method

Regulating the Nic1 ERF gene in tobacco plants through gene editing reduces alkaloid content and TSNA formation, addressing commercial and regulatory challenges in tobacco production.

JP7832967B2Active Publication Date: 2026-03-18UNIVERSITY OF KENTUCKY RESEARCH FOUNDATION
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-01-10
Publication Date
2026-03-18

AI Technical Summary

Technical Problem

Existing methods struggle to effectively regulate alkaloid content, particularly nicotine, in plants like tobacco, which affects plant defense, yield, and the formation of harmful tobacco-specific nitrosamines (TSNAs), and there is a need for genetically modified plants with controlled alkaloid levels for commercial and regulatory compliance.

Method used

Regulating the activity or expression of the Nic1 ERF gene, specifically through gene editing or inhibition, to modulate alkaloid content in plants, including reducing nicotine levels, thereby controlling alkaloid synthesis and TSNA formation.

Benefits of technology

Achieves significantly lower alkaloid content, particularly nicotine, in tobacco plants, enhancing commercial value and reducing TSNA formation, thus addressing consumer preferences and regulatory requirements.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007832967000018
    Figure 0007832967000018
  • Figure 0007832967000019
    Figure 0007832967000019
  • Figure 0007832967000020
    Figure 0007832967000020
Patent Text Reader

Abstract

To provide a method for modulating an alkaloid content of a plant (e.g., a tobacco plant).SOLUTION: An alkaloid content of a plant is modulated by a method comprising modifying the plant by modulating activity or expression of at least one Nic1 ERF gene. The present invention also provides: use of at least one Nic1 ERF gene for modulating the alkaloid content of a plant; and tobacco cells, plants, plant propagation materials, harvested leaves, processed tobaccos, or tobacco products obtainable in accordance with the invention.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for regulating the alkaloid content, such as nicotine content, of a plant or a part thereof. The present invention also extends to a method for regulating the expression and / or activity of polypeptides encoded by genes that regulate alkaloid content in plants. Alternatively, the present invention provides a method for regulating the expression and / or activity of genes that encode polypeptides that regulate alkaloid content in plants. The present invention also extends to constructs that can be used to regulate polypeptides, plant cells transformed with such constructs, and the genetically modified plants themselves. The present invention also extends to the use of harvested leaves from such genetically modified plants transformed with gene constructs for regulating alkaloid content, and smoking articles (e.g., combustible smoking articles) containing such leaves. To relate to. [Background technology]

[0002] Alkaloids are a group of naturally occurring compounds that typically contain a basic nitrogen atom and are produced by various organisms, including bacteria, fungi, plants, and animals. Alkaloids can be classified according to the similarity of their carbon skeletons, for example, indole, isoquinoline, and pyridine-like structures. Pyridine derivatives are a class of monomeric alkaloids, and this class includes simple derivatives of pyridine, polycyclic condensed and uncondensed pyridine derivatives, and sesquiterpene pyridine derivatives. Examples include nicotine, nornicotine, anabasine, myosmin, and anatabine. Most of the known biological functions of alkaloids are related to protection. Alkaloids in tobacco enhance the functional properties of smoking.

[0003] Nicotine is naturally present in several plant varieties, but is found at the highest levels in tobacco plants. Nicotine is produced in both wild and cultivated tobacco (Nicotiana) species. Nicotine plays a crucial role in plant defense against herbivores and insects (Voelckel, C., Krugel, T., Gase, K., Heidrich, N., van Dam, NM, Winz, R., and Baldwin, IT (2001). Anti-sense expression of putrescine N-methyltransferase confirms defensive role of nicotine in Nicotiana sylvestris against Manducasexta. Chemoecology 11, 121-126, incorporated herein by reference), accounting for approximately 90% of the total alkaloid content. The remaining 10% of the alkaloid pool consists mainly of nornicotine, anatabine, myosmin, and anabasine.

[0004] Controlling the alkaloid content in tobacco is complex. Several factors, including genotype, environment, fertilization, and agricultural practices (e.g., toppings), influence alkaloid levels in tobacco plants.

[0005] In the 1930s, a certain type of Cuban cigar tobacco (Nicotiana tabacum) was identified as having a very low alkaloid content, and this trait was Introduced into tobacco breeding lines in the United States (Valleau W. 1949. Breedinglow-nicotinetobacco). Journal of Agricultural Research 78: 171-181, incorporated herein by reference. Subsequently, the low-alkaloid trait was incorporated into the genetic background of the cultivar Burley-21 (B21) through multiple generations of backcrossing (Legg PD, Collins GB, Litton CC. 1970. Registration of La Burley-21 Tobacco Germplasm. CropScience 10(2): 212). (and incorporated herein by reference).

[0006] Genetic studies using the low-alkaloid Burley 21 (LA-B21) were initially referred to as loci A and B (Legg P, Chaplin J, Collins G. (1969)). Inheritance of p ercent total alkaloids in Nicotiana tabacum L.: populations derived fromcrosses of low alkaloid lines with burley and flue-cured varieties. Journal of Heredity 60: 213-217 (incorporated by reference), later known as Nic1 and Nic2 Two unlinked loci were suggested to contribute to nicotine levels in tobacco leaves as regulatory loci for nicotine biosynthesis (Legg P., and G., C. (1971)). Inheritance of percent total alkaloidsin Nicotiana tabacum L. II. genetic effects of two loci in Burley21 X LA Burley21 populations. Canadian Journal of Genetics and Cytology 13, 287-291, incorporated by reference; Hibi, N., Higashiguchi, S., Hashimoto, T., and Yamada, Y. (1994). Gene-Expression in Tobacco Low-Nicotine Mutants.Plant Cell 6, 723-735, incorporated by reference). LA B21 is used in plant defense. Consistent with the role of alkaloids, it has been reported that they are more susceptible to insect damage. Hot-air dried tobacco isogenic lines with low total alkaloids (approximately 0.2%) have also been reported to have lower yields. Collins et al. (Collins, GB, Legg, PD, and Kasperba, Mj (1974). Use of Anther-Derived Haploids in Nicotiana. 1. Isolation of breeding lines differing in total alkaloid content. Crop Science 14, 77-80 (incorporated by reference) developed two other isogenic lines (NILs) of B21 possessing high intermediate alkaloids (HI-B21, AAbb) and low intermediate alkaloids (LI-B21, aaBB), which were later registered as varieties in 1988 (Nielsen, MT, Legg, PD, and Collins, GB (1988). Registration of HI and LI burley 21 tobacco germplasms. Crop Science 28, 206-207 (incorporated by reference)). The lineage (NIL, near isogenic line) is referred to herein as Burley 21 (B21, Nic1Nic2), high intermediate (HI, Nic1nic2), low intermediate (LI, nic1Nic2), and low alkaloid B21 (LA, nic1nic2).

[0007] Subsequent studies have shown that these two loci also regulate the expression of numerous genes unrelated to nicotine biosynthesis, such as stress response genes (Kidd, SK, Melillo, AA, Lu, RH, Reed, DG, Kuno, N., Uchida, K., Furuya, M., and Jelesko, JG (2006). The A and B loci in tobacco regulate a network of stress response genes, few of which are associated with nicotine biosynthesis. Plant Mol Biol 60, 699-716, incorporated by reference). The Nic2 locus was identified based on the identification of a large deletion. It was characterized as (Shoji, T., Kajikawa, M., and Hashimoto, T. (2010). Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. The Plant Cell 22, 3390-3409 (incorporated herein by reference), Nic1 residue in tobacco Determining the location of the constellation Densula proved difficult due to the complexity of quantitative traits, such as alkaloid levels, which hinder map-based cloning approaches.

[0008] Modification of the alkaloid content in plants (e.g., tobacco) can have several commercial advantages. For example, by reducing the total alkaloid content in the plant, the value of the plant as a biomass source can be enhanced. For example, modification of the alkaloid content can include reduction of the alkaloid content, e.g., nicotine content, in tobacco plants. Tobacco plants and products having reduced nicotine may be desirable considering regulations such as the "nicotine ceiling", i.e., the possible regulation of the average upper limit of nicotine in tobacco products. Alternatively, an increase in the alkaloid content in plants, e.g., tobacco plants, can help protect the plants against insects and herbivores. There remains a need for plants having a regulated alkaloid content, e.g., a regulated nicotine content, improved commercially desirable traits, and methods for producing the same.

[0009] Tobacco pyridine alkaloids are precursors of tobacco-specific nitrosamines (TSNA) formed during the drying of harvested leaves. The four main TSNAs found in dried tobacco leaves are N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT), N'-nitrosoanabasine (NAB), and 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK).

[0010] When nitrogen oxide species (e.g., NO, NO2, N2O3, and N2O4) react with tobacco alkaloids, TSNA is formed. NAT and NAB are formed via the nitrosation of anatabine and anabasine, which are secondary alkaloids, respectively. Initial studies claimed that NNN originated from both nicotine and nor-nicotine, but more recent reports have demonstrated that the presence of NNN in dried tobacco leaves correlates with the nor-nicotine content rather than the nicotine content (Bush et al., Rec. Adv. Tob. Sci. 27; 23-46 (2001); Bush et al., Rec. Adv. Tob. Sci. 27; 23-46 (2001)). Nor-nicotine is a demethylation derivative of nicotine, which is the main alkaloid in tobacco, accounting for 90% of the total alkaloid content (Saitoh et al., 1985 Phytochemistry, 24 pp. 477-480). The precursor / product relationship for NNK formation is not very clear. Some studies have stated that NNK is a nitrosation product of nicotine, but due to the slow reaction rate of nicotine nitrosation, an oxidation derivative of nicotine rather than nicotine itself may function as the direct precursor of NNK (Caldwell et al Ann. N.Y. Acad. Sci. 686, 213-228 (1993)) Identifying the genes responsible for the production and control of TSNA precursors is of great importance.

[0011] Nor-nicotine typically accounts for only 2-4% of the total pyridine alkaloid content in tobacco plants, but the genetic instability that leads to the natural occurrence of high-nor-nicotine-containing converted plants is a long-term issue in tobacco production. By maintaining low nor-nicotine levels, the unpleasant flavors and aromas associated with this alkaloid can be prevented, and the formation of N-nitrosonornicotine (NNN) in tobacco industrial products, for which nor-nicotine is the direct precursor, can be reduced.

[0012] The main gene responsible for the conversion of nicotine to nornicotine is the CYP82E4 gene of nicotine demethylase, which encodes cytochrome P450 monooxygenase (Siminszky et al., Proc. Natl. Acad. Sci. USA, 102 (2005), pp.14919-14924; Xu et al., Physiol. Plantarum, 129 (2007), pp. 307-319). Nicotine demethylates in tobacco. While the xenobiotic gene family is extensively characterized, little is known about other cellular processes that may affect nornicotine levels. There remains a great need to devise methodologies that can further reduce TSNA levels in tobacco plants and products derived from tobacco.

