Method for treating methane fermentation residue

Abstract

To provide a processing method of methane fermentation residue capable of stable processing of a digestion supernatant liquid which has been separated from a fermentation residue processed by a methane fermentation process into a solid matter and a liquid, e.g., target water containing a 50 mg / L or over of a polymeric organic matter having a molecular weight of 1,000-100,000 by an Anammox processing while suppressing decrease in an activity.SOLUTION: In a processing method of methane fermentation residue, a digestion supernatant liquid which has been separated from a fermentation residue processed by a methane fermentation process into a solid matter and a liquid, is subjected to an anaerobic ammonia oxidation treatment by using a sludge where Anammox bacterium occupies 8% or over of a total prokaryotic organism and having an abundance ratio of Candidatus Kuenenia sp. to Candidatus Brocadia sp. in the Anammox bacterium of 1-fold or over.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] The present invention relates to a method for treating methane fermentation residue, and more particularly to a technology for treating fermentation residue generated when organic slurry is subjected to wet methane fermentation treatment using an anaerobic ammonium oxidation (anammox) process. [Background technology]

[0002] Anaerobic digestion fermentation residue contains high concentrations of ammonia nitrogen (500-6000 mg-N / L). Therefore, when disposing of fermentation residue, solid-liquid separation is performed in a dewatering process to remove nitrogen before discharging it into rivers or sewerage systems. Nitrification-denitrification is often used for nitrogen removal, but because the dewatered filtrate from anaerobic digestion fermentation residue has a low C / N ratio, organic matter such as methanol is added as an external carbon source. This increases the cost of methanol and other materials. In addition, the cost of aeration power for nitrification is high.

[0003] The Anammox process is a biological nitrogen removal method that differs from conventional nitrification and denitrification, and has the advantages of not requiring the addition of an organic carbon source and reducing aeration power by approximately 50%.

[0004] The anammox reaction is carried out by anammox bacteria. Anammox bacteria belong to the Planctmycetes class in phylogenetic classification based on the 16S rRNA gene, and the genera Candidatus Brocadia, Candidatus Kuenenia, Candidatus Jettenia, Candidatus Anammoxoglobus, and Candidatus Scalindua are known to date. Of these, freshwater anammox bacteria are the genera Candidatus Brocadia, Candidatus Kuenenia, Candidatus Jettenia, and Candidatus Anammoxoglobus, with the Candidatus Brocadia genus often dominating in wastewater treatment plants.

[0005] The Anammox process has been mainly applied to the treatment of return water from sewage treatment plants (dewatered filtrate from sludge digestion liquid). Sludge digestion at sewage treatment plants generally involves concentrating the sludge from the final settling tank and the final settling tank to a total solids (TS) of 1-5% (10,000-50,000 mg / L) through a concentration process, and then treating it by wet methane fermentation. The excess sludge at the inlet to the methane fermentation tank has a high organic content, with a volatile solids (VS) ratio of 0.7-0.9, and the methane gas generation rate is 0.22-0.36 Nm 3 The digested liquid from the methane fermentation tanks at such sewage treatment plants is sometimes separated into solids and liquids using a dehydrator, and the anammox process is applied to this dehydrated filtrate. In most cases, the anammox bacteria are predominantly Candidatus and Brocadia, and the sludge activity is 0.2 to 0.7 kg-N / kg-VS / d.

[0006] On the other hand, the organic matter concentration for methane fermentation is high at VS6% to 15%, and the methane gas generation rate is 0.22 to 0.8 Nm3, which is equal to or greater than that of excess sludge from sewage treatment plants. 3 When an organic slurry containing 1000 sulphuric acid / g-VS is subjected to methane fermentation and the anammox process is applied to the dehydrated filtrate from the fermentation residue, anammox activity (the activity of anammox bacteria) decreases, ultimately reaching 0.2 kg-N / kg-VS / d or less. When methane fermentation is performed on organic slurry with a high organic matter concentration and decomposition rate, the concentration of soluble, persistent organic matter in the digester fluid increases, and it is thought that there are substances among these that affect anammox activity. While there have been reports that humic acid and fulvic acid inhibit anammox activity, the specific inhibitors in the dehydrated filtrate from methane fermentation have not been clarified. In such cases, the dehydrated filtrate must be diluted with tap water or industrial water to adjust the concentration. This increases the amount of dilution water and discharged water, reducing the cost benefits of the anammox process. [Prior art documents] [Patent documents]

[0007] [Patent Document 1] Japanese Patent Application Publication No. 2019-37912 [Patent Document 2] Japanese Patent Application Publication No. 2018-161607 Summary of the Invention [Problem to be solved by the invention]

[0008] When the Anammox process is applied to the fermentation liquid residue from methane fermentation of high-concentration organic matter slurry (VS 6% to 15%), there are cases where Anammox activity decreases. In such cases, it is assumed that there is some kind of inhibition of the Anammox bacteria, so it is necessary to adjust the concentration by dilution to prevent activity reduction, which creates the problem of increased costs due to the increased amount of dilution water and treated water.

