Large-scale adeno-associated virus production system

Abstract

The present invention provides a process for producing and characterizing adeno-associated virus particles and baculovirus particles. The present invention is directed to a method for improving adeno-associated virus (AAV) production. The present invention addresses problems associated with the production of rAAV using baculovirus-infected Sf9 cells and achieves an improved method for producing rAAV. The present invention has developed different methods for producing recombinant baculovirus (rBV) and recombinant adeno-associated virus (rAAV). These methods address problems such as genomic instability and also provide improved production of rAAV, producing rAAV with improved properties.

Description

[Technical Field]

[0001] Sequence Listing Reference The Sequence Listing, submitted contemporaneously herewith as an XML file entitled "6439-0113PWO1," created on July 21, 2022, and 6 KB in size, is hereby incorporated by reference in accordance with 37 C.FR § 1.52(e)(5).

[0002] The present invention is directed to methods and processes for producing adeno-associated virus (AAV) particles. [Background technology]

[0003] The present invention is directed to a method for improving adeno-associated virus (AAV) production. AAV is a non-enveloped virus with a single-stranded DNA genome terminated by at least one inverted terminal repeat (ITR). For example, the AAV2 serotype may have a single-stranded DNA genome of approximately 4.7 kilobases (kb) terminated by two 145-nucleotide inverted terminal repeats (ITRs). This virus does not encode a polymerase and therefore relies on cellular polymerases for genome replication. The ITRs are flanked by two viral genes, rep (replication) and cap (capsid), which encode nonstructural and structural proteins, respectively. The Rep gene encodes four regulatory proteins, designated Rep78, Rep68, Rep52, and Rep40, through the use of two promoters and alternative splicing. These proteins are involved in the replication and packaging of the AAV genome. The Cap gene generates three capsid proteins, VP1 (virion protein 1), VP2, and VP3, through alternative splicing and translation initiation. The molecular weights of AAV2 VP1, VP2, and VP3 are 87, 72, and 62 kDa, respectively. These capsid proteins assemble into a roughly spherical protein shell of 60 subunits.

[0004] AAV cannot replicate on its own and requires co-infection with a helper virus, typically an adenovirus or a herpesvirus. When AAV infects human cells alone, the AAV gene expression program is self-suppressed, resulting in latent infection of the cells. However, when latently infected cells are co-infected with a helper virus, such as an adenovirus or a herpes simplex virus, AAV gene expression is activated, leading to excision of proviral DNA from the host cell chromosome, followed by replication and packaging of the viral genome.

[0005] Baculoviruses containing AAV genes and therapeutic genes have been used to infect Sf9 cells to produce AAV capsids containing therapeutic genes. For example, baculoviruses containing either AAV Rep / Cap genes or therapeutic genes are used to co-infect Sf9 cells. In this method, baculoviruses serve a dual role, serving as a "helper" virus necessary for AAV production and as a vehicle for AAV and therapeutic genetic material.

[0006] The baculovirus-AAV production method offers many advantages. First, Sf9 cells can be cultured at high density as a free-floating suspension in large bioreactors with capacities up to 2000 liters (L), enabling more efficient AAV production than can be achieved with adherent cell culture. In addition, Sf9 cells can be grown under serum-free conditions, which improves biosafety by eliminating the presence of potentially immunogenic or toxic animal-derived proteins. Furthermore, baculovirus cannot replicate in human cells.

[0007] However, baculovirus / Sf9 production of AAV capsids also has significant limitations. For example, the baculovirus genome can become unstable after multiple passages. Loss of the rep gene halts rAAV production. Pijlman (Pijlman, Gorben P., et al. "Autographa californica baculoviruses with large genomic deletions are rapidly generated in infected insect cells" Virology 283.1 (2001):132-138) specifically describes deletions in the baculovirus genome within two passages. Airenne (Airenne, Kari J., et al. "Improved generation of recombinant baculovirus genomes in Escherichia coli" Nucleic acids research 31.17 (2003):e101-e101) describes a lethal selection strategy for selecting E. coli colonies harboring recombinant bacmids. Scholz and Suppmann (Scholz, Judith, and Sabine Suppmann. “A new single-step protocol for rapid baculovirus-driven protein production in insect cells” BMC biotechnology 17.1 (2017): 83) disclose bacmid transfection in suspension and isolation of P0 baculovirus to shorten recombinant protein production time, but do not disclose isolation of P0 BV to address genomic instability or for use in AAV production.Negrete (Negrete, Alejandro, et al. "Economized large-scale production of high yield of rAAV for gene therapy applications exploiting baculovirus expression system" The Journal of Gene Medicine: A cross-disciplinary journal for research on the science of gene transfer and its clinical applications 9.11 (2007):938-948) discloses producing AAV by infecting Sf cells with baculovirus at an MOI of 0.03. Mena (Mena, Jimmy A., et al. "Improving adeno-associated vector yield in high-density insect cell cultures" The Journal of Gene Medicine: A cross-disciplinary journal for research on the science of gene transfer and its clinical applications 12.2 (2010):157-167) also discloses producing AAV by infecting Sf cells with baculovirus at an MOI of 0.3. Neither Negrete nor Mena suggest using an MOI of BV less than 0.3 for AAV production. Summary of the Invention

[0008] The present invention addresses the problems associated with the production of rAAV using baculovirus-infected Sf9 cells and achieves improved methods for producing rAAV. The inventors have developed different methods for producing recombinant baculovirus (rBV) and recombinant adeno-associated virus (rAAV). These methods address problems such as genomic instability and provide improved production of rAAV, while producing rAAV with improved properties (e.g., higher infectivity, lower encapsidated nucleic acid impurities, etc.).

[0009] Embodiments for producing rAAV are disclosed.

[0010] In various embodiments, the method for producing rAAV includes infecting cells with at least one rBV. The at least one rBV comprises a nucleotide sequence for producing the rAAV. The method further includes culturing the infected cells to produce the rAAV. In this method, the at least one rBV is isolated from at least one cell culture comprising cells transfected with at least one of the nucleotide sequences.

[0011] In various embodiments, a method for producing rAAV includes infecting cells with at least one rBV. The at least one rBV has a nucleotide sequence for producing rAAV. The method further includes culturing the infected cells to produce rAAV. In this method, prior to the infecting step, the at least one rBV is isolated from at least one cell culture containing cells having at least a portion of a baculovirus genome. The cells are also transfected with at least one nucleotide sequence that combines with at least a portion of the baculovirus genome to form a baculovirus genome capable of producing rBV.

[0012] In various embodiments, a method for producing rAAV includes infecting at least one cell with a passage zero (P0) rBV and culturing the infected at least one cell to produce rAAV, wherein the P0 rBV comprises a nucleotide sequence for producing rAAV.

[0013] In various embodiments, the method for producing rAAV includes infecting cells with rBV at a multiplicity of infection (MOI) of less than 0.01. The rBV comprises a nucleotide sequence for producing rAAV. The method also includes culturing the infected cells to produce rAAV.

[0014] In various embodiments, a method for large-scale rBV-based rAAV production using at least one rBV is disclosed, comprising the steps of generating a bank of recombinant Escherichia coli (E. coli) containing a bacmid having an AAV Rep gene, an AAV Cap gene, and an rAAV vector genome, cryopreserving the E. coli bank, thawing the E. coli bank, isolating the bacmid from the thawed E. coli bank, transfecting insect cells with the bacmid from the thawed E. coli bank and culturing the transfected insect cells, isolating the rBV from the transfected insect cells, and further infecting the insect cells with the isolated rBV in a bioreactor and culturing the infected insect cells to produce rAAV.

[0015] Other embodiments relating to rBV-based production of rAAV are also disclosed.

[0016] In various embodiments, a method for increasing rAAV production and reducing encapsidated nucleic acid impurities within the produced rAAV is disclosed. The method includes infecting different cell cultures with an rBV having a nucleotide sequence of an rAAV vector genome and one or more second rBVs having nucleotide sequences encoding Rep and Cap proteins. Each cell culture is infected with the first rBV and the one or more second rBVs at a different ratio of MOI of the first rBV to MOI of the one or more second rBVs. The method also includes isolating rAAV from the different cell cultures, determining the titer of the isolated rAAV from the different cell cultures, determining the concentration of encapsidated nucleic acid impurities within the isolated rAAV from the different cell cultures, and identifying one or more ratios of MOI of the first rBV to MOI of the one or more second rBVs from both determining steps.

[0017] In various embodiments, a method for measuring rBV titer includes infecting indicator cells with rBV. The indicator cells have a reporter nucleotide sequence operably linked to an early or middle baculovirus promoter sequence. In other embodiments, the reporter nucleotide sequence is operably linked to a baculovirus-derived enhancer sequence. The method also includes measuring expression of the reporter nucleotide sequence and determining the rBV titer from the expression of the reporter nucleotide sequence.

[0018] In various embodiments, the cells for measuring rBV titer comprise a reporter nucleotide sequence operably linked to an early or intermediate baculovirus promoter sequence. The reporter nucleotide sequence and the early or intermediate baculovirus promoter sequence are stably maintained within the cells. In a different embodiment, the reporter nucleotide sequence is operably linked to a baculovirus-derived enhancer sequence, and the baculovirus-derived enhancer sequence is stably maintained within the cells.

[0019] In various embodiments, methods for generating indicator cells for measuring rBV titer are disclosed. The methods include transfecting into cells a vector comprising a reporter nucleotide sequence operably linked to an early or intermediate baculovirus promoter. In other embodiments, the reporter nucleotide sequence is operably linked to a baculovirus-derived enhancer sequence. [Brief explanation of the drawings]

[0020] [Figure 1] 1 is a graphical representation showing AAV titers (vector genomes (vg) / milliliter (mL)) produced from rBVs that provide / encode vg carrying a gene of interest (GOI), Rep, and Cap. The rBVs were cultured with naive Sf9 cells at an MOI of 0.1, 0.01, 0.001, 0.0001, and 0.00001.

[0021] [Figure 2] 1 is a map of the plasmid used to develop the indicator cell line, which has a nucleotide sequence encoding enhanced green fluorescent protein (eGFP) operably linked to a 39k promoter sequence. [Figure 3] 1 is a map of the plasmid used to develop the indicator cell line, which has a nucleotide sequence encoding eGFP operably linked to the p6.9 promoter sequence. [Figure 4] 1 is a map of the plasmid used to develop the indicator cell line, which has a nucleotide sequence encoding eGFP operably linked to a polyhedrin (Polh) promoter sequence.

[0022] [Figure 5] Flow cytometry data for untransfected Sf9 cells are shown. The dotted line indicates the green fluorescent gate, where approximately 0.1% of the cells exhibit fluorescence.

[0023] [Figure 6] Flow cytometry data of Sf9 cells transfected with a plasmid containing an eGFP nucleotide sequence operably linked to a 39k promoter sequence. The cells were not transfected with rBV. The dotted line indicates the green fluorescent gate, where approximately 0.1% of the cells exhibit fluorescence.

[0024] [Figure 7] Flow cytometry data of Sf9 cells transfected with a plasmid containing an eGFP nucleotide sequence operably linked to a 39k promoter sequence were shown. The cells were infected with rBV. The dotted line indicates the gate showing green fluorescence. 55.5% of the 39k promoter cells showed green fluorescence. [Figure 8] Flow cytometry data of Sf9 cells transfected with a plasmid containing an eGFP nucleotide sequence operably linked to the p6.9 promoter sequence were shown. The cells were infected with rBV. The dotted line indicates the gate showing green fluorescence. 11% of the p6.9 promoter cells showed green fluorescence. [Figure 9] Flow cytometry data of Sf9 cells transfected with a plasmid containing an eGFP nucleotide sequence operably linked to a Polh promoter sequence were shown. The cells were infected with rBV. The dotted line indicates the gate showing green fluorescence. 2% of the Polh promoter cells showed green fluorescence.

[0025] [Figure 10] 1 is a graphical representation showing eGFP expression at various times after rBV infection. As shown, at 19 hours after rBV infection, 55.5% of 39k promoter cells showed green fluorescence, 11% of p6.9 promoter cells showed green fluorescence, and 2% of Polh promoter cells showed green fluorescence. [Figure 11]1 is a graphical representation showing eGFP expression at various times after rBV infection. As shown, at 40 hours after rBV infection, 65.4% of 39k promoter cells showed green fluorescence, 19% of p6.9 promoter cells showed green fluorescence, and 11% of Polh promoter cells showed green fluorescence. [Figure 12] 1 is a graphical representation showing eGFP expression at various times after rBV infection. As shown, at 68 hours after rBV infection, 66.3% of 39k promoter cells showed green fluorescence, 19% of p6.9 promoter cells showed green fluorescence, and 15% of Polh promoter cells showed green fluorescence.

[0026] [Figure 13] 1 is a graphical representation showing eGFP expression in 39k promoter cells at various times after rBV infection. The percentage of 39k promoter cells expressing eGFP was 41.1% (15 hours), 39.9% (18 hours), 40.7% (24 hours), 68.0% (43 hours), 66.4% (65 hours), 67.3% (70 hours), and 69.3% (94 hours).

[0027] [Figure 14] 1 is a graphical representation comparing expressing cells containing a nucleotide sequence encoding eGFP or eGFP that has been codon-optimized for expression in insect cells. As shown, at 20 hours, using the codon-optimized eGFP sequence with the 39k promoter increased the percentage of cells expressing eGFP from 56.5% to 57.8%, and using the codon-optimized eGFP sequence with the PolH promoter increased the percentage of cells expressing eGFP from 4.0% to 10.5%. [Figure 15]1 is a graphical representation comparing expressing cells containing a nucleotide sequence encoding eGFP or eGFP that has been codon-optimized for expression in insect cells. As shown, at 25 hours, use of the codon-optimized eGFP sequence for the 39k promoter cells resulted in essentially no difference in the percentage of cells expressing eGFP (56.6% and 55.9%), while use of the codon-optimized eGFP sequence for the PolH promoter cells increased the percentage of cells expressing eGFP from 4.8% to 12.0%. [Figure 16] 1 is a graphical representation comparing expressing cells containing a nucleotide sequence encoding eGFP or eGFP that has been codon-optimized for expression in insect cells. As shown, at 48 hours, using the codon-optimized eGFP sequence with the 39k promoter increased the percentage of cells expressing eGFP from 58.5% to 59.3%, and using the codon-optimized eGFP sequence with the PolH promoter increased the percentage of cells expressing eGFP from 10.9% to 17.5%.

[0028] [Figure 17] We highlight the statistical analysis of the effect of the MOI of rBV on rAAV5 productivity. The figure is a graphic representation showing normalized productivity, and values ​​are presented relative to the first condition (GOI 0.01 / Rep 0.01 / Cap 0.01). [Figure 18] The figure highlights the statistical analysis of the effect of the MOI of rBV on rAAV5 productivity. The figure is a graphical representation showing the capsid-to-vg ratios obtained from different experimental cell culture conditions infected with rBV.

[0029] [Figure 19] Figure 1 shows the effect of rBV MOI and rBV co-infection on AAV5 productivity. Figure 2 shows a graphical representation of productivity across four experimental conditions using two different rBV transgene sets. For each set, values ​​were normalized to its GOI 0.03 / Rep 0.003 / Cap 0.003 condition. [Figure 20]Figure 1 shows the effect of rBV MOI and rBV coinfection on AAV5 productivity. A graphical representation shows normalized productivity versus Cap copy number (VP3 / 18s). Peak cell density was adjusted based on the percentage of coinfected cells. For the VP3 / 18s ratio (indicated by diamonds), the final value was adjusted based on the percentage of dTomato-expressing cells. The correlation coefficient between the adjusted outputs is 0.849.

[0030] [Figure 21] Figure 1 shows the effect of the MOI of Rep and Cap rBV on packaging of baculovirus DNA impurities. Figure 2 shows a graphical representation of the mean α-β:cp in infections with GOI-B-rBV, Rep rBV, and Cap rBV. Values ​​are normalized to the first condition: GOI 0.03 / Rep 0.003 / Cap 0.003. Analysis was performed from nuclease-treated clarified harvests. GOI-B-rBV only, Rep Cap-rBV only, and Cap-rBV only conditions were included as controls. [Figure 22] Figure 1 shows the effect of MOI of Rep and Cap BV on packaging of baculovirus DNA impurities. Figure 2 shows a graphical representation of the mean δ-γ:cp in infections with GOI-B-rBV, Rep rBV, and Cap BV. Values ​​are normalized to the first condition: GOI 0.03 / Rep 0.003 / Cap 0.003. Analysis was performed from nuclease-treated clarified harvests. GOI-B-rBV only, Rep Cap-rBV only, and Cap-rBV only conditions were included as controls. DETAILED DESCRIPTION OF THE INVENTION

[0031] As required, detailed embodiments of the present disclosure are disclosed herein; however, it should be understood that the disclosed embodiments are merely exemplary and can be embodied in various and alternative forms.

[0032] Except in the examples, or where expressly stated otherwise, all numerical values ​​herein expressing quantities of ingredients or conditions of reaction and / or use should be understood as modified by the word "about." For example, a description referring to "about X" includes a description of "X." In one example, the term "about" is understood as within normal tolerances in the art, e.g., within two standard deviations of the mean. In different examples, "about" refers to a variation of ±0.0001%, ±0.0005%, ±0.001%, ±0.005%, ±0.01%, ±0.05%, ±0.1%, ±0.5%, ±1%, ±5%, or ±10%. In further examples, "about" can be understood as within ±9%, ±8%, ±7%, ±6%, ±5%, ±4%, ±3%, or ±2%.

[0033] The first definition of an acronym or other abbreviation applies to all subsequent uses herein of the same abbreviation and applies mutatis mutandis to normal grammatical variations of the abbreviation originally defined, and unless expressly indicated to the contrary, measurements of a property are determined by the same techniques previously or later referenced for the same property.

[0034] Unless otherwise defined, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0035] It is also to be understood that this disclosure is not limited to the specific embodiments and methods described below, as specific components and / or conditions may, of course, vary. Further, the terminology used herein is used only to describe particular embodiments and is not intended to be limiting in any way.

[0036] Also, please note that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, reference to an element in the singular is intended to include plural elements.

[0037] The terms "or" and "and" can be used interchangeably and can be understood to mean "and / or."

[0038] The term "comprising" is synonymous with "including," "having," "containing," or "characterized by." These terms are inclusive and open-ended and do not exclude additional, unrecited elements or method steps.

