells to LDR include: 60 Co and 137 In another embodiment, stem cells are exposed to LDR from an X-ray irradiation device.

[0140] The stem cells may be irradiated (i.e., exposed to an LDR) for preconditioning by any suitable method, including those described herein. The stem cells may be exposed to an LDR in vitro or ex vivo, as appropriate.

[0141] In some embodiments of the methods described herein, the cells to be LDR-preconditioned can be in cell culture at the time of preconditioning / exposure, e.g., a population or culture of stem cells in a petri dish or test tube can be exposed to LDR.

[0142] The exposure time for irradiation to achieve the desired level of preconditioning for a given stem cell can vary. The irradiation time for a given stem cell may be selected based on various factors, including, for example, the desired dose of LDR, the radiation delivery method, and available equipment. In some applications, the exposure time may vary between 1 second and 24 hours. In one embodiment, the stem cells are exposed to the LDR for 1 second to 10 minutes.

[0143] In one embodiment, aged stem cells that have been exposed to an LDR have improved (i.e., less deteriorated) properties compared to aged stem cells that have not been exposed to an LDR. These improved properties may include, but are not limited to, improved regenerative properties, increased or improved differentiation potential, increased viability, increased proliferation, increased therapeutic efficacy, and increased retention of stem cell properties. These properties may be assessed by any suitable method. Any of the attributes / properties may be increased by at least 10%, 25%, 50%, 75%, 100%, 200%, or 300% compared to stem cells that have not been exposed to an LDR.

[0144] For example, in embodiments where the stem cells are muscle stem cells, aged muscle stem cells that have been exposed to an LDR exhibit increased differentiation into muscle fibers compared to aged muscle stem cells that have not been exposed to an LDR (i.e., there may be less of a decline from control values ​​in young cells than in untreated muscle stem cells).

[0145] Various methods for assaying differentiation into muscle fibers are known in the art and can involve quantifying the proportion of stem cells that become part of newly formed muscle fibers.

[0146] For example, in one embodiment, a myofiber differentiation assay is used. In this example, the fusion index is calculated using the following formula: f =N 融合 / N 総数 ×100%, in the formula, N 融合 is the number of nuclei for myosin-positive cells (i.e., muscle fibers), and N 総数 is the total number of nuclei scored. A higher fusion index indicates increased differentiation into myofibers. Thus, in one embodiment, muscle stem cells exposed to an LDR have a higher fusion index after at least 5, 10, 15, 30, 60, or 90 days of culture after exposure, or in the range of about 1 day to about 100 days of culture after irradiation, compared to muscle stem cells not exposed to an LDR.

[0147] In other embodiments, stem cells exposed to an LDR may exhibit increased expression of at least one marker associated with cell differentiation compared to stem cells not exposed to an LDR. For example, if the stem cells are muscle stem cells, the muscle stem cells exposed to an LDR may exhibit increased expression of at least one marker associated with muscle cell differentiation compared to muscle stem cells not exposed to an LDR. Markers of muscle differentiation may include, but are not limited to, myogenin, MyH3, MyoD, TKS5, and TMEM8c. Thus, in one embodiment, muscle stem cells exposed to an LDR exhibit increased gene or protein expression of markers of muscle differentiation (optionally, myogenin, MyH3, MyoD, TKS5, and / or TMEM8c) compared to muscle stem cells not exposed to an LDR after at least 5, 10, 15, 30, 60, or 90 days of culture following exposure to an LDR. Multiple myogenic pathways may be activated in the treated muscle stem cells, as confirmed by next-generation gene expression sequencing.

[0148] In some embodiments, the method can include obtaining or providing stem cells prior to exposing the stem cells to an LDR. For example, the stem cells can be harvested from a tissue sample. As used herein, a "tissue sample" can refer to any sample of tissue containing stem cells. The tissue sample can be obtained from any mammal, including, but not limited to, humans and mice. In one embodiment, the tissue is muscle. As used herein, the term "harvesting cells" refers to isolating or removing cells from a tissue sample (e.g., muscle, etc.). Various suitable methods for harvesting cells from a tissue sample are known in the art.

[0149] The stem cells used in the methods herein may be from any suitable source and may be derived from other cell types, for example, embryonic stem cells (ESCs) and induced pluripotent stem cells (iPS) may be converted into muscle stem cells (Maffioleti et al., 2015, and Chal et al., 2015).

[0150] Stem cells may be grown and / or maintained in cell culture before, during, and / or after exposure to an LDR. As commonly understood in the art, cell culture is a process in which cells are grown under controlled conditions that are generally not their native environment. Typically, cells in culture are maintained in culture medium. As used herein, the term "culture medium" refers to a medium designed to support the growth of cells, particularly stem cells. Various culture media are known in the art. In one embodiment, the culture medium is a basal medium (e.g., Dulbecco's Modified Eagle's Medium (DMEM)), improved DMEM, Biogro™, SkGM™, Ham's F10, Ham's F12, Iscove's Modified Dulbecco's Medium, Neurobasal Medium, RPMI 1640 medium, or MCDB 120 medium. The medium may contain serum or may be serum-free. In one embodiment, muscle stem cells are grown in DMEM with 10% FBS and differentiated to form muscle fibers in DMEM containing 2% horse serum, 5 μg / ml insulin, and transferrin.

[0151] Optionally, the harvested stem cells are maintained in culture for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more passages, optionally for 3 passages, prior to exposure to the LDR.

[0152] In other embodiments, the method further comprises administering the preconditioned stem cells to a subject in need thereof.

[0153] Preconditioned stem cell populations The present disclosure also provides a cell population (e.g., a cell culture) comprising stem cells exposed to LDR. In one embodiment, the cell population comprises preconditioned stem cells obtained by the method described herein. As used herein, the term "cell" refers to both a single cell and a plurality of cells. A "plurality of cells" may include a cell population.

[0154] Optionally, the preconditioned stem cells in the population can be preconditioned muscle stem cells. Alternatively, the preconditioned stem cells in the population can be mesenchymal stem / stromal cells and progenitor / cells, or endothelial colony-forming cells / endothelial stem and progenitor cells. In yet another example, the preconditioned cells in the population can be hematopoietic stem and progenitor cells. Optionally, the preconditioned stem cells can be human stem cells.

[0155] Pharmaceutical Composition Consistent with another broad aspect of the teachings described herein, pharmaceutical compositions may be made that include, as an active ingredient, preconditioned stem cells produced using the methods described herein, together with a suitable pharmaceutically acceptable carrier.

[0156] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in this field; which is incorporated herein by reference. Optional examples of such carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin.

[0157] A pharmaceutical composition may be formulated to be compatible with its intended route of administration, including parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (i.e., topical), transmucosal, and rectal administration.