[0009] An object of the present invention is to provide a method for treating methane fermentation residue, which can stably treat, by the Anammox process, a digestion supernatant obtained by separating fermentation residue treated in a methane fermentation process into solids and liquid, for example, water to be treated containing 50 mg / L or more of high molecular weight organic matter with a molecular weight of 1,000 to 100,000, while suppressing a decrease in activity. [Means for solving the problem]

[0010] In the method for treating methane fermentation residue of the present invention, a digestion supernatant obtained by separating fermentation residue treated in a methane fermentation process into solids and liquid is subjected to anaerobic ammonium oxidation treatment using sludge in which Anammox bacteria account for 8% or more of all prokaryotes and the abundance ratio of the genus Candidatus Kuenenia to the genus Candidatus Brocadia among the Anammox bacteria is 1:1 or more.

[0011] In one aspect of the present invention, the anaerobic ammonium oxidation treatment involves simultaneously carrying out partial nitritation and anaerobic oxidation by Anammox bacteria in the same tank, or carrying out partial nitritation in a partial nitritation tank followed by anaerobic oxidation by Anammox bacteria in an Anammox tank.

[0012] In one embodiment of the present invention, the digestion supernatant is pretreated in advance to remove BOD or SS (suspended solids).

[0013] In one embodiment of the present invention, the digestion supernatant contains 50 mg / L or more of high molecular weight organic matter having a molecular weight of 1,000 to 100,000. [Effects of the Invention]

[0014] According to the present invention, water to be treated, such as dehydrated filtrate from a wet methane fermenter, containing 50 mg / L or more of high-molecular-weight organic matter with a molecular weight of 1,000 to 100,000, can be treated with anammox without concentration adjustment or with only a low dilution ratio, resulting in a higher concentration than conventional treatments, while reducing activity decline. This reduces the cost of dilution water and sewerage costs (in the case of sewerage discharge). It is estimated that the genus Candidatus Kuenenia is relatively more resistant to high-molecular-weight organic matter contained in the digestive fluid than other genera of anammox bacteria. [Brief explanation of the drawings]

[0015] [Figure 1] FIG. 1 is a configuration diagram of a test device employed in Example 1. [Figure 2] FIG. 10 is a configuration diagram of a test device employed in Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0016] Hereinafter, an embodiment of the present invention will be described.

[0017] In the method for treating methane fermentation residue of the present invention, a digestion supernatant obtained by separating fermentation residue treated in a methane fermentation process into solids and liquid is subjected to anaerobic ammonium oxidation treatment using sludge in which Anammox bacteria account for 8% or more of all prokaryotes and the abundance ratio of the genus Candidatus Kuenenia to the genus Candidatus Brocadia among the Anammox bacteria is 1:1 or more.

[0018] In one embodiment of the present invention, VS is 6 to 15%, and methane gas generation rate is 0.22 to 0.8 Nm 3 The fermentation residue obtained by methane fermentation of an organic slurry of 1000 kJ / kg-VS is separated into solids and liquids in a solid-liquid separation process, and the separated liquid is treated with sludge in which Anammox bacteria account for 8% or more (preferably 15% or more) of all prokaryotes, and among them, the dominance rate of the genus Candidatus Kuenenia is 50% or more (preferably 60% or more), in other words, sludge in which the ratio of the genus Candidatus Kuenenia to the genus Candidatus Brocadia is 1:1 or more (preferably 1.5:1 or more).

[0019] The solid-liquid separation process can be performed using, for example, a centrifugal dehydrator, belt press, or screw press, but there are no particular restrictions. Furthermore, if necessary, a BOD and SS removal process can be performed before the separated liquid is introduced into the Anammox reactor. BOD removal can be performed using an aeration tank, but there are no particular restrictions. The SS removal process can also be performed using a settling tank or sand filtration, but there are no particular restrictions. The Anammox process can be either a two-tank type, in which the nitritation process is performed in a tank separate from the Anammox reactor, or a single-tank type, in which the nitritation process is performed in the same tank as the Anammox reactor. The sludge retention method can also be any type, such as a granular method, a carrier method, or a membrane separation method.

