Composition for improving pulmonary hypertension, method for predicting the prognosis of pulmonary hypertension, method for assisting in determining the severity of pulmonary hypertension, and method for assisting in the diagnosis of pulmonary hypertension.

A composition targeting the intestinal microbiota of patients with pulmonary hypertension addresses treatment resistance by normalizing bacterial levels, improving prognosis and diagnosis through bacterial detection.

JP7830312B2Active Publication Date: 2026-03-16中岡良和 +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-02-19
Publication Date
2026-03-16

AI Technical Summary

Technical Problem

Current treatments for pulmonary hypertension are ineffective for a significant portion of patients, and there is a need for new methods and biomarkers to improve prognosis and diagnosis.

Method used

A composition targeting the intestinal flora of patients with pulmonary hypertension, comprising substances that normalize the intestinal microbiota by reducing or increasing specific bacteria, and methods for predicting prognosis and diagnosing severity through bacterial detection.

Benefits of technology

The composition improves pulmonary hypertension, allows for predicting prognosis, and assists in determining severity by normalizing intestinal bacteria, providing a more effective treatment approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007830312000003
    Figure 0007830312000003
  • Figure 0007830312000004
    Figure 0007830312000004
  • Figure 0007830312000005
    Figure 0007830312000005
Patent Text Reader

Abstract

The present invention provides: (1) a composition which is for alleviating pulmonary hypertension and contains, as an active ingredient, at least one substance that normalizes the intestinal flora of patients with pulmonary hypertension; (2) a method for predicting the prognosis of patients with pulmonary hypertension or for assisting in determining the severity of pulmonary hypertension, the method comprising a step for detecting at least one kind of bacteria selected from among bacteria belonging to the genus Micrococcaceae, bacteria belonging to the genus Streptococcaceae, bacteria belonging to the genus Pasteurellaceae, bacteria belonging to the genus Veillonellaceae, and bacteria belonging to the genus Lactobacillaceae, in the intestinal flora of the patients with pulmonary hypertension; and (3) a method for assisting in diagnosing pulmonary hypertension, the method comprising comparing the IgA concentration in the feces of a subject with that of a healthy subject.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a composition for improving pulmonary hypertension, a method for predicting the prognosis of pulmonary hypertension, a method for assisting in determining the severity of pulmonary hypertension, and a method for assisting in the diagnosis of pulmonary hypertension.

Background Art

[0002] Pulmonary hypertension is a refractory disease with a poor prognosis that leads to right heart failure due to an increase in pulmonary artery pressure caused by vascular remodeling (stenosis or occlusion) in the pulmonary artery. Pulmonary hypertension is classified into groups 1 to 5 based on the main locus of the disease state (see Table 1). Among them, pulmonary arterial hypertension caused by pulmonary artery remodeling such as pulmonary artery medial hypertrophy and intimal proliferative lesions, and chronic thromboembolic pulmonary hypertension caused by chronic thromboembolism in the pulmonary artery are intractable diseases designated by the Ministry of Health, Labour and Welfare.

[0003] Currently, drugs such as endothelin receptor antagonists (bosentan, ambrisentan, macitentan, etc.), phosphodiesterase (PDE) 5 inhibitors (sildenafil, tadalafil, etc.), soluble guanylate cyclase (sGC) stimulants (riociguat, etc.), prostaglandin I2 and its derivatives (epoprostenol, selexipag, iloprost, treprostinil, etc.) are used in current clinical practice for the treatment of pulmonary hypertension in Japan. However, there are also patients who are resistant to these treatments, and such patients have a very poor prognosis, so the development of new treatment methods and biomarkers is necessary.

[0004] Although BMPR2 signal-related genes are known as genetic factors for pulmonary hypertension, the disease penetrance is as low as about 20%, and inflammation and exposure to foreign chemicals are considered important for the onset of pulmonary hypertension. The present inventors reported that the interleukin-6 (IL-6) / Th17 cell / IL-21 signal axis is important for the pathogenesis of pulmonary hypertension (Non-Patent Document 1). Based on the fact that Th17 cells, which play an important role in this signal axis, are most abundantly distributed in the intestinal tract and the interaction with the intestinal flora is important for their differentiation induction, the role of the intestinal flora in the pulmonary hypertension disease state was examined.

[0005] [Table 1] [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Hashimoto-Kataoka T, et al. Proc Natl Acad Sci USA 112, E2677-2686(2015) [Overview of the project] [Problems that the invention aims to solve]

[0007] The present invention aims to provide a composition that improves pulmonary hypertension by acting on the intestinal bacteria of patients with pulmonary hypertension. Furthermore, the present invention aims to provide a method for predicting the prognosis of patients with pulmonary hypertension by detecting specific intestinal bacteria in such patients, and a method for assisting in determining the severity of pulmonary hypertension. Additionally, the present invention aims to provide a method for assisting in the diagnosis of pulmonary hypertension using the feces of a subject. [Means for solving the problem]

[0008] The present invention encompasses the following inventions in order to solve the above problems. [1] A composition for improving pulmonary hypertension, comprising as an active ingredient at least one substance that normalizes the intestinal flora of patients with pulmonary hypertension. [2] The composition according to [1], wherein the substance is a substance that reduces the intestinal bacteria that increase in patients with pulmonary hypertension compared to healthy individuals. [3] The composition according to [2], wherein the increased intestinal bacteria are Streptococcus bacteria, Micrococcaceae bacteria, Veillonellaceae bacteria, Pasteurellaceae bacteria, Clostridium bacteria or Sutterellaceae bacteria. [3-1] The composition according to [2], wherein the increased intestinal bacteria are bacteria of the family Streptococcus, Micrococcaceae, Veillonellaceae, Pasteurellaceae, Fusobacteriaceae, Lactobacillaceae, Enterobacteriaceae, Coriobacteriaceae, or Sutterellaceae. [4] The increasing intestinal bacteria include Actinomyces, Rothia, Citrobacter, Veillonella, Escherichia, Gemella, Granulicatella, Atopobium, Clostridium, and Enterophylline. The composition according to [2], wherein the bacteria are of the genus Enterobacter, Streptococcus, Abiotrophia, Klebsiella, Cronobacter, Shigella, Salmonella, Sutterella, or Haemophilus. [4-1] The increasing intestinal bacteria include Actinomyces, Rothia, Citrobacter, Veillonella, Escherichia, Gemella, Granulicatella, Atopobium, Enterobacter, Streptococcus, and Abiotrophia The composition according to [2] above, which is a bacterium of the genus Abiotrophia, Klebsiella, Cronobacter, Shigella, Salmonella, Sutterella, Lachnoclostridium, Fusobacterium, Lactobacillus, or Erysipelatoclostridium. [5] The increasing intestinal bacteria include Streptococcus infantis, Streptococcus parasanguinis, Ruminococcus gnavus, Clostridium bolteae, Sutterella wadsworthensis, Klebsiella pneumoniae, and Rothia muci The composition described in [2] above, which is a bacterium of the genus Veillonella, such as *Streptococcus laginosa*, *Streptococcus mitis*, *Streptococcus oralis*, *Streptococcus pneumoniae*, *Streptococcus salivarius*, *Haemophilus parainfluenzae*, *Veillonella parvula*, or an unclassified species of the genus Veillonella. [6] The composition according to [1] or [2], wherein the substance is an agent having antibacterial activity against oral commensal bacteria. [7] The composition according to [6], wherein the drug having antibacterial activity against the oral commensal bacteria is a penicillin, cephalosporin, penem, carbapenem, macrolide, lincomycin, ketolide, fluoroquinolone, glycopeptide, streptogramin, tetracycline, chloramphenicol, quinolone, peptide, aminoglycoside, monobactam, nitroimidazole, or fosfomycin-based drug. [8] The composition according to [1] or [2], wherein the substance is a phage that exhibits lytic activity against intestinal bacteria that are increased in patients with pulmonary hypertension compared to healthy individuals. [9] The composition according to [1], wherein the substance is a substance that increases the intestinal bacteria that are reduced in patients with pulmonary hypertension compared to healthy individuals.

[10] The composition according to [9], wherein the reduced intestinal bacteria are Rikenellaceae bacteria, Coriobacteriaceae bacteria, Ruminococccaceae bacteria, Alcaligeneaceae bacteria, Bacteriodaceae bacteria, Eubacteriaceae bacteria, Lachnospiraceae bacteria, Desulfovibrionaceae bacteria, Bifidobacteriaceae bacteria, Sutterellaceae bacteria, Lachnospiraceae bacteria, or Porphyromonadaceae bacteria. [10-1] The composition according to [9], wherein the reduced intestinal bacteria are Rikenellaceae bacteria, Ruminococccaceae bacteria, Alcaligeneaceae bacteria, Bacteriodaceae bacteria, Eubacteriaceae bacteria, Lachnospiraceae bacteria, Desulfovibrionaceae bacteria, Bifidobacteriaceae bacteria, Sutterellaceae bacteria, Prevotellaceae bacteria, Clostridiaceae bacteria, Eggerthellaceae bacteria, or Porphyromonadaceae bacteria.

[11] The increasing intestinal bacteria include Butyricimonas, Alistipes, Ruminococcus, Adlercreutzia, Acidaminococcus, Sutterella, Oscillospira, Rikenella, Lachnospira, Collinsella, and Holdimannia. The composition according to [9], wherein the bacteria are demania, Eubacterium, Subdoligranulum, Bilophila, Bifidobacterium, Parasutterella, Roseburia, Faecalibacterium, Parabacteroides, or Bacteriodes. [11-1] The intestinal bacteria that decrease as described above include Butyricimonas, Alistipes, Ruminococcus, Adlercreutzia, Acidaminococcus, Sutterella, Oscillospira, Rikenella, and Lachnospira. Bacteria of the genera Holdemania, Eubacterium, Subdoligranulum, Bilophila, Bifidobacterium, Parasutterella, Roseburia, Faecalibacterium, and Parabacteroides. es) Bacteria, Megamonas bacteria, Phascolarctobacterium bacteria, Agathobacter bacteria, Hydrogenoanaerobacterium bacteria, Blautia bacteria, Ruminiclostridium bacteria, Paraprevotella bacteria, Acetanerobacterium (Ac The composition according to [9], wherein the bacteria are etanaerobacterium, Dorea, Fusicatenibacter, Coprococcus, Gordonibacter, Coprobacter, Oscillibacter, Anaerostipes, or Bacteriodes.

[12] The aforementioned decrease in intestinal bacteria includes Eubacterium hallii, unclassified Bilophila species, Bifidobacterium adolescentis, Bifidobacterium pseudocatenulatum, Parasutterella excrementihominis, Roseburia hominis, Aristipes onderdonkii, and The composition according to [9], wherein the composition is Faecalibacterium prausinitzii, Eubacterium ventriosum, Roseburia intestinalis, Parabacteroides johnsonii, Bacteroides cellulosilyticus, Bacteroides uniformis, Eubacterium eligens, Alistipes sp. AP11, Bacteroidales bacterium ph8, Subdoligranulum sp. 4_3_54A2FAA, or Lachnospiraceae bacterium 1_1_57FAA.

[13] The composition according to [9], comprising one or more of the bacteria described in any of

[10] to

[12] above as an active ingredient. [13-1] The composition according to [9], comprising one or more of the bacteria described in any of [10-1] to

[12] above as an active ingredient.

[14] A composition for improving pulmonary hypertension comprising as an active ingredient a substance that inhibits at least one pathway selected from the group consisting of the mevalonate pathway, the mannosylglycerate synthesis pathway, the methylglyoxal degradation pathway, the D-glucarate degradation pathway, the TCA cycle VIII pathway, the heme biosynthesis pathway, and the nitrate metabolism pathway.

[15] The composition according to

[14] wherein the substance that inhibits the mevalonate pathway is an HMG-CoA reductase inhibitor.

[16] A method for predicting the prognosis of a patient with pulmonary hypertension, comprising the step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, and Pasteurellae in the gut microbiota of a patient with pulmonary hypertension. [16-1] A method for predicting the prognosis of a patient with pulmonary hypertension, characterized by comprising the step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, Pasteurellaceae, Veillonellaceae, and Lactobacillaceae in the gut microbiota of a patient with pulmonary hypertension.