[0158] The active ingredient may be prepared with a carrier that will protect the active ingredient from rapid elimination from the body (e.g., sustained / controlled release formulations, including implants and microencapsulated delivery systems). Biodegradable, biocompatible polymers can be used (e.g., ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, polylactic acid, and the like). Various methods for preparing such formulations will be apparent to those skilled in the art.

[0159] If necessary, oral or parenteral compositions may be formulated in dosage unit form for ease of administration and uniformity of dosage.As used herein, dosage unit form refers to a physically discrete unit suitable as a unitary dosage for the subject to be treated, each unit containing a predetermined amount of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.The specifications for dosage unit form are determined by and may depend on the unique characteristics of the active ingredient (i.e., preconditioned stem cells) and the specific therapeutic effect to be achieved, as well as the inherent limitations in the technology of preparing such active ingredients for the treatment of individuals.

[0160] The formulations may also contain more than one active ingredient as needed to treat a particular indication, and may optionally contain two or more active ingredients with complementary activities that do not adversely affect each other. Alternatively, or in addition, the pharmaceutical composition may contain an agent that enhances its function. Such molecules are preferably present in combination in amounts that are effective for the intended purpose.

[0161] Use of preconditioned stem cells A population of preconditioned stem cells can be obtained according to the methods described herein. Applications and uses of preconditioned stem cells can include, but are not limited to, maintaining stem cell properties during proliferation, differentiating stem cells into specific lineages (e.g., differentiating muscle stem cells into muscle fibers), and tissue regeneration. Differentiated lineages can be used for both in vitro and in vivo purposes.

[0162] The preconditioned stem cells and pharmaceutical compositions described herein may be useful for treating or preventing diseases or conditions. Some examples of diseases or conditions that can be treated using certain types of preconditioned stem cells, and optionally the preconditioned stem cells described herein, may include muscular dystrophy, sarcopenia, type 2 diabetes, septic shock, multiple sclerosis, knee osteoarthritis, acute graft-versus-host disease, heart failure, Crohn's disease, acute myocardial infarction, acute myocardial infarction, pulmonary hypertension, and critical limb ischemia.

[0163] Preferably, the disease or condition is one known to benefit from stem cell therapy, for example, the preconditioned muscle stem cells and pharmaceutical compositions described herein may be useful for treating or preventing muscle diseases or conditions.

[0164] The preconditioned muscle stem cells and pharmaceutical compositions described herein may optionally be used in methods for treating or preventing a muscle disease or condition, comprising administering to a subject in need thereof an effective amount of the preconditioned muscle stem cells or pharmaceutical compositions disclosed herein.

[0165] If desired, an effective amount of the preconditioned muscle stem cells or pharmaceutical compositions disclosed herein may be used to treat or prevent a muscle disease or condition.

[0166] Optionally, the muscle disease or condition can be a genetic disease (e.g., Duchenne muscular dystrophy or facioscapulohumeral muscular dystrophy). In another embodiment, the muscle disease or condition is an age-related muscle disease (e.g., sarcopenia). In another embodiment, the muscle disease or condition is muscle injury. In yet another embodiment, the muscle disease or condition is non-genetic or age-related (e.g., cachexia associated with cancer, renal failure, or chronic obstructive pulmonary disease, etc.).

[0167] As used herein, the term "subject" may include any suitable member of the animal kingdom, including, for example, mammals, particularly humans. For example, a subject may be a patient with a disease or condition (such as, for example, a muscle disease or condition).

[0168] Preconditioned stem cells can be autologous stem cells (ie, stem cells derived from the subject) or can be allogeneic stem cells (ie, stem cells not derived from the subject).

[0169] The effective amount of the preconditioned stem cells or pharmaceutical compositions of the present disclosure generally relates to the amount required to achieve a therapeutic goal. The effectiveness of the treatment may be determined in connection with any suitable method for diagnosing or treating the disease. Alleviation of one or more symptoms of the disease indicates that the preconditioned stem cells or pharmaceutical compositions may provide a clinical benefit.

[0170] As used herein, "treating or preventing" includes, but is not limited to, reversing, alleviating, or arresting the progression of a disease or condition, or a symptom or condition associated with a disease or condition. Preventing includes preventing the onset of a disease or condition, or a symptom or condition associated with a disease or condition, or preventing the worsening of the severity of a disease or condition, or a symptom or condition associated with a disease or condition. Thus, "treating or preventing a disease or condition" includes prophylactic treatment of a subject to prevent or reduce the occurrence or recurrence of a disease or condition, or a symptom or condition associated with a disease or condition, as appropriate.

[0171] Various methods for administering stem cells to a subject are known in the art. For example, the preconditioned stem cells or compositions described herein may be administered systemically or locally to a specific site or tissue of interest. In one embodiment, the preconditioned stem cells or compositions described herein are injected into a subject. In another embodiment, the preconditioned muscle stem cells are injected intramuscularly.

[0172] The preconditioned stem cells or compositions described herein may be used or administered in combination with another stem cell or cell therapy. In this manner, the preconditioned stem cells or compositions described herein may be used to enhance the therapeutic potential of non-irradiated cells.

[0173] Below are non-limiting examples of methods for preconditioning some examples of stem cells.

[0174] Example 1: Low doses of X-rays and gamma radiation have been shown to produce a variety of stimulatory effects at the cellular and organismal levels (collectively referred to as radiation hormesis or radiation homeostasis) [Calabrese, 2015; Calabrese, 2016; Baldwin and Grantham, 2015; Jolly and Meyer, 2009]. Previous results have demonstrated that low doses of radiation (LDR), specifically gamma radiation, can delay the onset of tumorigenesis in vivo [Mitchel et al., 2003; Mitchel, 1999] and suppress the age-related accumulation of DNA damage in vivo [Osipov et al., 2013]. Little is known about the effects of LDR on stem cells. The few studies that have examined the effects of LDR on stem cells have produced inconsistent results. We have discovered that the therapeutic properties of mouse and human muscle stem cells can be enhanced by preconditioning the muscle stem cells using LDR.

[0175] C2C12 mouse muscle myoblasts (a commonly used cell model in muscle stem cell biology) were used to study the effects of LDR on muscle stem cells. Results show that LDR exposure of C2C12 cells improves myofiber formation by these cells, and that the loss of this ability (which is routinely observed in long-term culture) is partially reversed as a result of LDR exposure of young cultures compared with non-irradiated controls.

[0176] method C2C12 mouse muscle stem cells These cells, also called myoblasts and originally derived from the hindlimb muscles of adult C3H mice, were purchased from ATCC. C2C12 myoblasts are an efficiently fused subclone of C2 myoblasts and have been widely used as a model for muscle differentiation in tissue culture and muscle stem cell biology. For growth, cells were maintained in Dulbecco's modified medium (4.5 g / L glucose) supplemented with 10% fetal bovine serum, 4 mM L-glutamine, and 1.5 g / L sodium bicarbonate, while not allowing the cell density to reach more than 80% confluency.