[0020] The method for determining whether the genus Candidatus Kuenenia is dominant or not is not particularly limited, but examples thereof include the following bacterial flora analysis and Anammox bacteria quantification method.

[0021] [Bacteria flora analysis, Anammox bacteria quantification method] The method for calculating the dominance rate of the genus Candidatus Kuenenia is not particularly limited, and methods well known to those skilled in the art can be used. Examples of such methods include polymerase chain reaction (PCR), shotgun metagenomics, 16S amplicon analysis, real-time PCR, and LAMP. Among these methods, 16S amplicon analysis, which can distinguish Candidatus Kuenenia from other Anammox bacteria, such as the genus Candidatus Brocadia, and calculate the proportion of these bacteria in all other prokaryotes, and real-time PCR is preferred because it can detect and quantify Candidatus Kuenenia and calculate the proportion of Candidatus Kuenenia in all bacteria using commercially available universal primers, etc.

[0022] The following describes how to carry out 16S amplicon analysis and real-time PCR, but the analytical methods and sequences shown here are merely examples and are not particularly limited.

[0023] <Preparation of genomic DNA samples> Genomic DNA can be prepared using, for example, a commercially available DNA extraction kit.

[0024] <When performing 16S amplicon analysis> Libraries can be prepared using oligo DNA primers with base sequences that can amplify specific regions in the 16S rRNA genes of common bacteria, including Anammox bacteria, and amplicon sequencing can be performed using a next-generation sequencer, such as Illumina Miseq. As the primer sequences, for example, oligo DNAs having the base sequences shown in SEQ ID NOs: 1 and 2 can be used.

[0025] SEQ ID NO: 1: 5'-cctacgggrsgcagcag-3' SEQ ID NO: 2: 5'-ggactachvgggtatctaat-3'

[0026] The obtained sequence data can be analyzed using bacterial flora analysis tools such as Mothur and QIIME2.

[0027] <Where real-time PCR is performed> Oligonucleotide DNA having a base sequence that can amplify a predetermined region in the 16S rRNA gene of the genus Candidatus Kuenenia in distinction from other prokaryotes can be used as a primer. The primers may have the nucleotide sequences shown in SEQ ID NOs: 3 and 4, for example, as a forward primer and a reverse primer, respectively. When a probe method is used as a fluorescence monitoring method, the probe may have the nucleotide sequence shown in SEQ ID NO: 5, for example. Any fluorescent dye and quencher, such as FAM (5-Carboxyfluorescein) and EQ (EclipseQuencher), may also be used, and MGB (Minor Groove Binder) may also be used to further increase the Tm value.

[0028] As the standard DNA used to prepare a calibration curve, for example, the base sequence shown in SEQ ID NO: 6 can be used. SEQ ID NO:3 corresponds to the base sequence from the 104th to the 123rd bases of SEQ ID NO:6. SEQ ID NO: 4 is reverse complementary to the nucleotide sequence from 300 to 319 of SEQ ID NO: 6 SEQ ID NO:5 is reverse complementary to the base sequence from base 252 to base 269 of SEQ ID NO:6.

[0029] SEQ ID NO: 3: 5'-gagttaggaaatgcaggtgc-3' SEQ ID NO: 4: 5'-actcaagccctgtagtatca-3' SEQ ID NO: 5: 5'-tcacaactgwctygcaag-3'

[0030] SEQ ID NO:6: 5'-ctcctacgggaggctgcagtcgagaatctttcgcaatgcccgaaaggtgacgaagcgacgccgcgtgtgggaagaaggccttcgggttgtaaaccact gtcgggagttaggaaatgcaggtgcgttaatagcgcacttgcttgactaaggctccagaggaagccacggcttactctgtgccagcagccgcggtaataca gaggcggcaaggcttgttcggaattattgggcgtaaagagcacgtaggcggccttgcaagtcagttgtgaaagccttccgcttaacggaagaacggcatct gatactacagggcttgagtacgggaggggagagtggaacttctggtggagcggtgaaatgcgtagatatcagaaggaacgccggcggcgaaagcgactc-3'