[0013] As described in the examples, the inventors attempted to investigate the genes responsible for alkaloid synthesis with the aim of regulating the alkaloid content in plants, for example, reducing the nicotine content in tobacco plants. These investigations led the researchers to generate Burley 21 (B21) hybrid tobacco plants of normal / high alkaloid B21 (HA) × low intermediate alkaloid B21 (LI), normal / high alkaloid B21 (HA) × low alkaloid B21 (LA), and high intermediate B21 (HI) × low alkaloid B21 (LA). The alkaloid content of the resulting F2 plants was analyzed. SNP genotyping was performed on the F2 individuals with the highest or lowest alkaloid content from the HA × LA and HA × LI F2 populations to identify polymorphic markers for further analysis. The HI × LA population was also generated for fine mapping. The inventors developed markers isolated at the Nic1 locus. Ethylene response factor (ERF, ethyle Nine genes from the (ne response factor) subfamily were identified as potential transcription factor regulators for alkaloid synthesis. [Prior art documents] [Non-patent literature]

[0014] [Non-Patent Document 1] Voelckel, C., Krugel, T., Gase, K., Heidrich, N., van Dam, NM, Winz, R., and Baldwin, IT (2001). Anti-sense expressionof putrescineN-methyltransferase confirms defensive role of nicotine inNicotiana sylvestrisagainst Manduca sexta. Chemoecology 11, 121-126 [Non-Patent Document 2] Valleau W. 1949. Breedinglow-nicotinetobacco. Journal of Agricultural Research 78: 171-181 [Non-Patent Document 3] Legg PD, Collins GB, Litton CC.1970.Registration of La Burley-21 Tobacco Germplasm. Crop Science 10(2): 212 [Non-Patent Document 4] Legg P, Chaplin J, Collins G. (1969). Inheritance of percenttotal alkaloids in Nicotiana tabacum L.:populations derived from crosses oflow alkaloid lines with burley and flue-cured varieties. Journal of Heredity60: 213-217 [Non-Patent Document 5] Legg P., and G., C. (1971). Inheritanceofpercent total alkaloids in Nicotiana tobacco L. II. genetic effects of two loci Burley21 X LA Burley 21 populations. Canadian Journal of Geneticsand Cytology 13, 287-291

Outdoor Configuration6

Direct Environment 7

Outdoor Track 8

Outdoor Tools9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Non-Patent Document 14

Non-Patent Document 15

Non-Patent Document 16

Summary of the Invention

[0015] Surprisingly, we have found that the alkaloid content of plants can be regulated by regulating the activity or expression of the Nic1 ERF gene, as taught herein. As a result, tobacco products can be manufactured with regulated alkaloid content and commercially desirable traits that are desired by consumers of tobacco products. In some cases, consumers may desire products with low levels of alkaloid content, for example, low levels of nicotine content. [Means for solving the problem]

[0016] The present invention may be particularly useful in the field of plant molecular agriculture, where plants (such as tobacco and other tobacco species) are used for the production of proteins, peptides, and metabolites, for example, in the manufacture of therapeutic and pharmaceutical products such as antibiotics, virus-like particles, or nutritional supplements or low-molecular-weight substances. Tobacco is being used by PharmPlant and Medicago Inc. for the development of HIV neutralizing antibodies, which they call a EU-funded project, and Canada is working on a tobacco-based platform for the production of virus-like particles for the manufacture of influenza vaccines.

[0017] Thus, the plants according to the present invention can be used for molecular agriculture to reduce or eliminate the presence of nicotine and / or other nicotine alkaloids. The use of low-nicotine plants or rhizomes is beneficial in molecular agriculture and will reduce downstream processing costs associated with purification.

[0018] In other cases, it may be desirable to produce plants with high alkaloid levels, e.g., high nicotine content, so that nicotine can be purified from tobacco plants to produce pure nicotine products for use in devices that utilize nicotine-containing liquids (e.g., e-cigarettes) or tobacco heating devices. For example, producing plants with leaves containing high levels of nicotine can reduce the cost of nicotine extracts for the production of e-liquids for e-cigarettes.

[0019] The inventors investigated the regulation of nicotine biosynthesis in tobacco plants. They examined regulatory loci Nic1 and Nic2, which are thought to control the expression of structural genes related to nicotine and other unrelated genes. One of the inventors' objectives was to provide modifications to alkaloid content. Nine ERF genes were identified in the Nic1 region that unexpectedly regulated alkaloid content in modified tobacco plants compared to equivalent wild-type plants grown under the same conditions.

[0020] The inventors have surprisingly discovered a method for regulating the alkaloid content, such as nicotine content, of tobacco plants by regulating the activity or expression of the ERF gene. The nicotine content of tobacco plants can be reduced by inhibiting the activity or expression of the ERF gene. Prior to the present invention, it was not known that the regulation of the activity or expression of the Nic1 ERF gene described herein could be used to regulate alkaloid content.

[0021] The inventors have found that regulating the Nic1 ERF gene can reduce the alkaloid content of modified plants to remarkably low levels.

[0022] LI (low intermediate, aaBB) lines typically produce about half the alkaloid content compared to HA (high alkaloid, AABB) lines. However, in Example 13, we produced EMS lines equivalent to the LI lines. We produced EMS lines with mutations in Nitab4.5_0003090g0030.1(ERF199). These mutant EMS lines produced about one-third the alkaloid content compared to the HA lines, which is much lower than expected for the LI lines.

[0023] In another example, when the Nic1 ERF gene Nitab4.5_0003090g0030.1 (ERF199) was knocked out by gene editing of the HI strain (AAbb), the alkaloid content of the knockout strain was significantly lower than that of the equivalent LA strain (aabb) (see Example 14). Surprisingly, these data suggest that the Nic1 ERF gene (e.g., Nitab4.5_0003090) This suggests that the regulation of the activity or expression of g0030.1 or ERF199) alone (e.g., knockdown or knockout of activity or expression) is sufficient to regulate (e.g., reduce) the alkaloid content of a plant or part thereof.

[0024] According to a first aspect, the present invention provides a method for regulating the alkaloid content of a plant or a part thereof, or a cell culture, comprising modifying the plant or cell culture by regulating the activity or expression of at least one Nic1 ERF gene, wherein at least one Nic1 ERF gene encodes a polypeptide comprising an amino acid sequence presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene comprises a nucleotide sequence presented in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or a functional variant, functional fragment, or orthologue thereof.

[0025] In another embodiment, the present invention provides a method for regulating the content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs in a tobacco plant or a part thereof, comprising modifying the plant or cell culture by regulating the activity or expression of at least one Nic1 ERF gene, wherein at least one Nic1 ERF gene encodes a polypeptide containing an amino acid sequence presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene contains a nucleotide sequence presented in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or a functional variant, functional fragment, or orthologue thereof.

[0026] In another embodiment, the use of the Nic1 ERF gene for regulating the alkaloid content of cells (e.g., tobacco cells), plants or parts thereof, or cell cultures is provided, wherein at least one Nic1 ERF gene encodes a polypeptide comprising an amino acid sequence presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene comprises a nucleotide sequence presented in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or a functional variant, functional fragment, or orthologue thereof.

[0027] In a further embodiment, the present invention is for producing plants or parts thereof, cell cultures, plant propagation materials, tobacco leaves, cut and harvested tobacco leaves, processed tobacco leaves, or cut and processed tobacco leaves with controlled alkaloid content. A method comprising modifying the plant or cell culture to regulate the activity or expression of at least one Nic1 ERF gene, wherein at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene encodes SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, or SEQ ID NO: 17, Alternatively, the present invention provides a method comprising a nucleotide sequence presented in SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or a functional variant, functional fragment, or ortholog thereof.

[0028] Appropriately, at least one Nic1 ERF gene for use according to the present invention may encode a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or ortholog thereof.

[0029] Appropriately, at least one Nic1 ERF gene for use according to the present invention may include the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant or functional fragment or ortholog thereof.

[0030] In one embodiment, the present invention provides a method or use in which the alkaloid content is regulated compared to a plant or cell culture that has not been modified to regulate the activity or expression of at least one Nic1 ERF gene.

[0031] In another embodiment, the present invention provides a plant or a part thereof, or a cell culture, that has been modified to achieve regulation in alkaloid content compared to an unmodified plant or an unmodified cell culture, wherein the modification is the regulation of the activity or expression of at least one Nic1 ERF gene.

[0032] In another embodiment, the present invention provides a plant propagation material that can be obtained from plants or cell cultures according to the present invention, or from plants produced by the method of the present invention.

[0033] In one embodiment, the present invention provides a method or use, or a plant or part thereof, or a plant propagation material of the present invention, in which the alkaloid content of the plant is reduced compared to a plant that has not been modified to regulate the activity or expression of at least one Nic1 ERF gene.

[0034] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, in which the activity or expression of at least one Nic1 ERF gene is reduced.

[0035] In another embodiment, the present invention provides a method or use of the present invention, or a plant or part thereof, or a plant propagation material of the present invention, wherein the alkaloid content of the plant is increased compared to a plant that has not been modified to regulate the activity or expression of at least one Nic1 ERF gene.

[0036] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, wherein a plant is modified to increase the activity or expression of at least one Nic1 ERF gene, and the plant exhibits an increased alkaloid content compared to a plant that has not been modified to regulate the activity or expression of at least one Nic1 ERF gene.

[0037] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, in which the total alkaloid content of the plant is controlled.

[0038] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, in which the content of one or more alkaloids selected from nicotine, nornicotine, anabasine, myosmin, and anatabine is adjusted. In one embodiment, the nicotine content is controlled.

[0039] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, wherein the plant is derived from the Solanaceae family.

[0040] In one embodiment, the method or use of the present invention, wherein the plant is of the genus Solanum. The present invention provides a plant or a part thereof, or a plant propagation material of the present invention.

[0041] In another embodiment, the method of the present invention or the plant is derived from the genus Nicotiana. The present invention provides the plant or a part thereof, or the plant propagation material of the present invention.

[0042] In one embodiment, the present invention provides a method or use, a tobacco plant or a part thereof, or a plant propagation material of the present invention, in which the nicotine content is controlled.

[0043] In one embodiment, the present invention provides a method or use, a tobacco plant or a part thereof, or a plant propagation material of the present invention, in which the nicotine content is reduced.

[0044] In one embodiment, the present invention provides a method or use of the present invention, a plant or part thereof, or a plant propagation material of the present invention, wherein at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or ortholog thereof, or at least one Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or ortholog thereof.

[0045] In one embodiment, an additional ERF gene is regulated, and the additional ERF gene is the Nic2 ERF gene, encoding a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 40, or SEQ ID NO: 44, or SEQ ID NO: 48, or SEQ ID NO: 52, or SEQ ID NO: 56, or SEQ ID NO: 60, or SEQ ID NO: 64, or SEQ ID NO: 68, or SEQ ID NO: 72, or a functional variant, functional fragment, or orthologue thereof, providing a method or use of the present invention, a plant or part thereof, or a plant propagation material of the present invention.

[0046] In one embodiment, an additional ERF gene is regulated, the additional ERF gene being the Nic2 ERF gene, which encodes a polypeptide comprising the nucleotide sequence presented in SEQ ID NO: 69, or a functional variant, functional fragment, or ortholog thereof, or the amino acid sequence presented in SEQ ID NO: 72, or a functional variant, functional fragment, or ortholog thereof, providing a method or use of the present invention, a plant or part thereof, or a plant propagation material of the present invention.

[0047] In one embodiment, at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or orthologue thereof; or at least one Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or orthologue thereof, and an additional ERF gene is regulated, and the additional ERF gene comprises at least one Nic2 ERF gene, e.g., SEQ ID NO: 40, or SEQ ID NO: 44, or SEQ ID NO: 48, or SEQ ID NO: 52, or SEQ ID NO: 5 6, or the Nic2 ERF gene encoding a polypeptide containing the amino acid sequence presented in SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or functional variants, functional fragments, or orthologues thereof, or The present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, wherein the additional ERF gene is a Nic2 ERF gene, for example, a Nic2 ERF gene comprising a nucleotide sequence presented in SEQ ID NO: 37, or SEQ ID NO: 41, or SEQ ID NO: 45, or SEQ ID NO: 49, or SEQ ID NO: 53, or SEQ ID NO: 57, or SEQ ID NO: 61, or SEQ ID NO: 65, or SEQ ID NO: 69, or a functional variant, functional fragment, or ortholog thereof.