[0177] Culture of human biopsy-derived muscle stem cells Muscle biopsy-derived stem cells were purchased from the biotechnology company Lonza. To achieve exponentially growing cultures, cells were maintained in skeletal muscle basal medium supplemented with 20% FBS (fetal bovine serum), 4 mM L-glutamine, gentamicin, human EGF (epidermal growth factor), dexamethasone, and 1.5 g / L sodium bicarbonate, while not allowing the cell density to exceed 80% confluency.

[0178] long-term culture Muscle tissue regeneration is a continuous process that continues throughout the lifespan of an organism, involving multiple successive changes between a proliferative mode (myoblasts), differentiation and self-renewal, and a standby or reserve mode (Figure 1). To model this in vitro, C2C12 myoblasts (proliferative mode) can be stimulated to differentiate, self-renew, and then release self-renewing standby cells (also called reserve cells) and return to a proliferative mode (Yaffe and Saxel, 1997). These multiple changes represent an in vitro model of the exhausting myogenic potential of muscle stem cells (Figure 1). This decline may mimic the changes that occur in satellite cells under in vitro growth conditions. Reserve cells exhibit many classic characteristics of satellite cells (e.g., asymmetric stem cell divisions, greater expression of specification markers (e.g., Pax7), and differentiation potential). The functional properties of muscle stem cells that undergo multiple rounds of differentiation-proliferation may decline with each successive round. Reserve cells were obtained from differentiated myofiber cultures by performing differential enzymatic digestion.

[0179] Unlike the C2C12 myoblasts described herein, freshly isolated muscle stem cells derived from muscle biopsies may have a limited doubling capacity (10–12). Therefore, instead of performing preliminary cell isolation, muscle stem cells were maintained in growth medium for 14 days and differentiation medium for 3 days.

[0180] Differentiation of C2C12 muscle cells into muscle fibers Cultures grown to 80%-90% confluency in growth medium were washed twice with phosphate-buffered saline and incubated in differentiation medium (DM: DMEM containing 2% horse serum and antibiotics). DM was replaced daily until the end point was reached. Incubation in DM medium induces the differentiation process, an essential part of which is the fusion of myoblasts into multinucleated myofibers. By 72 hours of differentiation, approximately 50%-70% of myoblasts have fused into myofibers.

[0181] Differentiation of human muscle stem cells into muscle fibers Cultures grown to 80%–90% cell confluency in growth medium were washed twice with phosphate-buffered saline and incubated in differentiation medium (DM: 1:1 DMEM-F12 with 2% horse serum and antibiotics).

[0182] Radiation In this example, young C2C12 myoblasts were irradiated with 10 mGy or 100 mGy or sham irradiated. 60 Irradiation was performed using a Gamma-Cell 200 instrument equipped with a Co source. After irradiation, cells were maintained in culture for up to 90 days as described in the "Long-Term Culture" subsection (Figure 2). At 30, 60, and 90 days, cells were assayed for proliferation and differentiation endpoints.

[0183] Young human biopsy-derived muscle stem cells were irradiated with 10 mGy or 100 mGy of radiation or sham irradiation. 60 Irradiation was performed using a Gamma-Cell 200 instrument equipped with a Co source. After irradiation, cells were maintained in culture for up to 14 days as described in the "Long-Term Culture" subsection. At the end of 14 days, cells were transferred to differentiation medium to obtain myofibers and assayed for differentiation and fusion indices.

[0184] Myofiber differentiation assay Cultures on glass coverslips undergoing differentiation for various periods were fixed in 4% paraformaldehyde and immunolabeled overnight at 4°C with primary anti-MyH3 antibody (myosin heavy chain) diluted in PBS / 5% BSA solution. After washing, cells were incubated with a secondary antibody conjugated to Alexa Fluor 488 (Invitrogen-A11001). Prior to visualization, coverslips were fixed in mounting medium with DAPI (Vector Laboratories Inc. H-1500). Images were acquired at 40x magnification using a Zeiss Epifluorescence Observer Z1 microscope.

[0185] The fusion index was calculated using the following formula: l f =N 融合 / N 総数 ×100%, During the ceremony, N 融合 is the number of nuclei in myosin-positive cells (muscle fibers), N 総数 is the total number of nuclei scored.

[0186] In total, 500 nuclei were scored per sample.

[0187] Western blot Whole cell lysates were prepared from differentiated C2C12 myofibers as follows: Cell pellets were resuspended in 1 pellet volume of modified buffer C (20 mM Hepes (pH 7.6), 1.5 mM MgCl, 650 mM KCl, Benzonase (2.5 units / 10 7 The cells were resuspended in 0.2 mM PMSF, 0.5 mM DTT, 5 mM β-glycerol phosphate, and 1 mM sodium orthovanadate and centrifuged for 30 minutes at 4°C. The homogenate was then diluted with one pellet volume of Buffer E (20 mM Hepes (pH 7.6), 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM PMSF, 0.5 mM DTT, 5 mM β-glycerol phosphate, and 1 mM sodium orthovanadate). Extracted proteins were then recovered from the cells by centrifugation at 15,000 × g for 30 minutes at 4°C. The extracts were quantified for protein concentration prior to SDS-PAGE. Each quantified extract was loaded on a gradient polyacrylamide gel, separated, and transferred to a PVDF membrane for Western blot analysis. Antibodies were purchased from Santa Cruz Biotechnologies (MyoD, SC304; myogenin, SC12732; Myh3, SC53091; and tubulin, SC23948).

[0188] Quantitative RT-PCR Cell cultures were trypsinized and pellets obtained by centrifugation. RNA was isolated from cultured cells using Qiazol (Qiagen). Adherent cultures were washed once with cold PBS to remove residual PBS, and cells were scraped into Qiazol (4×10 6 1mL for 2x10 cells 6Lysates were vortexed vigorously to shear the genomic DNA and then stored at -70°C until further processing. RNA was purified according to the manufacturer's instructions (Invitrogen). Briefly, samples were thawed at room temperature for 5 minutes, 200 μL of chloroform per mL of Qiazol was added, vortexed vigorously for 30 seconds, and the phases were separated by centrifugation at 12,000 rpm. The RNA in the aqueous phase was carefully removed and processed using the RNeasy Mini Kit (Qiagen catalog #217004). Finally, the RNA was dissolved / eluted in nuclease-free water (Eppendorf) and examined for quality and quantity using a Nanodrop spectrophotometer and an Experion. 2.5 μg of total RNA was used to generate cDNA (RT first strand Kit, Qiagen catalog #330404). cDNA was diluted 1:5 in H2O and mixed with Sybr Green Master Mix (2x SYBR Biotool) and 2.5 pmoles of primers. Analysis was performed in triplicate using a 7900HT Sequence Detection Systems cycler (BioRad) and CFX Manager software. Primers used in quantitative RT-PCR were designed using Primer3 software and confirmed by BLAST (Basic Local Alignment Search Tool) analysis. The primer sequences used in this study are listed below. Myogenin forward, GGC TCA AGA AAG TGA ATG AGG C; myogenin reverse, CGA TGG ACG TAA GGG AGT GC; Myh3 forward, GCATAGCTGCACCTTTCCTC; Myh3 reverse, GGC CAT GTC CTC AAT CTT GT; TKS forward, CTT TGT GGG GAA GAT GCT CG; TKS5 reverse, TCC TTC TGG CCA CCT TCA AT; TMEM8C forward, GCT CCT ATG CAA AGA CTG GC; TMEM8C reverse, GGT CGA TCT CTG GGG TTC AT.