[0039] The phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. When this phrase appears in a clause in the body of a claim rather than immediately following the preamble, it limits only the elements set forth in that clause and does not exclude other elements from the claim as a whole.

[0040] The phrase "consisting essentially of" limits the scope of a claim to certain materials or steps in addition to the claimed subject matter that do not materially affect the essential and novel characteristic(s).

[0041] The terms "comprising," "consisting of," and "consisting essentially of" may be used interchangeably. When one of these three terms is used, the claimed subject matter of this disclosure may include use of either of the other two terms.

[0042] Throughout this application, where publications are referenced, the disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains.

[0043] The term "heterologous" refers to a polynucleotide sequence that is non-native to the AAV or cell, or that is native to the AAV or cell but is not located in its natural place or location within the viral genome or host cell genome.

[0044] "Encodes," "encoded," and "encoding" refer to the inherent property of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes. Thus, a gene encodes a protein when transcription and translation of the mRNA produced by that gene produces the protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually provided in a sequence listing, and the non-coding strand, which is used as a template for transcription of the gene or cDNA, can be said to encode the protein or other product of that gene or cDNA.

[0045] The term "expression control element" refers to a nucleic acid sequence in a polynucleotide that is capable of regulating the expression of a nucleotide sequence to which it is operably linked. "Operatively linked" refers to a functional relationship between two moieties in which the activity of one moiety (e.g., the ability to regulate transcription) results in the effect of the other moiety (e.g., transcription of the sequence). An expression control element is "operably linked" to a nucleotide sequence if the element controls or regulates the transcription or translation of the nucleotide sequence. Examples of expression control elements include sequences such as promoters (e.g., inducible or constitutive), enhancers, transcription terminators, start codons (e.g., ATG), intronic splicing signals, stop codons, internal ribosome entry sites, homology region elements (e.g., homology region 2 of Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV)), AAV regulatory elements (e.g., Rep binding elements), and the like.

[0046] The term "promoter" or "promoter polynucleotide" is understood to mean a regulatory or control sequence / element that is capable of binding / recruiting RNA polymerase and initiating transcription of a sequence downstream or 3' from the promoter. A promoter can be, for example, constitutively active (always on) or inducible, where the promoter is active or inactive in the presence of an external stimulus. A promoter can express a protein at high concentrations. For example, the transcription level of a promoter can be about or at least about 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold, 6-fold, 6.5-fold, 7-fold, 7.5-fold, 8-fold, 8.5-fold, 9-fold, 9.5-fold, 10-fold, 10.5-fold, 11-fold, 11.5-fold, 12-fold, 12.5-fold, 13-fold, 13.5-fold, 14-fold, 14.5-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold, 48-fold, 49-fold, 50-fold, 15-fold, 15.5-fold, 16-fold, 16.5-fold, 17-fold, 17.5-fold, 18-fold, 18.5-fold, 19-fold, 19.5-fold, 20-fold, 50-fold, 100-fold, 250-fold, 500-fold, 1000-fold, 2000-fold, 2500-fold, 3000-fold, 3500-fold, 4000-fold, 4500-fold, 5000-fold, 5500-fold, 6000-fold, 6500-fold, 7000-fold, 7500-fold, 8000-fold, 8500-fold, 9000-fold, 9500-fold, or 10000-fold higher. In different embodiments, the transcription level of the constitutive promoter polynucleotide ranges between any two of the levels listed above. The promoter can also be placed in conjunction with other expression control element(s) to control transcriptional expression. For example, an expression cassette having a promoter, homology region elements, and / or AAV regulatory elements can be stably integrated into the genome of an insect cell such that baculovirus infection of the insect cell induces transcriptional expression from the expression cassette (see US2012 / 0100606).

[0047] Adeno-associated virus

[0048] Therapeutically effective rAAV particles include those disclosed in US9,504,762, WO2019 / 222136, US2019 / 0376081, and WO2021 / 097157 (the disclosures of which are incorporated herein by reference).

[0049] "AAV" is the standard abbreviation for adeno-associated virus. Adeno-associated virus is a single-stranded DNA parvovirus with a genome encapsidated by a capsid. Currently, there are 13 characterized serotypes of AAV. General information and reviews of AAV can be found, for example, in Carter, 1989, Handbook of Parvoviruses, Vol. 1, pp. 169-228, and Berns, 1990, Virology, pp. 1743-1764, Raven Press, New York. However, since it is well known that the various serotypes are very closely related, both structurally and functionally, even at the genetic level, it is fully expected that these same principles will be applicable to additional AAV serotypes. (See, e.g., Blacklowe, 1988, Parvoviruses and Human Disease, pp. 165-174, J.R.P.Tattison, ed., and Rose, Comprehensive Virology 3:1-61 (1974)). For example, all AAV serotypes clearly exhibit very similar replication properties mediated by homologous rep genes, and all possess three related capsid proteins. The degree of relatedness is further suggested by heteroduplex analysis, which reveals extensive cross-hybridization between genotypes along the length of the genome and the presence of similar self-annealing segments at the ends corresponding to "inverted terminal repeats" (ITRs). Similar infectivity patterns also suggest that the replication functions in each serotype are under similar regulatory control.

[0050] As used herein, "AAV viral particle" refers to an infectious viral particle consisting of at least one AAV capsid protein and an encapsidated AAV genome. "Recombinant AAV," or "rAAV," "rAAV virion," or "rAAV viral particle" refers to a viral particle consisting of at least one capsid or Cap protein and an encapsidated rAAV vector genome as described herein. Thus, production of rAAV particles includes production of rAAV vector genomes. In different embodiments, rAAV viral particles include the AAV particles and rAAV particles disclosed in US9,504,762, WO2019 / 222136, US2019 / 0376081, and WO2021 / 097157 (the disclosures of which are incorporated herein by reference).

[0051] "Capsid" refers to the structure in which the rAAV vector genome is packaged. The capsid may contain either the VP1 protein or the VP3 protein, but more typically contains all three VP1, VP2, and VP3 proteins, as found in native AAV. The sequence of the capsid proteins determines the serotype of the rAAV virion. rAAV virions include those derived from several AAV serotypes, including AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba 36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bce14, Bce15, Bce16, Bce17, Bce18, Bce20, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma 43, Bpo1, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpo13, Bpo18, Bpo20, Bpo23, Bpo24, Bpo27, Bpo28, Bpo29 , Bpo33, Bpo35, Bpo36, Bpo37, Brh26, Brh27, Brh28, Brh29, Brh30, Brh31, Brh32, Brh33, Bfm17, Bf Examples of capsid proteins include m18, Bfm20, Bfm21, Bfm24, Bfm25, Bfm27, Bfm32, Bfm33, Bfm34, Bfm35, AAV-rh10, AAV-rh39, AAV-rh43, AAVanc80L65, or any variant thereof (see, e.g., U.S. Patent No. 8,318,480 for disclosure of non-natural mixed serotypes). Exemplary capsids are also provided in International Application Nos. 2018 / 022608 and 2019 / 222136, which are incorporated herein in their entireties. Capsid proteins can also be variants of native VP1, VP2, and VP3, including mutated, chimeric, or shuffled proteins. Capsid proteins can be of rh.10 or other subtypes within various AAV clades.Various clades and subtypes are disclosed, for example, in U.S. Patent No. 7,906,111. In various embodiments, the capsid of the AAV viral particle is selected from the group consisting of AAV-1 (Genbank Accession No. AAD27757.1), AAV-2 (NCBI Reference SEQ ID NO: YP_680426.1), AAV-3 (NCBI Reference SEQ ID NO: NP_043941.1), AAV-3B (Genbank Accession No. AAB95452.1), AAV-4 (NCBI Reference SEQ ID NO: NP_044927.1), AAV-5 (NCBI Reference SEQ ID NO: YP_068409.1), AAV-6 (Genbank Accession No. AAB95450.1), AAV-7 (NCBI Reference SEQ ID NO: YP_077178.1), AAV-8 (NCBI Reference SEQ ID NO: YP_077179.1), AAV-9 (Genbank Accession No. AAB95451.1), AAV-10 (NCBI Reference SEQ ID NO: YP_077178.1), AAV-11 (NCBI Reference SEQ ID NO: YP_077179.1), AAV-12 (NCBI Reference SEQ ID NO: YP_077179.1), AAV-13 (NCBI Reference SEQ ID NO: YP_077179.1), AAV-14 (NCBI Reference SEQ ID NO: YP_077179.1), AAV-15 (NCBI Reference SEQ ID NO: YP_068409.1), AAV-16 (Genbank Accession No. AAB95450.1), AAV-17 (NCBI Reference SEQ ID NO: YP_077178.1), AAV-18 (NCBI Reference SEQ ID NO: YP_0 and / or AAV-10 (Genbank Accession No. AAT46337.1), AAV-11 (Genbank Accession No. AAT46339.1), AAV-12 (Genbank Accession No. ABI16639.1), AAV-13 (Genbank Accession No. ABZ10812.1), or a portion of any amino acid sequence disclosed in WO2018 / 022608 and WO2019 / 222136. The construction and use of AAV proteins of different serotypes are discussed in Chao et al., Mol. Ther. 2:619-623, 2000; Davidson et al., PNAS 97:3428-3432, 2000; Xiao et al., J. Virol. 72:2224-2232, 1998; Halbert et al., J. Virol. 74:1524-1532, 2000; Halbert et al., J. Virol. 75:6615-6624, 2001; and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, 2001.

[0052] As used herein, "AAV vector genome," "vector genome," or "rAAV vector genome" refers to a single-stranded nucleic acid. rAAV viral particles have an rAAV vector genome encapsidated within a capsid. The rAAV vector genome has an AAV 5' inverted terminal repeat (ITR) sequence and an AAV 3' ITR flanking a protein coding sequence (preferably a functional therapeutic protein coding sequence; e.g., FVIII, FIX, and PAH) operably linked to transcriptional regulatory elements (i.e., one or more promoters and / or enhancers, and optionally, a polyadenylation sequence and / or one or more introns inserted within the regulatory elements, or between the regulatory elements and the protein coding sequence, or between exons of the protein coding sequence) that are heterologous to the AAV viral genome. rAAV vector genome refers to a nucleic acid present in an rAAV viral particle and can be either the sense strand or the antisense strand of a nucleic acid sequence disclosed herein. The size of such a single-stranded nucleic acid is provided in base number. As used herein, the terms "inverted terminal repeat" and "ITR" refer to art-recognized regions found at the 5' and 3' ends of the rAAV genome that function in cis as the origin of viral DNA replication and as a packaging signal for the viral genome. AAV ITRs, together with Rep proteins, provide efficient removal and rescue from, and integration of, nucleotide sequences inserted between two adjacent ITRs into, the host cell genome. The sequences of certain AAV-related ITRs are disclosed by Yan et al., J. Virol. 79(1):364-379 (2005). ITRs are also found in a "flip" or "flop" configuration, in which the sequence between the AA' inverted repeats (forming the arms of the hairpin) is in the reverse complement (Wilmott, Patrick, et al. Human gene therapy methods 30.6 (2019):206-213).The construction and use of AAV vector genomes of different serotypes are discussed in Chao et al., Mol. Ther. 2:619-623, 2000; Davidson et al., PNAS 97:3428-3432, 2000; Xiao et al., J. Virol. 72:2224-2232, 1998; Halbert et al., J. Virol. 74:1524-1532, 2000; Halbert et al., J. Virol. 75:6615-6624, 2001; and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, 2001. Due to the wide range of constructs available and extensive characterization, the exemplary AAV vector genomes disclosed below are derived from serotype 2.

[0053] Therapeutically effective rAAV particles or therapeutic rAAVs can infect cells such that the infected cells express (e.g., by transcription and / or translation) elements of interest (e.g., nucleotide sequences, proteins, etc.). To this extent, therapeutically effective rAAV particles can include AAV particles having capsids or vector genomes (vg) with different properties. For example, therapeutically effective AAV particles can have capsids with different post-translational modifications. In other examples, therapeutically effective AAV particles can contain vg's with different sizes / lengths, plus or minus strand sequences, different flip / flop ITR configurations (flip / flop, flop / flip, flip / flip, flop / flop, etc.), different numbers (1, 2, 3, etc.) of ITRs or truncations. For example, in AAV-infected cells, annealing / complementation of overlapping truncated plus and minus genomes occurs such that a "complete" nucleic acid encoding a large protein is generated, thereby reconstituting a functional, full-length gene. Therapeutically effective AAV particles are also called "heavy" or "intact" capsids.

[0054] As an example, a "therapeutic rAAV" refers to an rAAV virion, rAAV virus particle, rAAV vector particle, or rAAV containing a heterologous polynucleotide encoding a therapeutic protein, and can be used to replace or complement proteins in vivo. A "therapeutic protein" refers to a polypeptide having a biological activity that replaces a corresponding endogenous protein or complements the loss or reduction of its activity. For example, functional phenylalanine hydroxylase (PAH) is a therapeutic protein for phenylketonuria (PKU). Thus, for example, a recombinant AAV PAH virus can be used in a medicament for treating a subject suffering from PKU. The medicament can be administered intravenously (IV), and administration of the medicament results in expression of the PAH protein in the subject at a level sufficient to alter the levels of a neurotransmitter metabolite or neurotransmitter in the subject. Optionally, the medicament can also include a prophylactic and / or therapeutic corticosteroid for the prevention and / or treatment of any liver toxicity associated with the administration of a PAH-encoding rAAV. The prophylactic or therapeutic corticosteroid treatment may include at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 mg / day or more of corticosteroid. The prophylactic or therapeutic corticosteroid-containing medication may be administered for a continuous period of at least about 3, 4, 5, 6, 7, 8, 9, 10 weeks or more. The PKU therapy may optionally include tyrosine supplementation.

[0055] The transgene incorporated into the AAV capsid can be, but is not limited to, any heterologous gene of therapeutic interest. The transgene is a nucleic acid sequence heterologous to the AAV ITR sequences flanking the transgene that encodes a polypeptide, protein, or other product of interest. The nucleic acid coding sequence is operably linked to regulatory components in a manner that allows transcription, translation, and / or expression of the transgene in the host cell.

[0056] The composition of the transgene sequence depends on the use of the resulting virus. For example, one type of transgene sequence contains a reporter sequence that generates a detectable signal upon expression. Such reporter sequences include, but are not limited to, b-lactamase, b-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, membrane-associated proteins (including, for example, CD2, CD4, CD8), influenza hemagglutinin protein, and others known in the art for which high-affinity antibodies exist or can be produced by conventional means, as well as DNA sequences encoding fusion proteins, particularly those containing membrane-associated proteins appropriately fused to antigen tag domains derived from hemagglutinin or Myc.

[0057] These coding sequences, when associated with the regulatory elements that drive their expression, provide signals that can be detected by conventional means, including enzyme assays, radiographic assays, colorimetric assays, fluorescent assays, or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunological assays, including enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), and immunohistochemistry. For example, if the marker sequence is the LacZ gene, the presence of cells infected with the rAAV encoding the signal can be detected by assaying for β-galactosidase activity. If the transgene is green fluorescent protein or luciferase, the rAAV encoding the signal can be detected by instruments that measure fluorescence or luminescence.

[0058] However, it is desirable that the transgene be a non-marker sequence that encodes a product useful in biology and medicine, such as a protein, peptide, RNA, enzyme, dominant-negative mutant, or catalytic RNA. Desirable RNA molecules include tRNA, dsRNA, ribosomal RNA, catalytic RNA, siRNA, small hairpin RNA, trans-splicing RNA, and antisense RNA. An example of a useful RNA sequence is a sequence that inhibits or eliminates the expression of a target nucleic acid sequence in the treated subject. Typically, suitable target sequences include oncological targets and viral diseases. For examples of such targets, see the tumor targets and viruses identified in the section related to immunogens below.

[0059] Transgenes can be used to correct or ameliorate genetic defects, including those in which a normal gene is expressed at less than normal levels or in which a functional gene product is not expressed. A preferred type of transgene sequence encodes a therapeutic protein or polypeptide to be expressed in infected cells. A vector genome can further include multiple transgenes, for example, to correct or ameliorate genetic defects caused by multisubunit proteins. In certain situations, different transgenes can be used to encode each subunit of a protein or to encode different peptides or proteins. This is desirable when the DNA encoding the protein subunits is large (e.g., immunoglobulins, platelet-derived growth factor, or dystrophin protein). To produce a multisubunit protein, cells are infected with a recombinant virus containing each of the different subunits. Alternatively, different subunits of a protein can be encoded by the same transgene. In this case, a single transgene contains DNA encoding each of the subunits, separated by an internal ribozyme entry site (IRES). This is desirable when the size of the DNA encoding each of the subunits is small (e.g., the total size of the DNA encoding the subunits and the IRES is less than 5 kilobases). As an alternative to an IRES, the coding sequences may be separated by a sequence encoding a 2A peptide that self-cleaves in a post-translational event. See, e.g., Donnelly et al., J. Gen. Virol., 78(Pt 1):13-21 (January 1997); Furler et al., Gene Ther., 8(11):864-873 (June 2001); Klump et al., Gene Ther., 8(10):811-817 (May 2001). This 2A peptide is significantly smaller than an IRES, making it well suited for use when space is a limiting factor.More often, when the transgene is large, consists of multiple subunits, or two transgenes are delivered simultaneously, coadministration of rAAVs carrying the desired transgene(s) or subunits allows them to concatenate in vivo to form a single vector genome. In such embodiments, for coexpression in host cells, a first AAV may carry an expression cassette expressing a single transgene, and a second AAV may carry an expression cassette expressing a different transgene. However, the selected transgene can encode any biologically active product or other product (e.g., a product desired for research).