[0048] In one embodiment, the present invention provides a method or use, a plant or part thereof, or a plant propagation material of the present invention, wherein at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or orthologue thereof, or at least one Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or orthologue thereof, and an additional ERF gene is regulated, and the additional ERF gene is a Nic2 ERF gene which encodes a polypeptide comprising the nucleotide sequence presented in SEQ ID NO: 69, or a functional variant, functional fragment, or orthologue thereof, or the amino acid sequence presented in SEQ ID NO: 72, or a functional variant, functional fragment, or orthologue thereof.

[0049] In another embodiment, the present invention provides the use of the plant or a part thereof, or a plant produced by the method of the present invention, for breeding plants.

[0050] In another embodiment, the use of the plant of the present invention, or a part thereof, or a plant produced by the method of the present invention, for the manufacture of a product (e.g., tobacco industry product) is provided.

[0051] In another embodiment, the present invention provides the use of the plant or a part thereof, or the plant produced by the method of the present invention, for growing crops.

[0052] In one embodiment, the present invention provides a dried tobacco material prepared from a plant or a part thereof, or an extract thereof, or a tobacco cell culture according to the present invention.

[0053] In another aspect, the present invention provides a tobacco blend comprising the dried tobacco material.

[0054] In another embodiment, the present invention provides the use of the plant or a part thereof, or the plant produced by the method of the present invention, for producing leaves.

[0055] In one embodiment, harvested leaves are provided, which can be obtained from the plants of the present invention, or from plants propagated from the propagating material of the present invention, or from plants obtained by the use of the present invention, or from plants produced by the method of the present invention.

[0056] In one aspect, the present invention provides harvested plant leaves, which are cut and harvested leaves of a plant.

[0057] In another embodiment, the present invention Can it be obtained from plants that can be obtained from the use of the present invention? Can the plants of the present invention be obtained by processing them? It can be obtained from plants propagated from the plant propagation material of the present invention, or This can be obtained by processing the harvested leaves of the plant of the present invention, or It can be obtained from plants produced by the method of the present invention. The present invention provides treated leaves, preferably treated tobacco leaves that are unable to grow.

[0058] In one embodiment, the present invention provides treated leaves, wherein the leaves are treated by drying, fermentation, sterilization, or a combination thereof.

[0059] In one embodiment, the present invention provides treated leaves, wherein the treated leaves are cut and treated leaves.

[0060] In another embodiment, the present invention The tobacco plant or a part thereof of the present invention Tobacco plants or parts thereof propagated from the tobacco plant propagation material of the present invention, The harvested leaves of the tobacco plant of the present invention The treated tobacco leaves of the present invention, or Tobacco plants produced by the method of the present invention We provide tobacco products prepared from [the source].

[0061] In another embodiment, the present invention i) The tobacco plant of the present invention or a part thereof, or the tobacco cell culture of the present invention, ii) Tobacco plants or parts thereof propagated from the tobacco plant propagation material of the present invention, iii) Harvested leaves of the tobacco plant of the present invention, iv) Tobacco leaves treated according to the present invention We provide tobacco industrial products prepared from [unspecified source].

[0062] In one embodiment, the present invention provides a tobacco product in which the tobacco product is a flammable smoking article.

[0063] In another embodiment, the present invention provides a tobacco industrial product in which the tobacco product is a smokeless tobacco product.

[0064] In one embodiment, the present invention provides a tobacco industry product in which the tobacco industry product is a non-flammable aerosol supply system such as a tobacco heating device or an aerosol generating device.

[0065] In one embodiment, the present invention provides the use of cells (e.g., tobacco cells) for adjusting the alkaloid content in a cell culture.

[0066] In one embodiment, the present invention provides a smoking article, a smokeless tobacco product, or a tobacco heating device comprising a plant or a part thereof or an extract thereof (e.g., tobacco extract), or a tobacco cell culture according to the present invention, or a dried tobacco material according to the present invention, or a tobacco blend according to the present invention.

[0067] In one embodiment, the present invention relates to selecting plants having a regulated (e.g., reduced) alkaloid content and / or a regulated (e.g., reduced) content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs, selected from SEQ ID NOs. 3, 5, 9, 13, 17, 21, 25, or 29. The present invention provides the use of nucleotide sequences of at least one Nic1 ERF gene, or functional variants, functional fragments, or orthologues thereof.

[0068] Appropriately, this use may involve determining the presence of a modification in the plant of at least one Nic1 ERF gene selected from SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or a functional variant, functional fragment, or ortholog thereof, wherein the modification modifies (e.g., reduces) the activity or expression of at least one Nic1 ERF gene. Appropriately, the modification may reduce or knock out the expression or function of the Nic1 ERF gene such that the protein expression or function of the Nic1 ERF gene in the plant is undetectable.

[0069] In one embodiment, the present invention provides a plant mutant having a genetic mutation in the nucleotide sequence of at least one Nic1 ERF gene, wherein the Nic1 ERF gene is selected from SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or a functional variant, functional fragment, or ortholog thereof, wherein the genetic mutation modulates (e.g., reduces) the activity or expression of at least one Nic1 ERF gene, and the mutant plant has a regulated (e.g., reduced) alkaloid content and / or a regulated content of tobacco-specific nitrosamines (TSNA) or TSNA precursors compared to an equivalent plant without the genetic mutation.

[0070] Genetic mutations are induced by technical means; that is, genetic mutations are manipulated and not naturally occurring mutations. Genetic mutations can be induced using any technical means. Appropriately, genetic mutations can be induced by chemical mutagenesis such as ethyl methanesulfonate (EMS) treatment, physical irradiation, and UV mutagenesis or gene editing techniques (CRISPR / Cas, etc.) using insertion agents containing T-DNA. In another embodiment, the present invention provides offspring or seeds of mutant plants having the genetic mutation according to the present invention.

[0071] In one embodiment, the present invention provides harvested leaves, treated leaves, or dried tobacco material produced from a plant comprising a nucleotide sequence modification of at least one Nic1 ERF gene, wherein at least one Nic1 ERF gene is selected from SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or a functional variant, functional fragment, or ortholog thereof, the modification modulates (e.g., reduces) the activity or expression of at least one Nic1 ERF gene, and the plant has a regulated (e.g., reduced) alkaloid content and / or a regulated content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs compared to an equivalent plant without the modification in the at least one Nic1 ERF gene.

[0072] The present invention further provides, with reference to this specification and the drawings, methods, leaves, plants, plant propagation materials, harvested leaves, processed tobacco, tobacco products, uses, or combinations thereof as described herein. [Brief explanation of the drawing]

