Skin external preparations and internal preparations containing an extract of Sanguisorba officinalis cultivated under irradiation with light having a specific wavelength range

Abstract

To provide a novel external or internal skin preparation that is safe and has an excellent stability as well as has an excellent melanin production inhibitory effect, MMP inhibitory effect, hyaluronic acid production promoting effect, cell proliferation promoting effect, and antioxidant effect.SOLUTION: The present invention provides external and internal skin preparations containing the extract of Sanguisorba officinalis cultivated by irradiating artificial light with a specific wavelength range.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to topical and internal skin preparations containing novel Sanguisorba officinalis and / or its extracts, which have been cultivated by irradiating it with one or two types of light having specific wavelength ranges and have excellent effects such as melanin production inhibition, MMP inhibition (MMP production inhibition), hyaluronic acid production promotion, cell proliferation promotion, and antioxidant effects. [Background technology]

[0002] Generally, skin pigmentation such as age spots, freckles, and sunburn is thought to be caused by excessive melanin production by melanin-producing cells present in the skin due to hormonal abnormalities or ultraviolet light, which then deposits in the skin. One known method for preventing such pigmentation is to inhibit excessive melanin production. Conventionally, ascorbic acid (vitamin C) and the like have been used internally or externally as whitening agents to treat pigmentation (Patent Document 1).

[0003] In addition to ultraviolet rays, skin is exposed daily to various physical and chemical stressors, including dryness, cold, heat, and drugs. As a result, skin function declines, and various skin aging phenomena become apparent. One of these skin aging phenomena is wrinkles. Two types of wrinkles are known: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles, also known as fine lines, are temporary wrinkles that occur when the moisture content in the epidermal stratum corneum decreases due to dry skin. Dermal wrinkles, on the other hand, are wrinkles that are formed by ultraviolet rays contained in sunlight and aging. Possible mechanisms for their formation include a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays and aging, and accelerated collagen degradation due to an increase in matrix metalloproteinases (MMPs).

[0004] Epidermal wrinkles caused by dryness and dermal wrinkles differ in their histological morphology, onset mechanism, and treatment methods, and dermal wrinkles caused by ultraviolet rays and aging are difficult to improve by using cosmetics with moisturizing effects.

[0005] To date, agents that aim to improve dermal wrinkles caused by ultraviolet rays have been reported, including an agent for preventing and improving skin wrinkle formation, which contains hydrolyzed almonds as an active ingredient (Patent Document 2), and an agent for improving wrinkles caused by ultraviolet radiation, which contains extracts of Acanthus chinensis, Acanthus chinensis, and Acanthus chinensis as active ingredients (Patent Document 3).

[0006] Collagen is a major structural protein, accounting for approximately one-third of mammalian tissues, and is an essential component of many matrix tissues, such as cartilage, bone, tendon, and skin. When collagenase (MMP1), a member of the MMP family, cleaves collagen at a single site, the collagen molecule, which is stable in normal tissues, is denatured into single-chain gelatin, which is then susceptible to degradation by various other proteases. As a result, the structural integrity of the matrix tissue is lost.

[0007] Materials that have been proposed as having collagenase inhibitory activity include, for example, cocoa husk extract (Patent Document 4), which is the skin of the cocoa bean, Rubus nigra extract (Patent Document 5), lactoferrin (Patent Document 6), etc. With increasing interest in skin aging and oral hygiene, there is a demand for materials that are safe, have no side effects, and have excellent collagenase activity inhibitory activity.

[0008] Gelatinase (MMP2), a member of the MMP family, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, and other cells. It degrades substrates such as collagen, gelatin, and elastin (structural proteins that are specific components of elastic tissues such as arteries, tendons, and skin). Therefore, substances with inhibitory activity against gelatinase are expected to suppress angiogenesis and cancer metastasis in cancer tissues, making them useful for the prevention and treatment of cancer. Furthermore, MMP inhibition is useful not only for cancer, but also for the prevention, treatment, and amelioration of various diseases caused by increased MMP activity, such as ulcer formation, rheumatoid arthritis, osteoporosis, and periodontitis.

[0009] Fibroblasts also produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue, which maintains skin firmness. It is believed that wrinkles and sagging skin occur when this connective tissue loses its contractile force and elasticity.

[0010] In particular, hyaluronic acid is known as a high molecular weight polysaccharide widely distributed in connective tissue, and it takes on a gel-like form in the dermis, maintaining skin elasticity. Therefore, the alteration or decrease of hyaluronic acid is thought to be important in skin aging. Furthermore, because hyaluronic acid is a high molecular weight, cosmetics containing it have the problem of being poorly absorbed when applied directly to the skin. Therefore, to date, efforts have been made to develop topical skin preparations that can activate fibroblasts to promote the cells' own production of collagen and hyaluronic acid (Patent Document 7).