[0060] A suitable transgene can be readily selected by one of skill in the art. The selection of the transgene is not to be construed as a limitation of the present invention. The transgene may be a heterologous protein, which may be a therapeutic protein. Exemplary therapeutic proteins include, but are not limited to, blood factors, such as b-globin, hemoglobin, tissue plasminogen activator, and clotting factors; colony-stimulating factors (CSF); interleukins, such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, and the like; growth factors, such as keratinocyte growth factor (KGF), stem cell factor (SCF), fibroblast growth factor (FGF, e.g., basic FGF), and the like. and acidic FGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), bone morphogenetic protein (BMP), epidermal growth factor (EGF), growth differentiation factor 9 (GDF-9), hepatoma-derived growth factor (HDGF), myostatin (GDF-8), nerve growth factor (NGF), neurotrophic factors, platelet-derived growth factor (PDGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-a), and transforming growth factor beta (TGF-. b.), etc.; soluble receptors, such as soluble TNF-α receptor, soluble VEGF receptor, soluble interleukin receptor (e.g., soluble IL-1 receptor and soluble type II IL-1 receptor), soluble g / dT cell receptor, ligand-binding fragments of soluble receptors, etc.; enzymes, such as α-glucosidase, imiglucarase, β-glucocerebrosidase, and alglucerase; enzyme activators, such as tissue plasminogen activator; chemokines, such as For example, 1P-10, interferon-γ-induced monokine (Mig), Groa / IL-8, RANTES, MIP-1a, MIR-1b, MCP-1, PF-4, etc.; angiogenic agents, for example, vascular endothelial growth factors (VEGF, e.g., VEGF121, VEGF165, VEGF-C, VEGF-2), glioma-derived growth factor, angiogenin, angiogenin-2, etc.; anti-angiogenic agents, for example, soluble VEGF receptors; protein vaccines;Neuroactive peptides, such as nerve growth factor (NGF), bradykinin, cholecystokinin, gastrin, secretin, oxytocin, gonadotropin-releasing hormone, β-endorphin, enkephalin, substance P, somatostatin, prolactin, galanin, growth hormone-releasing hormone, bombesin, dynorphin, warfarin, neurotensin, motilin, thyroid-stimulating hormone, neuropeptide Y, luteinizing hormone, calcitonin, insulin, glucagon, vasopressin, angiotensin II, thyroid-stimulating hormone These include: releasing hormones, vasoactive intestinal peptides, sleep peptides, etc.; thrombolytic agents; atrial natriuretic peptides; relaxin; glial fibrillary acidic protein; follicle-stimulating hormone (FSH); human alpha-1 antitrypsin; leukemia inhibitory factor (LIF); tissue factor, luteinizing hormone; macrophage-activating factor; tumor necrosis factor (TNF); neutrophil chemotactic factor (NCF); tissue inhibitors of metalloproteinases; vasoactive intestinal peptide; angiogenin; angiotropin; fibrin; hirudin; IF-1 receptor antagonists, etc. Some other non-limiting examples of proteins of interest include ciliary neurotrophic factor (CNTF); brain-derived neurotrophic factor (BDNF); neurotrophins 3 and 4 / 5 (NT-3 and 4 / 5); glial cell line-derived neurotrophic factor (GDNF); aromatic amino acid decarboxylase (AADC); hemophilia-associated coagulation proteins, e.g., factor VIII, factor IX, factor X; dystrophin, mini-dystrophin, or micro-dystrophin; lysosomal acid lipase; phenylalanine hydroxylase (PAH); glycogen storage disease-associated enzymes, e.g., glucose-6-phosphatase, acid maltase, glycogen debranching enzyme, muscle glycogen phosphorylase, liver glycogen phosphorylase, muscle phosphofructokinase, phosphorylase kinase (e.g., PHKA2), glucose transporters (e.g., GFUT2), aldolase A, β-enolase, and glycogen synthase; lysosomal enzymes (e.g., β-N-acetylhexosaminidase A);and any variants thereof. The AAV vector genome also includes conventional control elements or sequences operably linked to the transgene in a manner that allows its transcription, translation, and / or expression in cells transfected with the vector or infected with the virus. As used herein, "operably linked" sequences include both expression control sequences contiguous with the gene of interest and expression control sequences that act in trans or remotely to control the gene of interest. Suitable genes include those discussed in Anguela et al., "Entering the Modern Era of Gene Therapy," Annual Rev. of Med., Vol. 70, pages 272-288 (2019) and Dunbar et al., "Gene comes of age," Science, Vol. 359, Issue 6372, eaan4672 (2018).

[0061] Expression control sequences can be linked to the transgene. Examples of expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and, if necessary, sequences that enhance secretion of the encoded product. Many expression control sequences, including natural, constitutive, inducible, and / or tissue-specific promoters, are known in the art and can be used. Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) (see, e.g., Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the b-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1 promoter. Inducible promoters allow for the regulation of gene expression and can be regulated by the presence of exogenously supplied compounds, environmental factors such as temperature, or specific physiological states (e.g., acute phase, specific differentiation states of cells, or only in replicating cells). Inducible promoters and induction systems are available from a variety of commercial suppliers, including, but not limited to, Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by one of ordinary skill in the art.Examples of inducible promoters regulated by exogenously supplied compounds include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system [WO98 / 10088], the ecdysone insect promoter [No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], the tetracycline-repressible system [Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], and the tetracycline-inducible system [Gossen et al., Science, 268:1766-1769 (1995), Harvey et al. al., Curr. Opin. Chem. Biol., 2:512-518 (1998)], the RU486 inducible system [Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)], and the rapamycin inducible system [Magari et al., J. Clin. Invest., 100:2865-2872 (1997)]. Other types of inducible promoters that may be useful in this context are those that are regulated by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of the cell, or only in replicating cells.

[0062] Optionally, the native promoter of the transgene may be used. When the expression of the transgene should mimic the native expression, the native promoter may be preferred. The native promoter may be used when the expression of the transgene must be regulated temporally or developmentally, in a tissue-specific manner, or in response to a specific transcriptional stimulus. In further embodiments, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, may also be used to mimic the native expression.

[0063] The transgene may also comprise a gene operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is desired, a promoter active in muscle must be used. These include promoters derived from genes encoding skeletal actin, myosin light chain 2A, dystrophin, and muscle creatine kinase, as well as synthetic muscle promoters that have higher activity than naturally occurring promoters (see Li et al., Nat. Biotech., 17:241-245 (1999)). Examples of promoters that are tissue-specific are known, inter alia, for liver (albumin, Miyatake et al., J. Virol., 71:5124-32 (1997); hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), bone osteocalcin (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)); bone sialoprotein (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), lymphocytes (CD2, Hansal et al. al., J. Immunol., 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor chain), neuronal promoters, such as the neuron-specific enolase (NSE) promoter (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), the neurofilament light chain gene (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)), and the neuron-specific vgf gene (Piccioli et al., Neuron, 15:373-84 (1995)).

[0064] Recombinant AAV can be used to produce target protein in vitro, for example, in cell culture.For example, AAV can be used in the method for producing target protein in vitro, this method includes providing recombinant AAV that contains the nucleotide sequence encoding heterologous protein, and contacting recombinant AAV with cells in cell culture, thereby recombinant AAV expresses target protein in cells.The size of the nucleotide sequence encoding target protein can vary. For example, the nucleotide sequence may be at least about 0.1 kilobases (kb) in length, at least about 0.2 kb in length, at least about 0.3 kb in length, at least about 0.4 kb in length, at least about 0.5 kb in length, at least about 0.6 kb in length, at least about 0.7 kb in length, at least about 0.8 kb in length, at least about 0.9 kb in length, at least about 1 kb in length, at least about 1.1 kb in length, at least about 1.2 kb in length, at least about 1.3 kb in length, at least about 1.4 kb in length, at least about 1.5 kb in length, at least about 1.6 kb in length, at least about 1. The nucleotide may be 7 kb long, at least about 1.8 kb long, at least about 2.0 kb long, at least about 2.2 kb long, at least about 2.4 kb long, at least about 2.6 kb long, at least about 2.8 kb long, at least about 3.0 kb long, at least about 3.2 kb long, at least about 3.4 kb long, at least about 3.5 kb long, at least about 4.0 kb long, at least about 5.0 kb long, at least about 6.0 kb long, at least about 7.0 kb long, at least about 8.0 kb long, at least about 9.0 kb long, or at least about 10.0 kb long. In some embodiments, the nucleotide is at least about 1.4 kb long.

[0065] Recombinant AAV can be used to produce a protein of interest in an animal (e.g., a mammal) in vivo. Some embodiments provide a method for producing a protein of interest in vivo, comprising providing a recombinant AAV containing a nucleotide sequence encoding the protein of interest and administering the recombinant AAV to a subject, whereby the recombinant AAV expresses the protein of interest in the subject. In some embodiments, the subject can be a non-human mammal, such as a monkey, dog, cat, mouse, or cow. The size of the nucleotide sequence encoding the protein of interest can vary. For example, the nucleotide sequence may be at least about 0.1 kb in length, at least about 0.2 kb in length, at least about 0.3 kb in length, at least about 0.4 kb in length, at least about 0.5 kb in length, at least about 0.6 kb in length, at least about 0.7 kb in length, at least about 0.8 kb in length, at least about 0.9 kb in length, at least about 1 kb in length, at least about 1.1 kb in length, at least about 1.2 kb in length, at least about 1.3 kb in length, at least about 1.4 kb in length, at least about 1.5 kb in length, at least about 1.6 kb in length, at least about 1.7 kb in length The nucleotide may be at least about 1.8 kb long, at least about 2.0 kb long, at least about 2.2 kb long, at least about 2.4 kb long, at least about 2.6 kb long, at least about 2.8 kb long, at least about 3.0 kb long, at least about 3.2 kb long, at least about 3.4 kb long, at least about 3.5 kb long, at least about 4.0 kb long, at least about 5.0 kb long, at least about 6.0 kb long, at least about 7.0 kb long, at least about 8.0 kb long, at least about 9.0 kb long, or at least about 10.0 kb long. In some embodiments, the nucleotide is at least about 1.4 kb long.

[0066] Of particular interest is the use of recombinant AAVs to express one or more therapeutic proteins to treat various diseases or disorders. Non-limiting examples of diseases include cancers such as carcinoma, sarcoma, leukemia, and lymphoma; and autoimmune diseases such as multiple sclerosis. Non-limiting examples of carcinomas include esophageal cancer, hepatocellular carcinoma, basal cell carcinoma, squamous cell carcinoma (various histologies), bladder cancer including transitional cell carcinoma, bronchogenic carcinoma, colon cancer, colorectal cancer, gastric cancer, lung cancer including small cell carcinoma and non-small cell carcinoma of the lung, adrenocortical carcinoma, thyroid cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, renal cell carcinoma, ductal carcinoma in situ or bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, bone formation carcinoma, epithelial carcinoma, and nasopharyngeal carcinoma. Non-limiting examples of sarcomas include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, chordoma, osteogenic sarcoma, osteosarcoma, angiosarcoma, endothelial tumor, lymphangiosarcoma, lymphangioendothelial tumor, synoviomas, mesothelioma, Ewing's sarcoma, leiomyosarcoma, rhabdomyosarcoma, and other soft tissue sarcomas. Non-limiting examples of solid tumors include glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma. Non-limiting examples of leukemia include chronic myeloproliferative syndromes; acute myeloid leukemia; chronic lymphocytic leukemia, including B-cell CLL, T-cell CLL, prolymphocytic leukemia, and hairy cell leukemia; and acute lymphoblastic leukemia. Examples of lymphomas include, but are not limited to, B-cell lymphomas, such as Burkitt's lymphoma, Hodgkin's lymphoma, and the like.

[0067] Other non-limiting examples of diseases that can be treated using the rAAVs and methods disclosed herein include sickle cell disease, cystic fibrosis, lysosomal acid lipase (LAL) deficiency, Tay-Sachs disease, phenylketonuria, mucopolysaccharidoses, glycogen storage diseases (GSDs, e.g., GSD types I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII, XIII, and XIV), galactosemia, muscular dystrophies (e.g., Duchenne muscular dystrophy), and hemophilia (e.g., hemophilia A (classical hemophilia) and hemophilia B (Christmas disease)), Wilson's disease, Fabry disease, Gaucher disease, hereditary angioedema (HAE), and alpha-1 antitrypsin deficiency. In addition, the rAAVs and methods disclosed herein can be used to treat other disorders that can be treated by local expression of a transgene in the liver or by expression of a secreted protein from the liver or hepatocytes.

[0068] The amount of heterologous protein expressed in a subject (e.g., in the serum of a subject) can vary. For example, in some embodiments, the protein is expressed in the serum of the subject at a concentration of at least about 9 milligrams (mg) / mL, at least about 10 mg / mL, at least about 11 mg / mL, at least about 12 mg / mL, at least about 13 mg / mL, at least about 14 mg / mL, at least about 15 mg / mL, at least about 16 mg / mL, at least about 17 mg / mL, at least about 18 mg / mL, at least about 19 mg / mL, at least about 20 mg / mL, at least about 21 mg / mL, at least about 22 mg / mL, at least about 23 mg / mL, at least about 24 mg / mL, at least about 25 mg / mL, at least about 26 mg / mL, at least about 27 mg / mL, at least about 28 mg / mL, at least about 30 mg / mL, at least about 31 mg / mL, at least about 32 mg / mL, at least about 33 mg / mL, at least about 34 mg / mL, at least about 35 mg / mL, at least about 36 mg / mL, at least about 37 mg / mL, at least about 38 mg / mL, at least about 39 mg / mL, at least about 40 mg / mL, at least about 41 mg / mL, at least about 42 mg / mL, at least about 43 mg / mL, at least about 44 mg / mL, at least about 45 mg / mL, at least about 46 mg / mL, at least about 47 mg / mL, at least about 48 mg / mL, at least about 49 mg / mL, at least about 50 mg / mL, at least about 51 mg / mL, at least about 52 mg / mL, at least about 53 mg / mL, at least about 54 mg / mL, at least about 55 mg / mL In some embodiments, the agonist may be expressed in an amount of at least about 29 mg / mL, at least about 30 mg / mL, at least about 31 mg / mL, at least about 32 mg / mL, at least about 33 mg / mL, at least about 34 mg / mL, at least about 35 mg / mL, at least about 36 mg / mL, at least about 37 mg / mL, at least about 38 mg / mL, at least about 39 mg / mL, at least about 40 mg / mL, at least about 41 mg / mL, at least about 42 mg / mL, at least about 43 mg / mL, at least about 44 mg / mL, at least about 45 mg / mL, at least about 46 mg / mL, at least about 47 mg / mL, at least about 48 mg / mL, at least about 49 mg / mL, or at least about 50 mg / mL. The protein of interest may be expressed in the serum of a subject in an amount of about 9 picograms (pg) / mL, about 10 pg / mL, about 50 pg / mL, about 100 pg / mL, about 200 pg / mL, about 300 pg / mL, about 400 pg / mL, about 500 pg / mL, about 600 pg / mL, about 700 pg / mL, about 800 pg / mL, about 900 pg / mL, about 1000 pg / mL, about 1500 pg / mL, about 2000 pg / mL, about 2500 pg / mL, or a range between any two of these values.Those skilled in the art will understand that the expression level required for therapeutic efficacy of a protein of interest may vary depending on factors such as, but not limited to, the particular protein of interest and the subject being treated, and that an effective amount of protein can be readily determined by one of skill in the art using conventional methods known in the art without undue experimentation.

[0069] Methods for producing adeno-associated viruses

[0070] The present disclosure provides materials and methods for producing rAAV virions in cells, such as insect cells.

[0071] Methods for producing AAV viral particles are described, for example, in U.S. Patent Nos. 6,204,059, 5,756,283, 6,258,595, 6,261,551, 6,270,996, 6,281,010, 6,365,394, 6,475,769, 6,482,634, 6,485,966, 6,943,019, 6,953,690, 7,022,519, 7,238,526, 7,291,498, and 7,491,508, 5,064,764, 6,194,191, 6,566,118, and 6,566,118. International Publication No. 8137948, or International Publication No. 1996 / 039530, International Publication No. 1998 / 010088, International Publication No. 1999 / 014354, International Publication No. 1999 / 015685, International Publication No. 1999 / 047691, International Publication No. 2000 / 055342, International Publication No. 2000 / 07 No. 5353, No. 2001 / 023597, No. 2015 / 191508, No. 2019 / 217513, No. 2018 / 022608, No. 2019 / 222136, No. 2020 / 232044, No. 2019 / 222132, Methods In Molecular Biology, ed. Richard, Humana Press, NJ (1995), O'Reilly et al., Baculovirus Expression Vectors, A Laboratory Manual, Oxford University Press (1994), Samulski et al., J. Vir. 63:3822-8 (1989), Kajigaya et al., Proc. Nat'l. Acad. Sci. USA 88:4646-50 (1991), Ruffing et al., J. Vir. 66:6922-30 (1992), Kimbauer et al., Vir., 219:37-44 (1996), Zhao et al., Vir. 272:382-93 (2000), the contents of each of which are incorporated herein by reference in their entirety.

[0072] For example, cells such as insect cells, yeast cells, and mammalian cells (e.g., human cells or non-human mammalian cells) can produce rAAV. For example, the cells can produce provided AAV helper functions, AAV non-helper functions, and nucleotide sequences that the cells use to produce the AAV vector genome. In various embodiments, the AAV helper functions, AAV non-helper functions, and nucleotide sequences that the cells use to produce the rAAV are provided by a vector that is delivered to the cell, e.g., via transfection with a transfection reagent, via transduction / infection with another recombinant virus, by integrating the nucleotide sequences into the genome of the cell, or by other methods.

[0073] The term "vector" is understood to refer to any genetic element that, when associated with appropriate control elements, can replicate and transmit genetic sequences between cells, such as a plasmid, phage, transposon, cosmid, bacmid, miniplasmid (e.g., a plasmid without bacterial elements), dogbone DNA (e.g., a minimal closed linear construct), chromosome, virus, or virion (e.g., baculovirus). As used herein, "insect cell-compatible vector" or "vector" refers to a nucleic acid molecule capable of productive transformation or transfection of an insect or insect cell. Exemplary biological vectors include plasmids, linear nucleic acid molecules, and recombinant viruses. Any vector can be used as long as it is insect cell-compatible. While the vector can be integrated into the insect cell genome, the presence of the vector in the insect cell need not be permanent; transient episomal vectors are also included. The vector can be introduced by any known means, such as chemical treatment, electroporation, or infection of the cells. Baculovirus vectors and methods for their use are described in the above-cited references regarding molecular engineering of insect cells.

[0074] The vector from which the cell produces the rAAV vector genome can include a promoter and a restriction site downstream of the promoter to allow insertion of a polynucleotide encoding one or more proteins of interest, the promoter and restriction site being located downstream of the 5' AAV ITR and upstream of the 3' AAV ITR. The vector can also include post-transcriptional regulatory elements downstream of the restriction site and upstream of the 3' AAV ITR. The viral construct can further include a polynucleotide inserted into the restriction site and operably linked to the promoter, the polynucleotide including the coding region for the protein of interest.