[17] A method for assisting in determining the severity of pulmonary hypertension in patients, comprising the step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, and Pasteurellae in the intestinal microbiota of patients with pulmonary hypertension. [17-1] A method for assisting in determining the severity of pulmonary hypertension in patients, characterized by comprising the step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, Pasteurellaceae, Veillonellaceae, and Lactobacillaceae in the intestinal microbiota of patients with pulmonary hypertension.

[18] The method according to

[17] , wherein the Micrococcaceae bacteria are of the genus Rothia and the Streptococceae bacteria are of the genus Streptococcus. [18-1] The method according to [17-1], wherein the Micrococcaceae bacteria are of the genus Rothia, the Streptococcus bacteria are of the genus Streptococcus, and the Veillonellaceae bacteria are of the genus Veillonella.

[19] A method for assisting in the diagnosis of pulmonary hypertension, characterized by comprising measuring the fecal IgA concentration of a subject and comparing it with the fecal IgA concentration of a healthy person.

[20] A composition for improving pulmonary hypertension, comprising short-chain fatty acids or a salt thereof as an active ingredient.

[21] A method for assisting in the diagnosis of pulmonary hypertension associated with portal hypertension, comprising the step of detecting one or more bacteria selected from the genera Bifidobacterium, Dorea, and Blautia in the gut microbiota of a subject.

[22] A method for assisting in the diagnosis of chronic thromboembolic pulmonary hypertension, comprising the step of detecting Klebsiella bacteria in the gut microbiota of a subject. [Effects of the Invention]

[0009] According to the present invention, it is possible to provide a composition that acts on the intestinal bacteria of patients with pulmonary hypertension to improve pulmonary hypertension. In addition, it is possible to provide a method for predicting the prognosis of patients with pulmonary hypertension and a method for assisting in the determination of the severity of patients with pulmonary hypertension by detecting specific intestinal bacteria in patients with pulmonary hypertension. Furthermore, it is possible to provide a method for assisting in the diagnosis of pulmonary hypertension using the feces of a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] [Figure 1] It is a diagram showing the procedure for producing a pulmonary hypertension model rat. The upper part shows the hypoxic load, the middle part shows the monocrotaline load, and the lower part shows the procedure for producing a pulmonary hypertension model rat by Sugen5416 / hypoxia / positive oxygen load. [Figure 2] It is a diagram showing the results of 16S rRNA metagenomic analysis of DNA in the feces of three types of pulmonary hypertension model rats prepared by subjecting wild-type rats to each treatment of hypoxic load (Hx), monocrotaline load (MCT), or Sugen5416 / hypoxia / positive oxygen load (SuHx), Aryl hydrocarbon Receptor (AHR)-deficient rats treated with Sugen5416 / hypoxia / positive oxygen load (SuHx), and untreated rats (control group), and analyzing the composition of the intestinal flora at the family level. [Figure 3] (A) is a diagram showing the prevalence of S24-7 in the intestinal flora of each group, and (B) is a diagram showing the prevalence of Lachnospiraceae in the intestinal flora of the control group, Hx group, MCT group, and SuHx group. [Figure 4] It is a diagram showing the results of examining the changes in the pathological state of pulmonary hypertension by administering an antibiotic cocktail to hypoxic load pulmonary hypertension model rats (Hx). [Figure 5] It is a diagram showing the results of examining the changes in the pathological state of pulmonary hypertension by administering an antibiotic cocktail to monocrotaline load pulmonary hypertension model rats (MCT). [Figure 6]This is a figure showing the results of examining the changes in the pathological condition of pulmonary hypertension by administering an antibiotic cocktail to Sugen5416 / hypoxic / normoxic load pulmonary hypertension model rats (SuHx). [Figure 7] This is a figure showing the results of 16S rRNA metagenomic analysis of fecal DNA in patients with pulmonary hypertension and healthy subjects, and analyzing the composition of the gut microbiota at the family level. [Figure 8] This is a figure showing the results of evaluating the α-diversity of the gut microbiota in patients with pulmonary hypertension and healthy subjects. (A) shows the results of the Shannon index, and (B) shows the results of the Chao index. [Figure 9] This is a figure showing the results of evaluating the β-diversity of the gut microbiota in patients with pulmonary hypertension and healthy subjects by principal component analysis. [Figure 10] This is a figure showing the prevalence rates of gut bacteria that increase in patients with pulmonary hypertension in each individual healthy subject and each individual patient with pulmonary hypertension, and comparing the prevalence rates between the healthy subject group and the pulmonary hypertension patient group. (A) shows the results of the Streptococcaceae family, (B) shows the results of the Micrococcaceae family, and (C) shows the results of the Pasterurellaceae family. [Figure 11] This is a figure showing the results of examining the relationship between changes in gut bacteria and severity in patients with pulmonary hypertension. (A) shows the results of the Micrococcaceae family, (B) shows the results of the Streptococcaceae family, and (C) shows the results of the Pasterurellaceae family. [Figure 12] This is a figure showing the results of examining the relationship between changes in gut bacteria and prognosis in patients with pulmonary hypertension. (A) shows the results of the Micrococcaceae family, (B) shows the results of the Streptococcaceae family, and (C) shows the results of the Pasterurellaceae family. [Figure 13]This figure shows the results of an investigation into the relationship between serum aromatic hydrocarbon receptor (AHR) activity and disease severity in patients with pulmonary hypertension. (A) shows the results of measuring serum AHR activity in patients with pulmonary hypertension and healthy individuals. (B) shows the results of measuring serum AHR activity in patients with WHO severity levels 1-2, patients with WHO severity levels 3-4, and healthy individuals. (C) shows the results of an investigation into the correlation between pulmonary vascular resistance (PVR) and serum AHR activity in patients with pulmonary hypertension. [Figure 14] This figure shows the results of an investigation into the relationship between changes in gut bacteria and serum AHR activity in patients with pulmonary hypertension. [Figure 15] This figure shows the results of comparing the increased gut bacteria at the genus level in patients with pulmonary hypertension, with (A) being Actinomyces, (B) being Rothia, (C) being Citrobacter, (D) being Veillonella, (E) being Escherichia, (F) being Gemella, (G) being Granulicatella, (H) being Atopobium, (I) being Clostridium, (J) being Enterobacter, (K) being Streptococcus, (L) being Abiotrophia, (M) being Klebsiella, (N) being Cronobacter, (O) being Shigella, and (P) being Salmonella. [Figure 16] This figure shows the prevalence of reduced intestinal bacteria in pulmonary hypertension patients in individual healthy individuals and individual pulmonary hypertension patients, and compares the prevalence of these bacteria in the healthy control group and the pulmonary hypertension patient group. (A) shows the results for Rikenellaceae, (B) shows the results for Coriobacteriaceae, and (C) shows the results for Alcaligeneaceae. [Figure 17]This figure shows the results of comparing the decreased gut bacteria at the genus level in patients with pulmonary hypertension, with (A) being Butyricimonas, (B) being Alistipes, (C) being Ruminococcus, (D) being Adlercreutzia, (E) being Acidaminococcus, (F) being Sutterella, (G) being Oscillospira, (H) being Rikenella, (I) being Lachnospira, (J) being Collinsella, and (K) being Holdemania. [Figure 18] This figure shows the results of full metagenomic analysis of fecal DNA from patients with pulmonary hypertension and healthy individuals. [Figure 19] This figure shows the results of analyzing the functional metabolic profile of the gut microbiota using data obtained from full metagenomic analysis. [Figure 20] This figure shows the results of measuring fecal IgA concentration, with (A) representing the results from a pulmonary hypertension model rat and (B) representing the results from a pulmonary hypertension patient. [Figure 21] This figure shows the results of PLS-DA analysis of the gut microbiota of pulmonary hypertension patients and healthy individuals. [Figure 22] This figure shows the results of evaluating the alpha diversity of the gut microbiota in patients with pulmonary hypertension and healthy individuals. (A) shows the results of Faith's phylogenic dicersity, (B) shows the results of the Shannon index, and (C) shows the results of Observed OTUs. [Figure 23] This figure shows the bacteria (at the genus level) that showed a statistically significant increase or decrease in patients with pulmonary hypertension, using an LDA score of 3.0 or higher as the cutoff. [Figure 24] This figure shows a volcano plot created from the relative frequency of genus-level intestinal bacteria present in healthy individuals and patients with pulmonary hypertension, the change in pulmonary hypertension patients (effect size), and the statistical significance of the change [(-Log10(p-value)]. [Figure 25] This figure shows the results of plotting the significantly changed gut bacteria at the genus level using a Cladogram, based on the LDA score and Volcano plot results. [Figure 26] This figure shows the results of comparing the frequency of 18 bacterial species (genera level) that increase or decrease in each subgroup of pulmonary hypertension, with (A) being Rothia, (B) Bifidobacterium, (C) Klebsiella, (D) Veillonella, (E) Erysipelatoclostridium, (F) Ruminococcus gnavus group, (G) Tyzzerella, (H) Streptococcus, (I) Alistipes, (J) Subdoligranulum, (K) Ruminiclostridium 5, (L) Eubacterium hallli group, (M) Roseburia, (N) Fusicatenibacter, (O) Dorea, (P) Coprococcus, (Q) Blautia, and (R) Anaerostipes. [Figure 27] This figure shows the results of ranking the gut bacteria associated with the occurrence of pulmonary hypertension-related events (a composite event of right heart failure, lung transplantation, and death) using random forest analysis. [Figure 28] This figure shows the results of analyzing the association between the severity of pulmonary hypertension (WHO Classification of Pulmonary Hypertension) and the cut-off value that best predicts the occurrence of composite events, calculated from ROC analysis, divided into two groups. (A) represents the results for Rothia, (B) for Veillonella, and (C) for Streptococcus. [Figure 29] This figure compares event-free survival rates using the Kaplan-Meir method, dividing patients into two groups based on the cut-off values ​​for pulmonary hypertension-related events, specifically for Rothia, Veillonella, and Streptococcus. (A) shows the results for Rothia, (B) for Veillonella, and (C) for Streptococcus. [Figure 30] This figure shows the networks of intestinal bacteria where the correlation coefficient (r) > 2 was calculated by exhaustively determining the correlation coefficient between the relative proportion of intestinal bacteria (at the genus level) and serum IL-6 concentration. [Figure 31]This figure shows the results of evaluating the pathogenesis of pulmonary hypertension in gnotobiote rats, a model of pulmonary hypertension, transplanted with feces from healthy individuals and in gnotobiote rats, a model of pulmonary hypertension, transplanted with feces from patients with pulmonary hypertension. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricle / left ventricular mass ratio (right ventricular hypertrophy). [Figure 32] This figure shows the results of measuring the concentrations of acetic acid, propionic acid, and butyric acid in the stool of healthy individuals and patients with pulmonary hypertension. [Figure 33] This figure shows the results of evaluating the pathogenesis of pulmonary hypertension in rats modeled after administration of butyrate solution. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio (right ventricular hypertrophy). [Modes for carrying out the invention]

[0011] [Composition for improving pulmonary hypertension] The present invention provides a composition for improving pulmonary hypertension (hereinafter referred to as "the composition of the present invention") that contains as an active ingredient at least one substance that normalizes the intestinal microbiota of patients with pulmonary hypertension. The inventors compared the composition of the intestinal microbiota of patients with pulmonary hypertension and healthy individuals through metagenomic analysis of fecal DNA and found that there are intestinal bacteria that increase and decrease in patients with pulmonary hypertension compared to healthy individuals. Therefore, it is believed that the pathology of pulmonary hypertension can be improved by normalizing the composition of the intestinal microbiota of patients with pulmonary hypertension, that is, by bringing the composition of the intestinal microbiota of patients with pulmonary hypertension closer to that of healthy individuals.

[0012] Examples of gut bacteria (at the family level) that increase in patients with pulmonary hypertension compared to healthy individuals include bacteria from the families Streptococcus, Micrococcaceae, Veillonellaceae, Pasteurellaceae, Fusobacteriaceae, Lactobacillaceae, Enterobacteriaceae, Coriobacteriaceae, and Sutterellaceae.

[0013] Intestinal bacteria (at the genus level) that increase in patients with pulmonary hypertension compared to healthy individuals include, for example, Actinomyces, Rothia, Citrobacter, Veillonella, Escherichia, Gemella, Granulicatella, Atopobium, Enterobacter, and Streptococcus. Examples include bacteria of the genera Abiotrophia, Klebsiella, Cronobacter, Shigella, Salmonella, Sutterella, Lachnoclostridium, Fusobacterium, Lactobacillus, Erysipelatoclostridium, Collinsella, Tyzzerella, and Haemophilus.