[0011] Hyaluronic acid is also present in joints, where it is known to cushion the impact of joint loads and smooth joint movement. While the normal concentration of hyaluronic acid in human synovial fluid is approximately 2.3 mg / mL, in patients with rheumatoid arthritis, the concentration drops to approximately 1.2 mg / mL, and the viscosity of the synovial fluid also drops significantly (Non-Patent Document 1). It is also known that septic arthritis, gouty arthritis, and other conditions, like rheumatoid arthritis, experience a decrease in hyaluronic acid content (Non-Patent Document 2). Increasing the amount of hyaluronic acid in synovial fluid is considered to improve lubrication, coat and protect articular cartilage, suppress pain, and improve pathological synovial fluid in the above diseases. For example, it is known that intra-articular injection of sodium hyaluronate in patients with rheumatoid arthritis improves the symptoms described above (Non-Patent Document 3). However, treatment for these diseases is long-term. Therefore, there is a demand for external skin preparations, foods, and pharmaceuticals containing hyaluronic acid production promoters so that prevention and treatment can be easily carried out in daily life.

[0012] Floaters are a condition characterized by the appearance of thin shadows resembling lint or mosquitoes in the field of vision. They occur when opacities in the vitreous, which fills the interior of the eye, cast a shadow on the retina. Floaters can be broadly divided into two types: physiological floaters, which develop due to factors such as aging, ultraviolet light, and active oxygen, and pathological floaters, which appear as a symptom of diseases such as retinal detachment, retinal tears, vitreous hemorrhage, and uveitis. Physiological floaters occur when the vitreous becomes opaque due to the loss of hyaluronic acid, a major component of the vitreous, causing liquefaction and the breakdown of collagen fibers. Treatment options include vitrectomy and laser therapy, but these procedures are not commonly performed in Japan due to safety concerns, and treatment overseas is expensive. Therefore, to prevent and improve physiological floaters, foods and medicines containing hyaluronic acid production promoters that can be used on a daily basis are needed.

[0013] In general, the proliferation and division ability of epidermal cells declines with age, resulting in thinner epidermal layers (Non-Patent Document 4). Biological factors such as epidermal growth factor (EGF) and female hormones (estrogen) stimulate epidermal cell proliferation, but their secretion declines with age. This age-related decline in epidermal cell metabolic function slows skin turnover, leading to rough skin and skin aging. Furthermore, retention of keratinocytes that shed from the stratum corneum inhibits the smooth excretion of melanin within the epidermis, resulting in pigmentation and dull skin. It is also known to slow epidermal wound healing. To prevent or ameliorate these phenomena, researchers have sought to identify ingredients that promote epidermal cell proliferation, and many topical skin preparations have been proposed.

[0014] Furthermore, skin, located at the outermost layer of the body, is an organ susceptible to the generation of reactive oxygen species due to the effects of ultraviolet rays and other factors, and is constantly exposed to oxygen stress. Meanwhile, reactive oxygen-scavenging enzymes exist within skin cells, protecting them from reactive oxygen damage unless the generation of reactive oxygen species exceeds their capacity. However, it is known that the activity of these enzymes declines with age. When the damage caused by reactive oxygen species overcomes their defense response, the skin becomes oxidized, cellular function deteriorates, and aging progresses. Furthermore, exposure to reactive oxygen species in organs other than the skin can lead to functional decline, aging, and the development of various lifestyle-related diseases such as cancer and myocardial infarction. Therefore, reactive oxygen scavengers and antioxidants have been investigated to protect against reactive oxygen species damage, and foods, cosmetics, quasi-drugs, and pharmaceuticals containing reactive oxygen scavenging enzymes such as SOD and catalase, and SOD-like active substances, as well as reactive oxygen scavengers and antioxidants, have been developed (Patent Documents 8 and 9).

[0015] Sanguisorba officinalis (scientific name: Sanguisorba officinalis) is a perennial herb belonging to the genus Sanguisorba in the family Rosaceae. Publicly known literature on Sanguisorba includes its matrix metalloproteinase inhibitory effect (Patent Document 10) and antioxidant effect (Patent Document 11).

[0016] Meanwhile, methods for enhancing the medicinal effects of plants through plant cultivation methods, such as methods for characteristically increasing the amounts of functional substances in plants, such as vitamins, polyphenols, and rutin, have already been reported in patent documents. Patent Document 12 discloses a method for increasing the amounts of vitamin A and vitamin E contained in soybean sprouts by irradiating them with light in the near-ultraviolet to blue wavelength range. Patent Document 13 discloses a cultivation method for increasing the functional substances α-tocopherol and vitamin C by irradiating komatsuna (Japanese mustard spinach) with artificial ultraviolet light for five minutes a day. Patent Document 14 discloses a method for increasing the amounts of vitamin C and vitamin A in komatsuna (Japanese mustard spinach) and lettuce by adjusting the intensities of blue, red, and far-red artificial light. [Prior art documents] [Patent documents]