[0189] RNAseq Sixty-day-old mouse muscle (C2C12) cell cultures were trypsinized, and pellets were obtained by centrifugation. RNA was isolated and purified according to the manufacturer's instructions (Invitrogen) as described herein. The purified RNA was subsequently subjected to quality control. Five micrograms of RNA was used in library preparation, and 75-base pair single-sided sequencing was performed according to standard Illumina procedures for the NextSeq 500 genome sequencer. RNAseq data were analyzed using the Bowtie, Tophat2, and Cuffdiff (CuffLinks v1) software suites. Sequencing reads were mapped to the GRC m38 mouse genome assembly by HISAT2 (v2.0.4), guided by the GENCODE vm12 gene expression model. Differentially expressed genes were identified and quantified using Cuffdiff and datasets displayed as Venn diagrams. The functional relevance of differentially expressed genes in the LDR (10 mGy and 100 mGy) treated groups was interpreted using Gene Ontology (GO) pathway analysis software, which specifically considers biological processes (BPs).

[0190] statistical analysis All experiments, except RNAseq, were repeated three times from the tissue culture initiation and LDR exposure stages, so that biological replicates were represented. Mean values ​​from the three replicates were calculated. Statistical significance when comparing groups was determined by Student's t-test at P < 0.05.

[0191] result LDR improves the potential of C2C12 cells to differentiate into muscle fibers We assessed the potential of C2C12 myoblasts to form myofibers at various time points during long-term culture experiments and how this potential can be affected by LDR. The ability to form myofibers represents an important functional characteristic of muscle stem cells. This ability can be reliably measured experimentally by maintaining myoblasts under differentiation-inducing growth conditions for several days and then quantifying the percentage of myoblasts that become part of newly formed myofibers. This measurement is performed by immunofluorescence microscopy, where myofibers are stained with MyH3 and nuclei within fibers are quantified relative to the total number of nuclei (Figure 3). The resulting percentage of nuclei that are part of myofibers is referred to as the fusion index.

[0192] In control, nonirradiated cultures, the fusion index (i.e., control fusion index) was found to decline dramatically in a time-dependent manner from 50% in young cells to less than 3% in 90-day-old cells (Figure 3). If myoblasts were irradiated with 10 mGy or 100 mGy at the beginning of the culture experiment, the decline in fusion index was less pronounced than in nonirradiated cultures. The fusion index (i.e., fusion index at treatment) was increased in both 10 mGy- and 100 mGy-irradiated cells compared with control cells at 30, 60, and 90 days (Figure 3). Exposure of young myoblasts to LDR delayed their functional decline, resulting in a 2- to 5-fold increase in their potential to form myofibers at advanced culture ages.

[0193] In this example, the treatment fusion index was consistently greater than the aged fusion index (shown as the UT bar in Figure 3) at each of the threshold culture age measurement points (30, 60, and 90 days in this example), in some cases being at least twice the aged fusion index and having values ​​of at least 10%, 20%, 30%, or more of the initial fusion index.

[0194] LDR improves the potential of human muscle stem cells to differentiate into muscle fibers In addition to mouse muscle myoblasts, experiments were also performed on stem cells derived from human muscle biopsies. When these muscle stem cells were irradiated to form irradiated cultures, the fusion index of the irradiated cultures (i.e., the treatment fusion index) was found to be greater than the fusion index of control cultures containing untreated / non-irradiated muscle stem cells (i.e., the control fusion index). For example, referring to Figures 7A and 7B, as illustrated in Figure 7A, when muscle stem cells were irradiated with 10 mGy or 100 mGy at the start of the experiment, and the cells were aged in culture for 14 days and then differentiated for 3 days, the irradiated cultures exhibited a fusion index that was approximately 2.5-fold increased compared to untreated (non-irradiated) control stem cells (e.g., as shown in Figure 7B). In the illustrated example, the treatment fusion index was greater than the aging fusion index, exceeding approximately 70% of the initial fusion index (control) for both the 10 mGy and 100 mGy radiation doses.

[0195] Mechanism by which muscle identity is longer maintained in LDR-exposed myoblasts To investigate whether the enhanced myofiber formation in advanced-age cultures of LDR-exposed myoblasts was due to the classical muscle differentiation pathway, several classical markers of terminal differentiation were quantified by Western blot analysis in total protein extracts. These were myogenin, Myh3 (myosin heavy chain), and MyoD. Myogenin and Myh3 showed a similar decrease during long-term culture in the control group, whereas a significant increase in these protein levels was found in irradiated cells (Figure 4A, compare 60 and 90 days for the 10 mGy and 100 mGy groups with age-matched controls).

[0196] In this example, the preconditioned stem cells can achieve greater confluency after a given time (in this case, 10 hours) than untreated cells (for the first sample, the maximum increase in confluency observed was from 67.9% (untreated) to 78.6% (treated)). For the second sample, the maximum increase was from 61.9% (untreated) to 77.2% (treated). That is, treated stem cells may require less time to reach a given target confluency and / or may reach a greater level of confluency than comparable untreated cells at each time.

[0197] These observations were confirmed in an independent experiment in which 60-day-old cultures were allowed to differentiate and the expression of several genes that are markers of differentiation and fusion was assessed by quantitative RT-PCR (see, e.g., Figure 4B).

[0198] Additionally, and also see Figure 5, global gene expression analysis using RNAseq of mouse muscle cells at day 60 reinforced these previous observations. Mouse muscle cells irradiated with 10 mGy and 100 mGy showed improved markers of differentiation and fusion when compared to non-irradiated controls, as shown, for example, in Table 1. [Table 1]

[0199] The gene list obtained from the data analysis suggests an improvement in myofibrillogenesis. The majority of genes differentially expressed at 10 mGy and 100 mGy have critical functions in differentiation, muscle tissue development, skeletal muscle fiber formation, and muscle contraction, as shown in Figures 6A and 6B, respectively.