[0014] Examples of gut bacteria (at the species level) that increase in patients with pulmonary hypertension compared to healthy individuals include Streptococcus infantis, Streptococcus parasanguinis, Ruminococcus gnavus, Clostridium bolteae, Sutterella wadsworthensis, Klebsiella pneumoniae, and Russian worm. Examples include Rothia mucilaginosa, Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus salivarius, Haemophilus parainfluenzae, Veillonella parvula, and unclassified species of Veillonella bacteria.

[0015] Examples of gut bacteria (at the family level) that decrease in patients with pulmonary hypertension compared to healthy individuals include Rikenellaceae, Ruminococccae, Alcaligeneaceae, Bacteriodaceae, Eubacteriaceae, Lachnospiraceae, Desulfovibrionaceae, Bifidobacteriaceae, Sutterellaceae, Prevotellaceae, Clostridiaceae, Eggerthellaceae, and Porphyromonadaceae.

[0016] Examples of gut bacteria (at the genus level) that decrease in patients with pulmonary hypertension compared to healthy individuals include Butyricimonas, Aristipes, Ruminococcus, Adlercreutzia, Acidaminococcus, Sutterella, Oscillospira, Rikenella, and Lacnophore. Bacteria of the genera Lachnospira, Holdemania, Eubacterium, Subdoligranulum, Bilophila, Bifidobacterium, Parasutterella, Roseburia, Faecalibacterium, Parabacteroides Bacteria of the genera Parabacteroides, Megamonas, Phascolarctobacterium, Agatobacter, Hydrogenoanaerobacterium, Blautia, Ruminiclostridium, Paraprevotella, Acetamine Examples include bacteria of the genera Nerobacterium, Dorea, Fusicatenibacter, Coprococcus, Gordonibacter, Coprobacter, Oscillibacter, Anaerostipes, and Bacteriodes.

[0017] Examples of gut bacteria (at the species level) that decrease in patients with pulmonary hypertension compared to healthy individuals include Eubacterium hallii, unclassified Bilophila species, Bifidobacterium adolescentis, Bifidobacterium pseudocatenulatum, Parasutterella excrementihominis, Roseburia hominis, and Aristipes ondeldonchii. Examples include *Bacterium erdonkii*, *Faecalibacterium prausinitzii*, *Eubacterium ventriosum*, *Roseburia intestinalis*, *Parabacteroides johnsonii*, *Bacteroides cellulosilyticus*, *Bacteroides uniformis*, *Eubacterium eligens*, *Alistipes sp. AP11*, *Bacteroidales bacterium ph8*, *Subdoligranulum sp. 4_3_54A2FAA*, and *Lachnospiraceae bacterium 1_1_57FAA*.

[0018] The composition of the present invention may contain as an active ingredient at least one substance that normalizes the intestinal microbiota of patients with pulmonary hypertension. The target disease, pulmonary hypertension, may be in Group 1, Group 2, Group 3, Group 4, or Group 5 as shown in Table 1.

[0019] The active ingredient of the composition of the present invention may be a substance that reduces the intestinal bacteria that increase in patients with pulmonary hypertension compared to healthy individuals. Such a substance may be an agent that has antibacterial activity against oral commensal bacteria. The intestinal bacteria that increase in patients with pulmonary hypertension compared to healthy individuals include many oral commensal bacteria, and agents that have antibacterial activity against oral commensal bacteria are useful as active ingredients of the composition of the present invention. Examples of commensal bacteria in the oral cavity include Streptococcus infantis, Streptococcus parasanguinis, Klebsiella pneumoniae, Rothia mucilaginosa, Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus salivarius, Veillonella parvula, and unclassified species of the Veillonella genus.

[0020] Drugs that have antibacterial activity against oral commensal bacteria include penicillin-based antibacterial compounds (e.g., methicillin, oxacillin, nafcillin, cloxacillin, dicloxacillin, flucloxacillin, thymocillin, amoxicillin, piperacillin, tarampicillin, bacampicillin, ampicillin, ticarcillin, benzylpenicillin, carbenicillin, etc.), cephalosporin-based antibacterial compounds (e.g., cephalothin, cefazolin, cefotiam, cefmetazole, cefotaxime, cefmenoxime, cefozidime, ceftriaxone, ceftazidime, cefoperazone), Cefminox, latamoxef, flomoxef, cefpirome, cefepime, cefozopran, cephalexin, etc.), penem antimicrobial compounds (e.g., faropenem), carbapenem antimicrobial compounds (e.g., imipenem, panipenem, meropenem, biapenem, doripenem, ertapenem, tebipenem, etc.), macrolide antimicrobial compounds (e.g., azithromycin, clarithromycin, zilithromycin, erythromycin, troleandmycin, etc.), lincomycin antimicrobial compounds (e.g., lincomycin, clindamycin, pirurimycin, etc.), Ketolide antimicrobial compounds (e.g., telithromycin), fluoroquinolone antimicrobial compounds (e.g., ciprofloxacin, ofloxacin, sitafloxacin), glycopeptide antimicrobial compounds (e.g., vancomycin, teicoplanin), streptogramin antimicrobial compounds (e.g., quinupristin, dalfopristin), tetracycline antimicrobial compounds (e.g., demeclocycline, doxycycline, minocycline, oxytetracycline, tetracycline), chloramphenicol antimicrobial compounds (e.g., chloramphenicol) , quinolone antimicrobial compounds (e.g., ciprofloxacin, enoxacin, gatifloxacin, levofloxacin, lomefloxacin, moxifloxacin, norfloxacin, ofloxacin, trovafloxacin, etc.), peptide antimicrobial compounds (e.g., bacitracin, colistin, polymyxin B, etc.), aminoglycoside antimicrobial compounds (e.g., amikacin, gentamicin, kanamycin, capreomycin, neomycin, netylmycin, streptomycin, tobramycin, etc.), monobactam antimicrobial compounds (e.g., aztreonam, etc.),It may also be a nitroimidazole-based antimicrobial compound (e.g., metronidazole) or a fosfomycin-based antimicrobial compound (e.g., fosfomycin).

[0021] One type of drug having antibacterial activity against oral commensal bacteria may be used, or two, three, four, five, six, seven, eight, nine, or ten or more types may be used in combination.

[0022] The active ingredient of the composition of the present invention may be a phage that exhibits lytic activity against intestinal bacteria, which increase in patients with pulmonary hypertension compared to healthy individuals. Phages that exhibit lytic activity against specific bacteria have already been produced using genetic engineering techniques or isolated and cultured from the environment (Trends Biotechnol. 2010 Dec;28(12):591-595. doi: 10.1016 / j.tibtech.2010.08.001. Epub 2010 Aug 31, Bacteriophage. 2011 Mar-Apr; 1(2): 111-114. doi: 10.4161 / bact.1.2.14590). Phages that exhibit lytic activity against intestinal bacteria, which increase in patients with pulmonary hypertension compared to healthy individuals, are useful as the active ingredient of the composition of the present invention.

[0023] The composition of the present invention may be a substance that increases the number of intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals. A composition containing a substance that increases the number of intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals may be the above-mentioned composition containing intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals (hereinafter referred to as "composition containing intestinal bacteria"). The intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals can be isolated from human feces according to standard methods. Alternatively, bacteria that have been previously isolated and stockpiled can be used as the intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals. The intestinal bacteria contained in the composition containing intestinal bacteria may be one or more of the above-mentioned intestinal bacteria that decrease in patients with pulmonary hypertension compared to healthy individuals, and a combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 types may be used. When using two or more types of bacteria, the content ratio is not particularly limited and can be appropriately set according to the age, condition, severity, etc., of the patient with pulmonary hypertension.

[0024] A composition containing intestinal bacteria may also include a culture medium in which the bacteria are cultured. Furthermore, a composition containing intestinal bacteria that are reduced in patients with pulmonary hypertension compared to healthy individuals may include a fraction of a culture medium containing secretions and metabolites produced by the bacteria.

[0025] The bacteria contained in the composition containing intestinal bacteria may be live bacteria, weakened or inactivated bacteria, or sterilized bacteria (e.g., heat-sterilized bacteria).

[0026] Compositions containing intestinal bacteria may be implemented in the form of pharmaceutical compositions. When a composition containing intestinal bacteria is implemented in the form of a pharmaceutical composition, it can be formulated by known drug formulation methods. For example, a composition containing intestinal bacteria can be used orally in the form of capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film-coated preparations, pellets, lozenges, sublingual preparations, chewable preparations, buccal preparations, pastes, syrups, suspensions, elixirs, or emulsions. It can also be used as a suppository or enema.

[0027] Compositions containing intestinal bacteria may be implemented in the form of food compositions. Foods include supplements, health foods, functional foods, foods for specified health uses, foods for sick people, etc. The form of the food composition is not particularly limited and examples include beverages such as tea drinks, soft drinks, carbonated drinks, nutritional drinks, fruit drinks, and lactic acid drinks; noodles such as soba, udon, Chinese noodles, and instant noodles; sweets and breads such as candy, candy, gum, chocolate, snacks, biscuits, jelly, jam, cream, baked goods, and bread; processed seafood and livestock products such as kamaboko, ham, and sausage; dairy products such as processed milk and fermented milk; oils and fats and processed oils such as salad oil, tempura oil, margarine, mayonnaise, shortening, whipped cream, and dressings; seasonings such as sauces and dips; retort pouch foods such as curry, stew, donburi, porridge, and rice gruel; and frozen desserts such as ice cream, sherbet, and shaved ice.

[0028] To formulate compositions containing intestinal bacteria, pharmacologically acceptable carriers, carriers that are acceptable for ingestion in food or beverages, etc., can be used. For example, sterile water, physiological saline, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, fragrances, excipients, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffers, coating agents, lubricants, coloring agents, sweeteners, viscosity modifiers, flavor modifiers, solubilizers, etc., can be used.

[0029] Compositions containing intestinal bacteria may include additional components that enable efficient delivery of the bacteria to the large intestine when the composition is taken orally. Examples include pH-sensitive compositions. More specifically, examples include buffered sachet formulations or enteric polymers that release their contents when the pH becomes alkaline after passing through the stomach. When formulating a composition containing intestinal bacteria using a pH-sensitive composition, it is preferable that the pH threshold at which the pH-sensitive composition decomposes is within the pH range that shifts towards the alkaline side in the distal part of the stomach. Specifically, it is preferable that the pH threshold at which the pH-sensitive composition decomposes is about 6.8 to about 7.5.

[0030] As an additional component that enables efficient delivery of intestinal bacteria to the large intestine when a composition containing intestinal bacteria is orally ingested, one method is to ensure delivery to the large intestine by delaying the release of the contents (e.g., the composition containing intestinal bacteria of the present invention) to approximately 3 to 5 hours later, which corresponds to the transit time through the small intestine. For example, a formulation using a hydrogel as a shell is one such example. When the hydrogel comes into contact with gastrointestinal fluid, it hydrates and swells, and as a result, the contents are efficiently eluted (released mainly in the large intestine).

[0031] As additional components that enable efficient delivery of intestinal bacteria to the large intestine when a composition containing intestinal bacteria is orally ingested, selective coating materials such as biodegradable polymers, polymers that are gradually hydrolyzed, polymers that are gradually water-soluble, and enzymatically degradable polymers can be used. Examples of coating materials that efficiently delay release include cellulosic polymers such as hydroxypropyl cellulose, acrylic polymers and copolymers such as methacrylic polymers, and vinyl polymers and copolymers such as polyvinylpyrrolidone.

[0032] Compositions that enable delivery to the large intestine include bioadhesive compositions that adhere specifically to the colonic mucosa (e.g., polymers described in U.S. Patent No. 6,368,586), and compositions incorporating protease inhibitors to protect biological agents in the gastrointestinal tract from degradation by proteolytic enzyme activity.

[0033] The composition containing intestinal bacteria of the present invention may be used in combination with a prebiotic substance that acts to selectively favor the growth of the bacterial species in the composition over the growth of other human symbiotic bacterial species. Examples of prebiotic substances include indigestible oligosaccharides, indigestible starch, and dietary fiber.