[0017] [Patent Document 1] Japanese Patent Application Publication No. 5-229931 [Patent Document 2] Japanese Patent Application Laid-Open No. 2000-119125 [Patent Document 3] Japanese Patent Application Laid-Open No. 2006-199611 [Patent Document 4] Japanese Patent Application Publication No. 3-44331 [Patent Document 5] Japanese Patent Application Laid-Open No. 2003-137801 [Patent Document 6] Japanese Patent Application Publication No. 5-186368 [Patent Document 7] Japanese Patent Application Laid-Open No. 2007-1924 [Patent Document 8] Japanese Patent Application Publication No. 9-118630 [Patent Document 9] Japanese Patent Application Publication No. 9-208484 [Patent Document 10] JP 2001-269398 A [Patent Document 11] JP 2006-104117 A [Patent Document 12] Japanese Patent Application Publication No. 11-103680 [Patent Document 13] Japanese Patent Application Laid-Open No. 2004-305040 [Patent Document 14] Japanese Patent Application Publication No. 8-205677 [Non-patent literature]

[0018] [Non-Patent Document 1] “Arthritis Rheumatism”,vol.10,pp 357,1967 [Non-patent document 2] "Bonding Composition", Kanehara Publishing, 481 pages, 1984 [Non-patent document 3] "Inflammation," Japanese Society of Inflammation, Vol. 11, No. 16, 1991 [Non-patent document 4] Varani J et al., J Invest Dermatol, Vol.3,pp 57-60,1998 Summary of the Invention [Problem to be solved by the invention]

[0019] The present invention aims to provide a novel external or internal skin preparation that is safe, stable, and has excellent melanin production inhibitory effects, MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects. [Means for solving the problem]

[0020] In order to solve this problem, the inventors conducted extensive research and discovered that an extract of Sanguisorba officinalis grown under irradiation with one or two types of artificial light having specific wavelength ranges has excellent melanin production inhibitory effects, MMP inhibitory effects, hyaluronic acid production promotion effects, cell proliferation promotion effects, and antioxidant effects, leading to the completion of the present invention.

[0021] That is, the present invention provides the following (1) to (3). (3) It consists of: (1) Wavelength range 570~730nm and 400~515nm The photosynthetic photon flux density (PPFD) ratio is 4:1 to 2:1 By cultivating burnet under artificial light, melanin production suppression effect, MMP inhibition effect, Skin fibroblasts Hyaluronic acid production promoting effect and Cell proliferation promoting effect from Enhanced the effects of one or more selected ingredients Sanguisorba officinalis extract A topical skin preparation comprising: (2) This topical skin preparation for promoting hyaluronic acid production in skin fibroblasts is characterized by containing an extract of Sanguisorba officinalis, which has been cultivated under artificial light with a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 between the wavelength ranges of 570 to 730 nm and 400 to 515 nm, thereby enhancing the effect of promoting hyaluronic acid production in skin fibroblasts compared to Sanguisorba officinalis cultivated in sunlight. (3) Wavelength range 570~730nm and 400~515nm The photosynthetic photon flux density (PPFD) ratio is 4:1 to 2:1 By cultivating burnet under artificial light, melanin production suppression effect, MMP inhibition effect, Skin fibroblasts Hyaluronic acid production promoting effect andCell proliferation promoting effect from It is characterized by enhancing the effects of one or more selected Burntwood Cultivation method. [Effects of the Invention]

[0022] The Sanguisorba officinalis or its extract of the present invention has excellent melanin production inhibitory effects (whitening effect), MMP inhibitory effects, hyaluronic acid production promoting effects, cell proliferation promoting effects, and antioxidant effects, and can contribute to the fields of pharmaceuticals, quasi-drugs, cosmetics, and food. DETAILED DESCRIPTION OF THE INVENTION

[0023] Sanguisorba officinalis (scientific name: Sanguisorba officinalis), also known as Great Burnett, used in the present invention is a perennial herb belonging to the genus Sanguisorba in the family Rosaceae. It is cold- and heat-tolerant and grows widely from the cold to temperate zones, found in the mountains and fields of Japan. In the present invention, the term "sanguisorba extract" refers to an extract of parts of the plant, such as flowers, seeds, leaves, stems, rhizomes, and roots, or the entire plant (whole plant), or a mixture thereof. In the present invention, the parts used as the extraction raw material are preferably leaves, stems, rhizomes, and roots. For extraction, the plant may be used as is, or may be processed by drying, crushing, shredding, or the like.

[0024] Cultivation can be carried out using soil or hydroponics. When hydroponics is used, the seeds can be sown and then hydroponically cultivated in the rooted state or as seedlings. Cultivation is preferably carried out in a facility where temperature, light, and carbon dioxide concentration are controlled. The cultivation temperature is 15 to 30°C, preferably 20 to 25°C. The cultivation period varies depending on the irradiation conditions, but harvesting is possible in approximately 10 to 30 days. Cultivation for a longer period is also possible.

[0025] The light source can be a light source used in plant cultivation facilities, and among these, artificial light such as LED is most preferable. Examples of artificial light sources include optical semiconductor elements such as light-emitting diodes (LEDs) and laser diodes, but any light source that can selectively irradiate a specific range of wavelengths will suffice.