[0031] To confirm that the genus Candidatus Kuenenia is quantified separately from other Anammox bacteria, the genus Candidatus Brocadia can also be quantified simultaneously by using oligo DNA primers with a base sequence that amplifies a specific region in the 16S rRNA gene of the genus Candidatus Brocadia separately from other prokaryotes. For example, the base sequences shown in SEQ ID NOs: 7 and 8 can be used as the forward and reverse primers, respectively. When the probe method is used as the fluorescence monitoring method, the base sequence shown in SEQ ID NO: 9 can be used as the probe. Any fluorescent dye and quencher, such as FAM (5-Carboxyfluorescein) and EQ (EclipseQuencher), can be used in combination with this, and MGB (Minor Groove Binder) can also be used to further increase the Tm value.

[0032] As the standard DNA used to prepare a calibration curve, for example, the base sequence shown in SEQ ID NO: 10 can be used. SEQ ID NO:7 corresponds to the base sequence from the 103rd to the 123rd bases of SEQ ID NO:10. SEQ ID NO: 8 is reverse complementary to the nucleotide sequence from 300 to 319 of SEQ ID NO: 10. SEQ ID NO:9 is reverse complementary to the base sequence from positions 252 to 269 of SEQ ID NO:10.

[0033] SEQ ID NO: 7: 5'-ggagttaagaaatgcaaggat-3' SEQ ID NO: 8: 5'-actcgagctatgcagtatcg-3' SEQ ID NO: 9: 5'-tcacraccgacttacaya-3'

[0034] SEQ ID NO:10: 5'-tcctacgggaggctgcagtcgagaatctttcgcaatgcccgaaagggtgacgaagcgacgccgcgtgcgggaagaaggccttcgggttgtaaaccgct gtcgggagttaagaaatgcaaggatgttaatagcatctttgtttgactaaggctccggaggaagccacggctaactctgtgccagcagccgcggtaataca gaggcggcaagcgttgttcggaattattgggcgtaaagagcacgtaggcggctgtgtaagtcggttgtgaaagccttccgcttaacggaagaacggcatcc gatactgcatagctcgagtgcgggaggggagagtggaacttctggtggagcggtgaaatgcgtagatatcagaaggaacaccggcggcgaaggcgactc-3'

[0035] Known or proprietary primers and probes can be used to measure total bacteria. The primers may be, for example, the forward and reverse primers represented by the nucleotide sequences of SEQ ID NOs: 11 and 12. When a probe method is used as the fluorescence monitoring method, the probe may be, for example, the nucleotide sequence represented by SEQ ID NO: 13. Any fluorescent dye and quencher, such as FAM and BHQ1 (Black Hole Quencher 1), may also be used.

[0036] As the standard DNA used to prepare a calibration curve, for example, the base sequence shown in SEQ ID NO: 14 can be used. SEQ ID NO: 11 corresponds to the base sequence from positions 1047 to 1062 of SEQ ID NO: 14. SEQ ID NO: 12 is reverse complementary to the nucleotide sequence from 1384th to 1398th of SEQ ID NO: 14. SEQ ID NO:13 corresponds to the base sequence from positions 1092 to 1106 of SEQ ID NO:14.

[0037] SEQ ID NO: 11: 5'-atggctgtcgtcagct-3' SEQ ID NO: 12: 5'-acgggcggtgtgtac-3' SEQ ID NO: 13: 5'-caacgagcgcaaccc-3' SEQ ID NO: 14:

[0038] For DNA amplification, fluorescence detection, calibration curve creation, and quantification of target DNA in real-time PCR, commercially available reagents and devices can be used. For example, LightCycler® 480 ProbeMaster and LightCycler® 480 System II can be used.

Example

[0039] The following describes the examples.

[0040] <Analysis of the bacterial flora of Anammox sludge> 16S rRNA amplicon analysis was performed by the following method. Genomic DNA was extracted using the DNA extraction kit FastDNA SPIN Kit for Soil (Funakoshi). Oligo DNA with the nucleotide sequences shown in SEQ ID NO: 15 and SEQ ID NO: 16, which are suitable for the V3-V4 region of the 16S rRNA gene, was used as a primer, and library preparation was carried out according to the protocol of Illumina. Note that the sequence from the 1st to the 33rd of SEQ ID NO: 15 and the sequence from the 1st to the 34th of SEQ ID NO: 16 are overhang adapter sequences for binding the Illumina index.