[0034] The bacteria that are the active ingredients of compositions containing intestinal bacteria can be produced using fermentation technology. For example, the bacterial active ingredient may be produced using an anaerobic fermenter capable of supporting rapid bacterial growth. The anaerobic fermenter may be, for example, a stirred-tank reactor or a disposable wave bioreactor. The bacterial active ingredient may be grown using a culture medium such as BL agar medium or a similar type of medium that does not contain animal components. The bacterial active ingredient can be purified and concentrated from the fermentation broth by techniques such as centrifugation and filtration. The bacterial active ingredient may be dried or freeze-dried.

[0035] The dosage or intake of a composition containing intestinal bacteria can be determined empirically, taking into account factors such as the age, weight, sex, symptoms, and health status of the patient with pulmonary hypertension, as well as the type of composition (pharmaceutical, food, beverage). For example, the single dose or intake is usually between 0.01 mg / kg body weight and 100 mg / kg body weight, and may also be between 1 mg / kg body weight and 10 mg / kg body weight.

[0036] A composition for improving pulmonary hypertension containing an active ingredient that increases the intestinal bacteria that are reduced in patients with pulmonary hypertension compared to healthy individuals may be used in combination with a composition for improving pulmonary hypertension containing an active ingredient that reduces the intestinal bacteria that are increased in patients with pulmonary hypertension compared to healthy individuals, a composition for improving pulmonary hypertension containing an active ingredient that inhibits a specific metabolic pathway described later, and / or a composition for improving pulmonary hypertension containing a short-chain fatty acid or a salt thereof described later as an active ingredient. In this specification, "used in combination" means that the timing of application of two or more compositions or drugs overlaps, and does not require simultaneous administration or ingestion.

[0037] The inventors analyzed the functional metabolic profile of the gut microbiota using data from pulmonary hypertension patients and healthy individuals, and found that the functions related to several metabolic pathways were elevated in pulmonary hypertension patients. These metabolic pathways include the mevalonate pathway, mannosylglycerate synthesis pathway, methylglyoxal degradation pathway, D-glucarate degradation pathway, TCA cycle VIII pathway, heme biosynthesis pathway, and nitrate metabolism pathway. Therefore, the composition of the present invention may contain as an active ingredient a substance that inhibits at least one pathway selected from the group consisting of the mevalonate pathway, mannosylglycerate synthesis pathway, methylglyoxal degradation pathway, D-glucarate degradation pathway, TCA cycle VIII pathway, heme biosynthesis pathway, and nitrate metabolism pathway.

[0038] The active ingredient of the composition of the present invention may be an HMG-CoA reductase inhibitor. HMG-CoA reductase inhibitors are known as substances that inhibit the mevalonate pathway. Examples of HMG-CoA reductase inhibitors include mevastatin (compactin) (see USP3983140), pravastatin (see Japanese Patent Publication No. 57-2240 (USP4346227)), lovastatin (see Japanese Patent Publication No. 57-163374 (USP4231938)), simvastatin (see Japanese Patent Publication No. 56-122375 (USP4444784)), and fluvastatin (see Japanese Patent Publication No. 56-122375 (USP4444784)). This includes, but is not limited to, Japanese Patent Publication No. 60-500015 (USP4739073), atorvastatin (see Japanese Patent Publication No. 3-58967 (USP5273995)), rosuvastatin (see Japanese Patent Publication No. 5-178841 (USP5260440)), and pitavastatin (see Japanese Patent Publication No. 1-279866 (USP5854259 and USP5856336)).

[0039] The inventors have found that the concentration of short-chain fatty acids in the feces of patients with pulmonary hypertension is significantly lower than that in the feces of healthy individuals. Furthermore, they found that oral administration of short-chain fatty acids to a pulmonary hypertension model rat induced by hypoxia improved the pathology of pulmonary hypertension compared to the solvent-administered group. From these findings, it is considered that short-chain fatty acids have the effect of bringing the intestinal environment of patients with pulmonary hypertension closer to that of healthy individuals. It is also considered that short-chain fatty acids have the effect of bringing the composition of the intestinal microbiota of patients with pulmonary hypertension closer to that of healthy individuals. Therefore, the active ingredient of the composition of the present invention may be a short-chain fatty acid or a salt thereof. That is, the present invention provides a composition for improving pulmonary hypertension (hereinafter referred to as "composition containing short-chain fatty acids") containing a short-chain fatty acid or a salt thereof as an active ingredient.

[0040] Examples of short-chain fatty acids include fatty acids with 6 or fewer carbon atoms, specifically, acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, caproic acid, lactic acid, and succinic acid. Preferably, butyric acid, isobutyric acid, valeric acid, isovaleric acid, propionic acid, acetic acid, succinic acid, and lactic acid, and more preferably, butyric acid.

[0041] Fatty acids may be in free form or in salt form. Salting improves water solubility and increases physiological efficacy. Any pharmaceutically acceptable salt of the fatty acid is acceptable. Examples include alkali metal salts such as lithium, sodium, and potassium; alkaline earth metal salts such as magnesium and calcium; salts with inorganic bases such as ammonium hydroxide; salts with basic amino acids such as arginine, lysine, histidine, and ornithine; and salts with organic bases such as monoethanolamine, diethanolamine, and triethanolamine. Preferably, the salt is an alkali metal salt or an alkaline earth metal salt.

[0042] Compositions containing short-chain fatty acids may be implemented in the form of pharmaceutical compositions. When a composition containing short-chain fatty acids is implemented in the form of a pharmaceutical composition, it can be formulated by known drug formulation methods. For example, a composition containing short-chain fatty acids can be used orally in the form of capsules, tablets, pills, sachets, liquids, powders, granules, fine granules, film coatings, pellets, lozenges, sublinguals, chewables, buccal preparations, pastes, syrups, suspensions, elixirs, or emulsions. It can also be used as a suppository or enema.

[0043] Compositions containing short-chain fatty acids may be implemented in the form of food compositions. Foods include supplements, health foods, functional foods, foods for specified health uses, foods for the sick, etc. The form of the food composition is not particularly limited and examples include beverages such as tea drinks, soft drinks, carbonated drinks, nutritional drinks, fruit drinks, and lactic acid drinks; noodles such as soba, udon, Chinese noodles, and instant noodles; confectionery and bread such as candy, candy, gum, chocolate, snacks, biscuits, jelly, jam, cream, baked goods, and bread; processed seafood and livestock products such as kamaboko, ham, and sausage; dairy products such as processed milk and fermented milk; oils and fats and processed oils such as salad oil, tempura oil, margarine, mayonnaise, shortening, whipped cream, and dressings; seasonings such as sauces and dips; retort pouch foods such as curry, stew, donburi, porridge, and rice gruel; and frozen desserts such as ice cream, sherbet, and shaved ice.

[0044] To formulate compositions containing short-chain fatty acids, pharmacologically acceptable carriers, carriers that are acceptable for ingestion in food or beverages, etc., can be used. For example, sterile water, physiological saline, vegetable oil, solvents, bases, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, fragrances, excipients, preservatives, binders, diluents, isotonic agents, analgesics, bulking agents, disintegrants, buffers, coating agents, lubricants, colorants, sweeteners, viscosity modifiers, flavor modifiers, solubilizers, etc., can be used.

[0045] The dosage or intake of a composition containing short-chain fatty acids can be determined empirically, taking into account factors such as the age, weight, sex, symptoms, and health status of the patient with pulmonary hypertension, as well as the type of composition (pharmaceutical, food, or beverage). For example, the single dose or intake is usually between 0.01 mg / kg body weight and 100 mg / kg body weight, and may also be between 1 mg / kg body weight and 10 mg / kg body weight.

[0046] [Methods for predicting the prognosis of patients with pulmonary hypertension] The present invention provides a method for predicting the prognosis of patients with pulmonary hypertension (hereinafter referred to as "the prognosis prediction method of the present invention"). The prognosis prediction method of the present invention may include the step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, Pasteurellaceae, Veillonellaceae, and Lactobacillaceae bacteria. In the prognosis prediction method of the present invention, a poor prognosis means a high probability of registering for a lung transplant in the future, a high probability of developing right heart failure in the future, and / or a high probability of dying in the future in relation to pulmonary hypertension.

[0047] More specifically, the prognosis prediction method of the present invention preferably includes the following steps. (1) A step of extracting DNA from the feces of a patient with pulmonary hypertension and detecting one or more bacteria selected from Micrococcaceae, Streptococci, Pasteurellaceae, Veillonellaceae and Lactobacillaceae, and (2) A step in which, if one or more of the above-mentioned bacteria are detected, it is determined that the patient with pulmonary hypertension has a poor prognosis.

[0048] Micrococcaceae bacteria may be of the genus Rothia, including Rothia mucilaginosa, Rothia dentocariosa, and Rothia aeria. Streptococciaceae bacteria may be of the genus Streptococcus, including Streptococcus salivarius, Streptococcus parasanguinis, Streptococcus vestibulularis, Streptococcus oligofermentans, Streptococcus anginosus, Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus intermedius, Streptococcus peroris, and Streptococcus tigurinus. Pasteurellaceae bacteria may be of the genus Haemophilus, including Haemophilus parainfluenza. Veillonella bacteria may also be bacteria of the genus Veillonella, such as Veillonella parvula, Veillonella atypica, Veillonella disper, Veillonella denticariosi, and Veillonella rogosae.Lactobacillus bacteria may be Lactobacillus bacteria, such as Lactobacillus_delbrueckii, Lactobacillus_acidophilus, Lactobacillus_crispatus, Lactobacillus_gasseri, L actobacillus_helveticus, Lactobacillus_johnsonii, Lactobacillus_kefiranofaciens, Lactobacillus_paragasseri, Lactobacillus_casei, Lactobacillus_paracasei, Lactoba cillus_rhamnosus, Lactobacillus_sakei, Lactobacillus_curvatus, Lactobacillus_salivarius, Lactobacillus_plantarum, Lactobacillus_pentosus, Lactobacillus_fermentum , Lactobacillus_reuteri, Lactobacillus_brevis, Lactobacillus_fructivorans, Lactobacillus_lindeneri, Lactobacillus_sanfranciscensis, and Lactobacillus_kunkeei.

[0049] DNA extraction from feces can be performed using known DNA extraction methods. Bacterial detection can be performed, for example, by metagenomic analysis, PCR, ELISA, fecal culture, antigen testing, etc. Metagenomic analysis may be 16S rRNA metagenomic analysis or full metagenomic analysis. Metagenomic analysis can be performed using known methods. PCR can be performed using known methods with DNA extracted from feces as a template. Primers that can be used in PCR include, but are not limited to, the following primers. • 16S primer set capable of detecting all bacteria 16S(Total Bacteria)_F:GTGSTGCAYGGYTGTCGTCA(Sequence ID 1) 16S(Total Bacteria)_R:ACGTCRTCCMCACCTTCCTC(Sequence ID 2) • Primer set capable of detecting Micrococcaceae bacteria RM_F:GCCTAGCTTGCTAGGTGGAT(Sequence ID 3) RM_R:GCAGGTACCGTCAATCTCTC(Sequence ID 4) • Primer set capable of detecting streptococci Str1_F:GTACAGTTGCTTCAGGACGTATC(Sequence ID 5) Str2_R:ACGTTCGATTTCATCACGTTG(Sequence ID 6) • Primer set capable of detecting Pasteurella bacteria p84_F:GACGGAAAGACCCCGTGAACCT(Sequence ID 7) p85_R:GGCAAGTTTCGTGCTTAGAT(Sequence ID 8) For detection at the genus and species levels, the genome sequence of the target bacteria can be obtained from a known database, and an appropriate primer set can be designed and used.

[0050] If any one of the following bacteria is detected—Micrococcaceae, Streptococci, Pasteurellaceae, Veillonellaceae, or Lactobacillaceae—a patient with pulmonary hypertension may be judged to have a poor prognosis. If Streptococci are the target of detection, a patient with pulmonary hypertension may be judged to have a poor prognosis if the proportion of Streptococci is 1% or more. If Pasteurella are the target of detection, a patient with pulmonary hypertension may be judged to have a poor prognosis if the proportion of Pasteurella is 0.1% or more.