[0026] In cultivating burnet, the wavelengths of light to be irradiated are preferably blue light in the wavelength range of 400 to 515 nm and red light in the wavelength range of 570 to 730 nm, and more preferably light in the wavelength ranges of 430 to 460 nm and 630 to 680 nm. It is most preferable to irradiate these lights simultaneously. The wavelength in this case refers to the maximum wavelength (peak wavelength) of the irradiation spectrum. Any light source with such a peak wavelength can be used, whether it is a custom-made one or a commercially available one. An optical filter can also be used to selectively irradiate the above wavelengths. In addition to the above two types of light in the ranges, light sources such as sunlight and fluorescent lamps can also be used.

[0027] The amount of light to be irradiated is expressed as photosynthetic photon flux density (PPFD). When irradiating with a combination of two light emitters, the total amount of light is used. After germination, the amount of light is 10 to 300 μmol m -2 s -1 is preferred, and 50 to 200 μmol m -2 s -1 Light intensities outside this range may result in growth disorders or poor growth. Irradiation is preferably performed from a position 10 to 50 cm above the burnet plant. Irradiation time can be adjusted depending on the characteristics and purpose of the plant, but 6 hours or more per day is preferred, and 12 to 24 hours is more preferred.

[0028] The ratio of red to blue light intensity refers to the ratio of their respective PPFD, and can be selected according to the purpose, such as yield or effectiveness.

[0029] In particular, in order to increase the yield of the plant body, a red to blue light intensity ratio of 8:1 to 2:1 is preferable, and a particularly high yield was obtained when the red to blue light intensity ratio was 4:1 to 2:1.

[0030] In terms of the melanin production inhibitory effect, a red to blue light intensity ratio of 8:1 to 1:1 is preferable, and among these, a red to blue light intensity ratio of 3:1 is most preferable.

[0031] In terms of the effect of suppressing MMP1 mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is preferable, and among these, a red to blue light intensity ratio of 3:1 is most preferable.

[0032] In terms of the effect of suppressing MMP2 mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is preferable, and among these, a red to blue light intensity ratio of 3:1 is most preferable.

[0033] In terms of promoting hyaluronic acid synthase 2 (HAS2) mRNA expression, a red to blue light intensity ratio of 8:1 to 1:1 is effective. Among these, a red to blue light intensity ratio of 3:1 is most preferable. Cultivation under sunlight is also highly effective and preferable.

[0034] In terms of cell proliferation promoting effect, a red to blue light intensity ratio of 8:1 to 2:1 is preferable, and among these, a red to blue light intensity ratio of 3:1 is most preferable.

[0035] In terms of the active oxygen scavenging effect (free radical scavenging and removal effect), a red to blue light intensity ratio of 8:1 to 1:1 is preferable, and among these, a red to blue light intensity ratio of 3:1 is most preferable.

[0036] To sum up the above, the ratio of red to blue light intensity is preferably 8:1 to 1:1, more preferably 4:1 to 2:1, and most preferably 3:1.

[0037] In addition, the present invention can provide a novel hyaluronic acid production promoter by cultivating the plant using natural light such as sunlight instead of the artificial light. In this case, a known cultivation method can be used.

[0038] The extraction method is not particularly limited, but can be carried out using water, hot water, or a mixed solvent of water and an organic solvent, by stirring or column extraction. Examples of extraction solvents include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), and ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.). Polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are preferred, with water, ethanol, 1,3-butylene glycol, and propylene glycol being particularly preferred. These solvents may be used alone or in combination. Particularly preferred extraction solvents include water, a mixed polar solvent of water and ethanol, or a mixed polar solvent of water and 1,3-butylene glycol. The amount of solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more, the dry weight of the burnet plant. However, for convenience of operations such as concentration and isolation after extraction, it is preferable that the amount be 100 times or less. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure during extraction, etc.

[0039] The extract may be used as the extracted solution as it is, or, if necessary, may be subjected to treatment such as concentration (vacuum concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, ethanol precipitation, etc., within the scope of the effects of the present invention. Furthermore, the extracted solution may be subjected to treatment such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0040] In the present invention, the extract may be used as is, or may contain ingredients such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, coating agents, sweeteners, and acidulants, which are used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., within a range that does not impair the effects of the extract.

[0041] The present invention can be used for any of cosmetics, quasi-drugs, pharmaceuticals, and foods, and examples of dosage forms thereof include lotions, creams, emulsions, gels, aerosols, essences, packs, cleansers, bath additives, foundations, dusting powders, lipsticks, ointments, poultices, candy tablets, chocolates, gums, candies, beverages, powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, suppositories, and solutions for injection.

[0042] For external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight, calculated as solid matter. Furthermore, 0.01 to 5% by weight is most preferable. If the content is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If the content exceeds 10% by weight, it is difficult to see an enhancement of the effect, which is uneconomical.

[0043] For internal use, the dosage varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, etc. Generally, the daily dosage per adult is preferably 5 mg or more, more preferably 10 mg to 5 g, and most preferably 20 mg to 2 g.