[0200] Consideration Retention of C2C12 myoblast potency typically declines with time / cell age in culture and with the number of differentiation cycles. However, using the methods described herein, retention of C2C12 myoblast potency is enhanced by exposing the cultures to LDR. The observed 2.5-fold improvement in human muscle stem cell differentiation highlights at least part of the beneficial effect of low-dose radiation in stem cell preconditioning (Figure 7). Notably, the limited doubling potential of human muscle stem cells was the basis for limiting the described culture to 14-17 days, rather than the extended 90 days required for immortal C2C12 mouse muscle cells.

[0201] In this example, LDR (10 mGy or 100 mGy) was found to improve the differentiation capacity of C2C12 cultures exposed to multiple cycles of growth->differentiation->pre-cell fractionation. A decrease (16-fold) in the fusion index of control, non-irradiated cells was found with the length of culture or the number of differentiations. This decrease was partially reversed when cells were exposed to LDR on day 7 of culture. Notably, the magnitude of improvement increased over time (from approximately 50% at 30 days to over 300% at 90 days, Figure 3B). This indicates that the effects of LDR exposure can be maintained over long periods of time.

[0202] However, next-generation gene expression sequencing performed on 60-day-old mouse muscle cells not only showed induction of myogenic markers in 10 mGy and 100 mGy-treated cells, but also several classes of genes involved in myofiber formation, muscle tissue development, and muscle cell migration, which are required for myogenic fusion and maturation, as shown in Figure 5 and also in Figures 6A and 6B.

[0203] We further confirmed that classical markers of myogenic differentiation were increased in cultures exposed to LDR compared with non-irradiated controls, suggesting that LDR can induce molecular changes that ultimately converge on the classical pathway of myofiber formation. Without being bound by theory, we suspect that these changes may include mechanisms for maintaining muscle stem cell identity. For example, regulation of myogenic differentiation-specific gene expression by histone H3.3 variants may be one such mechanism [Ng and Gurdon, 2008]. This possibility is consistent with reports showing that LDR can induce epigenetic chromatin remodeling (reviewed in [Miousse et al., 2017]).

[0204] The decline in differentiation potential in control cultures was not accompanied by a change in myoblast proliferation rate. No evidence was found that proliferation rate was affected by LDR exposure. Without being bound by theory, the inventors believe this may further suggest that the improvement in differentiation potential may have been due to qualitative changes in long-term culture that allowed for increased retention of muscle identity.

[0205] The observed effects may have various implications for stem cell-based therapies for muscle diseases. One current limitation of such therapeutic approaches is the need to expand muscle stem cells, either in ex vivo culture of patient-derived muscle stem cells or in vitro culture of muscle stem cells generated by directed differentiation from hES or ihPS cells. Preconditioning cells in such cultures using LDRs may help enhance the retention of myogenic functional properties that are otherwise negatively affected by long-term culture conditions. This may help improve overall therapeutic efficacy. LDRs have been shown to improve the retention of muscle-specific identity in C2C12 mouse myoblasts subjected to multiple rounds of growth, differentiation, and preliminary cell isolation. Such improvements may find broad use in regenerative medicine, specifically in future stem cell-based therapies for various muscle diseases.

[0206] Example 2: Consistent with another broad aspect of the teachings described herein, the effects of LDR on mesenchymal stem cells and endothelial stem cells were investigated according to the methods described herein.

[0207] Materials and Methods cell culture In this example, umbilical cord blood (UCB)-derived mesenchymal stromal / stem and progenitor cells (MSPCs) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) and expanded in UCB mesenchymal stem cell (MSC) growth medium (#PCS-500-030 and PCS-500-040, ATCC) according to the manufacturer's instructions. Endothelial colony-forming cells (ECFCs) were obtained from fresh umbilical cord blood units (Canadian Blood Services, Ottawa, ON, Canada) following an approved ethical protocol (Veritas Independent Research Board). Umbilical cord blood was processed using a Ficoll-Paque Plus density separation gradient (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) to obtain mononuclear cells (MNCs). MNCs were plated onto CellBind-coated 6-well plates (#3335, Corning, NY, USA) and supplemented with ECFC growth medium (#CC-3162, Lonza Group Ltd., Basel, Switzerland). The medium was changed every 2–3 days. All cells were allowed to adhere and expanded at 37°C in a standard humidified CO2 incubator.

[0208] When 80% cell confluency was achieved for MSPC cultures and visible confluent endothelial colonies appeared in ECFC cultures, cells were passaged (p1). Individual ECFC colonies / clones were passaged separately using glass rings coated with DOW Corning high-vacuum grease (DOW Corning Corporation, Midland, MI, USA) and seeded into individual wells of 6-well plates at 2.5 × 10 cells / cm and further expanded to p2 and p100 at p3–p4. Passaged MSPCs were replated onto p100 plates at 3.0 × 10 cells / cm and expanded to p2–p4. On p4, all cells were acutely irradiated with 0, 10, 50, and 100 mGy of gamma rays using a Gamma Cell 200 cell irradiator (Atomic Energy of Canada Ltd., Chalk River, ON, Canada), and the cells were aged in culture. Three different clones (3-2, 3-3, and 13), representing biological replicates, were used in ECFC experiments. Experiments were performed at least in duplicate.

[0209] functional analysis Aging was defined in this case as a gradual decline in the proliferation capacity (function) of cultured cells. The passage at which a cell culture was considered "aged" differed for MSPC and ECFC clones: p15 for MSPC, p5 for ECFC clone 3-2, p8 for ECFC clone 13, and p11 for ECFC clone 3-3. Growth curves for cell cultures were generated based on percent cell confluency measurements performed using an Incucyte instrument (Essen Bioscience, Inc., Ann Arbor, Michigan, USA). Using the Incucyte, images of cells were taken every hour of cell culture at each passage using 4x and 10x objectives. Cell proliferation was typically measured as the doubling time in the linear portion of the cell growth curve between 20% and 80% cell confluency. The following formula was used to calculate doubling time: (t2-t1) / (3.32×(log n2-log n1)), in the formula t2 - final time point t1 - initial time point Cell count / cell confluency at n1-t1 Cell count / cell confluency at n2-t2

[0210] ECFC cell migration was measured using a scratch wound assay and cell migration kit (#4493, Essen Bioscience) according to the manufacturer's instructions. Briefly, cells were seeded into specialized 96-well plates at 90%–100% confluency and allowed to adhere. All wells in the plate were scratched using a specially designed wound maker, which allowed consistent scratches to be made while minimizing well-to-well variability. Plates were placed in an Incucyte instrument and monitored for 24 hours, with images taken every hour using a 10x objective. Migration analysis was based on two measurements: 1) the amount of time required for the wound to "heal" to 60% confluency and 2) the confluency of the wound at 10 hours after scratching. All values ​​were expressed relative to non-irradiated cells at p4. This assay was performed with five replicates on two clones (3-2 and 3-3) representing aged cells p6 and p13, respectively.