[0041] SEQ ID NO: 15: 5’- tcgtcggcagcgtcagatgtgtataagagacagcctacgggrsgcagcag-3’ SEQ ID NO: 16: 5’-gtctcgtgggctcggagatgtgtataagagacagggactachvgggtatctaat-3’

[0042] 16S amplicon sequencing by Illumina Miseq was performed using Miseq Reagent Kit v3.

[0043] The raw sequence data output from Illumina Miseq was analyzed using QIIME2, and the analysis was performed using a classifier created based on the SILVA database.

[0044] [Example 1, Comparative Example 1 (Single-tank Anammox treatment)] The treatment apparatus shown in FIG. 1 was used to treat the following water to be treated under the following treatment conditions.

[0045] As shown in Figure 1, this treatment system consists of methane fermentation, coagulation sedimentation, centrifugation, aerobic treatment, and then a first sequential batch anammox tank 1 (Candidatus broc) or a second sequential batch anammox tank 2 (Candidatus kuen). In other words, after the aerobic treatment stage, the system branches into two sequential batch anammox reactors. In Figure 1, the first anammox tank 1 and the second anammox tank 2 simultaneously carry out partial nitritation and anaerobic ammonium oxidation within the tanks.

[0046] The first Anammox tank 1 contains single-tank Anammox sludge (granules) mainly composed of Candidatus and Brocadia species. 30 The mixture was added so that the concentration became 20%. This was used for Comparative Example 1.

[0047] In the second anammox tank 2, single-tank anammox sludge (granules) mainly consisting of Candidatus Kuenenia genus was added. 30 The sludge was added so that the concentration became 20% and used in Example 1. It was confirmed in a batch test using synthetic wastewater that the Anammox activity of each sludge was 0.2 kg-N / kg-VSS / d or more.

[0048] <Untreated water> Digested fluid (TS 19100 mg / L, VS 11800 mg / L, VS / TS 0.61, NH4-N 2240 mg / L) was collected from a mesophilic wet methane fermenter (30 L) treating simulated food waste material with an HRT of 50 days.

[0049] The amount of polymeric organic matter measured by LC-OCD was found to be 110 mg-C / L of organic matter with a molecular weight of 1,000 to 100,000.

[0050] <Processing conditions> A cationic polymer flocculant dissolved at 2g / L (0.2%) was added to the solution to a concentration of 2.6% to flocculate the solids. The solution was left to stand to allow the flocs to settle, and the supernatant was centrifuged in a continuous centrifuge to remove the solids and prepare a solution (TS 5320mg / L, VS 1490mg / L, NH4-N 1250mg / L, SS 360mg / L).

[0051] This liquid was inoculated with a small amount of activated sludge and then passed through a 3 L transient aeration tank (water temperature 35°C, HRT 10 h) without a carrier to remove easily decomposable organic matter. This was used as raw water and then passed through a 1.5 L first or second Anammox reactor (water temperature 35°C, pH 7.5, granule volume 20%, nitrogen load 1.5 kg-N / m 3 / d) was passed through the water for 1.5 months.

[0052] The results are shown in Table 1.

[0053] [Table 1]

[0054] [Consideration] In Comparative Example 1, the Anammox bacteria ratio in the sludge was high at 42%, but the abundance ratio of the Kue genus (Candidatus Kuenenia genus) to the Bro genus (Candidatus Brocadia genus) (Kue ratio) was less than 0.02, and the Bro genus was dominant, so the Anammox activity fell to 0.05 kg-N / kg-VSS / d or less in about 30 days and the treatment capacity also fell.In contrast, in Example 1, the Anammox bacteria ratio was 8% or more and the Kue ratio was 11.1, and it is thought that the Kue genus was dominant, so the Anammox activity was able to be maintained at a high level.

[0055] [Examples 2a to 2c, Comparative Examples 2a and 2b (Two-tank Anammox treatment)] Using the treatment device shown in FIG. 2, the following water to be treated was treated under the following treatment conditions.

[0056] As shown in Figure 2, this treatment system consists of methane fermentation, coagulation sedimentation, centrifugation, aerobic treatment, partial nitritation treatment, and then a first sequential batch anammox tank 1 (Candidatus Brocadia species) or a second sequential batch anammox tank 2 (Candidatus Kuenenia species). In other words, after the aerobic treatment stage, the system branches into two sequential batch anammox reactors (SBR).