[0044] In the following, in order to explain the present invention in detail, production examples, experimental examples and formulation examples of the extract used in the present invention are given as examples, but the present invention is not limited to these. % in the production examples and formulation examples indicates % by weight. [Example]

[0045] (1) Experimental materials and growth conditions After removing the soil from commercially available burnet seedlings, the rhizome clumps were cut into small pieces of approximately 1 cm each, each wrapped in a sponge, and grown in a hydroponic cultivation system at a room temperature of 21-25°C for 24 hours. The plants were simultaneously irradiated with a red LED (peak wavelength 660 nm) and a blue LED (peak wavelength 450 nm) from a position 30 cm directly above the plants, until the total photosynthetic photon flux density of the red and blue LEDs reached 100 μmol m -2 s -1 The ratio of red and blue light intensity is set to 4:1~2:1 The light intensity ratio was not changed during cultivation. As a comparative example, cultivation was also carried out under sunlight. After 4 weeks of cultivation, the plants were harvested and dried with hot air at approximately 60°C to obtain dried burnet (Table 1).

[0046] [Table 1]

[0047] (2) Example of manufacturing Sanguisorba officinalis extract Burnett's extract was produced as follows: In Production Examples 1A to 4A, the whole plant of Burnett's plant cultivated in a red:blue ratio of 2:1 was used as the extraction material.

[0048] (Production Example 1A) Preparation of hot water extract of Sanguisorba officinalis 200 mL of water was added to 10 g of dried burnet, and the mixture was extracted for 2 hours at 95-100° C. The resulting extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.6 g of a hot water extract of burnet.

[0049] (Production Example 2A) Preparation of 50% Ethanol Extract of Sanguisorba officinalis 10 g of dried burnet was soaked in 200 mL of 50% ethanol solution at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 1.1 g of a 50% ethanol extract of burnet.

[0050] (Production Example 3A) Preparation of Sanguisorba officinalis ethanol extract 10 g of dried burnet was soaked in 200 mL of ethanol at room temperature for 7 days to perform extraction. The resulting extract was filtered and then concentrated to dryness using an evaporator to obtain 0.45 g of ethanol extract of burnet.

[0051] (Production Example 4A) Preparation of 1,3-butylene glycol extract of Sanguisorba officinalis 10 g of dried burnet was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days to perform extraction, and the resulting extract was filtered to obtain 192 g of a 1,3-butylene glycol extract of burnet.

[0052] As above, the total photosynthetic photon flux density of the red and blue LEDs is 100 μmol m -2 s -1 Burnettstus was grown under varying ratios of red and blue light so as to obtain the above results, and burnettstus was grown in sunlight. Extraction was performed in the same manner as in Production Examples 1A to 4A above, and the results were designated Production Examples 1B to 4B, 1C to 4C, and Production Examples P to S (Table 2).

[0053] [Table 2] [Example]

[0054] (Prescription Example 1) Lotion 1 Prescription Content (%) 1. Hot water extract of Sanguisorba officinalis (Production Example 1A) 2.0 2.1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl parahydroxybenzoate 0.1 9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 6 and 11 are dissolved uniformly, and components 7 to 10 are dissolved uniformly. The mixture is then mixed and filtered to obtain the product.

[0055] (Formulation example 2) Lotion 2 Lotion 2 was prepared by replacing the hot water extract of burnet (Production Example 1A) in Formulation Example 1 with the hot water extract of burnet (Production Example P).

[0056] (Comparative Formulation Example 1) Conventional lotion A conventional lotion was prepared by replacing the hot water extract of Sanguisorba officinalis (Production Example 1A) in Formulation Example 1 with purified water.

[0057] (Prescription Example 3) Cream 1 Prescription Content (%) 1. 50% ethanol extract of Sanguisorba officinalis (Preparation Example 2B) 1.0 2. Squalane 5.5 3. Olive Oil 3.0 4. Stearic Acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10.Fragrance 0.1 11. Methyl parahydroxybenzoate 0.2 12.1,3-butylene glycol 8.5 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 2-9, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1 and 11-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 10 at 45°C, then cool further to 30°C to form the final product.

[0058] (Prescription Example 4) Cream 2 Cream 2 was prepared by replacing the 50% ethanol extract of burnet (Production Example 2B) in Formulation Example 3 with a 50% ethanol extract of burnet (Production Example Q).

[0059] (Comparative Formulation Example 2) Conventional cream A conventional cream was prepared by replacing the 50% ethanol extract of Sanguisorba officinalis (Production Example 2B) in Formulation Example 3 with purified water.

[0060] (Formulation Example 5) Emulsion Prescription Content (%) 1. Sanguisorba officinalis ethanol extract (Production Example 3C) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl Monostearate 2.0 7. Polyoxyethylene cetyl ether (20E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20E.O.) 2.0 9.Fragrance 0.1 10. Propylene Glycol 1.0 11. Glycerin 2.0 12. Methyl parahydroxybenzoate 0.2 13. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 1-8, then maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 10-13, then maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool with stirring. Add ingredient 9 at 45°C, then cool to 30°C to form the final product.