[0075] The term "AAV helper" refers to AAV-derived coding sequences that can be expressed to provide AAV gene products that then function in trans for productive AAV replication. AAV helper functions therefore include both the major AAV open reading frames (ORFs), rep and cap. The Rep expression product has been shown to have many functions, including, inter alia: recognition, binding, and nicking of the AAV origin of DNA replication; DNA helicase activity; and regulation of transcription from an AAV (or other heterologous) promoter. The capsid (Cap) expression product supplies the necessary packaging function. AAV helper functions are used herein to complement in trans AAV functions missing from the AAV vector genome.

[0076] In various embodiments, vectors providing AAV helper functions include nucleotide sequence(s) encoding capsid proteins or Rep proteins. Any AAV serotype (including but not limited to, AAV1 (NCBI Reference SEQ ID NO / Genbank Accession No. NC_002077.1), AAV2 (NCBI Reference SEQ ID NO / Genbank Accession No. NC_001401.2), AAV3 (NCBI Reference SEQ ID NO / Genbank Accession No. NC_001729.1), AAV3B (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV4 (NCBI Reference SEQ ID NO / Genbank Accession No. NC_001829.1), AAV5 (NCBI Reference SEQ ID NO / Genbank Accession No. NC_006152.1), AAV6 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV7 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV8 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV9 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV10 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV11 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV12 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV13 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV14 (NCBI Reference SEQ ID NO / Genbank Accession No. AF028705.1), AAV15 (NCBI Reference SEQ ID NO / Genbank Accession No. AF0 F028704.1), AAV7 (NCBI Reference SEQ ID NO. / Genbank accession number NC_006260.1), AAV8 (NCBI Reference SEQ ID NO. / Genbank accession number NC_006261.1), AAV9 (NCBI Reference SEQ ID NO. / Genbank accession number AX753250.1), AAV10 (NCBI Reference SEQ ID NO. / Genbank accession number AY631965.1), AAV11 (NCBI Reference SEQ ID NO. / Genbank accession number AY631966.1), AAV12 (NCBI Reference SEQ ID NO. / Genbank accession number DQ813647.1), AAV13 (NCBI Reference SEQ ID NO. / Genbank accession number EU285562.1),1)Bba21, Bba26, Bba27, Bba29, Bba30, Bba31, Bba32, Bba33, Bba34, Bba35, Bba36, Bba37, Bba38, Bba41, Bba42, Bba43, Bba44, Bce14, Bce15, Bce16, Bce17, Bce18, Bce2 0, Bce35, Bce36, Bce39, Bce40, Bce41, Bce42, Bce43, Bce44, Bce45, Bce46, Bey20, Bey22, Bey23, Bma42, Bma43, Bpo1, Bpo2, Bpo3, Bpo4, Bpo6, Bpo8, Bpo13, Bpo18, Bpo2 AAV-rh10, AAV-rh39, AAV-rh43, AAVanc80L65, or any variant thereof) can be used herein to produce a recombinant AAV. Exemplary capsids are also provided in International Application Nos. 2018 / 022608 and 2019 / 222136, which are incorporated by reference in their entireties. Each NCBI reference sequence or Genbank accession number provided above is also incorporated by reference herein. In some embodiments, the AAV cap gene encodes a capsid from serotype 1, serotype 2, serotype 3, serotype 3B, serotype 4, serotype 5, serotype 6, serotype 7, serotype 8, serotype 9, serotype 10, serotype 11, serotype 12, serotype 13, or a variant thereof.

[0077] For production, cells with AAV helper functions produce sufficient recombinant capsid proteins to form capsids. This includes at least the VP1 and VP3 proteins, but more typically includes all three of the VP1, VP2, and VP3 proteins found in native AAV. The sequence of the capsid proteins determines the serotype of the AAV virions produced by the host cells. Capsids useful in the present invention include those derived from several AAV serotypes, including 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or mixed serotypes (see, e.g., U.S. Patent No. 8,318,480 for its disclosure of non-native mixed serotypes). Capsid proteins can also be variants of native VP1, VP2, and VP3, including mutated, chimeric, or shuffled proteins. Capsid proteins can be rh.10 or other subtypes within various AAV clades. The various clades and subtypes are disclosed, for example, in U.S. Patent No. 7,906, 111. Due to the wide range of constructs available and extensive characterization, the exemplary AAV vectors disclosed below are derived from serotype 2. The construction and use of AAV vectors and AAV proteins of different serotypes are discussed in Chao et al., Mol. Ther. 2:619-623, 2000; Davidson et al., PNAS 97:3428-3432, 2000; Xiao et al., J. Virol. 72:2224-2232, 1998; Halbert et al., J. Virol. 74:1524-1532, 2000; Halbert et al., J. Virol. 75:6615-6624, 2001; and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, 2001.

[0078] In various embodiments, the nucleotide sequence encoding the VP protein can be operably linked to a suitable expression control sequence, for example, the nucleotide sequence can be operably linked to a baculovirus promoter, such as the Polh promoter, ΔIE1 promoter, p5 promoter, p10 promoter, p40 promoter, metallothionein promoter, 39K promoter, p6.9 promoter, and orf46 promoter.

[0079] In different embodiments, the 39K promoter comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99%, more than 99%, or 100% identical to SEQ ID NO:1.

[0080] TTCGGACTGCTTGACTCGCAGCGAAATACAAGCGCTGTTCAGGGAAGCCATCAACACGCTCAAGCACACGATGAACACAGAAAACGTCTGCGCGCACATGTTGGACATCGTGTCGTTTGAGCGTATAAAAGAATATATAAGAGCTAA TTTAGGCCATTTCACAGTAATCACCGACAAATGTTCGAAGCGTAAGGTGTGTCTTCATCACAAACGAATTGCCAGGTTGTTGGGCATTAAAAAAATATATCATCAAGAATACAAACGGGTTGTTTCAAAGGTTTACAAGAAGCAAAC

[0081] In different embodiments, the p6.9 promoter comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99%, more than 99%, or 100% identical to SEQ ID NO:2.

[0082] AAATTCCGTTTTGCGACGATGCAGAGTTTTTGAACAGGCTGCTCAAACACATAGATCCGTACCCGCTAGTCGGATGTATTACAATGCAGCCAATACCATGTTTTACACGACTATGGAAAACTATGCCGTGTCCAATTGCAAGTTCAACATTGAGGATTACA ATAACATATTTAAGGTGATGGAAAATATTAGGAAACACAGCAACAAAAATTCAAACGACCAAGACGAGTTAAACATATATTTGGGAGTTCAGTCGTCGAATGCAAAGCGTAAAAAATATTAATAAGGTAAAAATTACAGCTACATAAATTACACAATTTAAAC

[0083] In different embodiments, the Polh promoter comprises a nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99%, more than 99%, or 100% identical to SEQ ID NO:3.

[0084] ATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCG

[0085] For production, cells with AAV helper functions produce Rep proteins to facilitate rAAV production. It has been found that infectious particles can be produced when at least one large Rep protein (Rep78 or Rep68) and at least one small Rep protein (Rep52 and Rep40) are expressed in cells. In certain embodiments, all four of Rep78, Rep68, Rep52, and Rep40 are expressed. Alternatively, Rep78 and Rep52, Rep78 and Rep40, Rep68 and Rep52, or Rep68 and Rep40 are expressed. The following example demonstrates the use of a Rep78 / Rep52 combination. The Rep proteins can be derived from AAV-2 or other serotypes. In various embodiments, the nucleotide sequence encoding the Rep proteins can be operably linked to suitable expression control sequences. For example, the nucleotide sequence can be operably linked to a baculovirus promoter such as the polyhedrin (Polh) promoter, ΔIE1 promoter, p5 promoter, p10 promoter, p40 promoter, metallothionein promoter, 39K promoter, p6.9 promoter, and orf46 promoter.

[0086] Cells with AAV helper functions can also produce assembly-activating proteins (AAPs), which assist in capsid assembly. In various embodiments, the nucleotide sequence encoding the AAP can be operably linked to a suitable expression control sequence. For example, the nucleotide sequence can be operably linked to a baculovirus promoter, such as the polyhedrin (Polh) promoter, ΔIE1 promoter, p5 promoter, p10 promoter, p40 promoter, metallothionein promoter, 39K promoter, p6.9 promoter, orf46 promoter.

[0087] The term "non-AAV helper functions" refers to non-AAV-derived viral and / or cellular functions on which AAV depends for replication. Thus, this term refers to proteins and RNAs required for AAV replication, including those involved in AAV gene transcription activation, stage-specific AAV mRNA splicing, AAV DNA replication, Cap expression product synthesis, and AAV capsid assembly. Viral-based accessory functions can be derived from any of the known helper viruses, such as adenovirus, herpesvirus (excluding herpes simplex virus type 1), and vaccinia virus.

[0088] The term "non-AAV helper function vector" generally refers to a nucleic acid molecule containing a nucleotide sequence that provides an accessory function. The accessory function vector can be transfected into a suitable host cell, and the vector can then support the production of AAV virions in the host cell. Naturally occurring infectious virus particles, such as adenovirus, herpesvirus, or vaccinia virus particles, are explicitly excluded from this term. Thus, the accessory function vector may be in the form of a plasmid, phage, transposon, or cosmid. In particular, it has been demonstrated that a full complement of adenovirus genes is not required for accessory helper function. For example, adenovirus mutants incapable of DNA replication and late gene synthesis have been shown to be permissive for AAV replication. (Ito et al., (1970) J. Gen. Virol. 9:243; Ishibashi et al., (1971) Virology 45:317). Similarly, mutations in the E2B and E3 regions have been shown to support AAV replication, indicating that the E2B and E3 regions are probably not involved in providing accessory functions. Carter et al., (1983) Virology 126:505. However, adenoviruses defective in the E1 region or deleted in the E4 region cannot support AAV replication. Thus, the E1A and E4 regions are likely required, either directly or indirectly, for AAV replication. Laughlin et al., (1982) J. Virol. 41:868; Janik et al., (1981) Proc. Natl. Acad. Sci. USA 78:1925; Carter et al., (1983) Virology 126:505.Other characterized Ad mutants include E1B (Laughlin et al. (1982), supra; Janik et al. (1981), supra; Ostrove et al. (1980) Virology 104:502), E2A (Handa et al. (1975) J. Gen. Virol. 29:239; Strauss et al. (1976) J. Virol. 17:140; Myers et al. (1980) J. Virol. 35:665; Jay et al. (1981) Proc. Natl. Acad. Sci. USA 78:2927; Myers et al. (1981) J. Biol. Chem. 256:567); E2B (Carter, Adeno-Associated Virus Helper Functions, I CRC Handbook of Parvoviruses (P. Tijssen ed., 1990); E3 (Carter et al. (1983), supra); and E4 (Carter et al. (1983), supra; Carter (1995)). Studies of accessory functions provided by adenoviruses with mutations in the E1B coding region have yielded conflicting results, although Samulski et al. (1988) J. Virol. 62:206-210 recently reported that E1B55k, but not E1B19k, is required for AAV virion production. In addition, WO 97 / 17458 and Matshushita et al. (1998) Gene Therapy 5:938-945 describe accessory function vectors encoding various Ad genes. A particularly preferred accessory function vector comprises an adenovirus VA RNA coding region, an adenovirus E4 ORF6 coding region, an adenovirus E2A 72 kD coding region, an adenovirus E1A coding region, and an adenovirus E1B region lacking an intact E1B55k coding region. Such vectors are described in WO 01 / 83797.

[0089] The use of insect cells for the expression of heterologous proteins is well documented, as are methods for introducing nucleic acids, e.g., vectors, e.g., insect cell-compatible vectors, into such cells and methods for maintaining such cells in culture. (For example, METHODS IN MOLECULAR BIOLOGY, ed. Richard, Humana Press, NJ (1995), O'Reilly et al., BACULOVIRUS EXPRESSION VECTORS, A LABORATORY MANUAL, Oxford Univ. Press (1994), Samulski et al. al., J. Vir. (1989) vol. 63, pp. 3822-3828, Kajigaya et al., Proc. Nat'l. Acad. Sci. USA (1991) vol. 88, pp. 4646-4650, Ruffing et al., J. Vir. (1992) vol. 66, pp. 6922-6930, Kirnbauer et al., Vir. (1996) vol. 219, pp. 37-44, Zhao et al. (See, e.g., U.S. Patent No. 6,204,059.) Examples of insect cell lines that can be used include Spodoptera frugiperda, e.g., Sf9, Sf21, Sf900+, drosophila cell lines, mosquito cell lines, e.g., Aedes albopictus-derived cell lines, domesticated silkworm cell lines, e.g., Bombyx mori cell lines, Trichoplusia ni cell lines, e.g., High Five cell lines, or lepidopteran cell lines, e.g., Ascalapha odorata cell lines. Exemplary insect cells are cells from insect species that are susceptible to baculovirus infection, including High Five, Sf9, Sf-RVN, Se301, SeIZD2109, SeUCR1, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, BM-N, Ha2302, Hz2E5, and Ao38.

[0090] In various embodiments, insect cells containing vectors for rAAV production are provided. Recombinant baculoviruses (rBVs) containing nucleotide sequences for rAAV production can be used to deliver these nucleotide sequences into insect cells for rAAV production. Baculoviruses, such as rBVs, are enveloped DNA viruses of arthropods, two of which are well-known expression vectors for producing recombinant proteins in cell culture. Baculoviruses have circular, double-stranded genomes (80-200 kbp) that can be engineered to allow delivery of large amounts of genomic content to specific cells. Viruses used as vectors are typically Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV) or Bombyx mori nuclear polyhedrosis virus (Bm-NPV) (Katou, Yasuhiro, et al., Virology 404.2 (2010):204-214). Baculoviruses are commonly used to infect insect cells for recombinant protein expression.In particular, the expression of heterologous genes in insects has been described, for example, in U.S. Pat. No. 4,745,051; Friesen, P.D., and L.K. Miller., Current Topics in Microbiology and Immunology 131 (1986): 31-49; EP 127839; EP 155476; Vlak, Just M., et al., Journal of General Virology 69.4 (1988): 765-776; Miller, Lois K., Annual Reviews in Microbiology 42.1 (1988): 177-199; Carbonell, Luis F., et al., Gene 73.2 (1988): 409-418; Maeda, Susumu, et al., Nature 315.6020 (1985): 592-594; Lebacq-Verheyden, Anne-Marie, et al. al., Molecular and cellular biology 8.8(1988):3129-3135; Smith, Gale E., et al., Proceedings of the National Academy of Sciences 82.24(1985):8404-8408; Miyajima, Atsushi, et al., Gene 58.2-3(1987):273-281; ​​and Martin, Brian M., et al., DNA 7.2(1988):99-106.Numerous baculovirus strains and variants, as well as corresponding permissive insect host cells that can be used for protein production, are described in Luckow, Verne A., and Max D. Summers., Bio / technology 6.1 (1988): 47-55; Miller et al. (1986) Genetic Engineering, Principles and Methods, Vol. 8 (eds. J. Setlow and A. Hollaender), Plenum Press, NY, pp. 277-298, 1986); Maeda, Susumu, et al., Nature 315.6020 (1985): 592-594; and McKenna, Kevin A., Huazhu Hong, and Robert R. Granados., Journal of Invertebrate Pathology 71.1 (1998): 82-90.

[0091] To generate recombinant baculovirus (rBV), a donor vector and bacmid or a transfer vector and linearized baculovirus DNA are used. Bacmids are propagated as large plasmids in bacteria such as Escherichia coli. When transfected into insect cells, bacmids generate baculovirus. Traditional baculovirus generation, such as that in Invitrogen's Bac-to-Bac system, generates recombinant baculovirus by site-specific transposition in E. coli. High-molecular-weight bacmid DNA is then isolated and transfected into Sf9 or Sf21 cells, from which recombinant baculovirus is isolated and amplified.

[0092] Insect cells can be separately transfected with bacmids carrying the nucleotide sequence of the rAAV vector genome or carrying nucleotide sequences that provide AAV helper functions to generate rBVs, and these different rBVs are then used to coinfect naive insect cells to generate rAAVs.

[0093] A key problem with currently used protocols for AAV production in insect cells is the instability of baculovirus. This instability leads to the generation of defective interfering particles (DIPs). This instability is caused, in part, by the inherent instability of baculovirus genome replication, which can result in large deletions containing the gene of interest and low rAAV productivity. A common mitigation strategy to address this issue involves passaging and infection with rBV at a very low multiplicity of infection (MOI). (MOI refers to the average number of viral particles infecting each cell, i.e., the number of viruses added per cell during infection.) A second strategy is to clone the rBV to select for stability. Other strategies involve modifying the baculovirus backbone to optimize stability, for example, by relocating a selection marker near a critical gene and / or by moving or deleting a repetitive hr region.

[0094] As described above, one strategy for addressing baculovirus instability involves using a low MOI, which somewhat improves baculovirus instability on a small scale, but the improvement is not sufficient for commercial production.

[0095] For example, it has been discovered that the baculovirus (BV) genome is unstable, with deletions occurring in the rep and cap genes or therapeutic genes after multiple passages. These deletions impair rAAV productivity. To address the deletions and reduced productivity, different processes have been developed. The first process involves banking a stable E. coli clone with a bacmid and propagating the bacmid within the clone. The second process involves transfecting Sf cells in suspension to generate BV and isolating passage 0 (P0) BV for rAAV production. The third process involves infecting Sf cells with P0 BV at an ultra-low multiplicity of infection (MOI) (e.g., less than 0.01) to produce rAAV.

[0096] In various embodiments, the method for producing rAAV includes infecting cells with at least one recombinant baculovirus (rBV). The at least one rBV has a nucleotide sequence for producing rAAV. The method further includes culturing the infected cells to produce rAAV. In this method, the at least one rBV is isolated from at least one cell culture containing cells transfected with at least one of the nucleotide sequences. For example, at least one of the nucleotide sequences is in a bacmid.

[0097] In various embodiments, rAAV is produced using any insect cell type that allows for the production of AAV or a biological product, can be maintained in culture, and is susceptible to baculovirus infection, including, but not limited to, High Five, Sf9, Sf-RVN, Se301, SeIZD2109, SeUCR1, Sf900+, Sf21, BTI-TN-5B1-4, MG-1, Tn368, HzAm1, BM-N, Ha2302, Hz2E5, and Ao38.