[0073] Embodiments of the present invention are described herein by reference only to the accompanying drawings. [Figure 1] Panel A shows the total alkaloid levels for the parent line and F2 generations derived from HA×LI hybrids. Panel B shows the nicotine levels for the parent line and F2 generations derived from HA×LA hybrids. Thirty individual plants were selected for each parent line and 200 F2 generations for each population for chemical analysis of alkaloid levels. [Figure 2]Figure 2 shows a comparison of gene maps of selected F2 individuals derived from HA×LI and HA×LA hybrids using the 30kInfiniumHD consensus map 2015 for N. tabacum. Dashed lines represent markers identified between the F2 map and the consensus map, and chained lines represent markers identified between two F2 maps. Bold font indicates markers common to two or more maps. Only markers identified in either the HA×LA or HA×LI map are shown in the consensus map, and the positions of other markers are shown as black horizontal lines. [Figure 3] Panels A and B show genotyping of selected F2 individuals from HA(AABB)×LI(aaBB) hybrids possessing the SNP4 CAPS marker. Panel A shows 20 F2 individuals with the lowest alkaloid levels. Panel B shows 24 F2 individuals with the highest alkaloid levels. Panels C and D show genotyping of selected F2 individuals from HA(AABB)×LA(aabb) hybrids possessing the SNP4 CAPS marker. Panel C shows 24 F2 individuals with the lowest alkaloid levels. Panel D shows 20 F2 individuals with the highest alkaloid levels. HA, HI, LI, and LA were used as controls. Promising recombinations are indicated by arrows. [Figure 4] Panel A shows a comparison of phenotypic values ​​for total alkaloid levels for LA, LI, HI, and HA. The mean values ​​for 30 plants are LA=0.4%, LI=1.69%, HI=2.89%, and HA=3.06%. Panel B shows a comparison of phenotypic values ​​for nicotine content for LA, LI, HI, and HA. The mean values ​​for 30 plants are LA=0.39%, LI=1.61%, HI=2.76%, and HA=2.92%. [Figure 5]Panel A shows the total alkaloid levels for the parent lines HI and LA, as well as for F2 plants genotyped as AA (F2-AA) and aa (F2-aa). Panel B shows the nicotine levels for the parent lines HI and LA, as well as for F2 plants genotyped as AA (F2-AA) and aa (F2-aa). Plants genotyped as AA, but with the lowest alkaloid or nicotine levels indicated by arrows in the panels, were obtained for F3 seed collection. [Figure 6] Panel A shows the total alkaloid content of the parent lines HI and LA, as well as the F3 plants derived from the obtained F2 plants. Panel B shows the nicotine levels of the parent lines HI and LA, as well as the F3 plants derived from the obtained F2 plants. Phenotypic separation was not observed in 40 F3 plants. [Figure 7] Figure 7 shows a gene map for Nic1. The number of observed recombinations with each marker is given. The genetic distance (cM) for each marker is shown on the left side of the chromosome. The cosegregated Nic1 locus with SNP4 is adjacent to SNP2 / SNP3 and SNP5. A deletion region larger than 500kb (INDEL1) surrounding the Nic1 locus was reported by Adams et al. (US Patent Application Publication 2016 / 0374387A1, incorporated herein by reference). Along with SNPs upstream and downstream (13 and 14), the genomic deletion lies outside the delimited region of the Nic1 locus. [Figure 8] Figure 8 shows a gene map for the Nic2 locus. The number of observed recombinations with each marker is given. The genetic distance (cM) for each marker is shown on the left side of the chromosome. The Nic2 locus is cosegregated at SNP17 and SNP18. [Figure 9] Figure 9 shows the alkaloid analysis of hairy roots transformed with Nic1 ERF (LA background). Hairy roots of HI and LA transformed with empty vectors were used as controls. [Figure 10] The following is a diagram of Sequence ID 1, as described below. [Figure 11] The following is a diagram of Sequence ID No. 2. [Figure 12] The following is a diagram of Sequence ID 3. [Figure 13] The following is a diagram of Sequence ID No. 4. [Figure 14] The following is a diagram of sequence number 5, as described below. [Figure 15] The following is a diagram of sequence number 6, as described below. [Figure 16] The following is a diagram of sequence number 7, as described below. [Figure 17] The following is a diagram of sequence number 8, as described below. [Figure 18] The following is a diagram showing sequence number 9, as described below. [Figure 19] This is a diagram of sequence number 10, as described below. [Figure 20] The following is a diagram of sequence number 11, as described below. [Figure 21] The following is a diagram of sequence number 12, as described below. [Figure 22] The following is a diagram of sequence number 13, as described below. [Figure 23] The following is a diagram of sequence number 14, as described below. [Figure 24] The following is a diagram of sequence number 15, as described below. [Figure 25] The following is a diagram of sequence number 16, as described below. [Figure 26] The following is a diagram of sequence number 17, as described below. [Figure 27] The following is a diagram of sequence number 18, as described below. [Figure 28] The following is a diagram of sequence number 19, as described below. [Figure 29] The following is a diagram of sequence number 20, as described below. [Figure 30] The following is a diagram of sequence number 21, as described below. [Figure 31] The following is a diagram of sequence number 22, as described below. [Figure 32]The following is a diagram of sequence number 23, as described below. [Figure 33] The following is a diagram of sequence number 24, as described below. [Figure 34] The following is a diagram of sequence number 25, as described below. [Figure 35] The following is a diagram of sequence number 26, as described below. [Figure 36] The following is a diagram of sequence number 27, as described below. [Figure 37] The following is a diagram of sequence number 28, as described below. [Figure 38] The following is a diagram of sequence number 29, as described below. [Figure 39] The following is a diagram of sequence number 30, as described below. [Figure 40] The following is a diagram of sequence number 31, as described below. [Figure 41] The following is a diagram of sequence number 32, as described below. [Figure 42] The following is a diagram of sequence number 33, as described below. [Figure 43] The following is a diagram of sequence number 34, as described below. [Figure 44] The figure below shows sequence number 35. [Figure 45] The following is a diagram of sequence number 36, as described below. [Figure 46] The following is a diagram of sequence number 37, as described below. [Figure 47] The following is a diagram of sequence number 38, as described below. [Figure 48] The following is a diagram of sequence number 39, as described below. [Figure 49] The following is a diagram of sequence number 40, as described below. [Figure 50] The following is a diagram of sequence number 41, as described below. [Figure 51] The following is a diagram of sequence number 42, as described below. [Figure 52] The following is a diagram of sequence number 43, as described below. [Figure 53] The following is a diagram of sequence number 44, as described below. [Figure 54] The following is a diagram of sequence number 45, as described below. [Figure 55] The following is a diagram of sequence number 46, as described below. [Figure 56] The following is a diagram of sequence number 47, as described below. [Figure 57] The following is a diagram of sequence number 48, as described below. [Figure 58] The following is a diagram of sequence number 49, as described below. [Figure 59] The following is a diagram of sequence number 50, as described below. [Figure 60] The following is a diagram of sequence number 51, as described below. [Figure 61] The following is a diagram of sequence number 52, as described below. [Figure 62] The following is a diagram of sequence number 53, as described below. [Figure 63] The following is a diagram of sequence number 54, as described below. [Figure 64] The following is a diagram of sequence number 55, as described below. [Figure 65] The following is a diagram of sequence number 56, as described below. [Figure 66] The following is a diagram of sequence number 57, as described below. [Figure 67] The following is a diagram of sequence number 58, as described below. [Figure 68] The following is a diagram of sequence number 59, as described below. [Figure 69] The following is a diagram of sequence number 60, as described below. [Figure 70] The following is a diagram of sequence number 61, as described below. [Figure 71] The following is a diagram of sequence number 62, as described below. [Figure 72] The following is a diagram of sequence number 63, as described below. [Figure 73] The following is a diagram of sequence number 64, as described below. [Figure 74] The following is a diagram of sequence number 65, as described below. [Figure 75] The following is a diagram of sequence number 66, as described below. [Figure 76] The following is a diagram of sequence number 67, as described below. [Figure 77] The following is a diagram of sequence number 68, as described below. [Figure 78] The following is a diagram of sequence number 69, as described below. [Figure 79] The following is a diagram of sequence number 70, as described below. [Figure 80] The following is a diagram of sequence number 71, as described below. [Figure 81] The following is a diagram of sequence number 72, as described below. [Figure 82]Figure 82 shows a partially complete physical map of the Nic1 genomic region indicating the location of the scaffold and markers (scale not shown). Thin black lines represent the BioNano hybrid scaffold with a dark gray scaffold in which pseudochromosomes are positioned, with pseudochromosomes from Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) Areference genome for Nicotiana tabacum enables map-based cloning of homeologousloci implicated in nitrogen utilization efficiency. BMC Genomics 18,448 (incorporated herein by reference) being shown. The dotted black lines represent discontinuous sequence regions, and the small gaps represent the boundary points between BioNano super scaffolds (for details, see Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) Areference genome for Nicotiana tabacum enables map-based cloning of homeologousloci implicatedin nitrogen utilization efficiency. BMC Genomics 18, 448).Light gray areas represent the locations of scaffolds estimated based on cross-BLAST analysis of the genome in Sierro, N., Battey, JN, Ouadi, S., Bakaher, N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobacco genome sequence and its comparison with those of tomato and potato. Nature Communications 5, 3833 (incorporated herein by reference). Pale scaffolds represent locations estimated based on the position of relevant markers in a single gene map. Approximate locations of SNP / INDEL markers are shown in the scaffolds below. The dotted gray boxes represent sequence regions identified by Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1. [Figure 83]Figure 83 shows a partially complete physical map of the Nic2 genomic region indicating the location of the scaffold and markers (scale not shown). The thin black lines represent the BioNano hybrid scaffold with a dark gray scaffold in which the pseudochromosomes from Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) Areferencegenome for Nicotiana tabacum enables map-based cloning of homeologouslociimplicated in nitrogen utilization efficiency. BMC Genomics 18, 448 are positioned. The small gaps in the black lines represent the limits between BioNano super scaffolds (for details, see Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacumenables map-basedcloning of homeologous lociimplicated in nitrogenutilization efficiency. BMC Genomics 18, 448).Light gray represents the location of scaffolds estimated based on cross-BLAST analysis of the genome from Sierro, N., Battey, JN, Ouadi, S., Bakaher, N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobacco genome sequence and its comparison with those of tomato and potato. Nature Communications 5, 3833. Pale scaffolds represent locations estimated based on the position of related markers in a single gene map. Approximate locations of SNP markers are shown in the scaffolds below. The dotted gray boxes represent sequence regions identified by Adams, AC, De GodoyLusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1. [Figure 84] Figure 84 shows the total alkaloid levels (nicotine, nornicotine, anabasine, and anatabin) in isolated populations of EMS-mutated plants, grouped according to the mutation status in Nitab4.5_0003090g0030.1(ERF199). Amino acid changes for mutant plants are shown in parentheses after the gene identifier. Significant differences from wild-type plants (p<0.01 or p<0.05, Student's t-test) are indicated by two or one asterisks, respectively. [Figure 85]Figure 85 shows the sequence analysis of the gene editing-related knockout of Nitab4.5_0003090g0030.1(ERF199) in the heterozygous mutant line L1. L1 contained a mutant allele with an "A" insertion resulting in an immature stop codon. PCR products amplified with primer pairs (sequence number 111 and sequence number 112) were cloned into a pGEM-T Easy Vector, and at least 10 colonies were selected for sequencing. [Figure 86] Figure 86 shows the alkaloid analysis of anatabin, anabasine, nornicotine, and nicotine using T1 plants of the gene-edited mutant L1. Knockout of Nitab4.5_0003090g0030.1 significantly reduced the alkaloid content in HI plants (A), and the alkaloid levels in homozygous mutants were approximately 1 / 10 of those in LA plants (B). WT-T1, Het-T1, and Mut-T1 were used to represent the genotypes of three T1 plants: wild-type, heterozygous, and homozygous mutants, respectively. At least 15 individual plants were measured for each genotype. HI and LA plants were used as controls. [Figure 87] Figure 87 shows the relative expression levels of the Nitab4.5_0003090g0030.1(ERF199) allele between HI and LA plants as determined by RT-PCR analysis. Nitab4.5_0003090g0030.1 expression is root-specific and is downregulated in LA plants. Actin was used as an internal control. The primer pairs used to amplify Nitab4.5_0003090g0030.1 were 5'AGTCCTAGCTCAAGTTTTAGCAGCTTCGA3' (SEQ ID NO: 73) and 5'CGGACTCGGAGTACTTTTCATGGGAT3' (SEQ ID NO: 172), and for actin, 5'ACGCAAGTACAGTGTCTGGA3' (SEQ ID NO: 173) and 5'GCAGATGAGCTCCTCCCTTT3' (SEQ ID NO: 74). [Modes for carrying out the invention]