[0061] (Formulation Example 6) Gel Prescription Content (%) 1. 1,3-butylene glycol extract of Sanguisorba officinalis (Preparation Example 4A) 1.0 2. Ethanol 5.0 3. Methyl parahydroxybenzoate 0.1 4. Polyoxyethylene hydrogenated castor oil (60E.O.) 0.1 5.Fragrance (appropriate amount) 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Add purified water to make the total volume 100 [Manufacturing method] Components 2 to 5, 1, and 6 to 11 are each dissolved uniformly, and then mixed to form the product.

[0062] (Prescription Example 7) Pack Prescription Content (%) 1. Hot water extract of Sanguisorba officinalis (Production Example 1C) 1.0 2. 1,3-butylene glycol extract of Sanguisorba officinalis (Preparation Example 4B) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3-Butylene Glycol 8.0 6. Methyl parahydroxybenzoate 0.2 7. Polyoxyethylene hydrogenated castor oil (20E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10.Fragrance (appropriate amount) 11. Add purified water to make the total volume 100 [Manufacturing method] Components 1 to 11 are dissolved uniformly to produce the product.

[0063] (Formulation Example 8) Foundation Prescription Content (%) 1. 50% ethanol extract of Sanguisorba officinalis (Production Example 2C) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20E.O.) 1.0 4. Polyoxyethylene cetyl ether (20E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid Lanolin 2.0 7. Liquid Paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethylcellulose 0.1 10. Bentonite 0.5 11. Propylene Glycol 4.0 12. Triethanolamine 1.1 13. Methyl parahydroxybenzoate 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Bengala 1.0 17. Yellow Iron Oxide 2.0 18.Fragrance (appropriate amount) 19. Add purified water to make the total volume 100 [Manufacturing Method] Heat and dissolve ingredients 2-8 and maintain at 80°C to form the oil phase. Ingredient 9 is thoroughly swelled in ingredient 19, and then ingredients 1 and 10-13 are added and mixed uniformly. To this, ingredients 14-17, which have been pulverized and mixed in a grinder, are added, and the mixture is stirred in a homomixer and maintained at 75°C to form the water phase. The water phase is added to the oil phase while stirring, and emulsified. After that, cool, add ingredient 18 at 45°C, and cool to 30°C while stirring to form the final product.

[0064] (Formulation Example 9) Bath additive Prescription Content (%) 1. Sanguisorba officinalis ethanol extract (Production Example 3A) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) appropriate amount 4.Fragrance (appropriate amount) 5. Add sodium sulfate to make the total volume 100 [Manufacturing method] Mix ingredients 1 to 5 uniformly to make the product.

[0065] (Prescription Example 10) Ointment Prescription Content (%) 1. Hot water extract of Sanguisorba officinalis (Production Example 1B) 5.0 2. 1,3-butylene glycol extract of Sanguisorba officinalis (Preparation Example 4C) 1.0 3. Polyoxyethylene cetyl ether (30E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid Paraffin 5.0 6. Cetyl alcohol 6.0 7. Methyl parahydroxybenzoate 0.1 8. Propylene Glycol 10.0 9. Add purified water to make the total volume 100 [Manufacturing Method] Heat, dissolve, and mix ingredients 3-6, and maintain at 70°C to form the oil phase. Heat, dissolve, and mix ingredients 1, 2, and 7-9, and maintain at 75°C to form the water phase. Add the water phase to the oil phase and emulsify, then cool to 30°C while stirring to form the final product.

[0066] (Prescription Example 11) Powder Prescription Content (%) 1. Hot water extract of Sanguisorba officinalis (Production Example 1C) 1.0 2.Dry cornstarch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix ingredients 1 to 3 to form a powder.

[0067] (Prescription Example 12) Tablets Prescription Content (%) 1. Sanguisorba officinalis ethanol extract (Production Example 3B) 5.0 2.Dry cornstarch 25.0 3. Calcium carboxymethylcellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing Method] Components 1 to 4 are mixed, and then an aqueous solution of component 5 is added as a binder to form granules. Component 6 is added to the formed granules and compressed into tablets. Each tablet weighs 0.52 g.

[0068] (Prescription Example 13) Tablets Prescription Content (%) 1. Sanguisorba officinalis ethanol extract (Production Example 3A) 2.0 2. Dry cornstarch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6.Fragrance 0.1 7.Purified water 0.1 [Manufacturing method] Mix ingredients 1 to 4 and 7 and form into granules. Add ingredients 5 and 6 to the formed granules and compress into tablets. Each tablet weighs 1.0 g.

[0069] (Formulation Example 14) Beverage Prescription Content (%) 1. Hot water extract of Sanguisorba officinalis (Production Example 1B) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4.Fragrance 0.1 5. Add purified water to make the total volume 100 [Manufacturing Method] Dissolve ingredients 1 to 3 in a small amount of water. Then add ingredients 4 and 5 and mix.

[0070] Next, experimental examples will be given to explain the effects of the present invention in detail. [Example]

[0071] Experimental Example 1: Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were plated in a 60 mm dish at 3 × 10 4Cells were seeded and cultured for 5 days at 37°C under 5% CO2 in MEM medium containing 10% FBS supplemented with each sample at a final concentration of 1 μg / mL. After incubation, cells were detached and centrifuged. The resulting pellet was sonicated and dissolved in PBS(-). Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265-275, 1951). To measure melanin levels, the remaining cell lysate was added with 4N NaOH and incubated at 60°C for 2 hours. The absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation). The melanin content was calculated from the calibration curve and the melanin content per mg of protein. The melanin production inhibition rate was calculated as the ratio of the reduction in melanin in the sample-treated group to the control (no sample added) group.