[0098] In various embodiments, a method for producing rAAV includes infecting cells with at least one recombinant baculovirus (rBV). The at least one rBV comprises a nucleotide sequence for producing rAAV. The method further includes culturing the infected cells to produce rAAV. In this method, prior to the infecting step, the at least one rBV is isolated from at least one cell culture comprising cells having at least a portion of a baculovirus genome. The cells are also transfected with at least one nucleotide sequence that combines with at least a portion of the baculovirus genome to form a baculovirus genome capable of producing rBV. For example, a linearized baculovirus genome can be recombined with a nucleotide molecule to produce a baculovirus genome comprising the nucleotide molecule, such that cells having the newly formed baculovirus genome can produce rBV.

[0099] In various embodiments, the method of producing rAAV includes infecting cells with passage 0 (PO) rBV and culturing the infected cells to produce rAAV. The PO rBV contains the nucleotide sequence for producing rAAV. In other embodiments, the rBV used to infect cells to produce rAAV is less than passage 1.

[0100] In various embodiments, a method for large-scale rBV-based rAAV production using at least one rBV is disclosed, comprising the steps of generating a bank of recombinant E. coli containing a bacmid having an AAV rep gene, an AAV cap gene, and an rAAV vector genome, cryopreserving the E. coli bank, thawing the E. coli bank, isolating the bacmid from the thawed E. coli bank, transfecting insect cells with the bacmid from the thawed E. coli bank and culturing the transfected insect cells, isolating the rBV from the transfected insect cells, and further infecting the insect cells with the isolated rBV in a bioreactor and culturing the infected insect cells to produce rAAV.

[0101] The term "passage" in reference to rBV refers to the process of increasing the concentration of rBV by infecting naive insect cells, such as Sf9 cells, in culture to produce more rBV. The number associated with the term "passage" refers to the successive times that a bacmid or rBV from a previous passage is used to produce more rBV. For example, transfecting at least a portion of naive Sf9 cells in culture with a bacmid and culturing these cells produces passage 0 or P0 rBV, which is isolated. When P0 rBV is used to infect at least a portion of naive Sf9 cells in culture, these cells produce P1 rBV.

[0102] In various embodiments, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least more than 99%, or 100% of the P0 rBV produced by the methods of various embodiments have a nucleotide sequence for generating an rAAV.

[0103] In various embodiments, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 1110%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, %, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% have a nucleotide sequence for generating an rAAV. In other embodiments, the percentage of P0 rBV produced by the methods of various embodiments that have a nucleotide sequence for generating an rAAV ranges between any two of the percentages provided above.

[0104] In various embodiments, an E. coli bank or clone is grown to a predetermined cell density to extract a predetermined concentration of bacmid and the cells are transfected in a culture volume of at least 5 milliliters (mL), at least 10 mL, at least 50 mL, at least 100 mL, at least 500 mL, at least 1 liter (L), at least 10 L, at least 50 L, at least 100 L, at least 250 L, at least 500 L, at least 1000 L, at least 1500 L, at least 2000 L, or at least 2500 L.

[0105] In various embodiments, the transfected cells are cultured for about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 240 hours after transfection, or for a time between any of these two time points.

[0106] In various embodiments, the method of producing rAAV includes infecting cells with rBV at a multiplicity of infection (MOI) of less than 0.01. The rBV comprises a nucleotide sequence for producing the rAAV. The method also includes culturing the infected cells to produce the rAAV. The nucleotide sequence for producing the rAAV of various embodiments provides an rAAV vector genome and includes nucleotide sequences encoding Rep and capsid proteins.

[0107] In various embodiments, a method for large-scale rBV-based rAAV production using at least one rBV is disclosed, comprising the steps of separately transfecting a quantity of insect cells in suspension with a bacmid comprising the AAV rep gene encoding the Rep protein, the AAV cap gene encoding the Cap protein, and nucleotide sequences providing the rAAV vector genome, culturing the transfected insect cells and isolating the rBV, further infecting the insect cells with the rBV in a bioreactor, and culturing the infected insect cells to produce rAAV. The amount in various embodiments is, for example, at least 0.0001 milliliters (mL), at least 0.0005 mL, at least 0.001 mL, at least 0.005 mL, at least 0.01 mL, at least 0.05 mL, at least 0.1 mL, at least 0.5 mL, at least 1 mL, at least 5 mL, at least 10 mL, at least 20 mL, at least 30 mL, at least 40 mL, at least 50 mL, at least 60 mL, at least 70 mL, at least 80 mL, at least 90 mL, at least 100 mL, at least 200 mL, at least 300 mL, at least 400 mL, or at least 500 mL.

[0108] The terms "multiplicity of infection" and "MOI" refer to the ratio of the total number of virus particles added per cell during infection. For example, 1 x 10 6 1 x 10 rBV particles 6 When added to a culture containing cells, the MOI is 1.

[0109] In various embodiments, the MOI is 0.01, 0.0099, 0.0098, 0.0097, 0.0096, 0.0095, 0.0094, 0.0093, 0.0092, 0.0091, 0.009, 0.0089, 0.0088, 0.0087, 0.0086, 0.0085, 0.0084, 0.0083, 0.0082, 0.0081, 0.008, 0.0079, 0.0078, 0.0077, 0.0076, 0.0075, 0.0074, 0.0073, 0.0072, 0.0071, 0.007, 0.0069, 0.0068, 0.0067, 0.007 ... .0066, 0.0065, 0.0064, 0.0063, 0.0062, 0.0061, 0.006, 0.0059, 0.0058, 0.0057, 0.0056, 0.0055, 0.0054, 0.0053, 0.0052, 0.0051, 0.005, 0.0049, 0. 0048, 0.0047, 0.0046, 0.0045, 0.0044, 0.0043, 0.0042, 0.0041, 0.004, 0.0039, 0.0038, 0.0037, 0.0036, 0.0035, 0.0034, 0.0033, 0.0032, 0.0031, 0. 003, 0.0029, 0.0028, 0.0027, 0.0026, 0.0025, 0.0024, 0.0023, 0.0022, 0.0021, 0.002, 0.0019, 0.0018, 0.0017, 0.0016, 0.0015, 0.0014, 0.0013, 0.0 012, 0.0011, 0.001, 0.00099, 0.00098, 0.00097, 0.00096, 0.00095, 0.00094, 0.00093, 0.00092, 0.00091, 0.0009, 0.00089, 0.00088, 0.00087, 0.000 86, 0.00085, 0.00084, 0.00083, 0.00082, 0.00081, 0.0008, 0.00079, 0.00078, 0.00077, 0.00076, 0.00075, 0.00074, 0.00073, 0.00072, 0.00071, 0.0 007, 0.00069, 0.00068, 0.00067, 0.00066, 0.00065, 0.00064, 0.00063, 0.00062, 0.00061, 0.0006, 0.00059, 0.00058, 0.00057, 0.00056, 0.00055, 0.00054、0.00053、0.00052、0.00051、0.0005、0.00049、0.00048、0.00047、0.00046、0.00045、0.00044、0.00043、0.00042、0.00041、0.0004、0.00039、0.00038、0.00037、0.00036、0.00035、0.00034、0.00033、0.00032、0.00031、0.0003、0.00029、0.00028、0.00027、0.00026、0.00025、0.00024、0.00023、0.00022、0.00021、0.0002、0.00019、0.00018、0.00017、0.00016、0.00015、0.00014、0.00013、0.00012、0.00011、0.0001、0.000099、0.000098、0.000097、0.000096、0.000095、0.000094、0.000093、0.000092、0.000091、0.00009、0.000089、0.000088、0.000087、0.000086、0.000085、0.000084、0.000083、0.000082、0.000081、0.00008、0.000079、0.000078、0.000077、0.000076、0.000075、0.000074、0.000073、0.000072、0.000071、0.00007、0.000069、0.000068、0.000067、0.000066、0.000065、0.000064、0.000063、0.000062、0.000061、0.00006、0.000059、0.000058、0.000057、0.000056、0.000055、0.000054、0.000053、0.000052、0.000051、0.00005、0.000049、0.000048、0.000047、0.000046、0.000045、0.000044、0.000043、0.000042、0.000041、0.00004、0.000039、0.000038、0.000037、0.000036、0.000035、0.000034、0.000033、0.000032、0.000031、0.00003、0.000029、0.000028、0.000027、0.000026、0.000025、0.000024、0.000023、0.000022、0.000021、0.00002、0.000019、0.000018、0.000017、0.000016、0.000015、0.000014、0.000013、0.000012、0.000011、0.00001、0.0000099、0.0000098、0.0000097、0.0000096、0.0000095、0.0000094、0.0000093、0.0000092、0.0000091、0.000009、0.0000089、0.0000088、0.0000087、0.0000086、0.0000085、0.0000084、0.0000083、0.0000082、0.0000081、0.000008、0.0000079、0.0000078、0.0000077、0.0000076、0.0000075、0.0000074、0.0000073、0.0000072、0.0000071、0.000007、0.0000069、0.0000068、0.0000067、0.0000066、0.0000065、0.0000064、0.0000063、0.0000062、0.0000061、0.000006、0.0000059、0.0000058、0.0000057、0.0000056、0.0000055、0.0000054、0.0000053、0.0000052、0.0000051、0.000005、0.0000049、0.0000048、0.0000047、0.0000046、0.0000045、0.0000044、0.0000043、0.0000042、0.0000041、0.000004、0.0000039、0.0000038、0.0000037、0.0000036、0.0000035、0.0000034、0.0000033、0.0000032、0.0000031、0.000003、0.0000029、0.0000028、0.0000027、0.0000026、0.0000025、0.0000024、0.0000023、0.0000022、0.0000021、0.000002、0.0000019、0.0000018、0.0000017、0.0000016、0.0000015, 0.0000014, 0.0000013, 0.0000012, 0.0000011, 0.000001, 0.000001 , 9e-7, 8e-7, 7e-7, 6e-7, 5e-7, 4e-7, 3e-7, 2e-7, 1e-7, 9e-8, 8e-8, 7e-8, 6e-8 , 5e-8, 4e-8, 3e-8, 2e-8, 1e-8, 9e-9, 8e-9, 7e-9, 6e-9, 5e-9, 4e-9, 3e-9, 2e-9, 1e-9, 9e-10, 8e-10, 7e-10, 6e-10, 5e-10, 4e-10, 3e-10, 2e-10, 1e-10. In other embodiments, the MOI is less than 1 virion, 2 virions, 3 virions, 4 virions, 5 virions, 6 virions, 7 virions, 8 virions, 9 virions, or 10 virions. In other embodiments, the number of rBV particles added to the culture ranges from 0.01 MOI to 1 virion, 0.01 MOI to 2 virions, 0.01 MOI to 3 virions, 0.01 MOI to 4 virions, 0.01 MOI to 5 virions, 0.01 MOI to 6 virions, 0.01 MOI to 7 virions, 0.01 MOI to 8 virions, 0.01 MOI to 9 virions, or 0.01 MOI to 10 virions.

[0110] In various embodiments, use of a P0 rBV or rBV MOI of less than 0.01 results in at least a 1%, at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 200%, at least 300%, at least 400%, at least 500%, at least 600%, at least 700%, at least 800%, at least 900%, at least 1000%, at least 5000%, at least 100000%, at least 100000%, at least a 7 log increase, at least an 8 log increase, or at least a 9 log increase in rAAV titer. For example, an increase in rAAV titer is relative to rBV at 1 or more passages or an MOI of rBV of 0.01 or more.

[0111] In various embodiments, the rBVs used to infect cells for rAAV production include a first rBV having a nucleotide sequence for the rAAV vector genome and one or more second rBVs having nucleotide sequences encoding the Rep and Cap proteins. In various embodiments, the cells are infected at an MOI of the first rBV:MOI of the one or more second rBVs ranging from 0.01 to 10.0, 0.05 to 7.5, 0.1 to 5, 0.5 to 5, 0.7 to 3.0, 0.8 to 3.0, 0.9 to 3.0, or 1.0 to 3.0. In other embodiments, the ratio of the MOI of the first rBV to the MOI of the one or more second rBVs is 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4 , 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, or 10. In other embodiments, the ratio ranges between any two of the above ratios.

[0112] In various embodiments, the rAAV produced by the methods of different embodiments has a concentration of encapsidated baculovirus nucleotide sequence of less than 1E-9 nanograms per nanogram of encapsidated rAAV vector genome, less than 1E-10 nanograms per nanogram of encapsidated rAAV vector genome, less than 1E-11 nanograms per nanogram of encapsidated rAAV vector genome, less than 1E-12 nanograms per nanogram of encapsidated rAAV vector genome, less than 1E-13 nanograms per nanogram of encapsidated rAAV vector genome, less than 1E-14 nanograms per nanogram of encapsidated rAAV vector genome, or less than 1E-15 nanograms per nanogram of encapsidated rAAV vector genome. In other embodiments, the rAAV produced by the methods of different embodiments has a concentration of encapsidated baculovirus nucleotide sequences that is at least an acceptable level for regulatory approval by a regulatory agency (e.g., the U.S. Food and Drug Administration (FDA), the European Medicines Agency (EMA), etc.).

[0113] In various embodiments, the rAAV produced by the methods of different embodiments has a concentration of encapsidated baculovirus nucleotide sequence encoding at least a portion of a baculovirus DNA polymerase that is less than 1E-3 copies per copy of the encapsidated rAAV vector genome, less than 1E-4 copies per copy of the encapsidated rAAV vector genome, less than 1E-5 copies per copy of the encapsidated rAAV vector genome, less than 1E-6 copies per copy of the encapsidated rAAV vector genome, less than 1E-7 copies, less than 1E-8 copies per copy of the encapsidated rAAV vector genome, less than 1E-9 copies per copy of the encapsidated rAAV vector genome, or less than 1E-10 copies per copy of the encapsidated rAAV vector genome. In other embodiments, the rAAV produced by the methods of the different embodiments has a concentration of encapsidated baculovirus nucleotide sequences encoding at least a portion of a baculovirus DNA polymerase that is at least a level acceptable for regulatory approval by a regulatory agency (e.g., FDA, EMA, etc.).

[0114] In various embodiments, the rAAV produced by the methods of different embodiments has less than 1E-3 copies per copy of encapsidated rAAV vector genome, less than 5E-3 copies per copy of encapsidated rAAV vector genome, less than 1E-4 copies per copy of encapsidated rAAV vector genome, less than 5E-4 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 2E-5 copies per copy of encapsidated rAAV vector genome, less than 3E-5 copies per copy of encapsidated rAAV vector genome, less than 4E-5 copies per copy of encapsidated rAAV vector genome, less than 5E-5 ...1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-5 copies per copy of The concentration of encapsidated rAAV vector genome is less than 6E-5 copies per copy, less than 7E-5 copies per copy of encapsidated rAAV vector genome, less than 8E-5 copies per copy of encapsidated rAAV vector genome, less than 9E-5 copies per copy of encapsidated rAAV vector genome, less than 1E-6 copies per copy of encapsidated rAAV vector genome, less than 5E-6 copies per copy of encapsidated rAAV vector genome, less than 1E-7 copies per copy of encapsidated rAAV vector genome, less than 5E-7 copies per copy of encapsidated rAAV vector genome, less than 1E-8 copies per copy of encapsidated rAAV vector genome, or less than 5E-8 copies per copy of encapsidated rAAV vector genome. In other embodiments, the rAAV produced by the methods of different embodiments has a concentration of encapsidated cellular 18S rRNA gene nucleotide sequences that is at least a level acceptable for regulatory approval by a regulatory agency (e.g., FDA, EMA, etc.).

[0115] In various embodiments, the cells infected with rBV are cultured for a predetermined period before the rAAV is harvested. For example, the rAAV viral particles can be harvested at about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, about 96 hours, about 120 hours, about 144 hours, about 168 hours, about 192 hours, about 216 hours, about 240 hours, or any time between these two time points after infection.

[0116] In various embodiments, the culturing step (e.g., Sf9 cells or E. coli) of various embodiments occurs in a volume of at least 5 mL, at least 10 mL, at least 20 mL, at least 50 mL, at least 100 mL, at least 500 mL, at least 1 liter (L), at least 10 L, at least 50 L, at least 100 L, at least 250 L, at least 500 L, at least 1000 L, at least 1500 L, at least 2000 L, or at least 2500 L.

[0117] In examples, the culturing step (e.g., Sf9 cells or E. coli) can occur in spin tube(s) or shake flask(s). In various embodiments, the culturing step of any aspect or embodiment occurs in a volume of 0.0001 mL, 0.0005 mL, 0.001 mL, 0.005 mL, 0.01 mL, 0.05 mL, 0.1 mL, 0.5 mL, 1 mL, 5 mL, 10 mL, 20 mL, 30 mL, 40 mL, 50 mL, 60 mL, 70 mL, 80 mL, 90 mL, 100 mL, 200 mL, 300 mL, 400 mL, 500 mL, 600 mL, 700 mL, 800 mL, 900 mL, 1 L, 2 L, 3 L, 4 L, or 5 L. In other embodiments, the volume of the culturing step ranges between any two of the volumes provided above.