[0074] Sequence List The sequence identifiers used throughout the subject specification and the corresponding sequence listing summaries are provided below. Sequence ID 1 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0003090g0020.1, or otherwise the gene known as ERF17L3ΔN. Sequence ID 2 corresponds to the cDNA sequence of Nitab4.5_0003090g0020.1(ERF17L3ΔN). Sequence ID 3 corresponds to the cds of Nitab4.5_0003090g0020.1(ERF17L3ΔN). Sequence ID 4 corresponds to the amino acid sequence of the Nitab4.5_0003090g0020.1(ERF17L3ΔN) polypeptide. Sequence ID 5 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0003090g0030.1, or otherwise known as ERF199. Sequence ID 6 corresponds to the cDNA sequence of Nitab4.5_0003090g0030.1(ERF199). Sequence ID 7 corresponds to the cds of Nitab4.5_0003090g0030.1(ERF199). Sequence ID 8 corresponds to the amino acid sequence of the Nitab4.5_0003090g0030.1(ERF199) polypeptide. Sequence ID 9 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0003665g0040.1, or otherwise the gene known as JRE5L2. Sequence ID 10 corresponds to the cDNA sequence of Nitab4.5_0003665g0040.1(JRE5L2). Sequence ID 11 corresponds to the cds of Nitab4.5_0003665g0040.1(JRE5L2). Sequence ID 12 corresponds to the amino acid sequence of the Nitab4.5_0003665g0040.1(JRE5L2) polypeptide. Sequence ID 13 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0004620g0010.1, or otherwise the gene known as ERF210. Sequence ID 14 corresponds to the cDNA sequence of Nitab4.5_0004620g0010.1(ERF210). Sequence ID 15 corresponds to the cds of Nitab4.5_0004620g0010.1(ERF210). Sequence ID 16 corresponds to the amino acid sequence of the Nitab4.5_0004620g0010.1(ERF210) polypeptide. Sequence ID 17 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0004620g0030.1, or otherwise the gene known as ERF91. Sequence ID 18 corresponds to the cDNA sequence of Nitab4.5_0004620g0030.1(ERF91). Sequence ID 19 corresponds to the cds of Nitab4.5_0004620g0030.1(ERF91). Sequence ID 20 corresponds to the amino acid sequence of the Nitab4.5_0004620g0030.1(ERF91) polypeptide. Sequence ID 21 is a known gene as Nitab4.5_0004620g0080.1. This corresponds to the nucleotide sequence encoding the child, or otherwise the gene known as ERF29. Sequence ID 22 corresponds to the cDNA sequence of Nitab4.5_0004620g0080.1(ERF29). Sequence ID 23 corresponds to the cds of Nitab4.5_0004620g0080.1(ERF29). Sequence ID 24 corresponds to the amino acid sequence of the Nitab4.5_0004620g0080.1(ERF29) polypeptide. Sequence ID 25 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0004620g0090.3, or otherwise known as ERF130. Sequence ID 26 corresponds to the cDNA sequence of Nitab4.5_0004620g0090.3(ERF130). Sequence ID 27 corresponds to the cds of Nitab4.5_0004620g0090.3(ERF130). Sequence ID 28 corresponds to the amino acid sequence of the Nitab4.5_0004620g0090.3(ERF130) polypeptide. Sequence ID 29 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0004620g0095.1, or otherwise known as ERF16. Sequence ID 30 corresponds to the cDNA sequence of Nitab4.5_0004620g0095.1(ERF16). Sequence ID 31 corresponds to the cds of Nitab4.5_0004620g0095.1(ERF16). Sequence ID 32 corresponds to the amino acid sequence of the Nitab4.5_0004620g0095.1(ERF16) polypeptide. Sequence ID 33 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0006382g0040.1, or otherwise known as ERF110. Sequence ID 34 corresponds to the cDNA sequence of Nitab4.5_0006382g0040.1(ERF110). Sequence ID 35 corresponds to the cds of Nitab4.5_0006382g0040.1(ERF110). Sequence ID 36 corresponds to the amino acid sequence of the Nitab4.5_0006382g0040.1(ERF110) polypeptide. Sequence ID 37 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0002924g0010.1, or otherwise known as ERF17LI. Sequence ID 38 corresponds to the cDNA sequence of Nitab4.5_0002924g0010.1(ERF17LI). Sequence ID 39 corresponds to the cds of Nitab4.5_0002924g0010.1(ERF17LI). Sequence ID 40 corresponds to the amino acid sequence of the Nitab4.5_0002924g0010.1(ERF17LI) polypeptide. Sequence ID 41 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0002924g0020.2, or otherwise known as ERF179. Sequence ID 42 corresponds to the cDNA sequence of Nitab4.5_0002924g0020.2(ERF179). Sequence ID 43 is Nitab4.5_0002924g0020.2(ERF179) This corresponds to the CDS. Sequence ID 44 corresponds to the amino acid sequence of the Nitab4.5_0002924g0020.2(ERF179) polypeptide. Sequence ID 45 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0002924g0040.2, or otherwise known as ERF17. Sequence ID 46 corresponds to the cDNA sequence of Nitab4.5_0002924g0040.2(ERF17). Sequence ID 47 corresponds to the cds in Nitab4.5_0002924g0040.2(ERF17). Sequence ID 48 corresponds to the amino acid sequence of the Nitab4.5_0002924g0040.2(ERF17) polypeptide. Sequence ID 49 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0002924g0045.1, or otherwise known as ERF168. Sequence ID 50 corresponds to the cDNA sequence of Nitab4.5_0002924g0045.1(ERF168). Sequence ID 51 corresponds to the cds of Nitab4.5_0002924g0045.1(ERF168). Sequence ID 52 corresponds to the amino acid sequence of the Nitab4.5_0002924g0045.1(ERF168) polypeptide. Sequence ID 53 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0002924g0050.2, or otherwise known as ERF115. Sequence ID 54 corresponds to the cDNA sequence of Nitab4.5_0002924g0050.2(ERF115). Sequence ID 55 corresponds to the cds of Nitab4.5_0002924g0050.2(ERF115). Sequence ID 56 corresponds to the amino acid sequence of the Nitab4.5_0002924g0050.2(ERF115) polypeptide. Sequence ID 57 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0006499g0010.1, or otherwise known as ERF104. Sequence ID 58 corresponds to the cDNA sequence of Nitab4.5_0006499g0010.1(ERF104). Sequence ID 59 corresponds to the cds of Nitab4.5_0006499g0010.1(ERF104). Sequence ID 60 corresponds to the amino acid sequence of the Nitab4.5_0006499g0010.1(ERF104) polypeptide. Sequence ID 61 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0006499g0020.2, or otherwise known as ERF221. Sequence ID 62 corresponds to the cDNA sequence of Nitab4.5_0006499g0020.2(ERF221). Sequence ID 63 corresponds to the cds of Nitab4.5_0006499g0020.2(ERF221). Sequence ID 64 corresponds to the amino acid sequence of the Nitab4.5_0006499g0020.2(ERF221) polypeptide. Sequence ID 65 corresponds to the nucleotide sequence encoding the gene known as Nitab4.5_0012667g0020.2(ERF91L1). Sequence ID 66 corresponds to the cDNA sequence of Nitab4.5_0012667g0020.2(ERF91L1). Sequence ID 67 corresponds to the cds of Nitab4.5_0012667g0020.2(ERF91L1). Sequence ID 68 corresponds to the amino acid sequence of the Nitab4.5_0012667g0020.2(ERF91L1) polypeptide. Sequence ID 69 corresponds to a nucleotide sequence encoding the gene known as Nitab4.5_0015055g0010.2, or otherwise known as ERF189. Sequence ID 70 corresponds to the cDNA sequence of Nitab4.5_0015055g0010.2(ERF189). Sequence ID 71 corresponds to the cds in Nitab4.5_0015055g0010.2(ERF189). Sequence ID 72 corresponds to the amino acid sequence of the Nitab4.5_0015055g0010.2(ERF189) polypeptide. Some sequences disclosed herein contain "N" in the nucleotide sequence. "N" may be any nucleotide, or a deletion or insertion of one or more nucleotides. For example, in some cases, a string of "N" is shown. The number of "N" does not necessarily correlate with the actual number of nucleotides at that position. These may be more or fewer nucleotides than those indicated as "N" in the sequence.

[0075] Detailed explanation First, we showed that the alkaloid and / or TSNA content of plants (e.g., tobacco plants) can be controlled by regulating the activity or expression of at least one Nic1 ERF gene in the plant.

[0076] At least one Nic1 ERF gene is selected from the group including genes encoding polypeptides containing the amino acid sequences presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or functional variants, functional fragments, or orthologues thereof, or the ERF gene contains the nucleotide sequences presented in SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or functional variants, functional fragments, or orthologues thereof.

[0077] Appropriately, at least one Nic1 ERF gene may be one, two, three, four, five, six, or seven genes selected from the group including genes encoding polypeptides containing the amino acid sequences presented in SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32, or functional variants, functional fragments, or orthologues thereof; or the ERF gene may contain the nucleotide sequences presented in SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, or SEQ ID NO: 29, or functional variants, functional fragments, or orthologues thereof.

[0078] In one embodiment, at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or ortholog thereof, or the Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or ortholog thereof.

[0079] In one embodiment, the activity or expression of at least one additional Nic1 ERF is regulated. Appropriately, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight additional Nic1 ERFs selected from Table 1 may also be regulated.

[0080] In one embodiment, at least one Nic1 ERF gene encodes a polypeptide containing the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or orthologue thereof, or at least one Nic1 ERF gene containing the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or orthologue thereof, is regulated, and the activity or expression of at least one additional Nic1 ERF is regulated. Preferably, at least one additional Nic1 The ERF may be selected from a Nic1 ERF gene encoding a polypeptide containing the amino acid sequence presented in SEQ ID NO: 4, or SEQ ID NO: 12, or SEQ ID NO: 16, or SEQ ID NO: 20, or SEQ ID NO: 24, or SEQ ID NO: 28, or SEQ ID NO: 32, or SEQ ID NO: 36, or functional variants, functional fragments, or orthologues thereof; or the ERF gene contains the nucleotide sequence presented in SEQ ID NO: 1, or SEQ ID NO: 3, or SEQ ID NO: 9, or SEQ ID NO: 13, or SEQ ID NO: 17, or SEQ ID NO: 21, or SEQ ID NO: 25, or SEQ ID NO: 29, or SEQ ID NO: 33, or functional variants, functional fragments, or orthologues thereof. Appropriately, at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight additional Nic1 ERFs may be regulated.

[0081] In one embodiment, the present invention provides a method for adjusting the alkaloid content of a plant (e.g., tobacco plant) or a part thereof, a method for modifying the plant by adjusting the activity or expression of at least one ERF gene.

[0082] The term "adjust" is used herein to mean either increasing or decreasing.

[0083] The term "increasing alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the present invention (e.g., a plant, a part thereof (e.g., leaves)), the treated leaves, or a product made from the plant (e.g., a tobacco product) is higher than that of an equivalent product not modified in accordance with the present invention.

[0084] The term "reducing alkaloid content" is used herein to mean that the concentration and / or total alkaloid content in the product of the present invention (e.g., a plant, a part thereof (e.g., leaves)), the treated leaves, or a product made from the plant (e.g., a tobacco product) is lower than that of an equivalent product not modified in accordance with the present invention.

[0085] In one embodiment, the present invention provides a method for regulating (i.e., increasing or decreasing) the content of tobacco-specific nitrosamines (TSNAs) or precursors of TSNAs in a plant (e.g., tobacco plant) or a portion thereof, a method comprising modifying the plant by regulating the activity or expression of at least one Nic1 ERF gene.

[0086] In one embodiment, TSNA is N'-nitrosonornicotine (NNN), and / or its precursor is nornicotine.

[0087] In one embodiment, TSNA may be one or more selected from the group consisting of N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT), N'-nitrosoanabasine (NAB), and 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK).

[0088] In a preferred embodiment, TSNA is N'-nitrosonornicotine (NNN).

[0089] TSNA can be measured in processed tobacco, such as dried tobacco or reconstituted tobacco. In one embodiment, the TSNA content is measured and / or modified (e.g., reduced) in dried tobacco plants or a portion thereof (e.g., dried tobacco leaves).

[0090] As used herein, the terms “tobacco-specific nitrosamine” or “TSNA” have their common meaning in the art, i.e., nitrosamines found only in tobacco products or other nicotine-containing products. Preferably, at least one tobacco-specific nitrosamine may be 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK), N'-nitrosonornicotine (NNN), N'-nitrosoanatabine (NAT), or N-nitrosoanabasin (NAB).

[0091] More precisely, at least one tobacco-specific nitrosamine may be NNK or NNN. In one embodiment, the tobacco-specific nitrosamine is NNN.

[0092] When used in relation to at least one tobacco-specific nitrosamine, the term “precursors to them” refers to one or more chemicals or compounds of the tobacco plant that are involved in a nitrosation reaction that results in the formation of or production of tobacco-specific nitrosamines. Appropriately, the term “precursors to them” may refer to nitrate, nitrite, or nitric oxide.

[0093] In one embodiment, the precursor of TSNA is a nicotine oxidative agent such as nornicotine, anabasine, anatabine, and pseudooxynicotine (PON). It is one or more of the group selected from the conductors.

[0094] In a preferred embodiment, the precursor of TSNA is nornicotine.

[0095] In one embodiment, the precursor of TSNA may be PON. The precursor of TSNA (e.g., NNN, NNK, NAB and / or NAT) may be measured in green tobacco leaves, for example, before processing, for example, before drying. In one embodiment, the precursor of TSNA (e.g., NNN, NNK, NAB and / or NAT) may be measured and / or modified (e.g., reduced) in green tobacco leaves, for example, before processing, for example, before drying.

[0096] In one embodiment, performing the method and / or use of the present invention results in a reduction of at least one TSNA or precursor thereto in a modified tobacco plant (or a part thereof) compared to a tobacco plant (or a part thereof) that has not been modified according to the present invention.

[0097] The terms "reducing at least one TSNA or its precursors" or "reducing at least one TSNA or its precursors" are used herein. The term "TSNA" is used to mean that the concentration and / or content of at least one TSNA or its precursor in the product, method, or use of the present invention is lower than that of equivalent products, methods, or uses. For example, equivalent tobacco industrial products are derived from tobacco plants that are not modified according to the present invention but have all other relevant characteristics the same (e.g., plant species, growing conditions, method of processing tobacco, etc.).

[0098] Any method known in the art for determining the concentration and / or level of at least one TSNA or its precursors may be used. In particular, such a method may involve the addition of a deuterium-labeled internal standard, aqueous extraction and filtration, followed by analysis using reversed-phase high-performance liquid chromatography (LC-MS / MS) with tandem mass spectrometry. Other examples for determining the concentration and / or level of precursors to tobacco-specific nitrosamines include methods such as CORESTA recommended method CRM-72: Determination of TobaccoSpecificNitrosamines in Tobacco and Tobacco Products by LC-MS / MS; CRM being developed into ISO / DIS21766 or the method detailed in Wagner et al. AnalyticalChemistry (2005), 77(4), 1001-1006, all of which are incorporated herein by reference.