[0211] Aged MSPCs were differentiated along the chondrogenic lineage for 14 days using a human MSC differentiation kit (#SC006, R&D System Inc., Minneapolis, MN, USA) according to the manufacturer's instructions. Briefly, p5 and p15 cells were pelleted by centrifugation and differentiated with fresh medium changes every 2–3 days. The chondrocyte pellets were sectioned at 10 μm using a cryostat (CM3050, Leica Biosystems Inc., Concord, ON, Canada) and fluorescently stained with anti-aggrecan antibody. Aggrecan is a protein specifically produced in chondrocytes and serves as a marker for chondrocyte differentiation. Images of pellet sections were captured using an Evos FL fluorescence microscope (Thermo Fisher Scientific, Waltham, MA, USA) with a 10x objective. Fluorescent staining was quantified using ImageJ software (ImageJ v.1.52b, National Institutes of Health, USA; http: / / imagej.nih.gov / ij), which measures the raw integrated intensity of every pixel in the image. All values ​​were normalized to p5 untreated controls, and experiments were performed in duplicate.

[0212] statistical analysis All values ​​were plotted against untreated (UT) early passage (p4 or p5) cells. Treated aged groups were compared to untreated aged controls at the same passage, and significance was determined using a paired one-tailed Student's t-test, with p<0.5 indicating a significant change.

[0213] Results and Discussion Delayed aging of cells exposed to low doses of radiation To examine the effect of LDR on stem cell aging in culture, images of untreated and irradiated cell cultures were taken hourly for each passage, and the percent cell confluency of the cell monolayer was measured. These values ​​were used to generate growth curves and determine cell doubling times as described in Materials and Methods. Figure 8A shows the change in MSCP doubling time as the MSCP ages from p4 to p15, with a relatively significant decrease in proliferation observed at p14-p15. Similar observations were made for ECFCs. Figure 9A depicts the aging process of ECFC clone 13. Interestingly, when MSPCs and ECFCs are irradiated at early passages and allowed to age in culture, the aging process is delayed. Figures 8B and 9B reveal a delay in aging for MSPCs and ECFCs, respectively, as measured by the decreased doubling time for the irradiated group versus the untreated control.

[0214] Increased functional capacity of MSPCs as measured by increased chondrogenic differentiation One of the defining characteristics of mesenchymal stem / stromal cells is their ability to differentiate into cells of the skeletal lineage (e.g., chondrocytes). To examine the effects of LDR on changes in the functional capacity of MSPCs, we differentiated pre-irradiated passage 5 and passage 15 cells at p4 along the chondrogenic lineage. After 14 days of differentiation, chondrocyte pellets were sectioned and stained for aggrecan, and the amount of staining was quantified. The amount of staining is shown in Figure 10A. The differentiation potential of p15 cells was compared to that of young MSPCs at p5. Compared to untreated young controls, untreated aged cells showed an approximately 2-fold decrease in chondrogenic differentiation. However, when treated with LDR, aged cells maintained and even improved their differentiation potential (e.g., 10 mGy condition). Representative images of chondrocyte pellet sections for the aged UT group and the aged 10 mGy group are shown in Figure 10B.

[0215] Increased functional capacity of low-dose irradiated ECFC cells as measured by enhanced migration To evaluate the effect of LDR on the functional capacity of ECFCs, a cell migration assay was performed. One of the most important functional attributes of endothelial stem cells is their ability to migrate / migrate to sites of tissue injury and repair vascular networks. To examine the migration capacity of ECFCs, a scratch wound assay was performed using untreated aged ECFCs and irradiated aged ECFCs. All values ​​were expressed relative to young (i.e., non-aged) untreated (i.e., non-irradiated) controls. Two separate measurements were performed as described in the Materials and Methods section. Figure 11A shows the relative percent cell confluency of the wound 10 hours after scratching, and Figure 11B summarizes the relative time required for cells to reach 60% cell confluency within the wound. It is clear from both graphs that aged cells demonstrate reduced migration when compared with young cells. For example, aged cells were approximately 70% as efficient as young cells in reaching confluency and took approximately 1.8 times longer to close the wound. However, although aged irradiated cells did not perform as well as young cells, they still maintained most of their migratory capacity. Thus, Figure 11 demonstrates the delayed aging capacity of irradiated ECFCs when expanded in culture, as evidenced by a significant increase in their migratory capacity when compared to untreated controls.