[0118] In other examples, the culturing step (e.g., Sf9 cells or E. coli) can occur in one or more bioreactors. In various embodiments, the culturing step of any aspect or embodiment may be performed using a culture medium containing 1 L, 2 L, 3 L, 4 L, 5 L, 6 L, 7 L, 8 L, 9 L, 10 L, 11 L, 12 L, 13 L, 14 L, 15 L, 16 L, 17 L, 18 L, 19 L, 20 L, 21 L, 22 L, 23 L, 24 L, 25 L, 26 L, 27 L, 28 L, 29 L, 30 L, 31 L, 32 L, 33 L, 34 L, 35 L, 36 L, 37 L, 38 L, 39 L, 40 L, 41 L, 42 L, 43 L, 44 L, 45 L, 46 L, 47 L, 48 L, 49 L, 50 L, 51 L, 52 L, 53 L, 54L, 55L, 56L, 57L, 58L, 59L, 60L, 61L, 62L, 63L, 64L, 65L, 66L, 67L, 68 L, 69L, 70L, 71L, 72L, 73L, 74L, 75L, 76L, 77L, 78L, 79L, 80L, 81L, 82L, 8 3L, 84L, 85L, 86L, ​​87L, 88L, 89L, 90L, 91L, 92L, 93L, 94L, 95L, 96L, 97L, 98L, 99L, 100L, 110L, 120L, 130L, 140L, 150L, ​​160L, 170L, 180L, 190L, 2 00L, 210L, 220L, 230L, 240L, 250L, 260L, 270L, 280L, 290L, 300L, 310L , 320L, 330L, 340L, 350L, 360L, 370L, 380L, 390L, 400L, 410L, 420L, 430 L, 440L, 450L, 460L, 470L, 480L, 490L, 500L, 510L, 520L, 530L, 540L, 55 0L, 560L, 570L, 580L, 590L, 600L, 610L, 620L, 630L, 640L, 650L, 660L, 6 70L, 680L, 690L, 700L, 710L, 720L, 730L, 740L, 750L, 760L, 770L, 780L, 790L, 800L, 810L, 820L, 830L, 840L, 850L, 860L, 870L, 880L, 890L, 900L , 910L, 920L, 930L, 940L, 950L, 960L, 970L, 980L, 990L, 1000L, 1010L, 1 020L, 1030L, 1040L, 1050L, 1060L, 1070L, 1080L, 1090L, 1100L, 1110L,1120L、1130L、1140L、1150L、1160L、1170L、1180L、1190L、1200L、1210L、1220L、1230L、1240L、1250L、1260L、1270L、1280L、1290L、1300L、1310L、1320L、1330L、1340L、1350L、1360L、1370L、1380L、1390L、1400L、1410L、1420L、1430L、1440L、1450L、1460L、1470L、1480L、1490L、1500L、1510L、1520L、1530L、1540L、1550L、1560L、1570L、1580L、1590L、1600L、1610L、1620L、1630L、1640L、1650L、1660L、1670L、1680L、1690L、1700L、1710L、1720L、1730L、1740L、1750L、1760L、1770L、1780L、1790L、1800L、1810L、1820L、1830L、1840L、1850L、1860L、1870L、1880L、1890L、1900L、1910L、1920L、1930L、1940L、1950L、1960L、1970L、1980L、1990L、2000L、2010L、2020L、2030L、2040L、2050L、2060L、2070L、2080L、2090L、2100L、2110L、2120L、2130L、2140L、2150L、2160L、2170L、2180L、2190L、2200L、2210L、2220L、2230L、2240L、2250L、2260L、2270L、2280L、2290L、2300L、2310L、2320L、2330L、2340L、2350L、2360L、2370L、2380L、2390L、2400L、2410L、2420L、2430L、2440L、2450L、2460L、2470L、2480L、2490L、2500L、2510L、2520L、2530L、2540L、2550L、2560L、2570L、2580L、2590L、2600L、2610L、2620L、2630L、2640L、2650L、2660L、2670L、2680L、2690L、2700L、2710L、2720L、2730L、2740L、2750L、2760L、2770L、The culture step occurs in an amount of 2780 L, 2790 L, 2800 L, 2810 L, 2820 L, 2830 L, 2840 L, 2850 L, 2860 L, 2870 L, 2880 L, 2890 L, 2900 L, 2910 L, 2920 L, 2930 L, 2940 L, 2950 L, 2960 L, 2970 L, 2980 L, 2990 L, or 3000 L. In other embodiments, the amount in the culture step ranges between any two of the amounts provided above.

[0119] In various embodiments, the titer of rBV is determined using a focus / virus plaque assay. This assay first involves infecting cells with serial dilutions of a solution containing rBV. After infection has occurred for a predetermined time, the rBV is removed from the culture and the cells are incubated for a predetermined time. After the predetermined time has passed, plaque medium (e.g., containing agarose) is added to the culture and allowed to harden. The cells are further incubated for a predetermined time, and the number of plaques is counted after the predetermined time. The titer is calculated using the following formula:

[0120] Titer (plaque forming units / mL) = number of plaques × dilution factor × (1 / (mL of inoculum / well)

[0121] For any process for producing rAAV, including those described above, impurities are also produced or found in compositions with therapeutically effective rAAV particles. Thus, rAAV production impurities can include non-therapeutically effective rAAV particles, exogenous high molecular weight DNA, small polynucleotides, proteins, buffer components, etc.

[0122] Other embodiments relating to rBV-based production of rAAV are also disclosed.

[0123] In various embodiments, a method for increasing rAAV production and reducing encapsidated polynucleotide impurities within the produced rAAV is disclosed. The method includes infecting different cell cultures with an rBV having a nucleotide sequence of an rAAV vector genome and one or more second rBVs having nucleotide sequences encoding Rep and Cap proteins. Each cell culture is infected with the first rBV and one or more second rBVs at a different ratio of multiplicity of infection (MOI) of the first rBV to the MOI of the one or more second rBVs. The method also includes isolating rAAV from the different cell cultures, determining the titer of the isolated rAAV from the different cell cultures, determining the concentration of encapsidated nucleotide impurities within the isolated rAAV from the different cell cultures, and identifying one or more ratios of the MOI of the first rBV to the MOI of the one or more second rBVs from both determining steps.

[0124] In various embodiments, indicator cells for measuring rBV titer comprise a reporter nucleotide sequence operably linked to an inducible baculovirus promoter sequence that is activated by baculovirus infection. The inducible baculovirus promoter sequence is selected from at least one of an early baculovirus promoter sequence and an intermediate baculovirus promoter sequence. The reporter nucleotide sequence and the inducible baculovirus promoter sequence are stably maintained in the indicator cells. The reporter nucleotide sequence of various embodiments and the inducible baculovirus promoter sequence of various embodiments are stably maintained in the indicator cells (e.g., episomal expression, such as episomal minicircles). In other embodiments, the reporter nucleotide sequence and the inducible baculovirus promoter sequence are stably integrated into the genome of the indicator cells. In various examples, the reporter nucleotide sequence of different embodiments encodes a reporter protein. Examples of reporter proteins include fluorescent proteins, luminescent proteins, or proteins used in histochemistry (e.g., immunohistochemistry, immunohistochemistry, etc.). Further examples of such proteins include cyan fluorescent protein, green fluorescent protein, yellow fluorescent protein, red fluorescent protein, DsRed, mCherry, luciferase, β-galactosidase, horseradish peroxidase, alkaline phosphatase, chloramphenicol acetyltransferase, and glucose oxidase. In various examples, the inducible baculovirus promoter sequence is selected from at least one of a 39K promoter, a p6.9 promoter, a gp64 promoter, a Polh promoter, and a p10 promoter. The inducible baculovirus promoter sequence of different embodiments is also placed in conjunction with other expression control element(s) to control transcriptional expression.

[0125] In different embodiments, the indicator cells comprise a promoter nucleotide sequence that is at least 95%, 96%, 97%, 98%, 99%, more than 99%, or 100% identical to SEQ ID NO:1, 2, or 3.

[0126] In various embodiments, the reporter nucleotide sequence of different embodiments is operably linked to a baculovirus-derived enhancer sequence, and the baculovirus-derived enhancer sequence is stably maintained in the indicator cell. The baculovirus-derived enhancer sequence of various embodiments is stably maintained in the indicator cell (e.g., episomal expression, such as episomal minicircles). In other embodiments, the baculovirus-derived enhancer sequence is stably integrated into the genome of the indicator cell. Examples of baculovirus-derived enhancer sequences of various embodiments include homology region (HR) enhancer sequences, such as HR1, HR1a, HR2, HR2a, HR3, HR4a, HR4b, HR4c, and HR5. For example, an expression cassette having a promoter, a homology region element, and / or a nucleotide sequence encoding an acetyltransferase can be stably integrated into the genome of an insect cell such that baculovirus infection of the insect cell induces transcriptional expression from the expression cassette (see US 2012 / 0100606).

[0127] In various embodiments, the indicator cells for measuring rBV titer of the different embodiments further comprise one or more nucleotide sequences that provide or encode one or more elements for selecting cells having the reporter nucleotide sequence of the different embodiments, the inducible baculovirus promoter sequence of the different embodiments, or the baculovirus-derived enhancer sequence of the different embodiments (e.g., positive antibiotic selection, selectable marker, etc.). In different examples, one selection element can be for selection in one cell type (e.g., Sf9 cells) and another selection element can be for selection in another cell type (e.g., E. coli). Examples of nucleotide sequences of the different embodiments, as well as elements for selecting cells of the different embodiments, are provided below. Examples of eukaryotic selectable antibiotics for which elements such as resistance genes and proteins are available include blastidine (blastidine resistance gene (bsr) encoding blastidine-S deaminase), geneticin (neomycin resistance gene (neo) from Tn5 encoding aminoglycoside 3'-phosphotransferase, APH 3'II), hygromycin B (hph gene encoding hygromycin-B 4-O kinase), puromycin (Pac gene encoding puromycin N-acetyltransferase), phleomycin (Sh ble gene), or zeocin (Sh ble gene). Examples of bacterial selectable antibiotics for which elements such as resistance genes and proteins are available include kanamycin (Kan R -Tn5 gene product (aminoglycoside phosphotransferase)), spectinomycin, streptomycin, ampicillin (the bla gene encoding β-lactamase), carbenicillin, bleomycin, erythromycin, polymyxin B, tetracycline (the Tet gene encoding the tetracycline inhibitor protein R -Tn10 gene), and chloramphenicol.

[0128] In various embodiments, methods for generating indicator cell(s) for measuring rBV titer of different embodiments are disclosed. The methods include transfecting a vector comprising a reporter nucleotide sequence operably linked to an inducible baculovirus promoter sequence activated by baculovirus infection. The reporter nucleotide sequence of different embodiments is operably linked to a baculovirus-derived enhancer sequence of different embodiments. In various embodiments, the vector further comprises a resistance nucleotide sequence operably linked to an expression control sequence, and the methods further include culturing the cells and positively selecting at least one cell in which the vector is stably maintained. In other embodiments, the methods further include culturing the cells, isolating the cells from the culture, and separately culturing the isolated cells.

[0129] In various embodiments, a method for measuring rBV titer includes infecting cells with rBV. The indicator cells of various embodiments include a reporter nucleotide sequence operably linked to an inducible baculovirus promoter sequence activated by baculovirus infection. The inducible baculovirus promoter sequence is selected from at least one of an early baculovirus promoter sequence and an intermediate baculovirus promoter sequence. The reporter nucleotide sequence of different embodiments is operably linked to a baculovirus-derived enhancer sequence of different embodiments. The method of various embodiments also includes measuring expression of the reporter nucleotide sequence and determining the rBV titer from the expression of the reporter nucleotide sequence. For example, the reporter nucleotide sequence is measured using flow cytometry. In other embodiments, the determining step occurs 3 hours or more, 4 hours or more, 5 hours or more, 6 hours or more, 7 hours or more, 8 hours or more, 9 hours or more, 10 hours or more, 11 hours or more, 12 hours or more, 13 hours or more, 14 hours or more, 15 hours or more, 16 hours or more, 17 hours or more, 18 hours or more, 19 hours or more, 20 hours or more after the infecting step.

[0130] Generally, vg and capsid (cp) titers can be assessed in any manner suitable for measuring the respective vg and capsid. For example, quantitative polymerase chain reaction (qPCR) can be used to measure vg titers, and enzyme-linked immunosorbent assay (ELISA) can be used to measure Cp titers. Alternatively, SEC (size exclusion chromatography)-HPLC can be used to measure vg and cp titers. In addition, RP (reverse phase)-HPLC assays can be used to evaluate the potential impact of process parameters on the VP ratio.

[0131] qPCR can be used for vg quantification by quantitative polymerase chain reaction (qPCR) using a standard qPCR system such as the Applied Biosystems 7500 Fast Real-Time PCR System. Alternatively, digital droplet PCR (ddPCR) can be used for Vg quantification. Primers and probes can be designed to target AAV DNA, allowing for quantification of DNA as it accumulates during PCR. Examples of ddPCR are Pasi, K. John, et al. “Multiyear Follow-Up of AAV5-hFVIII-SQ Gene Therapy for Hemophilia A.” New England Journal of Medicine 382.1(2020):29-40, Regan, John F., et al. “A Rapid Molecular Approach for Chromosomal Phasing. PloS one 10.3(2015):e0118270, and Furuta-Hanawa, Birei, Teruhide Yamaguchi, and Eriko Uchida. “Two-Dimensional Droplet Digital PCR as a Tool for Titration and Integrity Evaluation of Recombinant Adeno-Associated Viral Vectors” Human gene therapy methods 30.4(2019):127-136. Other systems for vg quantification include SEC, SEC-HPLC, and size exchange chromatography multi-angle light scattering, all of which are described in WO2021 / 062164, which is incorporated by reference in its entirety.

[0132] Capsid ELISA (cp-ELISA) assays measure intact capsids using, for example, the AAV5 capsid ELISA method, and commercially available kits (e.g., Progen PRAAV5) are available. This kit ELISA uses a monoclonal antibody specific for a conformational epitope on assembled AAV5 or other capsids. Capsids can be captured on a plate-bound monoclonal antibody, followed by subsequent binding of a detection antibody. Assay signals can be generated by adding conjugated streptavidin peroxidase, followed by the addition of a colorimetric TMB substrate solution and sulfuric acid to terminate the reaction. The titer of a test sample is interpolated from a four-parameter calibration curve of target capsid standards. Another system for quantifying capsid titer is the SEC-MALS system, described in WO 2021 / 062164.

[0133] The present invention is further described in the following examples, which do not limit the scope of the invention described in the claims. [Example]

[0134] Use passage 0 (P0) rBV at an ultra-low MOI for rAAV production

[0135] Bacmid Construction and Production: DNA sequences encoding the Rep and capsid proteins, providing a rAAV vector genome with a gene of interest (GOI), were cloned into a donor plasmid. The donor plasmid was then used to transform DH10Bac competent E. coli cells to generate a bacmid containing DNA sequences encoding Rep and Cap, providing a rAAV vector genome flanked by two ITRs carrying the GOI under a promoter. Bacmids from different E. coli clones were isolated and analyzed via Sanger sequencing to select clones with the correct nucleotide sequence. E. coli clones with the correct nucleotide sequence were used to generate a master bacmid E. coli cell bank and a working bacmid E. coli cell bank.

[0136] To generate bacmids for P0 rBV production, vials from either the master bacmid E. coli cell bank or the working bacmid E. coli cell bank were thawed and placed in culture. After culturing the E. coli cells to a predetermined cell density, the cells were concentrated and lysed. The bacmids were isolated from the lysed cells using different chromatography and filtration processes.

[0137] Production of P0 rBV: In the passage 0 (P0) rBV production step, Sf9 cells were cultured and expanded to a predetermined cell density. The Sf9 cells were then transfected with the generated bacmid using a transfection reagent. The transfected Sf9 cells were cultured for a predetermined time to generate P0 rBV. The P0 rBV was analyzed using digital droplet polymerase chain reaction (ddPCR) to determine whether the genome of the P0 rBV contained a deletion of the nucleotide sequence required for rAAV production. Subsequent passaging of the rBV resulted in deletion of the rBV genome containing the DNA sequence encoding the Rep protein or capsid protein, or provided an rAAV vector genome carrying the GOI. At the predetermined time, the rBV was isolated from the cell culture using centrifugation and stored at <15°C.

[0138] rAAV Production: For rAAV production, Sf9 cells were cultured and expanded to a predetermined cell density. When the cultured Sf9 cells reached a predetermined cell density, rBV, which contains DNA sequences encoding Rep and capsid proteins and provides an rAAV vector genome with a GOI, was added to the culture. For different rAAV production runs, rBV was added to the culture at different MOIs (i.e., number of rBV particles relative to number of cells) selected from the range of 0.1 to 1e-10.

[0139] After infecting Sf9 cells with rBV, the cells were cultured for a predetermined period of time to produce rAAV. After the predetermined time, the rAAV-containing supernatant was collected, treated with nuclease, and filtered using different depth filters. The rAAV was then isolated from the supernatant using affinity chromatography. The use of bacmid E. coli cell banks to generate P0 rBV, propagate bacmids in E. coli and isolate them for transfection, transfect Sf9 cells (5 mL or more) with bacmids to generate P0 rBV, or infect Sf9 cells with rBV at an MOI of less than 0.01 substantially improved rBV stability, rAAV production in Sf9 cells, and the infectivity of the generated rAAV.

[0140] Analysis of rBV passages in rAAV production: Baculovirus-infected insect cell lines (BIICs) were used to analyze BIICs containing different passages of rBV. In particular, rAAV was produced using BIICs spanning four passage levels and providing / encoding GOI, Rep, and Cap. BIICs were co-cultured with naive Sf9 cells at an MOI of 1:500, and it was understood that each BIIC could release approximately several hundred rBVs. The lowest passage BIIC yielded an AAV titer of approximately 9.55 x 10e11 vg / mL. The next passage BIIC yielded an AAV titer of approximately 1.8 x 10e11 vg / mL. The next passage BIIC yielded an AAV titer of approximately 3.8 x 10e10 vg / mL. The highest passage BIIC yielded an AAV titer of approximately 5.2 x 10e9 vg / mL. Therefore, serial passage of rBV reduces AAV titers, making BIIC inadequate for large-scale production of rAAV.

[0141] To overcome the limitations associated with BIICs, we developed a novel rAAV production process that uses bacmids as the starting material to produce high-titer rBV. rBV stocks are generated during each production run by transfecting Sf9 cells in shaken suspension culture, resulting in rBV titers sufficient to infect a 2,000 L production tank at a low MOI. By eliminating rBV passaging, either in the form of BIIC propagation or rBV stock amplification, the inherent instability of rBV can significantly affect the resulting rAAV titer after rBV is utilized to infect Sf9 production cultures. Thus, we achieved rAAV titers comparable to or greater than those achievable with rBV derived from low-passage BIICs, but without the limitations of scalability and supply.

[0142] The P0 rBV, which provides / encodes the GOI, Rep, and Cap, was then used to generate rAAV. As shown in Figure 1, naive sf9 cells were infected with rBV at MOIs of 0.1, 0.01, 0.001, 0.0001, and 0.00001. Figure 1 shows that infection of Sf9 cells with P0 rBV at an MOI of 0.01 or less significantly improved rAAV titers. [Example]

[0143] Generation of indicator cell lines

[0144] Plasmid construction: Using Gibson assembly, we ligated fragments containing an E. coli selection cassette, an insect cell selection cassette from pIBCMV GFP, the homologous region 5 sequence from the AcMNPV E2 genome KM667940, and the 39k (SEQ ID NO: 1), p6.9 (SEQ ID NO: 2), and Polh (SEQ ID NO: 3) promoters. Initially, three plasmids were constructed, each using a different promoter: 39k (Figure 2), p6.9 (Figure 3), or Polh (Figure 4). Each plasmid contained a reporter cassette, an Escherichia coli (E. coli) selection cassette, and an insect cell selection cassette. The reporter cassette contained either the 39k promoter, the p6.9 promoter, or the Polh promoter operably linked to a nucleotide sequence encoding a reporter protein (e.g., green fluorescent protein (GFP)). The E. coli selection cassette was an ampicillin resistance cassette containing an ampicillin resistance promoter operably linked to an ampicillin resistance gene. The insect cell selection cassette contained a blasticidin resistance gene operably linked to the EM7 promoter. Later, a second set of three plasmids was constructed in which the GFP gene was replaced with one optimized for expression in insect cells. Plasmid minipreps were verified for correct assembly, and E. coli clones harboring the correct constructs were scaled up, and the plasmids were extracted and purified using maxipreps. Additionally, the constructs containing the optimized GFP gene were then linearized with ScaI prior to transfection.