[0099] Appropriately, the concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor can be reduced by performing the methods and / or use of the present invention. Appropriately, the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor can be reduced in tobacco plants of the present invention (e.g., those that can or are obtained by the methods and / or use of the present invention) compared to the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor in tobacco plants that have not been modified according to the present invention.

[0100] The concentration and / or total content of at least one tobacco-specific nitrosamine or its precursors can be reduced in tobacco leaves, harvested leaves, treated tobacco leaves, tobacco industrial products, or combinations thereof that can be obtained from or obtained from tobacco plants (or parts of tobacco plants, or tobacco cell cultures) that have not been modified in accordance with the present invention, compared to tobacco leaves, harvested leaves, treated tobacco leaves, tobacco industrial products, or combinations thereof that can be obtained from or obtained from tobacco plants (or parts of tobacco plants, or tobacco cell cultures) that have not been modified in accordance with the present invention.

[0101] Appropriately, the concentration and / or total content of at least one tobacco-specific nitrosamine or its precursor can be reduced in the treated tobacco leaves.

[0102] Appropriately, the concentration and / or level of at least one tobacco-specific nitrosamine or its precursor can be reduced in tobacco industrial products.

[0103] In one embodiment, at least one tobacco-specific nitrosamine or its precursor may be reduced to at least about 1%, at least about 3%, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%. In some embodiments, at least one tobacco-specific nitrosamine or its precursor may be reduced to between about 5% and about 95%, between about 10% and about 90%, between 20% and about 80%, between 30% and about 70%, or between about 40% and 60%.

[0104] In relation to treated (e.g., dried) tobacco leaves (e.g., dried or reconstituted), at least one tobacco-specific nitrosamine or The precursors to these can be reduced to between approximately 5000 ng / g and 50 ng / g, between approximately 4000 ng / g and 100 ng / g, between approximately 3000 ng / g and 500 ng / g, or between 2000 ng / g and 1000 ng / g. In some embodiments, at least one tobacco-specific nitrosamine or its precursor can be reduced to at least approximately 5000 ng / g, at least approximately 4000 ng / g, at least approximately 3000 ng / g, at least approximately 2000 ng / g, at least approximately 1000 ng / g, at least approximately 500 ng / g, at least approximately 100 ng / g, or at least approximately 50 ng / g.

[0105] The term “equivalent product” as defined herein means a product derived from a plant (e.g., tobacco plant) that is not modified in accordance with the present invention but has all other relevant characteristics the same (e.g., plant species, growing conditions, method of processing the plant (e.g., tobacco, etc.). An equivalent product according to the present invention may mean a plant (e.g., tobacco plant) or a part thereof, e.g., leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut and harvested leaves (e.g., cut and harvested tobacco leaves), treated leaves (e.g., treated tobacco leaves), or plant propagation material (e.g., tobacco plant propagation material), or a product containing the plant or a part thereof, e.g., a tobacco product or combination thereof that can be obtained, for example, from an unmodified plant, to regulate the activity or expression of the Nic1 ERF gene (or a combination of one or more Nic1 ERF genes and one or more Nic2 ERF genes). Equivalent products may also be known as controls or wild types. In one embodiment, the equivalent product is a product that does not contain the Nic1 ERF gene whose activity or expression is regulated. In one embodiment, the equivalent product is a product that does not contain either the Nic1 ERF gene whose activity or expression is regulated, or the Nic2 ERF gene whose activity or expression is regulated.

[0106] The term “unmodified plant” as defined herein means a plant (e.g., tobacco plant) that has not been modified in accordance with the present invention to modulate the activity or expression of the Nic1 ERF gene and has all other relevant characteristics the same (e.g., plant species, growing conditions, method of processing tobacco, etc.). In one embodiment, the unmodified plant is a product that does not contain the Nic1 ERF gene whose activity or expression is regulated. In one embodiment, the equivalent product is a product that does not contain either the Nic1 ERF gene whose activity or expression is regulated, or the Nic2 ERF gene whose activity or expression is regulated.

[0107] Suitable plants according to the present invention include, for example, plants of the Solanaceae family, including tobacco, tomato, Datura, eggplant, mandrake, deadly nightshade (belladonna), Capsicum species (paprika, chili pepper), and potato. In one embodiment, a suitable genus of the Solanaceae family is Solanum, for example, tomato (Solanum lycopersicum) or potato (Solanum tuberosum). In one embodiment, a suitable genus of the Solanaceae family is Tobacco. Suitablely, the Tobacco species may be Nicotiana tabacum. A suitable species of the Tobacco genus may be referred to herein as tobacco plant, or simply tobacco.

[0108] The “activity or expression” of the Nic1 ERF gene (or Nic2 ERF gene) may refer to the level of transcription, translation, i.e., protein expression, or activity of the protein encoded by the Nic1 ERF gene (or, respectively, the Nic2 ERF gene). The activity of the Nic1 ERF gene (or Nic2 ERF gene) relates to its ability to function as a transcription factor in alkaloid biosynthesis. The activity of the Nic1 ERF gene (or Nic2 ERF gene) may be determined by measuring the product of alkaloid synthesis, i.e., by measuring the alkaloid content.

[0109] According to one aspect of the present invention, gene expression can be reduced (or inhibited) by inhibiting transcription and / or translation. In one embodiment, gene activity or expression may refer to the level of transcription, i.e., the amount of mRNA produced, or the level or amount of translation, i.e., the amount of protein produced.

[0110] In some embodiments, the adjustment of alkaloid content refers to an increase in alkaloid content, which is associated with increased activity or expression of at least one Nic1 ERF gene.

[0111] In some embodiments, the regulation of alkaloid content refers to a reduction in alkaloid content where the activity or expression of at least one Nic1 ERF gene is reduced (or inhibited).

[0112] In some embodiments, the adjustment of alkaloid content refers to an increase in alkaloid content where the activity or expression of at least one Nic1 ERF gene and the activity or expression of at least one Nic2 ERF gene are increased in combination.

[0113] In some embodiments, the adjustment of alkaloid content refers to a reduction in alkaloid content in which the activity or expression of at least one Nic1 ERF gene and the activity or expression of at least one Nic2 ERF gene are combined to decrease (or inhibit).

[0114] In a further embodiment, the alkaloid content is measured from the leaves. In one embodiment, the alkaloid content is measured from green leaves. In a further embodiment, the alkaloid content is measured from dried leaves, for example, air-dried leaves, hot-air-dried leaves, heat-dried leaves, or sun-dried leaves. In a further embodiment, the alkaloid content is measured from hot-air-dried leaves. In a further embodiment, the alkaloid content is measured from air-dried leaves.

[0115] The term "alkaloid content" is used herein to mean the concentration and / or total amount of the entire group of compounds classified as alkaloids. Typical alkaloids found in tobacco include nicotine, anatabine, anabasine, myosmin, and nornicotine. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, myosmin, and nornicotine is adjusted. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, myosmin, and nornicotine is reduced. In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, and nornicotine is increased. The nicotine content is appropriately adjusted. In one embodiment, the nicotine content is reduced.

[0116] Any method known in the art may be used to determine the concentration and / or total content of alkaloids. One preferred method for analyzing alkaloid content includes analysis by gas chromatography-flame ionization detection (GC-FID).

[0117] In one embodiment, the plant of the present invention, in which the alkaloid content is adjusted, can be obtained or obtained from the plant (e.g., tobacco plant) or a part thereof, plant propagation material (e.g., tobacco plant propagation material), cells (e.g., tobacco cells), leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut and harvested leaves (e.g., cut and harvested tobacco leaves), treated leaves (e.g., treated tobacco leaves), cut and treated leaves (e.g., cut and treated tobacco leaves), the plant The present invention provides a method for producing a product containing a substance or a part thereof (e.g., a tobacco product), or a combination thereof, comprising modifying the tobacco to regulate the activity or expression of the Nic1 ERF gene. The regulated alkaloid content can be determined by comparing the alkaloid content in a plant (e.g., tobacco plant) or a part thereof, plant propagation material (e.g., tobacco plant propagation material), cells (e.g., tobacco cells), leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut and harvested leaves (e.g., cut and harvested tobacco leaves), treated leaves (e.g., treated tobacco leaves), cut and treated leaves (e.g., cut and treated tobacco leaves), a product containing the plant or a part thereof according to the present invention, e.g., a tobacco product, or a combination thereof with an equivalent product.

[0118] Appropriately, the alkaloid content can be regulated in plants, e.g., tobacco plants, e.g., modified tobacco plants. Appropriately, the alkaloid content can be regulated in leaves (e.g., tobacco leaves, e.g., tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be regulated in harvested leaves (e.g., harvested tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be regulated in cut and harvested leaves (e.g., cut and harvested tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be regulated in treated leaves (e.g., treated tobacco leaves, e.g., treated tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be regulated in cut and treated leaves (e.g., cut and treated tobacco leaves, e.g., cut and treated tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be regulated in dried leaves (e.g., dried tobacco leaves derived from modified tobacco plants). Appropriately, the alkaloid content can be adjusted in green leaf extracts (e.g., green tobacco leaves derived from a modified tobacco plant). Appropriately, the alkaloid content can be adjusted in products containing the plant or a part thereof (e.g., tobacco products, e.g., tobacco products manufactured from a modified tobacco plant or a part thereof). Appropriately, the alkaloid content can be adjusted in any one of the above products or a combination thereof. Appropriately, the adjustment of the alkaloid content described above may be an increase in the alkaloid content. Appropriately, the adjustment of the alkaloid content described above may be a decrease in the alkaloid content.

[0119] In one embodiment, the content of one or more alkaloids selected from nicotine, anatabine, anabasine, myosmin, and nornicotine is reduced.

[0120] Appropriately, the adjustment of the alkaloid content described above may result in a reduction of the nicotine content.

[0121] In one embodiment, the nicotine content of a tobacco product derived from a modified plant (e.g., tobacco plant), plant propagation material (e.g., tobacco plant propagation material), leaves (e.g., tobacco leaves), harvested leaves (e.g., harvested tobacco leaves), cut and harvested leaves (e.g., cut and harvested tobacco leaves), treated leaves (e.g., treated tobacco leaves), cut and treated leaves (e.g., cut and treated tobacco leaves), or a modified tobacco plant is reduced.

[0122] In one embodiment, the alkaloid content of a plant (e.g., tobacco) or a portion thereof can be adjusted by at least two, three, four, five, six, seven, eight, nine, or ten times compared to the alkaloid content of a plant (e.g., tobacco) or a portion thereof that has not been modified to regulate the activity or expression of at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) grown under similar growth conditions. In particular, the alkaloid content can be adjusted to about 2 to 10 times, preferably about 3 to 10 times, and appropriately about 3 to 5 times. Appropriately, the modification may be an increase or decrease in the alkaloid content. Appropriately, the adjustment may be an adjustment of the content of one or more alkaloids selected from nicotine, anatabine, anabasine, myosmin, and nornicotine. Appropriately, the modification may be a modification of the nicotine content.

[0123] In one embodiment of the present invention, the alkaloid content of a plant (e.g., tobacco plant) or a part thereof can be adjusted to 1%, 2%, 5%, 8%, 10%, 12%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to a plant (e.g., tobacco plant) or a part thereof that has not been modified according to the present invention. The adjustment may be an increase or decrease in alkaloid content compared to an unmodified plant (e.g., tobacco plant) or a part thereof. Preferably, the adjustment may be an adjustment of the total alkaloid content. Preferably, the adjustment may be an adjustment of the content of one or more alkaloids selected from nicotine, anatabine, anabasine, myosmin, and nornicotine. Preferably, the modification is a modification of the nicotine content.