[0216] While the present invention has been described with reference to illustrative embodiments and examples, the description is not intended to be construed in a limiting sense. As such, various modifications of the illustrative embodiments, as well as other embodiments of the invention, will become apparent to those skilled in the art upon reference to this description. It is therefore intended that the appended claims shall cover any and all such modifications or embodiments. The present invention also includes the following preferred embodiments. (1) 1. A method of preconditioning stem cells, comprising: The method comprises: a) providing a sample containing a plurality of target stem cells; b) irradiating the target stem cells with a first dose of radiation emitted from a radiation source during a radiation exposure period to convert the target stem cells into irradiated preconditioned stem cells that are suitable for use in a subsequent therapeutic treatment process. The above method comprising: (2) The method according to (1), wherein irradiating the target stem cells reduces age-related decline in at least a first cell function of each of the target stem cells. (3) The method of (2), wherein the first cell function has an initial performance value, defines an aged performance value at a threshold aging time, and the preconditioned stem cells have a treatment performance value at a threshold aging time that is between the aged performance value and the initial performance value. (4) The method according to (2), wherein the treated performance value is closer to the initial performance value than the aged performance value. (5) The method of any one of (1) to (4), wherein the target stem cells each have a second initial performance value and include a second cell function defining a second aged performance value at a second threshold aging time, and the preconditioned stem cells have a second treatment performance value at a second threshold aging time that is between the second aged performance value and the second initial performance value. (6) The method of (5), wherein the second threshold aging time is different from the first threshold aging time. (7) The method of (5) or (6), wherein the second treatment performance value is closer to the second initial performance value than the second aged performance value. (8) The method according to any one of (3) to (7), wherein at least one of the threshold aging time and the second threshold aging time is determined by the completion of a threshold number of cell passages. (9) The method according to any one of (1) to (8), wherein the threshold number of cell passages exceeds four. (10) The method according to any one of (1) to (9), wherein the threshold number of cell passages is between 4 and 23. (11) The method according to any one of (3) to (10), wherein at least one of the threshold aging time and the second threshold aging time is determined by the elapsed time in cell culture. (12) The method according to any one of (1) to (11), wherein the target stem cells comprise muscle stem cells, the first cell function is cell fusion, the initial performance value comprises an initial fusion index, the aged performance value comprises an aged fusion index, and the treatment performance value comprises a treatment fusion index. (13) The method according to (12), wherein the fusion index at the time of treatment is greater than the fusion index at the time of aging. (14) The method according to (12) or (13), wherein the fusion index at the time of treatment is at least twice the fusion index at the time of aging. (15) The method according to any one of (12) to (14), wherein the fusion index upon treatment exceeds 50%. (16) The method according to any one of (12) to (15), wherein the fusion index upon treatment exceeds 60%. (17) The method according to any one of (12) to (16), wherein the fusion index upon treatment exceeds 70%. (18) The method according to any one of (12) to (17), wherein the preconditioned stem cells exhibit increased differentiation into muscle fibers compared to non-irradiated target stem cells. (19) The method according to any one of (12) to (18), wherein the preconditioned stem cells have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c, compared to non-irradiated target stem cells. (20) The method according to any one of (1) to (19), wherein the target stem cells comprise mesenchymal stem cells, the first cell function is proliferation, the initial performance value comprises an initial doubling time, the aged performance value comprises an aged doubling time, and the treatment performance value comprises a treatment doubling time. (21) The method according to (20), wherein the doubling time during treatment is less than the doubling time during aging. (22) The method according to any one of (20) to (21), wherein the doubling time during treatment is less than 50% of the doubling time during aging. (23) The method according to any one of (20) to (22), wherein the doubling time during treatment is less than three times the initial doubling time. (24) The method according to any one of (20) to (23), wherein the threshold number of cell passages is between 12 and 15. (25) The method according to any one of (20) to (24), wherein the threshold number of cell passages is 14 or 15. (26) The method according to any one of (20) to (25), wherein the threshold number of cell passages is 15. (27) The method according to any one of (20) to (26), further comprising a second cell function which is chondrogenic differentiation, a second initial performance value including initial differentiation ability, a second aging performance value including aging differentiation ability at a second threshold aging time, and a second treatment performance value including treatment differentiation ability at a second threshold aging time. (28) The method according to any one of (1) to (27), wherein the target stem cells comprise mesenchymal stem cells, the first cell function is chondrogenic differentiation, the initial performance value comprises initial differentiation capacity, the aging performance value comprises aging differentiation capacity, and the treatment performance value comprises treatment differentiation capacity. (29) The method according to (28), wherein the differentiation ability during treatment is greater than the differentiation ability during aging. (30) The method according to any one of (28) to (29), wherein the differentiation ability during treatment is greater than the initial differentiation ability. (31) The method according to any one of (28) to (30), wherein the differentiation ability upon treatment is at least 60% of the initial differentiation ability. (32) The method according to any one of (28) to (31), wherein the differentiation ability during treatment is at least 150% of the differentiation ability during aging. (33) The method according to any one of (28) to (32), wherein the difference between the differentiation ability upon treatment and the initial differentiation ability is smaller than the difference between the differentiation ability upon aging and the initial differentiation ability. (34) The method according to any one of (1) to (33), wherein the target stem cells comprise endothelial stem cells, the first cell function is proliferation, the initial performance value comprises an initial doubling time, the aged performance value comprises an aged doubling time, and the treatment performance value comprises a treatment doubling time. (35) The method according to (34), wherein the doubling time during treatment is less than the doubling time during aging. (36) The method according to (34) or (35), wherein the doubling time during treatment is shorter than the doubling time during aging. (37) The method according to any one of (34) to (36), wherein the threshold aging time is defined by a threshold number of cell passages between 5 and 8. (38) The method according to (37), wherein the threshold number of cell passages is 7 or 8. (39) The method according to any one of (37) to (38), wherein the threshold number of cell passages is at least 5. (40) The method of any one of (34) to (39), further comprising a second cellular function being migration, a second initial performance value comprising an initial time to achieve a predetermined cellular confluency, a second aged performance value comprising an aged time to achieve the predetermined cellular confluency at a second threshold time, and a second on-treatment performance value comprising an on-treatment time to achieve the predetermined cellular confluency at a second threshold time. (41) The method according to (40), wherein the predetermined cell confluency is at least 60%. (42) The method according to (41) or (42), wherein the treatment time required to achieve a predetermined cell confluency is less than the aging time required to achieve the predetermined cell confluency. (43) The method according to any one of (40) to (42), wherein the treatment time to achieve the predetermined cell confluency is between about 1.4 and 1.8 times the initial time to achieve the predetermined cell confluency. (44) The method of any one of (1) to (43), wherein the target stem cells comprise endothelial stem cells, the cell function comprises migration, the initial performance value comprises an initial time to achieve a predetermined cell confluency, the aging performance value comprises an aging time to achieve a predetermined cell confluency, and the treatment performance value comprises a treatment time to achieve a predetermined cell confluency. (45) The method according to (44), wherein the predetermined cell confluency is at least 60%. (46) The method according to (44) or (45), wherein the treatment time required to achieve a predetermined cell confluency is less than the aging time required to achieve the predetermined cell confluency. (47) The method according to any one of (44) to (46), wherein the treatment time to achieve the predetermined cell confluency is between about 1.4 and 1.8 times the initial time to achieve the predetermined cell confluency. (48) The method according to any one of (1) to (47), wherein the target stem cells are human stem cells. (49) The method according to any one of (1) to (47), wherein the target stem cells are mouse stem cells. (50) The method according to any one of (1) to (49), wherein the radiation includes ionizing radiation. (51) The method according to any one of (1) to (50), wherein the radiation comprises low linear energy transfer (LET) ionizing radiation. (52) The method according to any one of (1) to (51), wherein the radiation comprises at least one of gamma radiation and X-ray radiation. (53) The method according to any one of (1) to (52), wherein the radiation includes gamma radiation. (54) The method of any one of (1) to (53), wherein the first dose of radiation comprises between about 1 mGy and about 500 mGy of radiation. (55) The method of any one of (1) to (54), wherein the first dose of radiation comprises between about 2 mGy and about 200 mGy of radiation. (56) The method of any one of (1) to (55), wherein the first dose of radiation comprises between about 10 mGy and about 150 mGy of radiation. (57) The method of any one of (1) to (56), wherein the first dose of radiation comprises between about 10 mGy and about 100 mGy of radiation. (58) The method according to any one of (1) to (57), wherein the first dose of radiation is about 10 mGy. (59) The method according to any one of (1) to (58), wherein the first dose of radiation is about 50 mGy. (60) The method according to any one of (1) to (59), wherein the first dose of radiation is about 100 mGy. (61) The method according to any one of (1) to (60), wherein the target stem cells are irradiated while in vitro. (62) The method according to any one of (1) to (61), wherein the target stem cells are irradiated ex vivo. (63) The method according to any one of (1) to (62), further comprising using the preconditioned stem cells in a subsequent treatment process. (64) 63. The method of claim 63, further comprising administering the preconditioned stem cells to a subject in need thereof. (65) The method according to (63), wherein the subject is a human. (66) The method according to any one of (63) to (65), wherein the subject has a muscular disease. (67) A population of preconditioned stem cells obtained by using the method according to any one of (1) to (66). (68) 67. The population of (67), wherein the preconditioned stem cells comprise muscle stem cells and exhibit increased differentiation into muscle fibers at a threshold aging time when compared to target stem cells that have not been exposed to LDR. (69) 68. The population of (68), wherein the preconditioned muscle stem cells have increased expression of at least one marker selected from the group consisting of myogenin, MyH3, MyoD, TKS5, and TMEM8c compared to muscle stem cells that have not been exposed to LDR. (70) A pharmaceutical composition comprising preconditioned stem cells obtained by using the method according to any one of (1) to (66) above, and a carrier. (71) A method for treating a muscle disease, comprising administering preconditioned stem cells obtained by using the method according to any one of (1) to (66) to a subject in need thereof. (72) Use of preconditioned stem cells prepared according to the method of any one of (1) to (66) for treating a muscle disease in a subject in need thereof.