[0145] Transfection: Transfections were performed in 6-well plates. 2 mL / well of Sf9 cells at 0.5E6 cells / mL were plated on SF900 III plates to obtain 1E6 cells / well. 56 μL of Cellfectin II reagent was diluted in 700 μL of PBS, and 3 μg of each plasmid was diluted in 100 μL of PBS. 100 μL of diluted Cellfectin was added to each of the diluted plasmid solutions, which were then incubated at room temperature for 30 minutes. 0.8 mL of Sf900 III was then added to the plasmid solutions, and the medium in the plates was removed and replaced with the plasmid solution. The plates were then incubated at 28°C for 4-5 hours, after which the transfection mix was removed from the wells and replaced with 3 mL of Sf900 III medium containing 25 μg / mL or 50 μg / mL blasticidin, depending on the well. They were then incubated at 28°C for an additional 72-96 hours.

[0146] Selection: Selection was performed in medium containing either 25 μg / mL or 50 μg / mL blasticidin during transfection. After cells were transferred to shake flasks, the concentration of blasticidin remained at 25 μg / mL for all cultures to maintain selective pressure.

[0147] Identification and screening of initial clones: Outgrowths from shake flasks were infected with recombinant baculovirus (rBV) at a high MOI and then analyzed by flow cytometry for GFP expression at various times between 15 and 96 hours. Cells from 39k-unoptGFP cultures were diluted and seeded into 96-well plates for subcloning. Cells were diluted to 5 cells / mL in conditioned medium plus 25 μg / mL blasticidin and seeded at 200 μL / well (1 cell / well) in 20 plates. Another 10 plates were seeded in the same manner, but with the addition of 1 e4 feeder cells / well (untransfected Sf9 cells).

[0148] Cell banking: Cells were seeded at 0.5E6 cells / mL on day 0 and banked 2 days after seeding. Five vials were prepared with 30E6 cells / vial. Cells were removed from shake flasks and centrifuged at 300g for 10 minutes at 4°C. Freezing medium was prepared at a concentration of 50% fresh medium and 50% spent medium with 7.5% DMSO. The freezing medium was filtered and 5 mL was used to resuspend the cells. 1 mL of cells was added to each vial and they were placed in a freezing container at -80°C for 24 hours before being transferred to a freezing tank.

[0149] Subcloning of 39k-GFP stable pools: Conditioned medium was harvested from naive Sf9 cells (4e6 cells / mL, 3-day culture) and sterile filtered. Sf9 cells transfected with the 39k-GFP plasmid were diluted to 5 cells / mL in conditioned medium + 25 μg / mL blasticidin and seeded at 200 μL / well (1 cell / well) in 20 well plates. Single-cell clones were sorted and expanded in 96-well plates. Samples of clones were extracted and infected with rBV at different MOIs. GFP expression was measured by flow cytometry.

[0150] Analysis of indicator cell lines

[0151] Indicator cells were seeded into 96-well deep-well plates, then infected with serial dilutions of baculovirus and incubated on a shaker at 28° C. for 18 hours. The indicator cells were transfected with a plasmid carrying a GFP expression cassette containing either the 39k promoter nucleotide sequence, the p6.9 promoter nucleotide sequence, or the polyhedrin promoter nucleotide sequence.

[0152] After infection, cells were analyzed by flow cytometry for GFP expression. Figure 5 shows graphs from flow cytometry analysis of naive Sf9 cells. Figure 6 shows graphs from flow cytometry analysis of Sf9 cells transfected with a GFP expression cassette containing the 39k promoter nucleotide sequence. These Sf9 cells were not infected with rBV. In both figures, the dotted line indicates green fluorescence; neither naive Sf9 cells nor uninfected Sf9 cells carrying the 39k plasmid emitted any fluorescence. Specifically, approximately 0.1% of the cells exhibited green fluorescence.

[0153] Figure 7 is a graph from flow cytometry analysis of Sf9 cells transfected with a GFP expression cassette containing the 39k promoter nucleotide sequence. Figure 8 is a graph from flow cytometry analysis of Sf9 cells transfected with a GFP expression cassette containing the p6.9 promoter nucleotide sequence. Figure 9 is a graph from flow cytometry analysis of Sf9 cells transfected with a GFP expression cassette containing the polyhedrin promoter nucleotide sequence. These Sf9 cells were infected with rBV. In these figures, the dotted line indicates green fluorescence, and different cells showed fluorescence. For Figure 7, 55.5% of the 39k promoter cells showed green fluorescence. For Figure 8, 11% of the p6.9 promoter cells showed green fluorescence. For Figure 9, 2% of the Polh promoter cells showed green fluorescence.

[0154] GFP expression under each promoter nucleotide sequence was measured over time. As shown in Figure 10, at 19 hours after rBV infection, 55.5% of the 39k promoter cells showed green fluorescence, 11% of the p6.9 promoter cells showed green fluorescence, and 2% of the Polh promoter cells showed green fluorescence. As shown in Figure 11, at 40 hours after rBV infection, 65.4% of the 39k promoter cells showed green fluorescence, 19% of the p6.9 promoter cells showed green fluorescence, and 11% of the Polh promoter cells showed green fluorescence. As shown in Figure 12, at 68 hours after rBV infection, 66.3% of the 39k promoter cells showed green fluorescence, 19% of the p6.9 promoter cells showed green fluorescence, and 15% of the Polh promoter cells showed green fluorescence. As shown in Figures 10, 11, and 12, both the p6.9 and polyhedrin promoter sequences showed a large increase in GFP expression, but the expression was slower than that of the 39K promoter sequence. Furthermore, the 39K promoter sequence showed the highest GFP expression.

[0155] Figure 13 shows data from an analysis of the 39k promoter. Insect cells containing a reporter cassette with the 39k promoter were infected with rBV and incubated for a predetermined period of time before being analyzed for GFP expression via flow cytometry. The percentage of 39k promoter-driven cells expressing eGFP was 41.1% (15 h), 39.9% (18 h), 40.7% (24 h), 68.0% (43 h), 66.4% (65 h), 67.3% (70 h), and 69.3% (94 h). Also shown in Figure 13, GFP expression under the 39k promoter was observed as early as 15 h postinfection. It was noted that GFP expression was maintained, which may be due to secondary rBV infection after 24 h. To this extent, the assay can be performed prior to secondary rBV infection (e.g., 24 h).

[0156] The cells were also transfected with a plasmid containing a nucleotide sequence encoding GFP, and the nucleotide sequence was codon-optimized for expression of GFP in insect cells. These nucleotide sequences were operably linked to the 39K and Polh promoters. As shown in Figures 14, 15, and 16, the use of the codon-optimized GFP nucleotide sequence increased GFP expression from the 39K and Polh promoters. As shown in Figure 14, at 20 hours, the use of the codon-optimized eGFP sequence in the 39K promoter cells increased the percentage of cells expressing eGFP from 56.5% to 57.8%, and the use of the codon-optimized eGFP sequence in the PolH promoter cells increased the percentage of cells expressing eGFP from 4.0% to 10.5%. As shown in Figure 15, at 25 hours, the use of the codon-optimized eGFP sequence in the 39k promoter cells resulted in essentially no difference in eGFP expression (56.6% and 55.9%), while the use of the codon-optimized eGFP sequence in the Polh promoter cells increased the percentage of cells expressing eGFP from 4.8% to 12.0%. As shown in Figure 16, at 48 hours, the use of the codon-optimized eGFP sequence in the 39k promoter cells increased the percentage of cells expressing eGFP from 58.5% to 59.3%, while the use of the codon-optimized eGFP sequence in the Polh promoter cells increased the percentage of cells expressing eGFP from 10.9% to 17.5%. It was noted that GFP expression was still greater with the 39k promoter.

[0157] Below is an example of rBV titration using an indicator cell line. The P0 baculovirus infectious titer is measured using a flow cytometry-based baculovirus infectious titer assay (FC-BITA) to calculate the volume of rBV required to infect Sf9 cells to initiate production. This assay uses the Sf9 cell line, which expresses GFP (green fluorescent protein) upon infection with rBV. GFP levels are detected by flow cytometry, and the percentage of fluorescent cells is converted to rBV concentration using a Poisson distribution. A positive control is run with every assay to confirm assay performance. [Example]

[0158] Effect of baculovirus MOI on AAV productivity and encapsidated baculovirus-derived DNA profile

[0159] Insect cell-based production of recombinant adeno-associated virus (rAAV) is typically achieved by infecting Sf9 cells with an rBV encoding the AAV Rep gene, AAV Cap gene, and a transgene of interest. The effects of the rBV MOI on Sf9 production, AAV vector yield, and packaging of DNA impurities were evaluated. To investigate the independent effects of low MOI, a full-scale, three-level experiment was performed in a bioreactor, followed by a small-scale test. A 10-fold MOI range (0.003–0.03) was examined for all rBVs. Statistical analysis showed that AAV5 productivity was positively affected by early gene levels of Rep and Cap but negatively affected by early gene levels of the GOI. A similar trend was observed for total capsid production, which translated into comparable capsid-to-vector genome ratios (cp:vg) between conditions. Packaging of BV DNA impurities in AAV5 was calculated by tracking the copy number of BV genetic markers located near (α and β) and far (γ and δ) the AAV ITRs. The results suggest that the MOI effect was dependent on the distance from the ITRs. Increasing the MOI of all rBVs had a mildly negative effect on DNA accumulation from loci close to the ITRs (α:vg and β:vg ratios). Meanwhile, DNA accumulation from loci far from the ITRs (γ:vg and δ:vg ratios) was positively influenced by Rep early gene levels and negatively influenced by GOI early levels. The identified trends highlight the significant impact of BV MOI on vector productivity and product quality. Overall, our data suggest that higher Rep and Cap early levels may lead to higher productivity, but at the expense of an additional increase in copackaged rBV DNA impurities. This negative effect could be mitigated by infecting all rBVs at a similar MOI. We speculate that packaging of rBV DNA impurities is Rep-dependent and that the level of encapsidated rBV DNA impurities depends on Rep concentration.

[0160] Introduction rAAV is one of the most promising therapeutic modalities intended to cure or mitigate the effects of various monogenic disorders. Extensive scientific evidence focused on understanding AAV biology and clinical evaluation of rAAV safety and efficacy supports current efforts to make gene therapy available for patient use [Aguti S et al. Expert Opin Biol Ther 2018;18:681-93; Ramlogan-Steel CA et. Clin Experiment Ophthalmol 2019;47:521-36; Li C and Samulski RJ. Nat Rev Genet 2020;21:255-72]. rAAV has traditionally been produced in anchorage-dependent mammalian cell lines, such as HEK293, via plasmid transfection. The need to improve specific productivity, process robustness, and scalability has led to the development of alternative cell culture processes using various hosts. The insect cell / rBV system is recognized by many as one of the most scalable and productive systems for rAAV production. Robert Kotin and Masashi Urabe's seminal paper established the insect cell / BV system as an efficient means for viral vector production [Urabe M et al. Hum Gene Ther 2002;13:1935-43, Urabe M et al. J Virol 2006;80:1874-85]. Their approach involved the distribution of AAV gene sequences controlled by insect-specific promoters and distributed between two or three baculoviruses via their cis- or trans-regulatory activities. Over time, several groups have identified ways to improve the molecular design of recombinant BV, leading to more robust vector production [Chen H. Mol Ther 2008;16:924-30, Smith RH et al. Mol Ther 2009;17:1888-96, Mietzsch M et al. Hum Gene Ther Methods 2017;28:15-22].

[0161] As with most biologics production platforms, thorough process characterization is key to identifying parameters that impact process performance and product quality. MOI, defined as the number of infectious rBV divided by the total number of cells, is well known to play an important role during recombinant protein expression. Several studies have described how varying MOI concentrations affect rBV replication dynamics, host-rBV metabolic interactions, and overall protein expression [Radford KM et al. Cytotechnology 1997;24:73-81, Pastor AR et al. Vaccine 2019;37:6962-9, Virag T et al. Hum Gene Ther 2009;20:807-17]. In the context of rAAV production, this information is only partially applicable because subsequent vector-specific molecular events (e.g., capsid assembly, rAAV DNA replication, and packaging) must occur after protein expression to generate infectious vector particles [Aponte-Ubillus JJ et al. Appl Microbiol Biotechnol 2018;102:1045-54]. Several studies have evaluated the effect of MOI on recombinant AAV production. Meghrous and Aucoin used three rBVs to deliver AAV genes and evaluated the effects of total MOI and MOI ratio. The initial evaluation highlighted the benefits of using a high MOI strategy (MOI > 3) and the importance of a balanced MOI ratio for high productivity [Meghrous J et al. Biotechnol Prog 2005;21:154-60]. Subsequent reports have strengthened research on high MOI strategies and confirmed the positive effect of the MOI of Rep BV and Cap BV on infectious vector yield [Aucoin MG et al. Biotechnol Bioeng 2006;95:1081-92]. There is a lack of research characterizing asynchronous, low MOI BV infection in the rAAV production process. In low MOI infections, only a small number of cells are infected after virus addition. Secondary rounds of infection result from viral replication, leading to the infection of the entire cell population.Mena et al. [Mena JA et al. J Gene Med 2010;12:157-67] described comparable AAV infection yields using either a low MOI (0.3) or a high MOI (9) in a 3-rBV process. Further optimization of seeding cell density and feeding strategy resulted in further yield increases. Less understood is the effect of the MOI of BV on the quality of rAAV product. Vector quality is as important as vector productivity to ensure robust expression and activity of AAV-derived transgenes. Packaging of DNA impurities is a documented phenomenon during rAAV production, in which sequences derived from helper plasmids or BV DNA are misencapsidated [Chadeuf G et al. Molecular Therapy 2005;12:744-53, Wright JF. Biomedics 2014;2:80-97]. Studies have reported that plasmid backbone and rBV backbone sequences can be present in rAAV vector stocks at high percentages of 6% and 3%, respectively [Lecomte E et al. Molecular Therapy-Nucleic Acids 2015;4:e260, Penaud-Budloo M et al. Hum Gene Ther Methods 2017;28:148-62]. In the context of insect cell systems, it is believed that not only the rBV molecular design but also upstream process parameters may play a role in packaging DNA impurities. More research is needed to gain insight into the contribution of biological inputs and cell culture parameters to the formation of this product-related impurity.

[0162] At large scale, a low rBV MOI strategy may simplify BV expansion procedures, reduce operational costs, and improve BV genetic stability. Therefore, understanding the implications of a low MOI strategy for rAAV production is important. In this study, we investigated how different low BV MOIs and initial gene ratios affect productivity and rAAV quality by monitoring specific outputs, such as productivity per cell, capsid-to-vector genome ratio, and packaging of rBV-derived DNA impurities. Follow-up evaluations were conducted to develop hypotheses that may explain the identified trends.

[0163] Materials and Methods Cell line and culture maintenance Subcloning from the Spodoptera frugiperda cell line Sf9 was used in this study. Cells were cultured at 5 × 10 5 Cells were passaged twice weekly in shake flasks (Corning, NY) containing proprietary serum-free medium, targeting an initial cell density of 1000 cells / mL. Shake flasks were incubated at 28°C.

[0164] Generation of recombinant BV Recombinant bacmids and rBVs were designed and produced using the bac-to-bac expression system (Thermo Fisher Scientific, CA). Bac-GOI-A (transgene A) and Bac-GFP-GOI-B (transgene B) contained 4.6 and 4.8 kb ITR-flanked transgenes, respectively. In addition to transgene B, Bac-GFP-GOI-B contained a GFP gene controlled by the GP64 promoter. Baculoviruses were engineered to express Rep (e.g., Rep78 and Rep52) and Cap genes via different baculovirus promoters. An additional construct contained a dTomato fluorescent protein expression cassette controlled by another baculovirus promoter. Quantification of infectious BVs was determined by flow cytometry using an Sf9-derived indicator cell line expressing GFP under the control of the 39kb promoter. This titration method has been evaluated against other well-established protocols to ensure the accuracy of the multiplicity of infection values ​​(MOI) used in subsequent experiments (data not shown). Experimental design

[0165] Bioreactor studies were conducted to evaluate the effect of rBV MOI on AAV5 productivity and BV-derived encapsidated DNA impurities. A full factorial experimental matrix was designed using JMP14 (SAS). The MOI evaluation range was defined as 1 log to prevent process variability due to significant differences in cell growth or nutrient consumption. The amount of BV volume added per vessel represented less than 0.1% of the working volume (3 L) in all cases. The bioreactor was operated using a Dasgip controller (Eppendorf, CT). All seeding cell densities, infection times, harvest times, and physicochemical parameters (pH, DO, temperature) were consistent between conditions. The supernatant underwent chemical treatment to promote additional rAAV particle release and remove process-related impurities. The harvested material was further clarified by centrifugation at 4000 × g for 15 min and depth filtration.

[0166] Follow-up shake flask studies were performed to generalize the trends observed during the bioreactor studies. Two different GOI BVs were tested. Four representative conditions identified in the previous studies were tested using 125 mL shake flasks. The same inoculation, infection, and harvest schedule as in the bioreactor studies was followed, with a clarified harvest as the final upstream material.

[0167] AAV affinity purification An aliquot of each clarified harvest material was incubated with a slurry of AVB Sepharose resin (Thermo Fisher Scientific, CA) at room temperature and constant agitation for 2 hours. Each AVB resin / harvest mixture was then centrifuged, and the pelleted resin was transferred to an Acroprep filter plate (Pall Corporation, NY), where they were processed in parallel. The resin was washed three times with phosphate buffer and then incubated with a low pH buffer for 3.5 minutes to elute the rAAV capsids. The liquid contents were removed from the filter plate into a 96-deep-well plate using a multiplate vacuum manifold (Pall Corporation, NY). The collected eluate was adjusted to pH 7.0–7.2 before storage.