[0051] [Methods to assist in determining the severity of pulmonary hypertension in patients] The present invention provides a method for assisting in determining the severity of pulmonary hypertension in patients (hereinafter referred to as "the present invention's method for assisting in determining severity"). The present invention's method for assisting in determining severity may include a step of detecting one or more bacteria selected from Micrococcaceae, Streptococcus, Pasteurellaceae, Veillonellaceae, and Lactobacillaceae bacteria. The severity of pulmonary hypertension in patients can be determined, for example, based on the WHO Classification of Pulmonary Hypertension (Table 2).

[0052] [Table 2]

[0053] The present invention's method for assisting in determining the severity of an illness preferably includes the following steps. (1) A step of extracting DNA from the feces of a patient with pulmonary hypertension and detecting one or more bacteria selected from Micrococcaceae, Streptococci, Pasteurellaceae, Veillonellaceae and Lactobacillaceae, and (2) A step to assist in determining that the patient with pulmonary hypertension is highly severe if Micrococcaceae bacteria are detected, Streptococcus bacteria are detected and their prevalence is 0.5% or more, and / or Pasteurella bacteria are detected and their prevalence is 0.1% or more.

[0054] Micrococcaceae bacteria may be of the genus Rothia, including Rothia mucilaginosa, Rothia dentocariosa, and Rothia aeria. Streptococciaceae bacteria may be of the genus Streptococcus, including Streptococcus salivarius, Streptococcus parasanguinis, Streptococcus vestibulularis, Streptococcus oligofermentans, Streptococcus anginosus, Streptococcus mitis, Streptococcus oralis, Streptococcus pneumoniae, Streptococcus mutans, Streptococcus intermedius, Streptococcus peroris, and Streptococcus tigurinus. Pasteurellaceae bacteria may be of the genus Haemophilus, including Haemophilus parainfluenza. Veillonella bacteria may also be bacteria of the genus Veillonella, such as Veillonella parvula, Veillonella atypica, Veillonella disper, Veillonella denticariosi, and Veillonella rogosae.Lactobacillus bacteria may be Lactobacillus bacteria, such as Lactobacillus_delbrueckii, Lactobacillus_acidophilus, Lactobacillus_crispatus, Lactobacillus_gasseri, L actobacillus_helveticus, Lactobacillus_johnsonii, Lactobacillus_kefiranofaciens, Lactobacillus_paragasseri, Lactobacillus_casei, Lactobacillus_paracasei, Lactoba cillus_rhamnosus, Lactobacillus_sakei, Lactobacillus_curvatus, Lactobacillus_salivarius, Lactobacillus_plantarum, Lactobacillus_pentosus, Lactobacillus_fermentum , Lactobacillus_reuteri, Lactobacillus_brevis, Lactobacillus_fructivorans, Lactobacillus_lindeneri, Lactobacillus_sanfranciscensis, and Lactobacillus_kunkeei.

[0055] The present invention's method for assisting in determining the severity of a disease may include a step of detecting one or more bacteria selected from the genera Streptococcus, Rothia, and Veillonella. In this case, it is preferable to include the following steps. (I) A step of extracting DNA from the feces of a patient with pulmonary hypertension and detecting one or more bacteria selected from the genera Streptococcus, Rothia, and Veillonella, and (II) A step to assist in determining that a patient with pulmonary hypertension is highly severe if Streptococcus bacteria are detected and their prevalence is 10.8% or higher, if Rothia bacteria are detected and their prevalence is 0.33% or higher, and / or Veillonella bacteria are detected and their prevalence is 4.56% or higher.

[0056] DNA extraction from feces can be performed using known DNA extraction methods. Bacterial detection can be performed, for example, by metagenomic analysis, PCR, ELISA, fecal culture test, antigen test, etc. Metagenomic analysis may be 16S rRNA metagenomic analysis or full metagenomic analysis. Metagenomic analysis can be performed using known methods. PCR can be performed using known methods with DNA extracted from feces as a template. As primers used in PCR, the primer set described in the prognosis prediction method of the present invention above can be suitably used.

[0057] If any one of the following species of bacteria—Micrococcaceae, Streptococci, and Pasteurellaceae—exceeds the criteria described in step (2) above, it can be used to assist in determining that the patient with pulmonary hypertension is highly severe. Alternatively, if any one of the following species—Streptococcus, Rothia, and Veillonella—exceeds the criteria described in step (II) above, it can be used to assist in determining that the patient with pulmonary hypertension is highly severe.

[0058] [Methods to assist in the diagnosis of pulmonary hypertension] The present invention provides a method for assisting in the diagnosis of pulmonary hypertension (hereinafter referred to as "the present invention's method for assisting in the diagnosis of pulmonary hypertension"). The present invention's method for assisting in the diagnosis of pulmonary hypertension may include measuring the IgA concentration in the feces of a subject and comparing it with the IgA concentration in the feces of a healthy person.

[0059] The present invention's method for assisting in the diagnosis of pulmonary hypertension preferably includes the following steps. (1) A step of measuring the IgA concentration in the feces of the subject, and (2) A step to assist in the diagnosis that a subject has pulmonary hypertension if the fecal IgA concentration of the subject is higher than that of a healthy person.

[0060] Fecal IgA concentration can be measured by suspending and diluting feces in a suitable solution such as PBS, and then measuring the IgA concentration in this diluted suspension using a commercially available IgA measurement kit. The fecal IgA concentration of a healthy control may be measured simultaneously, or the accumulated fecal IgA concentration of a healthy control may be used. If the fecal IgA concentration of the subject is higher than that of a healthy control, it can be used to assist in the diagnosis of pulmonary hypertension in the subject. If the fecal IgA concentration of the subject is 120% or higher, 130% or higher, 140% or higher, 150% or higher, 170% or higher, 180% or higher, 190% or higher, or 200% or higher compared to the fecal IgA concentration of a healthy control, it may also be used to assist in the diagnosis of pulmonary hypertension in the subject.

[0061] [Methods to assist in the diagnosis of pulmonary hypertension associated with portal hypertension] The present invention provides a method for assisting in the diagnosis of pulmonary hypertension associated with portal hypertension (hereinafter referred to as "the present invention's method for assisting in the diagnosis of pulmonary hypertension associated with portal hypertension"). The present invention's method for assisting in the diagnosis of pulmonary hypertension associated with portal hypertension may include the step of detecting one or more bacteria selected from the genera Bifidobacterium, Dorea, and Blautia in the gut microbiota of a subject.

[0062] The present invention's method for assisting in the diagnosis of pulmonary hypertension associated with portal hypertension preferably includes the following steps. (1) A step of extracting DNA from the subject's feces and detecting one or more bacteria selected from the genera Bifidobacterium, Dorea, and Blautia, and (2) A step to assist in the diagnosis that the subject has pulmonary hypertension associated with portal hypertension if any of the above bacteria are detected.

[0063] DNA extraction from feces can be performed using known DNA extraction methods. Bacterial detection can be performed by, for example, metagenomic analysis, PCR, ELISA, fecal culture, antigen testing, etc. Metagenomic analysis may be 16S rRNA metagenomic analysis or full metagenomic analysis. Metagenomic analysis can be performed using known methods. PCR can be performed using known methods with DNA extracted from feces as a template.

[0064] [Methods to assist in the diagnosis of chronic thromboembolic pulmonary hypertension] The present invention provides a method for assisting in the diagnosis of chronic thromboembolic pulmonary hypertension (hereinafter referred to as "the present invention's method for assisting in the diagnosis of chronic thromboembolic pulmonary hypertension"). The present invention's method for assisting in the diagnosis of chronic thromboembolic pulmonary hypertension may include a step of detecting Klebsiella bacteria in the gut microbiota of a subject.

[0065] The present invention's method for assisting in the diagnosis of chronic thromboembolic pulmonary hypertension preferably includes the following steps. (1) A step of extracting DNA from the subject's feces and detecting Klebsiella bacteria, and (2) A step to assist in the diagnosis of chronic thromboembolic pulmonary hypertension when Klebsiella species are detected.

[0066] DNA extraction from feces can be performed using known DNA extraction methods. Bacterial detection can be performed by, for example, metagenomic analysis, PCR, ELISA, fecal culture, antigen testing, etc. Metagenomic analysis may be 16S rRNA metagenomic analysis or full metagenomic analysis. Metagenomic analysis can be performed using known methods. PCR can be performed using known methods with DNA extracted from feces as a template.

[0067] The present invention includes the following inventions: [a1] A method for improving pulmonary hypertension by normalizing the gut microbiota of patients with pulmonary hypertension by administering an effective amount of a drug having antibacterial activity against oral commensal bacteria to patients with pulmonary hypertension. [a2] A method for improving pulmonary hypertension by normalizing the gut microbiota of patients with pulmonary hypertension by administering an effective amount of a phage that exhibits lytic activity against the increased intestinal bacteria in patients with pulmonary hypertension compared to healthy individuals. [a3] A method for improving pulmonary hypertension by normalizing the gut microbiota of patients with pulmonary hypertension by administering an effective amount of at least one type of intestinal bacteria that is increased in patients with pulmonary hypertension compared to healthy individuals. [a4] A method for improving pulmonary hypertension in patients with pulmonary hypertension by administering an effective dose of an HMG-CoA reductase inhibitor. [a5] A method for improving pulmonary hypertension in patients with pulmonary hypertension by administering an effective amount of short-chain fatty acids or a salt thereof. [b1] A drug that has antibacterial activity against commensal bacteria in the oral cavity, used to normalize the gut microbiota of patients with pulmonary hypertension and improve pulmonary hypertension. [b2] A phage that exhibits lytic activity against the increased intestinal bacteria in pulmonary hypertension patients compared to healthy individuals, used to normalize the gut microbiota of pulmonary hypertension patients and improve pulmonary hypertension. [b3] At least one type of intestinal bacterium that is increased in patients with pulmonary hypertension compared to healthy individuals, for use in normalizing the gut microbiota of patients with pulmonary hypertension and improving pulmonary hypertension. [b4] HMG-CoA reductase inhibitors used to improve pulmonary hypertension. [b5] Short-chain fatty acids or salts thereof, used to improve pulmonary hypertension. [c1] Use of an antimicrobial agent having antimicrobial activity against oral commensal bacteria to manufacture a medicine that improves pulmonary hypertension by normalizing the gut microbiota of patients with pulmonary hypertension. [c2] Use of a phage that exhibits lytic activity against increased intestinal bacteria in patients with pulmonary hypertension compared to healthy individuals, for the purpose of manufacturing a medicine that improves pulmonary hypertension by normalizing the intestinal microbiota of patients with pulmonary hypertension. [c3] Use of at least one intestinal bacterium that is increased in patients with pulmonary hypertension compared to healthy individuals, for the purpose of manufacturing a pharmaceutical or food composition that normalizes the intestinal microbiota of patients with pulmonary hypertension and improves pulmonary hypertension. [c4] Use of HMG-CoA reductase inhibitors to manufacture medicines for the treatment of pulmonary hypertension. [c5] Use of short-chain fatty acids or salts thereof for the manufacture of medicines for the improvement of pulmonary hypertension. [Examples]

[0068] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0069] [Example 1: Examination of the gut microbiota in an animal model of pulmonary hypertension] A. Experimental materials and methods (1) Creation of an animal model of pulmonary hypertension (Figure 1) (1-1) Creation of a rat model of pulmonary hypertension by hypoxic stress Six-week-old male SD rats (purchased from Oriental Yeast) were used. The rats were continuously housed in a hypoxic chamber with 10% oxygen for three weeks to create a model rat of pulmonary hypertension induced by hypoxic stress (hereinafter referred to as "Hx").

[0070] (1-2) Creation of a rat model of pulmonary hypertension by monoclotaline loading Six-week-old male SD rats (purchased from Oriental Yeast) were used. Crotaline (Sigma) was subcutaneously injected at a dose of 60 mg / kg, and the rats were raised in a normal oxygen concentration environment (normal oxygen) for three weeks to create a monocrotaline-induced pulmonary hypertension model rat (hereinafter referred to as "MCT").

[0071] (1-3) Creation of a pulmonary hypertension model rat using Sugen5416 / hypoxia / noxiomatic load Six-week-old male SD rats (purchased from Oriental Yeast) were used. After subcutaneous administration of the VEGFR2 inhibitor Sugen5416 (MedChemExpress) at a dose of 20 mg / kg, the rats were continuously housed in a hypoxic chamber with 10% oxygen for three weeks, and then housed in a normal oxygen concentration environment (northoxic) for two weeks to create a rat model of pulmonary hypertension induced by Sugen5416 / hypoxia / northoxic load (hereinafter referred to as "(SuHx)").