[0057] The first Anammox tank 1 contains single-tank Anammox sludge (granules) mainly composed of Candidatus and Brocadia species. 30 The mixture was added so that the concentration became 20%. This was used for Comparative Example 2.

[0058] In the second anammox tank 2, single-tank anammox sludge (granules) mainly consisting of Candidatus Kuenenia genus was added. 30 The sludge was added so that the concentration became 20% and used in Example 2. It was confirmed in a batch test using synthetic wastewater that the Anammox activity of each sludge was 0.2 kg-N / kg-VSS / d or more.

[0059] <Untreated water> The digested liquid (TS 21100 mg / L, VS 13600 mg / L, TS / VS 0.64, NH4-N 2540 mg / L) collected from a mesophilic wet methane fermentation tank (30 L) that treated simulated food waste with an HRT of 50 days was used.

[0060] The amount of organic matter in the polymer was measured by LC-OCD, and it was found that the amount of organic matter with a molecular weight of 1,000 to 100,000 was 178 mg-C / L (Comparative Example 2b, Example 2c).

[0061] In addition, in order to dilute the concentration of high molecular weight organic matter, tap water was added to dilute the water by approximately 2.5 times, and ammonium sulfate and sodium nitrite were added to adjust the NH4-N and NO2-N concentrations to 520 mg / L. The molecular weight of the adjusted water (1,000 to 100,000) was 66 mg / L (Comparative Example 2a, Examples 2a and 2b).

[0062] <Processing conditions> A cationic polymer flocculant dissolved at 2g / L (0.2%) was added to the solution to a concentration of 2.6% to flocculate the solids. The solution was left to stand to allow the flocs to settle, and the supernatant was centrifuged in a continuous centrifuge to remove the solids and prepare a solution (TS 3960mg / L, VS 1070mg / L, NH4-N 1040mg / L, SS 610mg / L).

[0063] This solution was placed in a 3 L nitrite-type nitrification tank (pH 7.5, water temperature 35°C) containing a sponge carrier to generate nitrite at a ratio of 1:1 (NH4-N 520 mg / L, NO2-N 520 mg / L), and finally a small amount of sodium nitrite was added to adjust the ratio to 1:1.

[0064] This was used as raw water and placed in a 1L first or second tank type Anammox reactor (water temperature 35°C, pH 7.5), with a granule volume of 20%, Nitrogen load 1.5kg-N / m 3 Water was passed through the reactor for 1.5 months. The reactor was constantly purged with nitrogen gas to prevent imbalance in the bacterial flora.

[0065] The results are shown in Table 2.

[0066] [Table 2]

[0067] [Consideration] In Comparative Example 2a, the Anammox activity did not increase because the ratio of Anammox bacteria was low to begin with.

[0068] In Comparative Example 2b, the Kue ratio was low at 0.0005, and Bro bacteria were dominant, so the Anammox activity fell to 0.05 kg-N / kg-VSS / d or less in about 30 days, and the treatment capacity also fell.

[0069] In Examples 2a to 2c, the Anammox bacteria ratio was 8% or more, and the Kue ratio was high, resulting in Kue genus dominance, allowing for high Anammox activity. In particular, a comparison between Comparative Example 2b and Example 2b confirmed that high Anammox activity can be maintained if the Kue ratio is 1 or more and Kue genus dominance is achieved. [Explanation of symbols]

[0070] 1,2 Anammox tank

Claims

1. A method for treating methane fermentation residue, comprising anaerobic ammonium oxidation treatment using sludge obtained by separating a digestion supernatant obtained by separating a fermentation residue treated in a methane fermentation process into solids and liquid, in which Anammox bacteria account for 8% or more of all prokaryotes and the abundance ratio of the genus Candidatus Kuenenia to the genus Candidatus Brocadia among the Anammox bacteria is 1:1 or more.

2. 2. The method for treating methane fermentation residue according to claim 1, wherein the anaerobic ammonium oxidation treatment comprises simultaneously carrying out partial nitritation and anaerobic oxidation by Anammox bacteria in the same tank, or carrying out partial nitritation in a partial nitritation tank followed by anaerobic oxidation by Anammox bacteria in an Anammox tank.

3. 3. The method for treating methane fermentation residue according to claim 1, wherein the digestion supernatant is pretreated to remove BOD or SS.

4. 4. The method for treating methane fermentation residue according to claim 1, wherein the digestion supernatant contains 50 mg / L or more of high molecular weight organic matter having a molecular weight of 1,000 to 100,000.

Images