[0124] In one embodiment, the method or use results in a regulated alkaloid content compared to, or in comparison to, a plant (e.g., tobacco) or a part thereof that has not been modified to regulate the activity or expression of the Nic1 ERF gene (or the Nic1 ERF gene and the Nic2 ERF gene), more specifically, compared to, or in comparison to, expression by a plant (e.g., tobacco) in which the introduced regulation is absent.

[0125] In each embodiment, a plant (e.g., tobacco plant) or a portion thereof is modified to achieve regulation in alkaloid content compared to a plant (e.g., tobacco plant) or a portion thereof that is not modified to regulate the activity or expression of at least one Nic1 ERF gene (or at least one Nic1 ERF gene and at least one Nic2 ERF gene).

[0126] As used herein, the terms “modified” or “modified” mean a plant that has been altered or modified (e.g., tobacco plant). The present invention includes plant modification using techniques for genetic modification or non-genetic modification of plants. Such methods are well known in the art, and examples of genetic modification techniques include transformation, gene transfer, cisgenic and gene editing methods. Examples of non-genetic modification techniques include fast neutron mutagenesis, chemical mutagenesis, e.g., ethyl methanesulfonate (EMS) mutagenesis, and modern population analysis approaches.

[0127] In one embodiment, a natural variant having a modified Nic1 ERF gene is selected, and its trait or gene is bred into a second plant having a commercially desirable trait.

[0128] In one embodiment, the plant according to the present invention (for example, tobacco) may be a genetically modified plant.

[0129] In another embodiment, the plant according to the present invention (e.g., tobacco plant) may be a non-genetically modified plant.

[0130] Ideally, regulation of at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) is absent in LA Burley-21.

[0131] Ideally, regulation of at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) is absent in Burley-21.

[0132] In some embodiments, modifications that reduce the activity or expression of at least one Nic1 ERF gene (or at least one Nic2 ERF gene) and thereby reduce the alkaloid content reduce, interfere with, or weaken the transcription, translation, or expression of at least one Nic1 ERF gene (or both at least one Nic1 ERF gene and at least one Nic2 ERF gene); Inhibiting the synthesis of polypeptides encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene), or their release from intracellular stores; or The method is selected from the group consisting of increasing the rate of degradation of polypeptides encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene).

[0133] In one embodiment, a modification that reduces the activity or expression of at least one Nic1 ERF gene (or one or more modifications that reduce the activity of a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) includes mutations in one or more ERF genes.

[0134] In one embodiment, the mutation causes the deletion of one or more entire ERF genes.

[0135] In one embodiment, one or more ERF genes may contain one or more mutations within the gene. Appropriately, one or more mutations result in reduced or removed gene activity in the mutated gene. In one embodiment, one or more mutations result in an inactive gene. In one embodiment, the mutation may be a deletion. In one embodiment, the mutation may be an insertion. In one embodiment, the mutation may introduce an early stop codon. In one embodiment, the target site is unique to the target ERF gene and not present in other ERF genes. In one embodiment, the mutation targets the 5' end of the protein coding region.

[0136] In one embodiment, the mutation is a nonsense mutation.

[0137] In one embodiment, the variant has reduced total alkaloids and / or reduced nicotine levels.

[0138] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 4, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0139] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 8, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0140] In one embodiment, the present invention relates to one or more mutations in the Nic1 ERF gene encoding a polypeptide that includes (or consists of) the amino acid sequence of SEQ ID NO: 12, or a sequence having at least 90%, preferably at least 96%, identity therewith. provide.

[0141] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 16, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0142] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 20, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0143] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 24, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0144] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 28, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0145] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 32, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0146] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene encoding a polypeptide comprising (or consisting of) the amino acid sequence of SEQ ID NO: 36, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0147] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 1, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0148] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the coding sequence presented in Sequence ID No. 3, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0149] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 5, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0150] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 9, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0151] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 13, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0152] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 17, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0153] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 21, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0154] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 25, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0155] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 29, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0156] In one embodiment, the present invention provides one or more mutations in the Nic1 ERF gene that include (or consist of) the nucleotide sequence presented in SEQ ID NO: 33, or a sequence having at least 90%, preferably at least 96%, identity therewith.

[0157] For example, this method may include the following: To provide mutations in nucleic acid sequences encoding proteins, including amino acid sequences represented as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; To provide mutations in the promoter of a nucleic acid sequence encoding a protein, which includes an amino acid sequence represented as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; To provide mutations in the nucleic acid sequence of an ERF gene, including a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or any of these; To provide mutations in the promoter of the nucleic acid sequence of an ERF gene, which includes a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or any of these; To provide antisense RNA, siRNA, or miRNA that reduces the level of nucleic acid sequences encoding proteins, including amino acid sequences represented as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; To provide antisense RNA, siRNA, or miRNA that reduces the level of nucleic acid sequences of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or nucleotide sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these sequences.

[0158] In one embodiment, one or more Nic2 ERF genes are regulated (e.g., mutated) in the same way that one or more Nic1 ERF genes are regulated (e.g., mutated).

[0159] Appropriately, any one of the Nic1 ERF gene modifications (e.g., mutations) taught herein may be used in combination with one or more modifications of the Nic2 ERF gene, wherein the Nic2 ERF gene encodes a polypeptide containing the amino acid sequences presented in SEQ ID NO: 40, or SEQ ID NO: 44, or SEQ ID NO: 48, or SEQ ID NO: 52, or SEQ ID NO: 56, or SEQ ID NO: 60, or SEQ ID NO: 64, or SEQ ID NO: 68, or SEQ ID NO: 72, or functional variants, functional fragments, or orthologues thereof, or the Nic2 ERF gene contains the nucleotide sequences presented in SEQ ID NO: 37, or SEQ ID NO: 41, or SEQ ID NO: 45, or SEQ ID NO: 49, or SEQ ID NO: 53, or SEQ ID NO: 57, or SEQ ID NO: 61, or SEQ ID NO: 65, or SEQ ID NO: 69, or functional variants, functional fragments, or orthologues thereof.

[0160] For example, this method may include the following: To provide mutations in nucleic acid sequences encoding proteins, including amino acid sequences represented as SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; To provide mutations in the promoter of a nucleic acid sequence encoding a protein, which includes an amino acid sequence represented as SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; • Sequence ID 37, or Sequence ID 41, Sequence ID 45, or Sequence ID 49, or This provides a mutation in the nucleic acid sequence of an ERF gene that includes a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69, or any of these; To provide mutations in the promoter of the nucleic acid sequence of an ERF gene, including a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with SEQ ID NO: 37, or SEQ ID NO: 41, or SEQ ID NO: 45, or SEQ ID NO: 49, or SEQ ID NO: 53, or SEQ ID NO: 57, or SEQ ID NO: 61, or SEQ ID NO: 65, or SEQ ID NO: 69, or SEQ ID NO: 69; To provide antisense RNA, siRNA, or miRNA that reduces the level of nucleic acid sequences encoding proteins, including amino acid sequences represented as SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; To provide an antisense RNA, siRNA, or miRNA that reduces the level of nucleic acid sequences of SEQ ID NO: 37, 41, 45, 49, 53, 57, 61, 65, or 69, or nucleotide sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these sequences.

[0161] In one embodiment, these include one or more mutations in a nucleic acid sequence encoding a protein, which includes an amino acid sequence shown as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; or one or more mutations in a nucleic acid sequence of an ERF gene, which includes SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these; and at least one Nic2 Mutations in the ERF gene, specifically, one or more mutations in nucleotide sequences encoding the amino acid sequences of SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these, or one or more mutations in nucleic acid sequences including SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69, or nucleotide sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these, are used in combination, and more specifically, the Nic2 ERF mutation is the amino acid sequence of SEQ ID NO: 72, or has at least 70% (preferably at least 8 The mutations are in a nucleotide sequence encoding an amino acid sequence having 0%, preferably at least 90%, preferably at least 96%, preferably at least 98%, sequence identity, or the nucleotide sequence of Sequence ID No. 69, or in a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with the above, or in one or more mutations in such a nucleotide sequence.

[0162] In one embodiment, these include one or more mutations in a nucleic acid sequence encoding a protein, which includes the amino acid sequence shown as SEQ ID NO: 8, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto; and mutations in at least one Nic1 ERF gene, which includes the nucleic acid sequence of the ERF gene, which includes SEQ ID NO: 5, or a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto; and at least one Nic2 The ERF gene mutations, specifically, one or more mutations in nucleotide sequences encoding the amino acid sequences of SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or amino acid sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these, or a combination of one or more mutations in nucleotide sequences including SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69, or nucleotide sequences having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity with these.

[0163] In one embodiment, these are one or more mutations in a nucleic acid sequence encoding a protein comprising the amino acid sequence shown as SEQ ID NO: 8, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto, and the nucleic acid sequence of the ERF gene comprising SEQ ID NO: 5, or one or more mutations in a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto, a mutation in at least one Nic1 ERF gene consisting of; and one or more mutations in a nucleotide sequence encoding the amino acid sequence shown as SEQ ID NO: 72, or an amino acid sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto, or the nucleotide sequence shown as SEQ ID NO: 69, and one or more mutations in a nucleotide sequence having at least 70% (preferably at least 80%, preferably at least 90%, preferably at least 96%, preferably at least 98%) sequence identity thereto, a combination of mutations in at least one Nic2 ERF gene consisting of.

[0164] One or more Nic2 ERF genes can be one, or two, or three, or four, or five, or six, or seven, or eight, or nine Nic2 ERF genes selected from Table 2.

[0165] In some embodiments, at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) Modifications that reduce the activity or expression of a compound, thereby reducing the alkaloid content, are one or more modifications selected from the group consisting of point mutations, deletions, insertions, duplications, and inversions in one or more ERF genes. Preferably, the modification is introduced by a method selected from random mutagenesis and targeted mutagenesis. Preferably, the modification can be introduced by a targeted mutagenesis method selected from, for example, meganucleases, zinc finger nucleases, TALENs, gene editing, and CRISPR.

[0166] As used herein, the term “variant” includes both naturally occurring and manipulated genetic variants.

[0167] In particular, the term "mutation" refers to a modification in the amino acid sequence compared to the sequence shown as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or to an amino acid sequence that has at least 70% sequence identity with these sequences, thereby reducing the expression or function of the protein.

[0168] The term "mutation" may refer to a modification in a nucleotide sequence compared to the sequence shown as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or to a nucleotide sequence having at least 70% sequence identity with these.

[0169] In a preferred embodiment, each copy of a nucleic acid sequence encoding a protein, including the sequence shown as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or a sequence having at least 70% identity with these, or the sequence shown as SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or a sequence present in a plant having at least 70% sequence identity with these, is mutated as defined herein (for example, each genomic copy of the gene encoding the protein in the plant is mutated). For example, each copy of a gene in the allotetraploid genome of tobacco can be mutated.

[0170] In a preferred embodiment, the plant or plant cell according to the present invention is homozygous for mutation.

[0171] In one embodiment, preferably, the plant or plant cell according to the present invention expresses only mutated nucleic acids. In other words, in some embodiments, endogenous (or endogenous and functional) proteins are not present in the plant according to the present invention. In other words, if any endogenous proteins are present, they are preferably in an inactive and / or truncated form.

[0172] The mutation may interrupt the nucleic acid sequence encoding the protein detailed herein.

[0173] Interruption can result in untranscribed and / or untranslated nucleic acid sequences.