[0072] (1-4) Control animals Untreated 6-week-old male SD rats (purchased from Oriental Yeast) were used as the control group. Aromatic hydrocarbon receptor (AHR) deficient rats (hereinafter referred to as "AHRKO rats") subjected to Sugen5416 / hypoxia / nooxygen loading were also used as control animals. AHRKO rats were created by commissioning the Animal Experiment Facility of the Faculty of Medicine, Osaka University. Specifically, a guide RNA targeting a site adjacent to the PAM sequence of Exon-2 of the AHR gene was designed, and these rats were created by gene editing using the CRISPR-Cas9 system in SD rats.

[0073] (2) Measurement of right ventricular systolic pressure Rats were sedated and analgesic using isoflurane (Pfizer) inhalation anesthesia. Between procedures, the rats' body temperature was maintained at 37°C to 38°C using a thermostat-controlled heat pad linked to a rectal temperature monitor. Tracheostomies were performed, and the rats were ventilated using a rat ventilator (Harvard apparatus) at a tidal volume of 10 μL / g and 70 breaths / min. A polyethylene tube was inserted into the right external jugular vein and advanced to the right ventricle to measure right ventricular pressure (RVP). The RVP signal was detected by a pressure transducer (MLT0670; AD Instruments), relayed by a pressure amplifier (ML117; AD Instruments), and continuously sampled using a Power Lab system (AD Instruments Colorado Springs, CO). The data was recorded on a computer using Chart software (AD Instruments). Heart rate was calculated based on the peak of right ventricular systole.

[0074] (3) Right ventricular / left ventricular weight ratio After measuring the right ventricular systolic pressure, rats were euthanized with an excessive dose of anesthetic, and their hearts were removed. After removing the atria, the right ventricle (RV) was separated from the left ventricle (LV) and septum. After removing the excess water, the weight of the right ventricle and the weight of the left ventricle plus septum were measured, and the weight ratio of the two (right ventricle / left ventricle weight ratio) was calculated to evaluate right ventricular hypertrophy.

[0075] (4) 16S rRNA metagenomic analysis of gut microbiota DNA was extracted from feces using the NecleoSpin DNA stool (Macherey-Nagel). Libraries were prepared according to the product protocol using 16S Metagenomic Sequencing Library Preparation (Illumina) and primer sets targeting V1-V2 of 16S ribosomal RNA (27Fmod: 5'-AGRGTTTGATCMTGGCTCAG-3' (SEQ ID NO: 9) and 338R: 5'-TGCTGCCTCCCGTAGGAGT-3' (SEQ ID NO: 10)). 251-base amplicons were sequenced using the MiSeq System (Illumina). The resulting paired-end reads were merged using PEAR (sco.h-its.org / exelixis / web / software / pear / ) and trimmed using BBtrim (bbmap.sourceforge.net). Furthermore, random sequences were extracted using random_sequence_sample.pl (ualberta.ca / ~stothard / software.html) to a maximum of 20,000 reads per sample. The processed sequences were clustered into OTUs (operational taxonomic units) based on 97% homology, using UCLUST version 1.2.33q. Each OTU was taxonomically classified using RDP Classifier version 2.2 and the Greengenes 13_8 database, and bioinformatics microbiota analysis was performed using QIIME version 1.9.1.

[0076] (5) Evaluation of pulmonary hypertension pathology with antibiotic cocktail administration (5-1) Administration of antibiotic cocktail to Hx Six-week-old male SD rats were housed in a 10% oxygen hypoxic chamber for three weeks, and during this period, they were given autoclaved sterile water containing four antibiotics (ampicillin 1 g / L, fradiomycin 1 g / L, metronidazole 1 g / L, vancomycin 0.5 g / L) as drinking water (Hx antibiotic group). As controls, a group was continuously housed in a 10% oxygen hypoxic chamber for three weeks and given autoclaved sterile water as drinking water (Hx group), and a group was housed in a normal oxygen concentration environment (normal oxygen) for three weeks and given autoclaved sterile water as drinking water (control group). After the end of the study period, right ventricular systolic pressure and right ventricle / left ventricular mass ratio were measured.

[0077] (5-2) Administration of antibiotic cocktail to MCT Six-week-old male SD rats were subcutaneously injected with Crotaline (Sigma) at a dose of 60 mg / kg and reared in a normal oxygen environment (northoxygen) for three weeks. During this period, they were given 3% sucrose water containing four antibiotics (ampicillin 1 g / L, fradiomycin 1 g / L, metronidazole 1 g / L, and vancomycin 0.5 g / L) as drinking water (MCT antibiotic group). As controls, two groups were established: one group (MCT group) that was reared in a normal oxygen environment (northoxygen) for three weeks after Crotaline administration and given sucrose water as drinking water, and another group (control group) that was reared in a normal oxygen environment (northoxygen) for three weeks without Crotaline administration and given sucrose water as drinking water. After the end of the study period, right ventricular systolic pressure and the right ventricle / left ventricular mass ratio were measured.

[0078] (5-3) Administration of antibiotic cocktail to SuHx Six-week-old male SD rats were subcutaneously administered Sugen5416, then reared in a 10% oxygen hypoxic chamber for 3 weeks on autoclaved sterile water as drinking water, followed by 2 weeks of rearing in a normal oxygen concentration environment (normal oxygen). During the rearing period in the normal oxygen concentration environment, they were given 3% sucrose water containing four antibiotics (ampicillin 1 g / L, fradiomycin 1 g / L, metronidazole 1 g / L, vancomycin 0.5 g / L) as drinking water (SuHx antibiotic group). As controls, two groups were established: one group was reared in a hypoxic chamber for 3 weeks after administration of Sugen5416, followed by 2 weeks in a normal oxygen concentration environment (normal oxygen), and given 3% sucrose water as drinking water during the rearing period in the normal oxygen concentration environment (SuHx group); and the other group was reared in a normal oxygen concentration environment (normal oxygen) for 5 weeks without administration of Sugen5416, and given autoclaved sterile water as drinking water during the rearing period (control group). After the end of the study period, right ventricular systolic pressure was measured and the right ventricular / left ventricular mass ratio was determined.

[0079] (6) Statistical analysis All data are expressed as mean ± standard error. Significant differences between multiple groups were tested using one-way ANOVA and Scheffe's method. Two-group comparisons were analyzed using Student's t-test. A p-value of less than 0.05 was considered statistically significant.

[0080] B. Results (1) Changes in the gut microbiota 16S rRNA metagenomic analysis of fecal DNA from pulmonary hypertension model rats treated with hypoxia (Hx), monoclotaline (MCT), and Sugen5416 / hypoxia / noxia (SuHx), as well as untreated rats (control group), was performed to analyze the composition of the gut microbiota at the family level. The results are shown in Figure 2. In all pulmonary hypertension model rats, S24-7 was increased, while Ruminococcacaceae and Lachnospiraceae were decreased. The composition of the gut microbiota in AHRKO rats treated with Sugen5416 / hypoxia / noxia (SuHx) was similar to that of untreated rats (control group).

[0081] Figure 3(A) shows the prevalence of S24-7 in the gut microbiota of the control, Hx, MCT, and SuHx groups. In all pulmonary hypertension model rats, the prevalence of S24-7 was increased compared to the control group. Figure 3(B) shows the prevalence of Lachnospiraceae in the gut microbiota of the control, Hx, MCT, and SuHx groups. In all pulmonary hypertension model rats, the prevalence of Lachnospiraceae was decreased.

[0082] (2) Effects of antibiotic intervention on the gut microbiota on the pathogenesis of pulmonary hypertension (2-1) Hypoxic Load Model The results are shown in Figure 4. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio. In hypoxic stress model rats that were not administered the antibiotic cocktail (Hx group), both right ventricular systolic pressure and right ventricular / left ventricular weight ratio were elevated compared to the control group, indicating the pathophysiology of pulmonary hypertension. On the other hand, in hypoxic stress model rats that were not administered the antibiotic cocktail (Hx antibiotic group), the increase in right ventricular systolic pressure and the increase in right ventricular / left ventricular weight ratio were suppressed, indicating an improvement in the pathophysiology of pulmonary hypertension.

[0083] (2-2) Monochromalin Loading Model The results are shown in Figure 5. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio. Monoclotaline-loaded rats that were not administered the antibiotic cocktail (MCT group) showed elevated right ventricular systolic pressure and right ventricular / left ventricular weight ratio compared to the control group, exhibiting the pathophysiology of pulmonary hypertension. On the other hand, monoclotaline-loaded rats that were administered the antibiotic cocktail (MCT antibiotic group) showed suppression of both the increase in right ventricular systolic pressure and the increase in right ventricular / left ventricular weight ratio, indicating an improvement in the pathophysiology of pulmonary hypertension.

[0084] (2-3) Sugen5416 / Hypoxia / Noxioxic Load Model The results are shown in Figure 6. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio. In Sugen5416 / hypoxia / nomoxia load model rats (SuHx group) that were not administered the antibiotic cocktail, both right ventricular systolic pressure and right ventricular / left ventricular weight ratio were elevated compared to the control group, indicating a pathological condition of pulmonary hypertension. On the other hand, in Sugen5416 / hypoxia / nomoxia load model rats that were not administered the antibiotic cocktail (SuHx antibiotic group), the increase in both right ventricular systolic pressure and right ventricular / left ventricular weight ratio was suppressed, indicating an improvement in the pathological condition of pulmonary hypertension.

[0085] [Example 2: Examination of the gut microbiota of patients with pulmonary hypertension (1)] A. Experimental materials and methods (1) Analysis of the gut microbiota by 16S rRNA metagenomic analysis (1-1) Subjects The study included 25 patients with pulmonary hypertension and 25 healthy individuals. The pulmonary hypertension patients included 11 cases of idiopathic / hereditary pulmonary arterial hypertension, 4 cases of collagen disease-related pulmonary hypertension, 1 case of pulmonary hypertension associated with portal hypertension, 2 cases of drug-induced pulmonary hypertension, 3 cases of chronic thromboembolic pulmonary hypertension, and 4 cases of pulmonary hypertension associated with congenital shunt disorders.

[0086] (1-2) 16S rRNA metagenomic analysis 16S rRNA metagenomic analysis was performed using the same method as in Example 1.

[0087] (1-3) α Evaluation of diversity Alpha diversity was evaluated using the Shannon index and Chao index, which indicate the number and proportion of bacterial species present in feces, as well as the degree of bias in the phylogenetic relationships of the bacterial species. All were calculated using QIIME version 1.9.1.

[0088] (1-4) Evaluation of β diversity β-diversity was evaluated using principal component analysis (β-diversity) to assess differences in gut microbiota composition between individuals based on the composition and ratio of bacterial species in each individual. Calculations were performed using QIIME version 1.9.1.

[0089] (1-5) Measurement of Aromatic Hydrocarbon Receptor (AHR) Activity Serum AHR activity was measured using a luciferase reporter assay with the Human AhR Reporter Assay System (INDIGO Biosciences). Except for the stimulation conditions, the procedure followed the manufacturer's instructions. Stimulation was performed by adding serum to the culture medium specified in the instructions to a final concentration of 10%.

[0090] (2) Gut microbiota analysis by full metagenome analysis (2-1) Subjects The study included five patients with pulmonary hypertension and five healthy individuals. (2-2) Full metagenomic analysis Whole-genome sequencing was performed using DNBSEQ-G400 (MGI Tech), generating 150-base paired-end reads. Low-quality reads were removed using fastp version 0.20.0, and host-derived reads matching the human reference genome data (GRCh38) were removed using bowtie2 version 2.3.5. Subsequently, constituent bacterial species were identified using MetaPhlAn2 version 2.6.0, and a heatmap was created using hclust2.py.

[0091] (3) Functional analysis of the gut microbiota The functional metabolic profile of the gut microbiota was analyzed using HUMAnN2 version 0.9.9.

[0092] (4) Fecal IgA concentration measurement Fecal samples were weighed and diluted with PBS to a 1000-fold dilution to prepare a diluted suspension. The IgA concentration in the suspension was measured using the Human IgA ELISA kit (Bethyl Laboratories inc.). The IgA concentration in rat feces was similarly measured using the Rat IgA ELISA Kit (Genway).