[0217] All publications, patents, and patent applications referenced herein are incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference in its entirety. JPEG0007784401000002.jpg215143 JPEG0007784401000003.jpg229143 JPEG0007784401000004.jpg168143

Claims

1. 1. A method of preconditioning stem cells, comprising: The method comprises: a) providing a sample containing a plurality of target stem cells; b) irradiating the target stem cells with a first dose of radiation emitted from a radiation source during a radiation exposure period to convert the target stem cells into irradiated preconditioned stem cells that are suitable for use in a subsequent therapeutic treatment process. Including, the target stem cells comprise umbilical cord blood (UCB)-derived mesenchymal stem cells; the first dose of radiation comprises between 10 mGy and 100 mGy of radiation; and Irradiating the target stem cells reduces age-related decline in at least a first cellular function of each target stem cell; method.

2. 2. The method of claim 1, wherein the first cell function has an initial performance value and defines an aged performance value at a threshold aging time, and the preconditioned stem cells have a processed performance value at the threshold aging time that is between the aged performance value and the initial performance value.

3. 10. The method of claim 1, wherein the treated performance value is closer to the initial performance value than the aged performance value.

4. 4. The method of claim 1, wherein the target stem cells each have a second initial performance value and include a second cell function defining a second aged performance value at a second threshold aging time, and the preconditioned stem cells have a second treatment performance value at a second threshold aging time that is between the second aged performance value and the second initial performance value.

5. The method of claim 4 , wherein the second threshold aging time is different from the first threshold aging time.

6. 6. The method of claim 4 or 5, wherein the second treated performance value is closer to the second initial performance value than the second aged performance value.

7. The method of any one of claims 2 to 6, wherein at least one of the threshold aging time and the second threshold aging time is determined by the completion of a threshold number of cell passages.

8. The method of any one of claims 1 to 7, wherein the threshold number of cell passages is greater than 4.

9. The method of any one of claims 1 to 8, wherein the threshold number of cell passages is between 4 and 23.

10. The method of any one of claims 2 to 9, wherein at least one of the threshold aging time and the second threshold aging time is determined by time elapsed in cell culture.

11. A method according to any one of claims 1 to 10, wherein the first cell function is proliferation, the initial performance value comprises an initial doubling time, the aged performance value comprises an aged doubling time, and the treatment performance value comprises a treatment doubling time.

12. 12. The method of claim 11, wherein the doubling time during treatment is less than the doubling time during aging.

13. 13. The method of claim 11 or 12, wherein the doubling time during treatment is less than 50% of the doubling time during aging.

14. 14. The method of any one of claims 11 to 13, wherein the doubling time during treatment is less than three times the initial doubling time.

15. The method according to any one of claims 11 to 14, wherein the threshold number of cell passages is between 12 and 15.

16. The method of any one of claims 11 to 15, wherein the threshold number of cell passages is 14 or 15.

17. The method of any one of claims 11 to 16, wherein the threshold number of cell passages is 15.

18. 18. The method of any one of claims 11 to 17, further comprising a second cell function being chondrogenic differentiation, a second initial performance value comprising an initial differentiation potential, a second aged performance value comprising an aged differentiation potential at a second threshold aging time, and a second treated performance value comprising a treated differentiation potential at a second threshold aging time.

19. A method according to any one of claims 1 to 18, wherein the first cell function is chondrogenic differentiation, the initial performance value comprises initial differentiation capacity, the aged performance value comprises aged differentiation capacity, and the treated performance value comprises treated differentiation capacity.

20. The method of claim 19, wherein the differentiation ability upon treatment is greater than the differentiation ability upon aging.

21. 21. The method of claim 19 or 20, wherein the differentiation ability upon treatment is greater than the initial differentiation ability.

22. The method according to any one of claims 19 to 21, wherein the differentiation potential upon treatment is at least 60% of the initial differentiation potential.

23. The method according to any one of claims 19 to 22, wherein the differentiation potential during treatment is at least 150% of the differentiation potential during aging.

24. The method according to any one of claims 19 to 23, wherein the difference between the differentiation ability upon treatment and the initial differentiation ability is smaller than the difference between the differentiation ability upon aging and the initial differentiation ability.

25. The method of any one of claims 1 to 24, wherein the target stem cells are human stem cells.

26. The method of any one of claims 1 to 24, wherein the target stem cells are mouse stem cells.

27. The method of any one of claims 1 to 26, wherein the radiation comprises ionizing radiation.

28. 28. The method of any one of claims 1 to 27, wherein the radiation comprises low linear energy transfer (LET) ionizing radiation.

29. The method of any one of claims 1 to 28, wherein the radiation comprises at least one of gamma radiation and X-ray radiation.

30. 30. The method of any one of claims 1 to 29, wherein the radiation comprises gamma radiation.

31. 31. The method of any one of claims 1 to 30, wherein the first dose of radiation is 10 mGy.

32. 31. The method of any one of claims 1 to 30, wherein the first dose of radiation is 50 mGy.

33. 31. The method of any one of claims 1 to 30, wherein the first dose of radiation is 100 mGy.

34. The method of any one of claims 1 to 33, wherein the target stem cells are irradiated while in vitro.

35. The method of any one of claims 1 to 33, wherein the target stem cells are irradiated while ex vivo.

36. A pharmaceutical composition comprising the preconditioned stem cells of any one of claims 1 to 35.

37. 37. The pharmaceutical composition of claim 36, wherein the preconditioned stem cells are administered to a subject in need thereof.

38. 38. The pharmaceutical composition of claim 37, wherein the subject is a human.

39. 39. The pharmaceutical composition of claim 37 or 38, wherein the subject has a muscle disorder.

40. A population of preconditioned stem cells according to any one of claims 1 to 35.

41. A pharmaceutical composition comprising the preconditioned stem cells of any one of claims 1 to 35 and a carrier.

42. A pharmaceutical composition for treating a muscle disease, comprising the preconditioned stem cells according to any one of claims 1 to 35.

Images