[0168] DNA quantification by digital droplet PCR (ddPCR) The presence of capsid-protected transgenes and BV-derived DNA impurities was monitored by ddPCR according to the protocol described by Barajas et al. [Barajas D et al. PLoS One 2017;12]. Serial dilutions of AVB eluates were performed to cover a wide concentration range of the tested target sequences. Dilutions resulting in reactions below -5000 copies / microliter were used for quantification. Appropriate non-template controls consistently demonstrated copy numbers below 1. An automated droplet generator and reader (Bio-Rad Laboratories, CA) was used. Detection of positive droplets and determination of copy number were performed using Quantasoft software (Bio-Rad Laboratories, CA). To determine the VP3 / 18s ratio from cells, 2 mL of cell culture was spun down at 500 × g for 2 min, and the cell pellet was collected and frozen at -80°C. The frozen pellet was later resuspended in TE buffer + 0.5% SDS and incubated at room temperature for 1 h. This suspension was used as the starting material for ddPCR quantification.

[0169] Capsid quantification A high-throughput method based on the Octet system (Molecular Devices, CA) was used to quantify total capsids based on a standard curve constructed from antibody-capsid binding kinetic information using different concentrations of AAV5 standard material. Dilutions were performed to cover the dynamic range of the assay. Each sample was analyzed in duplicate along three dilutions. A positive control was included to track the precision of the assay.

[0170] Flow cytometry analysis The percentage of GFP- and dTomato-expressing cells was monitored over the culture time using Attune NxT (Thermo Fisher Scientific, CA). Channels YL1 and BL1 were used to track the different signals. One million cells per condition were collected for each sample run on the analyzer. GFP-positive, dTomato-positive, and negative (uninfected) controls were included in the analysis. Samples were taken at different time points after BV infection. At least 20,000 events per sample were analyzed to calculate the infection percentage.

[0171] result Preliminary studies were conducted in bioreactors producing AAV transgene A. A 10-fold MOI range was determined to minimize the impact of changes in viral load on cell culture growth capacity. Trends in viability and growth rates support the assertion that potential variability in cell growth and mortality trends between the conditions tested is insignificant and will not affect conclusions regarding the effect of the MOI of BV on productivity and product quality.

[0172] The clarified harvest and affinity-purified material were assayed for rAAV-transgene A vg titer and capsid-to-vector genome (cp:vg) ratio. Productivity was normalized and is shown in Figure 17. The highest productivity values ​​were obtained when the AAV genes were provided at the following MOIs of rBV:GOI 0.003 / Rep 0.03 / Cap 0.03, whereas the lowest values ​​were obtained when they were provided at the initial gene level: GOI 0.03 / Rep 0.003 / Cap 0.003. A statistical model was developed to describe the effect of the MOIs of rBVs providing / encoding GOI, Rep, and Cap, as well as their interaction on productivity per cell. The cp:vg ratio ranged from 1.5 to 3 across the tested conditions (Figure 18). Initially, it was hypothesized that conditions with higher MOIs of Rep and Cap BVs might exhibit higher ratios due to a higher likelihood of empty capsid production, but this experiment did not demonstrate this phenomenon. It is reasonable that an evaluation range of more than 10-fold can detect significant differences in encapsidation efficiency.

[0173] The effect of rBV MOI on the quality of rAAV material was characterized by quantifying four specific nuclease-resistant rBV-derived genetic markers present in the purified product. Markers α and β are located adjacent to the AAV ITRs but within a 10-kilobase (kb) region outside the rAAV vector genome nucleotide sequence within the baculovirus genome. Markers γ and δ are distant from the ITRs and cover approximately 135 kb of the BV DNA genome. Table 1 shows the results, determined as marker:vg ratios and as percentages of rBV-derived cDNA impurities. Table 1 also shows the effect of rBV MOI on encapsidation of rBV-derived DNA impurities. Experimental conditions are presented based on individual rBV MOIs and rBV MOI ratios. Ratios were averaged (α-β, γ-δ) and normalized to condition #10. Additionally, we estimated the percentage of rBV-derived DNA impurities present in purified vectors using the methodology from Penaud-Budloo [Grosse S et al. J Virol 2017;91] as a reference. The percentage of DNA contaminants was calculated from the copy numbers of the rAAV transgene, averaged α-β, and averaged γ-δ regions, normalized to each reference size (AAV transgene = 4.8 kb, α-β proximal ITR region = 10 kb, γ-δ backbone region = 135 kb). The average αβ:vg or γ-δ:vg ratio was used to provide a more representative estimate of the frequency of rBV-derived DNA impurities from each region during packaging. We assumed that increased Rep and Cap levels contributed to the decreased concentration of markers surrounding the ITRs within the 10 kb section. At low GOI levels (0.003), varying the MOI levels of Rep and Cap BV from low (0.003) to high (0.03) reduced the normalized α-β DNA ratio from 1.55 to 0.75 (a 52% reduction). Furthermore, the concentration pattern of γ-δ markers was negatively affected by the MOI of GOI BV. Normalized γ-δ:vg concentrations within the evaluated conditions ranged from 0.98 to 16.09, suggesting that the MOI of BV strongly influences gene sequences far from the ITRs, which are unlikely to be part of the reverse packaging event.Estimation of the percentage of BV-derived DNA impurities in rAAV particles showed total (α-β + γ-δ) values ​​ranging from 0.22 to 0.60%, consistent with a previous report [Penaud-Budloo M et al. Hum Gene Ther Methods 2017;28:148-62]. Overall, these results suggest that higher initial Rep and Cap levels may lead to higher productivity, but at the expense of further increasing BV-derived DNA impurities. This negative effect can be mitigated by adjusting the rBV ratio closer to 1. [Table 1]

[0174] To further our understanding of the productivity and trends of BV-derived DNA impurities, we conducted follow-up experiments in shake flasks. Using different BV sets—rBVs providing / encoding GOI-A, Rep, and Cap (as above) and fluorescently labeled dTomato-rBVs providing / encoding Rep, Cap, and GFP-GOI-B—we replicated different BV MOI conditions to confirm previous productivity trends. All conditions infected with the fluorescent protein-producing BV set were monitored using flow cytometry and ddPCR to identify potential correlations between infection levels, Cap expression, and productivity between rBVs encoding Rep or Cap. Flow cytometry analysis highlighted the percentage of co-infected cells at 90 hours post-infection (hpi) during AAV-GFP-GOI-B production. While significant imbalances in the MOI ratio of BVs can result in low coinfection percentages (32.2% and 28.9% for the GOI 0.03 / Rep 0.003 / Cap 0.003 and GOI 0.003 / Rep 0.03 / Cap 0.03 conditions, respectively), conditions with a 1:1:1 BV ratio demonstrated coinfection percentages between 68.8 and 70.6%. Compared to insect cell / BV processes aimed at protein production, successful production of rAAV particles requires cells to be coinfected with all BVs. Therefore, the BV coinfection rate can theoretically affect productivity per cell. Figure 19 shows comparable productivity between conditions with GOI / Rep / Cap BV MOI ratios of 1:1:1 or less (e.g., 1:<1:<1), regardless of transgene identity. Previous results suggested a positive effect of the MOI of rBV encoding Rep or Cap on vector yield, so we measured the VP3 gene copy number in the cell pellet after infection. In this example, VP3 serves as a proxy for cellular Rep or Cap copy number. Host cell 18s ribosomal RNA gene markers were also tracked to account for different cell densities. Figure 20 compares AAV-GOI-B productivity and VP3 / 18s ratios for various BV MOI combinations.Productivity and VP3 / 18s ratios were adjusted based on the assumption that only coinfected cells produce "intact" AAV particles and that only cells infected with rBV encoding Rep or Cap contain detectable levels of AAV VP3 DNA. These results showed a positive correlation between the adjusted VP3 / 18s DNA ratio and the adjusted productivity per cell. Collectively, the results in Figures 19 and 20 confirm the strong effect of the MOI of rBV encoding Rep or Cap on productivity. Conditions operating at an MOI ratio of GOI / Rep / Cap rBV less than 1:1:1 (e.g., 1:<1:<1) appear to coinfect fewer cells, but this subpopulation contains higher Rep or Cap copy numbers. This effect appears to improve vector productivity in that specific subpopulation, bringing bulk cell productivity to a level similar to that achieved when the MOI ratio of BVs is equal to 1:1:1.

[0175] Finally, we confirmed the effect of the MOI of rBV encoding Rep or Cap on the encapsidation of BV-derived DNA impurities. Vector particles generated from separate dTomato-rBVs encoding Rep, Cap, and GFP-GOI-B under different MOI conditions were purified, and the level of BV-derived DNA impurities per capsid (res DNA:cp ratio) was determined. Figures 21 and 22 show the normalized BV-derived DNA:cp ratios for the averaged α-β and γ-δ markers, respectively. Similar to the bioreactor studies, increasing the MOI of rBV encoding Rep or Cap negatively affected the α-β:cp ratio, with switching the GOI / Rep / Cap BV MOI ratio from 10 (e.g., 10:1:1) to 0.1 (e.g., 0.1:1:1) leading to a 50% reduction. The concentration of BV-derived DNA impurities in capsids produced with only rBV encoding Rep or Cap was in good agreement with this accumulation trend. Switching the MOI of GOI / Rep / Cap BV from 10 to 0.1 resulted in a roughly 15-fold increase in the γ-δ DNA:cp ratio, while up to a 30-fold increase was observed in rAAV particles produced with rBVs encoding only Rep or Cap. Furthermore, infection at an MOI ratio of 1 with GOI / Rep / Cap BVs yielded comparable results regardless of the exact MOI. Additionally, the percentage of cells infected with rBVs encoding only Rep or Cap at 90 hpi was negatively correlated with the α-β DNA:cp ratio and positively correlated with the γ-δ DNA:cp ratio. Overall, these results suggest that an imbalance in the MOI ratio of BVs toward a higher MOI of rBVs encoding Rep or Cap could lead to a shift in the cell subpopulation where an increased percentage of cells may produce transgene-free capsids, and that the disproportionate accumulation of BV-derived DNA in transgene-free capsids could lead to an overall increase in BV-derived DNA impurities in rAAV capsids. These results also confirmed the contrasting trends in encapsidation of BV-derived DNA impurities depending on the location of the marker within the BV genome.

[0176] The concept of a low-MOI rBV infection strategy offers important advantages for virus stock preparation. A 100- to 1000-fold reduction in BV stock size represents a significant operational easing in baculovirus production, which becomes ultimately important when operating at large scale [Virag T et al. Hum Gene Ther 2009;20:807-17]. A low BV inoculum also positively impacts BV genetic stability by minimizing the generation of defective interfering particles as a result of the "passage effect" during inoculum expansion [Krell PJ. Cytotechnology 1996;20:125-37]. In the context of rAAV production, the utility of a low-MOI strategy during insect cell / BV manipulation warrants thorough investigation of how various MOIs affect vector particle yield and quality.

[0177] As the MOI of total BV decreases, the percentage of cells coinfected during the first round of viral infection decreases. The subsequent asynchronous infection process is influenced by other inputs, such as cell line behavior, the number of BVs used, and infection time [Mena JA et al. BMC Biotechnol 2007;7:39; Lee DF et al. J Virol 2000;74:11873-80; Sokolenko S et al. Biotechnol Adv 2012;30:766-81]. Physicochemical parameters such as incubation temperature also affect the timing of AAV protein expression and vector production, suggesting that this parameter may influence BV replication and cell death kinetics [Aucoin MG et al. Biotechnol Bioeng 2007;97:1501-9]. This study explored various MOI values ​​for rBVs containing Rep, Cap, and GOI sequences, while all other process parameters remained constant. Data analysis highlights the positive effect of the Rep and Cap genes on rAAV production during the infection process. This result is consistent with previous experiments conducted by Meghrous and Aucoin at high MOIs [Meghrous J et al. Biotechnol Prog 2005;21:154-60, Aucoin MG et al. Biotechnol Bioeng 2006;95:1081-92]. Successful infection with Rep and Cap BV promotes robust expression of Rep proteins, which are required for rAAV DNA replication, genome degradation, and packaging into preformed capsids [Samulski RJ and Muzyczka N. Annual Review of Virology 2014;1:427-51]. This also promotes expression of AAV VP proteins and assembly-activating proteins (AAPs), the latter of which is important for chaperoning protein transport for proper capsid assembly [Grosse S et al. J Virol 2017;91]. A review of the relevant literature showed that operating at a BV MOI ratio of 1 is preferred as it leads to consistent process performance.The results support this rule of thumb but also contribute to the idea that the ratio is flexible. Aucoin [Aucoin MG et al. Biotechnol Bioeng 2006;95:1081-92] showed that reducing the GOI:Rep:Cap BV ratio from 10:10:10 (total MOI of 30) to 3:10:10 (total MOI of 23) resulted in comparable infectious titers, suggesting that the initial number of transgene (GOI) copies provided in the synchronous infection process is required in lower amounts compared to the number of Rep and Cap copies. While not being bound by this theory, we hypothesize that under conditions of low initial GOI copy numbers, Rep-driven transgene replication can provide abundant ITR-flanked DNA for subsequent packaging. Under conditions where the GOI is low but Rep and Cap levels are high, flow cytometry data suggest that both the percentage of virus-infected cells and the level of superinfection are potentially affected (data not shown). Interestingly, such a ratio improved bulk cell productivity.

[0178] Encapsidation of BV-derived DNA impurities was also evaluated in this study. In the Sf9 production system, evaluation of DNA impurities by next-generation sequencing and PCR-based techniques identified BV and host cell-derived DNA sequences at combined percentages ranging from 0.2 to 2% of the genome, with BV DNA being the most abundant [Penaud-Budloo M et al. Hum Gene Ther Methods 2017;28:148-62, Kondratov O et al. Mol Ther 2017;25:2661-75]. Although DNA impurities are present in small percentages, regulatory health authorities advise manufacturers to control this product-related impurity to reduce any potential genotoxic risk [FDA Briefing Document: Vaccines and Related Biological Products Advisory Committee Meeting: September 19, 2012: Cell Lines Derived from Human Tumors for Vaccine Manufacture nd:30]. Upstream and downstream rAAV production manipulations are thought to affect DNA impurity levels in drug substance. However, studies evaluating these hypotheses are lacking. This is believed to be the first report to systematically characterize the effect of BV MOI on BV-derived packaged DNA impurities in insect cell culture. Preliminary results suggest that increasing the MOI of Rep and Cap BVs relative to the MOI of the GOI reduces packaging of BV DNA from ITR-adjacent loci while increasing encapsidation of loci distal to the ITRs. These effects are not only contrasting but also differ in magnitude. These data explain two potential mechanisms of packaging BV-derived DNA impurities: 1) the previously reported "reverse packaging," which is significantly influenced by the presence of ITR sequences, and 2) a Rep-dependent mechanism that applies to all baculovirus genomic sequences. While exemplary embodiments are described above, these embodiments are not intended to describe all possible forms of the invention.Rather, the words used herein are words of description rather than limitation, and it is understood that various changes may be made without departing from the spirit and scope of the invention. Furthermore, features of various embodiments may be combined to form further embodiments of the invention.

Claims

1. 1. A method for producing a recombinant adeno-associated virus (rAAV), comprising: infecting cells with at least one recombinant baculovirus (rBV), wherein the at least one rBV comprises a nucleotide sequence for producing an rAAV; and culturing the infected cells to produce rAAV; the at least one rBV is a passage zero (P0) rBV; Prior to the infecting step, the passage zero (P0) rBV is isolated from at least one cell culture comprising cells transfected with at least one of the nucleotide sequences; In the infecting step, the cells are infected with the passage zero (P0) rBV at a multiplicity of infection (MOI) of less than 0.

01.

2. 1. A method for producing a recombinant adeno-associated virus (rAAV), comprising: infecting cells with at least one recombinant baculovirus (rBV), wherein the at least one rBV comprises a nucleotide sequence for producing an rAAV; and culturing the infected cells to produce rAAV; the at least one rBV is a passage zero (P0) rBV; Prior to the infecting step, the passage zero (P0) rBV is having at least a portion of the baculovirus genome; and isolated from at least one cell culture comprising cells transfected with at least one nucleotide sequence which, in combination with at least a portion of the baculovirus genome, forms a baculovirus genome capable of producing an rBV; In the infecting step, the cells are infected with the passage zero (P0) rBV at a multiplicity of infection (MOI) of less than 0.

01.

3. 3. The method of claim 1, wherein the MOI is 0.002 or less.

4. 3. The method of claim 1, wherein the MOI is less than 10E-4.

5. 3. The method of claim 1, wherein the MOI is less than 10E-5.

6. 3. The method of claim 1 or 2, wherein the passage zero (P0) rBV comprises a first rBV having a nucleotide sequence for an rAAV vector genome and one or more second rBVs having nucleotide sequences encoding Rep and Cap proteins, and the cells are infected at an MOI ratio of the first rBV to the MOI of the one or more second rBVs ranging from 0.01 to 10.

0.

7. 3. The method of claim 1 or 2, wherein the rAAV produced has a concentration of encapsidated baculovirus nucleotide sequence that is less than 1E-9 nanograms per nanogram of encapsidated rAAV vector genome.

8. 3. The method of claim 1 or 2, wherein the rAAV produced has a concentration of encapsidated baculovirus nucleotide sequence encoding at least a portion of a baculovirus DNA polymerase that is less than 1E-2 copies per copy of encapsidated rAAV vector genome.

9. 3. The method of claim 1 or 2, wherein the rAAV produced has a concentration of encapsidated cellular 18S ribosomal RNA gene nucleotide sequence that is less than 1E-3 copies per copy of encapsidated rAAV vector genome.

10. The method of claim 1 or 2, wherein the cell is an insect cell.

11. 3. The method of claim 1 or 2, wherein the cell is an insect cell derived from Spodoptera frugiperda, Aedes albopictus, Bombyxmori, Trichoplusia ni, Ascalapha odorata, Drosphila, Anophele, Culex, or Aedes.

12. 3. The method of claim 1 or 2, wherein the cell is an Sf9 cell, a High Five cell, a Se301 cell, a SeIZD2109 cell, a SeUCR1 cell, an Sf900+ cell, a Sf21 cell, a BTI-TN-5B1-4 cell, an MG-1 cell, a Tn368 cell, an HzAm1 cell, a BM-N cell, a Ha2302 cell, an Hz2E5 cell, or an Ao38 cell.

Images