[0093] (5) Statistical analysis Statistical analysis was performed using the same method as in Example 1.

[0094] B. Results (1) Results of 16S rRNA metagenomic analysis of fecal DNA (1-1) Changes in the gut microbiota as determined by 16S rRNA metagenomic analysis of fecal DNA 16S rRNA metagenomic analysis was performed on fecal DNA from patients with pulmonary hypertension and healthy individuals to analyze the composition of the gut microbiota at the family level. The results are shown in Figure 7. Certain gut bacteria (Streptococceae, Micrococcaceae, Pasterurellaceae, Veillonellaceae, etc.) were increased in patients with pulmonary hypertension compared to healthy individuals. Conversely, certain gut bacteria (Rikenellaceae, Ruminococcaceae, Coriobacteriaceae, etc.) were decreased in patients with pulmonary hypertension compared to healthy individuals.

[0095] (1-2) α Evaluation of diversity The results are shown in Figure 8. (A) shows the results for the Shannon index, and (B) shows the results for the Chao index. In patients with pulmonary hypertension, both indices were significantly reduced compared to healthy individuals.

[0096] (1-3) Evaluation of β diversity The results of the principal component analysis are shown in Figure 9. Separate cluster formations were observed in healthy individuals and patients with pulmonary hypertension, indicating that the composition of the gut microbiota is clearly different between healthy individuals and patients with pulmonary hypertension.

[0097] (1-4) Detailed examination of increased gut bacteria in patients with pulmonary hypertension Figure 10 plots the prevalence of bacteria belonging to the families (A) Streptococceae, (B) Micrococcaceae, and (C) Pasterurellaceae in individual healthy individuals and individual pulmonary hypertension patients, and shows the results of comparing the mean prevalences of both groups. In addition, it shows patients who subsequently died from pulmonary hypertension-related causes and those who subsequently registered for lung transplantation. All bacteria (families) were significantly increased in the pulmonary hypertension patient group compared to the healthy control group. Furthermore, it was shown that pulmonary hypertension patients with high prevalence of these bacteria were more likely to subsequently die from pulmonary hypertension-related causes or register for lung transplantation.

[0098] Figure 11 shows the results of an examination of the relationship between changes in gut bacteria and disease severity in patients with pulmonary hypertension. The severity of pulmonary hypertension was determined based on the WHO functional classification of pulmonary hypertension (Table 2) above. (A) shows the results of comparing the severity of pulmonary hypertension in patients in whom Micrococcaceae bacteria were not detected and in patients in whom Micrococcaceae bacteria were detected. (B) shows the results of comparing the severity of pulmonary hypertension in patients with a Streptococcaceae bacteria abundance of less than 1% and in patients with a Streptococcaceae bacteria abundance of 1% or more. (C) shows the results of comparing the severity of pulmonary hypertension in patients with a Pasterurellaceae bacteria abundance of less than 0.1% and in patients with a Pasterurellaceae bacteria abundance of 0.1% or more. (A) showed that pulmonary hypertension patients with Micrococcaceae bacteria had a higher severity, (B) showed that pulmonary hypertension patients with a Streptococcaceae bacteria presence of 1% or more had a higher severity, and (C) showed that pulmonary hypertension patients with a Pasterurellaceae bacteria presence of 0.1% or more had a higher severity. From these results, it became clear that changes in the gut microbiota of pulmonary hypertension patients reflect the severity of their condition. Therefore, it is thought that examining the gut bacteria of pulmonary hypertension patients can be an aid in determining the severity of their condition.

[0099] Figure 12 shows the results of an investigation into the relationship between changes in gut microbiota and prognosis in patients with pulmonary hypertension. Prognostic events were defined as pulmonary hypertension-related death and lung transplant registration. (A) shows the results of comparing the occurrence of events in pulmonary hypertension patients in whom Micrococcaceae bacteria were not detected and in patients in whom Micrococcaceae bacteria were detected. (B) shows the results of comparing the occurrence of events in pulmonary hypertension patients with a Streptococcaceae bacteria abundance of less than 1% and in patients with a Streptococcaceae bacteria abundance of 1% or more. (C) shows the results of comparing the occurrence of events in pulmonary hypertension patients with a Pasterurellaceae bacteria abundance of less than 0.1% and in patients with a Pasterurellaceae bacteria abundance of 0.1% or more. (A) showed that events occurred only in pulmonary hypertension patients in whom Micrococcaceae bacteria were detected, (B) showed that events occurred only in pulmonary hypertension patients in whom the presence of Streptococcaceae bacteria was 1% or more, and (C) showed that there was a significantly higher number of patients with pulmonary hypertension in whom the presence of Pasterurellaceae bacteria was 0.1% or more. From these results, it became clear that examining the gut bacteria of patients with pulmonary hypertension can predict the prognosis of these patients.

[0100] This study investigated the relationship between changes in gut bacteria and AHR activity in the serum of patients with pulmonary hypertension. Figure 13(A) shows the results of measuring serum AHR activity in healthy individuals and patients with pulmonary hypertension. It shows that serum AHR activity is significantly higher in patients with pulmonary hypertension than in healthy individuals. Figure 13(B) shows the results of measuring serum AHR activity in three groups: patients with pulmonary hypertension divided into two groups: patients with severity levels 1-2 and patients with severity levels 3-4 according to the WHO functional classification of pulmonary hypertension (Table 2), and a healthy control group. It shows that serum AHR activity is significantly higher with increasing severity. Figure 13(C) shows the correlation between pulmonary vascular resistance (PVR) and serum AHR activity in patients with pulmonary hypertension. A significant positive correlation was observed between PVR and serum AHR activity in patients with pulmonary hypertension. These results indicate that serum AHR activity in patients with pulmonary hypertension correlates with the severity of the patient's condition.

[0101] Next, Figure 14 shows the results of comparing serum AHR activity in pulmonary hypertension patients with a Streptococcaceae bacterium presence of less than 0.5% and those with a Streptococcaceae bacterium presence of 0.5% or more. The results showed that patients with a Streptococcaceae bacterium presence of 0.5% or more had significantly higher serum AHR activity than those with a Streptococcaceae bacterium presence of less than 0.5%. Therefore, this result also supports the idea that examining the gut microbiota of pulmonary hypertension patients can assist in determining the severity of the disease.

[0102] Figure 15 compares the increased gut bacteria at the genus level in patients with pulmonary hypertension. (A)Actinomyces, (B)Rothia, (C)Citrobacter, (D)Veillonella, (E)Escherichia, (F)Gemella, (G)Granulicatella, (H)Atopobium, (I)Clostridium, (J)Enterobacter, (K)Streptococcus, (L)Abiotrophia, (M)Klebsiella, (N)Cronobacter, (O)Shigella, and (P)Salmonella were significantly increased in patients with pulmonary hypertension compared to healthy individuals.

[0103] (1-5) Detailed examination of reduced gut bacteria in patients with pulmonary hypertension Figure 16 shows the prevalence of bacteria belonging to the families (A) Rikenellaceae, (B) Coriobacteriaceae, and (C) Alcaligeneaceae in individual healthy individuals and individual pulmonary hypertension patients, with a comparison of the mean prevalence rates in both groups. All bacteria (families) were significantly reduced in the pulmonary hypertension patient group compared to healthy individuals.

[0104] Figure 17 compares the decreased gut bacteria at the genus level in patients with pulmonary hypertension. (A)Butyricimonas, (B)Alistipes, (C)Ruminococcus, (D)Adlercreutzia, (E)Acidaminococcus, (F)Sutterella, (G)Oscillospira, (H)Rikenella, (I)Lachnospira, (J)Collinsella, and (K)Holdemania were significantly reduced in patients with pulmonary hypertension compared to healthy individuals.

[0105] (2) Results of full metagenome analysis of fecal DNA (2-1) Changes in the gut microbiota due to full metagenomic analysis of fecal DNA Full metagenomic analysis was performed on fecal DNA from patients with pulmonary hypertension and healthy individuals. The results are shown in Figure 18. Veillonella unclassified, Streprtococcus infantis, Streptococcus parasanguinis, Ruminococcus gnavus, Clostridium bolteae, Sutterella wadsworthesis, Klebsiella pneumoniae, Rothia muclilagnosa, Streptococcus mitis oralis pneumoniae, Streptococcus salivarius, Haemophilus parainfluenzae, and Veillonella parvula were increased in patients with pulmonary hypertension. Of these, all except Ruminococcus gnavus, Clostridium bolteae, Sutterella wadsworthesis, and Haemophilus parainfluenzae were commensal bacteria of the oral cavity (bacteria underlined in the figure). Meanwhile, Alistipes_sp_AP11, Bacteroides_Bacterium, Eubacterium_hallii, Subdoligranulum_sp_4_3_54A2FAA, Lachnospiracae_bacterium_ 1_1_57FAA, Bilophila_unclassifies, Bifidobacterium_adolescentis, Bifidobacterium_pseudocatenulatum, Parasutterella_excremen tihominis, Roseburia_hominis, Alistipes_onderdonkii, Faecalibacterium_prausinitzii, Eubacterium_ventriosum, Roseburia_intestinalis, Parabacteroides_johnsonii, Bacteroides_cellulosilyticus, Bacteroides_uniformis, and Eubacterium_eligens were decreased in patients with pulmonary hypertension.

[0106] (2-2) Functional analysis of the gut microbiota Figure 19 shows the results of an analysis of the functional metabolic profile of the gut microbiota using data obtained from full metagenomic analysis. It was revealed that functions related to the mevalonate pathway, mannosylglycerate synthesis pathway, methylglyoxal degradation pathway, D-glucarate degradation pathway, TCA cycle VIII pathway, heme biosynthesis pathway, and nitrate metabolism pathway were elevated in patients with pulmonary hypertension.

[0107] (3) Fecal IgA concentration The results are shown in Figure 20. (A) shows the results for rats, and (B) shows the results for humans. In rats, fecal IgA concentrations were elevated in the hypoxic load model rats (Hx group) and the Sugen5416 / hypoxic / noxic load model rats (SuHx group) compared to the control group. In humans, fecal IgA concentrations were elevated in the pulmonary hypertension patient group compared to the healthy control group.

[0108] [Example 3: Examination of the gut microbiota of patients with pulmonary hypertension (2)] A. Experimental materials and methods (1) Subjects The study included 57 patients with pulmonary hypertension and 57 healthy individuals. The 57 patients included 25 cases of idiopathic / hereditary pulmonary arterial hypertension (I / HPAH), 12 cases of collagen disease-associated pulmonary arterial hypertension (CTD-PAH), 6 cases of pulmonary hypertension associated with congenital shunt disease (CHD-PAH), 3 cases of pulmonary hypertension associated with portal hypertension (PoPH), 4 cases of chronic thromboembolic pulmonary hypertension (CTEPH), and 7 cases of other conditions (such as drug-induced pulmonary hypertension).

[0109] (2) 16S rRNA metagenomic analysis 16S rRNA metagenomic analysis was performed using the same method as in Example 1. Linear Discriminant Analysis (LDA) scores were calculated in a Bioconda environment to clarify the biological characteristics of the 16S rRNA metagenomic information of the gut microbiota of pulmonary hypertension patients and healthy individuals. Cladograms were plotted using LDA effect size (LEfSe) analysis to clarify the phylogenetic characteristics of the gut microbiota of PH patients. A composite event was defined as "death, lung transplant, and hospitalization due to right heart failure," and the gut bacteria (at the genus level) associated with the occurrence of this event were ranked using random forest analysis to narrow down the gut bacteria associated with the composite event (death, lung transplant, and hospitalization due to right heart failure).

[0110] (3) Serum IL-6 concentration measurement Patient serum IL-6 concentrations were measured using the R&D Systems IL-6 ELISA kit. Blood samples were collected at the same time as stool samples.

[0111] B. Results (1) Results of 16S rRNA metagenomic analysis of fecal DNA (1-1) PLS-DA analysis (Partial Least Squares Discriminant Analysis) The results of the PLS-DA analysis are shown in Figure 21. PLS-DA analysis is a partial least squares discriminant analysis. In this analysis, the frequency information of gut bacteria was used as an explanatory variable and visualized in three dimensions to classify healthy individuals from patients with pulmonary hypertension. In the figure, "Control" represents healthy individuals, and "PH" represents patients with pulmonary hypertension. Clearly different clusters were formed between healthy individuals and patients with pulmonary hypertension.