[0072] The results of these experiments are shown in Table 3. As a result, it was confirmed that the extract of the burnet plant cultivated under irradiation with artificial light having a specific wavelength range of the present invention has an excellent melanin production inhibitory effect. In particular, the burnet plant extract cultivated under a red to blue light intensity ratio of 3:1 exhibited a higher effect than Production Examples P to S. The burnet plant extract of the present invention obtained using other extraction methods (Production Examples 1A to 4C) also exhibited a higher effect than Production Examples P to S. Furthermore, the extract of the burnet plant cultivated under other light intensity ratios (red:blue = 8:1 to 1:1) also exhibited a higher effect than Production Examples P to S, as did the extract cultivated under a red:blue light intensity ratio of 3:1.

[0073] [Table 3]

[0074] Experimental Example 2 Measurement of mRNA expression levels of MMP1, MMP2, and hyaluronic acid synthase 2 (HAS2) The mRNA expression levels of MMP1, MMP2, and HAS2 were measured. Human dermal fibroblasts were cultured in a 60 mm dish at 1 × 10 5Cells were seeded and cultured in DMEM medium containing 10% FBS at 37°C under 5% CO2 conditions. When the cells reached confluence, they were cultured in DMEM(-) medium supplemented with each sample at final concentrations of 1 and 10 μg / mL for 24 hours, after which total RNA was extracted. Total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and total RNA content was determined by absorbance at 260 nm using a spectrophotometer (Nanodrop). mRNA expression levels were measured by real-time RT-PCR using the total RNA extracted from the cells. For real-time RT-PCR, a High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. 500 ng of total RNA was reverse transcribed and then subjected to PCR (95°C for 15 seconds, 60°C for 60 seconds, 40 cycles). Other procedures were performed according to established methods, and the expression levels of MMP1, MMP2, and HAS2 mRNA were calculated as a percentage of the expression level of β-actin mRNA, an internal standard. The MMP1 expression inhibition rate was calculated as the ratio of the MMP1 mRNA expression level in the sample-added group to the MMP1 mRNA expression level in the control (no sample added) group. The MMP2 mRNA expression inhibition rate and HAS2 mRNA expression promotion rate were calculated in the same way. The primers used to measure the expression level of each gene are as follows:

[0075] Primer set for MMP1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 1) TGAGCATCCCCTCCAATACC (SEQ ID NO: 2) Primer set for MMP2 CCGTCGCCCATCATCAA (SEQ ID NO: 3) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 4) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 5) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 6) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 7) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 8)

[0076] The results of these experiments are shown in Tables 4 to 6. As a result, the extract of the burnet plant cultivated under irradiation with artificial light having a specific wavelength range of the present invention was found to have excellent effects in suppressing MMP1 mRNA expression (MMP1 inhibitory activity) and MMP2 mRNA expression (MMP2 inhibitory activity). In particular, the burnet plant extract with a red to blue light intensity ratio of 3:1 was found to have a higher effect than Production Examples P to S. Furthermore, the burnet plant extract of the present invention obtained using other extraction methods (Production Examples 1A to 4C) also showed a higher effect than Production Examples P to S, as was the extract with a red to blue light intensity ratio of 3:1. Furthermore, the burnet plant extract of the present invention cultivated under other light intensity ratios (red:blue = 8:1 to 1:1) also showed a higher effect than Production Examples P to S, as was the extract with a red:blue light intensity ratio of 3:1. The burnet plant extract of the present invention showed an excellent effect in promoting HAS2 mRNA expression (promoting hyaluronic acid production). In particular, extremely high effects were observed in the burnet extracts exposed to sunlight and a red:blue light ratio of 3:1. Similar high effects were observed in the burnet extracts of the present invention obtained by other extraction methods (Production Examples 1A to 4C, Production Examples Q to S). Furthermore, similar high effects were observed in the extracts of the burnet of the present invention grown under other light ratios (red:blue = 8:1 to 1:1), as in the extracts exposed to sunlight and a red:blue light ratio of 3:1.

[0077] [Table 4]

[0078] [Table 5]

[0079] [Table 6]

[0080] Experimental Example 3 Cell proliferation promotion test Human keratinocytes were cultured in DMEM culture medium containing 0.1% FBS at 1 × 10 per well in a 96-well plate. 3 After seeding, each sample was added to a final concentration of 0.01 μg / mL and cultured for 5 days at 37°C under 5% CO2. Cell counts were measured using a staining method. After culture, the culture medium was removed and the cells were fixed with methanol. Next, 0.1% methylene blue was added and the cells were stained for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and mixed well. The absorbance at 650 nm was measured using a microplate reader. The cell proliferation rate was calculated as the ratio of the cell mass in the sample-added group to the cell mass in the control (no sample added) group.

[0081] The results of these experiments are shown in Table 7. As a result, the burnet plant cultivated under irradiation with artificial light having a specific wavelength range of the present invention exhibited an excellent cell proliferation-promoting effect. In particular, the burnet plant extract with a red to blue light intensity ratio of 3:1 exhibited a higher effect than Production Examples P to S. Furthermore, the burnet plant extracts of the present invention obtained using other extraction methods (Production Examples 1A to 4C) also exhibited a higher effect than Production Examples P to S, as did the extract with a red:blue light intensity ratio of 3:1. Furthermore, the burnet plant extracts of the present invention cultivated under other light intensity ratios (red:blue = 8:1 to 1:1) also exhibited a higher effect than Production Examples P to S, as did the extract with a red:blue light intensity ratio of 3:1.

[0082] [Table 7]

[0083] Experimental Example 4: Active oxygen scavenging effect Superoxide dismutase (SOD)-like activity was measured in a 96-well plate using the SOD Assay Kit-WST (Dojindo Laboratories). The reagents included with the kit were used. 20 μL of sample solution was added to each well, followed by 200 μL of WST working solution, and the mixture was mixed thoroughly using a plate mixer. 20 μL of dilution buffer was added to the blank wells. 20 μL of enzyme working solution was added to both the sample wells and the blank wells. The plates were then incubated at 37°C for 20 minutes, and the absorbance at 450 nm was measured using a plate reader to determine the active oxygen scavenging rate of each extract. The final sample concentration was 3.33 μg / mg.

[0084] The test results are shown in Table 8. It was confirmed that the burnet extract of the present invention cultivated under irradiation with artificial light having a specific wavelength range possesses stable and excellent free radical scavenging and scavenging activity (antioxidant activity). In particular, the burnet extract cultivated under a red to blue light intensity ratio of 3:1 exhibited a higher effect than Production Examples P to S. Furthermore, the burnet extract of the present invention obtained using other extraction methods (Production Examples 1A to 4C) also exhibited a higher effect than Production Examples P to S, as did the extract cultivated under a red to blue light intensity ratio of 3:1. Furthermore, the burnet extract of the present invention cultivated under other light intensity ratios (red:blue = 8:1 to 1:1) also exhibited a higher effect than Production Examples P to S, as did the extract cultivated under a red:blue light intensity ratio of 3:1.

[0085] [Table 8]

[0086] Experimental Example 5: Usage test A one-month usage test was conducted on five people (aged 25-66) with wrinkles and sagging skin using Cream 1 of Formulation Example 3, Cream 2 of Formulation Example 4, and the conventional cream of Comparative Formulation Example 2. After use, the degree of wrinkles and sagging skin was assessed by questionnaire.

[0087] As a result, the cream containing the extract of the present invention reduced wrinkles and sagging. Furthermore, during the test period, not a single subject experienced any skin problems, and there were no safety issues. There were also no problems with the deterioration of the prescription ingredients.

[0088] Furthermore, a similar use test was carried out using lotion 1 of formulation example 1, lotion 2 of formulation example 2, and a conventional lotion of comparative formulation example 1. As a result, it was found that the lotion containing the extract of the present invention reduced wrinkles and sagging. [Industrial Applicability]

[0089] From the above, the burnet extract of the present invention has excellent melanin production inhibitory activity, MMP inhibitory activity, hyaluronic acid production promoting activity, cell proliferation promoting activity, and antioxidant activity, and is also excellent in stability. Therefore, the burnet extract of the present invention can be used not only in the cosmetic field such as skin aging, but also in the medical field such as suppressing functional decline due to aging, preventing and treating cancer, etc., and is expected to be applied to cosmetics, foods, quasi-drugs, and pharmaceuticals.

Claims

1. A topical skin preparation containing an extract of Sanguisorba officinalis, which has been cultivated under irradiation with artificial light having a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 between the wavelength ranges of 570-730 nm and 400-515 nm, and which has enhanced one or more effects selected from the melanin production suppression effect, MMP inhibition effect, hyaluronic acid production promotion effect in skin fibroblasts, and cell proliferation promotion effect, compared to Sanguisorba officinalis cultivated under sunlight.

2. A topical skin preparation for promoting hyaluronic acid production in dermal fibroblasts, characterized by containing an extract of Sanguisorba officinalis, which has been cultivated under irradiation with artificial light having a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 in the wavelength ranges of 570 to 730 nm and 400 to 515 nm, thereby enhancing the effect of promoting hyaluronic acid production in dermal fibroblasts compared to Sanguisorba officinalis cultivated in sunlight.

3. A method for cultivating burnet, characterized in that the burnet is cultivated by irradiating it with artificial light having a photosynthetic photon flux density (PPFD) ratio of 4:1 to 2:1 between the wavelength ranges of 570 to 730 nm and 400 to 515 nm, thereby enhancing one or more effects selected from the melanin production suppression effect, MMP inhibition effect, hyaluronic acid production promotion effect in skin fibroblasts, and cell proliferation promotion effect, compared to burnet cultivated in sunlight.

Images