[0112] (1-2) α diversity The results of the alpha diversity assessment are shown in Figure 22. (A) shows the results of Faith's phylogenic dicersity, (B) shows the results of the Shannon index, and (C) shows the results of Observed OTUs. In patients with pulmonary hypertension, all indicators were significantly reduced compared to healthy individuals.

[0113] (1-3) Using an LDA score of 3.0 or higher as a cutoff, Figure 23 shows the bacteria (at the genus level) that were statistically significantly increased or decreased in patients with pulmonary hypertension. The bacteria that increased were Streptococcus, Veillonella, Lachnoclostridium, Fusobacterium, [Ruminococcus] gnavus group, Lactobacillus, Erysipelatoclostridium, Bifidobacterium, Klebsiella, Eschericheia-Shigella, Collinsella, Tyzzerella, Haemophilus, and Rothia. On the other hand, the bacteria that decreased are Alistipes, Megamonas, Phascolarctobacterium, uncultured bacterium (Coriobacteriales), Acidaminococcus, Agathobacter, Prevotellaceae NK3B31 group, [Eubacterium] coprostanoligenes group, Subdoligranulum, Hydrogenoanaerobacterium, Ruminococcaceae UCG-002, Blautia, Ruminoclostridium 5, Paraprevotella, [Ruminococcus] torques group, Roseburia, Ruminococcaceae UCG-013, Lachnospira, Ruminococcaceae NK4A214 group, Acetanaerobacterium, Ruminococcus 1, Dorea, Fusicatenibacter, uncultured (Erysipelotrichaceae), [Eubacterium] halli group, Coprococcus 3, They were Gordonibacter, Coprobacter, uncultured (Ruminococcaceae), Oscillibacter, uncultured (Christensenellaceae), and Anaerostipes.

[0114] (1-4) To identify gut bacteria that have changed more significantly, a volcano plot was created from the relative frequency of genus-level gut bacteria in healthy individuals and patients with pulmonary hypertension, the amount of change (effect size) in patients with pulmonary hypertension, and the significance of the change [(-Log10(p-value)]], which is shown in Figure 24.

[0115] (1-5) Figure 25 shows the results of a Cladogram plotting the intestinal bacteria that showed significant changes at the genus level, based on the LDA score and Volcano plot. The following species showed particularly large increases: Rothia (genus) of the Micrococcaceae family, Bifidobacterium of the Bifidobacteriaceae family, Fusobacterium of the Fusobacteriaceae family, Veillonella of the Veillonellaceae family, Erysipelatoclostridium of the Erysipeotrichaceae family, Ruminococcus gnavus group of the Lachnospiraceae family, Tyzzerella of the Lachnospiraceae family, and Streptococcus of the Streptococcaceae family. Many of these were commensal bacteria found in the oral cavity. Furthermore, the following families were particularly depleted: Alistipes (Rikenellaceae), Subdoligranulum (Ruminococcaceae), Ruminiclostridium 5 (Ruminococcaceae), Eubacterium hallli group (Lachnospiraceae), Roseburia (Lachnospiraceae), Fusicatenibacter (Lachnospiraceae), Dorea (Lachnospiraceae), Coprococcus (Lachnospiraceae), Blautia (Lachnospiraceae), and Anaerostipes (Lachnospiraceae), many of which belonged to the Clostridium cluster IV / XIVa.

[0116] (1-6) Figure 26 shows the results of comparing the frequencies of 18 bacterial species (genera level) that increased or decreased for each subgroup of pulmonary hypertension. (A) is Rothia, (B) is Bifidobacterium, (C) is Klebsiella, (D) is Veillonella, (E) is Erysipelatoclostridium, (F) is Ruminococcus gnavus group, (G) is Tyzzerella, (H) is Streptococcus, (I) is Alistipes, (J) is Subdoligranulum, (K) is Ruminiclostridium 5, (L) is Eubacterium hallli group, (M) is Roseburia, (N) is Fusicatenibacter, (O) is Dorea, (P) is Coprococcus, (Q) is Blautia, and (R) is Anaerostipes. In the figure, Control refers to healthy individuals, I / HPAH refers to idiopathic / hereditary pulmonary arterial hypertension, CTD-PAH refers to collagen disease-related pulmonary arterial hypertension, CHD-PAH refers to pulmonary hypertension associated with congenital shunt disorders, PoPH refers to pulmonary hypertension associated with portal hypertension, CTEPH refers to chronic thromboembolic pulmonary hypertension, and Others refers to other conditions (such as drug-induced pulmonary hypertension). (B) Bifidobacterium, (O) Dorea, and (Q) Blautia were specifically and significantly increased in pulmonary hypertension associated with portal hypertension. In addition, (C) Klebsiella was specifically and significantly increased in chronic thromboembolic pulmonary hypertension.

[0117] (1-7) Figure 27 shows the results of random forest analysis ranking the gut bacteria associated with the occurrence of pulmonary hypertension-related events (a composite event of right heart failure, lung transplantation, and death). Rothia, Streptococcus, Haemophilus, and Veillonella were associated with the occurrence of the composite event.

[0118] (1-8) To calculate the optimal cut-off value that also predicts the occurrence of composite events, we performed Receiver Operating Characteristics Curve (ROC) analysis. The patients were divided into two groups based on the calculated cut-off value that best predicts the occurrence of composite events, and the results of the analysis of the relationship with the severity of pulmonary hypertension (WHO Classification of Pulmonary Hypertension, see Table 2) are shown in Figure 28. (A) is the result for Rothia, (B) is the result for Veillonella, and (C) is the result for Streptococcus. The WHO Classification of Pulmonary Hypertension showed that patients with Rothia > 0.33% and Streptococcus > 10.8% of their enterobacteria were significantly more severe.

[0119] (1-9) Figure 29 shows the results of comparing event-free survival rates using the Kaplan-Meir method, after dividing patients into two groups based on the cut-off values ​​for Rothia, Veillonella, and Streptococcus, regarding the occurrence of pulmonary hypertension-related events. (A) shows the results for Rothia, (B) shows the results for Veillonella, and (C) shows the results for Streptococcus. Patients with Rothia > 0.33%, Veillonella > 4.56%, and Streptococcus > 10.8% had a higher incidence of composite events such as death, right heart failure, and lung transplantation compared to patients with Rothia < 0.33%, Veillonella < 4.56%, and Streptococcus < 10.8%.

[0120] (2) Correlation between gut bacteria and serum IL-6 concentration The correlation coefficients between the relative proportion of intestinal bacteria (at the genus level) and serum IL-6 concentration were calculated by exhaustive analysis, and the networks of intestinal bacteria with a correlation coefficient (r) > 2 are shown in Figure 30. The relative abundance of the genera Haemophilus, Klebsiella, Fusobacterium, and Rothia correlated with serum IL-6 concentration quantified by ELISA.

[0121] [Example 4: Examination of the gut microbiota using a pulmonary hypertension model rat] A. Experimental materials and methods (1) Creation of a pulmonary hypertension model rat (notobiote) Sterile male F344 rats were purchased from SLC Japan Co., Ltd. and reared in a sterile isolator environment. 11-week-old rats were administered feces from healthy individuals or patients with pulmonary hypertension, and monoclotaline was administered to 15-week-old rats to create a pulmonary hypertension model gnotobiote rat. Specifically, feces from four healthy individuals were first mixed in an anaerobic chamber and diluted with anaerobic transport medium (containing Labelmco powder 20g, L-cysteine ​​1g, KH2PO4 0.45g, NaCl 0.9g, (NH4)2SO4 0.45g, CaCl2 0.045g, MgSO4 0.045g, glycerol 400mL, and distilled water 600mL in 1000mL) to prepare a healthy individual feces dilution, and feces from four patients were similarly mixed in an anaerobic chamber and diluted with anaerobic transport medium to prepare a patient feces dilution. Next, 11-week-old rats were orally administered either a diluted stool solution from a healthy person or a diluted stool solution from a patient in separate isolators to create gnotobiote rats that replicated the gut microbiota of healthy and patient individuals. Four weeks after fecal transplantation (15 weeks of age), monocrotaline 60 mg / kg was subcutaneously injected, and the rats were then housed in an isolator for three weeks to create gnotobiote rats that model pulmonary hypertension induced by monocrotaline.

[0122] (2) Control animals Sterile F344 rats were used as a control rat in a monocothaline-induced pulmonary hypertension model. Sterile F344 rats were 15 weeks old,

[0123] Right ventricular systolic pressure and right ventricular hypertrophy were measured in all rats at 18 weeks of age. Right ventricular systolic pressure was measured using the same method as in "A. Materials and Methods" (2) of Example 1. Right ventricular hypertrophy was measured using the method described in "A. Materials and Methods" (3) for the right ventricle / left ventricle weight ratio.

[0124] B. Results The results are shown in Figure 31. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio (right ventricular hypertrophy). In the figure, MCT-SPF represents F344 rats raised in an SPF environment, MTC-GF represents F344 rats raised in a sterile environment, MTC-HV represents F344 rats transplanted from healthy donors, and MTC-PH represents F344 rats transplanted from patients. F344 rats raised in a sterile environment showed lower right ventricular systolic pressure and right ventricular / left ventricular weight ratio compared to F344 rats raised in an SPF environment, indicating a significant suppression of monocrotaline-induced pulmonary hypertension. F344 rats transplanted from healthy donors showed similar levels of right ventricular systolic pressure and right ventricular / left ventricular weight ratio as F344 rats raised in a sterile environment, demonstrating a significant suppression of monocrotaline-induced pulmonary hypertension. F344 rats transplanted from patients showed significantly higher right ventricular systolic pressure compared to F344 rats transplanted from healthy donors.

[0125] [Example 5: Measurement of short-chain fatty acid concentration in human feces] High-performance liquid chromatography (Shimadzu organic acid analysis system) was used to measure the concentrations of acetic acid, propionic acid, and butyric acid in the stool of healthy individuals and patients with pulmonary hypertension.

[0126] The results are shown in Figure 32. (A) shows the results for acetic acid concentration, (B) for propionic acid concentration, and (C) for butyrate concentration. The concentrations of acetic acid, propionic acid, and butyrate in the stool of patients with pulmonary hypertension were all significantly lower than those in the stool of healthy individuals.

[0127] [Example 6: Improvement of pulmonary hypertension by administration of short-chain fatty acids] As described in Example 1, 6-week-old male SD rats (Oriental Yeast) were continuously reared in a 10% oxygen hypoxic chamber for 3 weeks to create a model rat of pulmonary hypertension induced by hypoxic load. For 3 weeks from the start of hypoxic rearing, 100 mM butyrate solution or solvent was orally administered to the rats via free drinking water. Butyrate solution was prepared by dissolving sodium butyrate (SIGMA) in distilled water to a concentration of 100 mM. Right ventricular systolic pressure and right ventricular hypertrophy were measured at 9 weeks of age. Right ventricular systolic pressure was measured using the same method as in "A. Materials and Methods" (2) of Example 1. Right ventricular hypertrophy was measured using the method described in "A. Materials and Methods" (3) for the right ventricle / left ventricle weight ratio.

[0128] The results are shown in Figure 33. (A) shows the results for right ventricular systolic pressure, and (B) shows the results for right ventricular / left ventricular weight ratio (right ventricular hypertrophy). Compared to the solvent administration group (Vehicle), the butyrate administration group showed significantly suppressed right ventricular systolic pressure and right ventricular hypertrophy. The results from Examples 5 and 6 showed that the concentration of short-chain fatty acids in the feces of pulmonary hypertension patients was significantly lower than that in healthy individuals, suggesting that oral administration of short-chain fatty acids may improve the pathophysiology of pulmonary hypertension.

[0129] It should be noted that the present invention is not limited to the embodiments and examples described above, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed in different embodiments are also included within the technical scope of the present invention. Furthermore, all academic and patent documents mentioned herein are incorporated herein by reference.

Claims

[Claim 1] A composition for improving pulmonary hypertension, comprising as an active ingredient at least one substance that normalizes the intestinal microbiota of patients with pulmonary hypertension, wherein the substance is the stool of a healthy person.