[0174] Nucleic acid sequences can be interrupted, for example, by deleting or otherwise modifying the ATG start codon of the nucleic acid sequence so that protein translation is reduced or prevented.

[0175] Nucleic acid sequences may contain one or more nucleotide changes that reduce or prevent protein expression or affect protein transport. For example, protein expression may be reduced or prevented by the introduction of one or more immature stop codons, frameshifts, splice mutations, or non-acceptable amino acid substitutions in the open reading frame.

[0176] An immature stop codon is a mutation that introduces a stop codon into an open reading frame, preventing the translation of the entire amino acid sequence. Immature stop codons can be TAG ("amber"), TAA ("ochre"), or TGA ("opal" or "umber") codons.

[0177] Appropriately, an immature stop codon may be introduced into Nitab4.5_0003090g0030.1(ERF199), as shown in any of sequence numbers 5-7.

[0178] Appropriately, the immature stop codon may be introduced into Nitab4.5_0003090g0030.1(ERF199) and may be a TGA ("opal" or "umber") immature stop codon, as shown in any of sequence numbers 5-7.

[0179] A frameshift mutation (also called a framing error or reading frameshift) is a mutation caused by a deletion or insertion (insertion or deletion) of nucleotides in a nucleic acid sequence that is not divisible by 3. Due to the triplet nature of gene expression by codons, insertions or deletions can alter the reading frame, resulting in a completely different translation from the original. Frameshift mutations often cause codon readings after mutations that encode different amino acids. Frameshift mutations generally result in the introduction of immature stop codons.

[0180] Splice mutations occur when splicing inserts, deletes, or changes several nucleotides at specific sites during the processing of precursor messenger RNA into mature messenger RNA. Deletion of a splicing site results in one or more introns remaining in the mature mRNA, which can lead to the production of abnormal proteins.

[0181] Non-permissible amino acid substitutions refer to mutations that cause non-synonymous amino acid substitutions in a protein that result in a reduction or ablation of the protein's function.

[0182] Any method known in the art for providing mutations in a nucleic acid sequence can be used in the present method. For example, homologous recombination may be used, where the relevant nucleic acid sequence is mutated and a vector used for transforming a plant or plant cell is prepared. Then, a recombinant plant or plant cell expressing the mutated sequence can be selected.

[0183] The nucleic acid sequence can be deleted in whole or in part. The deletion may be continuous or may include multiple sections of the sequence. The deletion preferably removes a sufficient amount of the nucleotide sequence so that the nucleic acid sequence no longer encodes a functional protein. The deletion can, for example, remove at least 50%, 60%, 70%, 80% or 90% of the coding portion of the nucleic acid sequence.

[0184] The deletion may be complete, in which case 100% of the coding portion of the nucleic acid sequence is absent when compared to the corresponding genome of an equivalent unmodified plant.

[0185] Methods for deletion of nucleic acid sequences in plants are known in the art. For example, homologous recombination may be used, where the relevant nucleic acid sequence is deleted and a vector used for transforming a plant or plant cell is prepared. Then, a recombinant plant or plant cell expressing the new portion of the sequence can be selected. transforming a plant or plant cell is prepared. Then, a recombinant plant or plant cell expressing the new portion of the sequence can be selected.

[0186] Plant cells transformed with the vectors described above can be grown and maintained according to well-known tissue culture methods, such as culturing the cells in a suitable culture medium supplemented with necessary growth factors such as amino acids, plant hormones, and vitamins.

[0187] Modification of nucleic acid sequences can be performed using targeted mutagenesis methods (also known as targeted nucleotide exchange (TNE) or oligo-directed mutagenesis (ODM)). Targeted mutagenesis methods include, but are not limited to, zinc finger nucleases, TALEN (see International Publication No. 2011 / 072246 and International Publication No. 2010 / 079430), Cas-9-like Cas9 / crRNA / tracrRNA or Cas9 / gRNA CRISPR systems (see International Publication No. 2014 / 071006 and International Publication No. 2014 / 093622), meganucleases (see International Publication No. 2007 / 047859 and International Publication No. 2009 / 059195), or, depending on the case, mutagenic oligonucleotides (e.g., KeyBase® or TALEN) containing chemically modified nucleotides in plant protoplasts to enhance mutagenesis with sequences complementary to the gene. The law is cited.

[0188] Alternatively, TILLING (Targeting Induced Local Lessons INGenomics, Genomics) Using mutagenesis systems such as targeted-induced local disruption in saturation (McCallum et al., 2000, Nat Biotech 18:455 and McCallum et al. 2000, Plant Physiol. 123, 439-442, both incorporated herein by reference), plant lines containing genes encoding mutated proteins can be generated. TILLING uses conventional chemical mutagenesis (e.g., ethyl methanesulfonate (EMS) mutagenesis), followed by high-throughput screening for mutations. Thus, plants, seeds, and tissues containing genes with the desired mutations can be obtained.

[0189] This method may include steps of mutagenesis in plant seeds (e.g., EMS mutagenesis), pooling plant individuals or DNA, PCR amplification of a desired region, heteroduplex formation and high-throughput detection, identification of mutant plants, and sequencing of mutant PCR products. It is understood that other mutagenesis and selection methods may be used in the same way to generate such modified plants. Seeds may be irradiated or chemically treated, for example, and plants may be screened for modified phenotypes.

[0190] Modified plants can be distinguished from unmodified plants, i.e., wild-type plants, by molecular methods such as mutations present in the DNA, and by the characteristics of the modified phenotype. Modified plants may be homozygous or heterozygous with respect to mutations.

[0191] Appropriately, the method may include transforming plant cells (e.g., tobacco plants) with a gene construct capable of inhibiting the activity or expression of at least one Nic1 ERF gene (or a construct capable of inhibiting the activity or expression of a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene).

[0192] In some embodiments, the activity or expression of at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) is increased, thereby increasing the alkaloid content. Modification involves increasing, promoting, or enhancing the transcription, translation, or expression of at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene); To increase the synthesis of polypeptides encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) or their release from intracellular stores; and To reduce the rate of degradation of polypeptides encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene). It is selected from the group consisting of the following.

[0193] Appropriately, the method may involve transforming plant cells (e.g., tobacco plants) with a gene construct comprising a nucleotide sequence encoding a protein capable of promoting or increasing at least one exogenous Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene), or at least one endogenous Nic1 ERF gene (or a combination of at least one endogenous Nic1 ERF gene and at least one endogenous Nic2 ERF gene). It is understood that each of these options results in increased activity and expression of a polypeptide encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene). The method may involve regenerating plants from the transformed cells.

[0194] Therefore, the present invention provides the use of a gene construct that has the ability to increase the activity and / or expression of polypeptides encoded by at least one Nic1 ERF gene (or a combination of at least one Nic1 ERF gene and at least one Nic2 ERF gene) in order to increase the alkaloid content in plants transformed with the construct.

[0195] The gene construct may encode a polypeptide containing the amino acid sequences presented in SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or functional variants, functional fragments, or orthologues thereof. This construct may also contain the nucleotide sequences presented in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or functional variants, functional fragments, or orthologues thereof.

[0196] In some embodiments, the methods or uses of the present invention include increasing the alkaloid content of a plant (e.g., tobacco plant) by increasing the activity or expression of the Nic1 ERF gene and the Nic2 ERF gene.

[0197] Appropriately, a method or use for increasing alkaloid content comprises increasing the activity or expression of at least one Nic1 ERF gene and Nic2 ERF gene, wherein at least one Nic1 ERF gene substantially encodes a polypeptide containing the amino acid sequence presented in SEQ ID NO: 4, or SEQ ID NO: 8, or SEQ ID NO: 12, or SEQ ID NO: 16, or SEQ ID NO: 20, or SEQ ID NO: 24, or SEQ ID NO: 28, or SEQ ID NO: 32, or SEQ ID NO: 36, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene substantially encodes SEQ ID NO: 1, or SEQ ID NO: 3, or SEQ ID NO: 5, or SEQ ID NO: 9, or The Nic2 ERF gene substantially encodes a polypeptide comprising the nucleotide sequence presented in SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or a functional variant, functional fragment, or orthologue thereof; or the Nic2 ERF gene substantially comprises the nucleotide sequence presented in SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or a functional variant, functional fragment, or orthologue thereof; or the Nic2 ERF gene substantially comprises the nucleotide sequence presented in SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69.

[0198] Appropriately, a method or use for increasing alkaloid content comprises increasing the activity or expression of at least one Nic1 ERF gene and a Nic2 ERF gene, wherein at least one Nic1 ERF gene encodes a polypeptide containing the amino acid sequence presented in SEQ ID NO: 4, or SEQ ID NO: 8, or SEQ ID NO: 12, or SEQ ID NO: 16, or SEQ ID NO: 20, or SEQ ID NO: 24, or SEQ ID NO: 28, or SEQ ID NO: 32, or SEQ ID NO: 36, or a functional variant, functional fragment, or orthologue thereof; or the ERF gene contains the nucleotide sequence presented in SEQ ID NO: 1, or SEQ ID NO: 3, or SEQ ID NO: 5, or SEQ ID NO: 9, or SEQ ID NO: 13, or SEQ ID NO: 17, or SEQ ID NO: 21, or SEQ ID NO: 25, or SEQ ID NO: 29, or SEQ ID NO: 33, or a functional variant, functional fragment, or orthologue thereof; or the Nic2 ERF gene contains the nucleotide sequence presented in SEQ ID NO: 69.

[0199] As used herein, the term “inhibit” (for example, inhibiting the activity or expression of the Nic1 ERF gene) means that the activity or expression of the Nic1 ERF gene is lower or reduced compared to the activity or expression of the gene in an equivalent product, or that the amount or activity of the protein produced by the Nic1 ERF gene is lower.

[0200] In one embodiment, the term “inhibit” as used herein (e.g., inhibiting the activity or expression of the Nic1 ERF gene) means that the activity or expression of the Nic1 ERF gene is lower than that of the gene in an equivalent product.

[0201] The activity of a specific Nic1 ERF gene can be measured by measuring gene transcription. Methods for measuring transcription are well known in the art, and include, in particular, Northern blotting, RNA-Seq, in situ hybridization, DNA microarrays, and RT-PCR. Alternatively, gene activity can be measured indirectly by measuring the level of the gene product, for example, the protein encoded by the gene.

[0202] In some embodiments, the activity or expression of the Nic1 ERF gene can be regulated, i.e., increased or decreased, by at least about 10%, 20%, 30%, or 40%, preferably at least about 50%, 60%, or 70%, and more preferably at least about 80%, 90%, 95%, or 100%, compared to the activity or expression of the Nic1 ERF gene in a plant not modified according to the present invention (e.g., tobacco plant).

[0203] Appropriately, the expression or function of the Nic1 ERF gene may be reduced, partially inactivated, inhibited, removed, knocked out, or lost so that the expression or function of the Nic1 ERF protein is undetectable.

[0204] In one embodiment, at least one Nic1 ERF gene is knocked out. In other words, the Nic1 ERF gene is completely disabled.

[0205] In one embodiment, a polypeptide encoding the amino acid sequence presented in SEQ ID NO: 8, or a functional variant, functional fragment, or ortholog thereof, or a Nic1 ERF gene containing the nucleotide sequence presented in SEQ ID NO: 5, or a functional variant, functional fragment, or ortholog thereof, is knocked out.

[0206] In a preferred embodiment, the Nic1 ERF gene may be substantially inactive or expressionless, meaning that the plant may contain less than about 1% (preferably less than about 0.1%) of activity or expression compared to a plant that has not been modified to inhibit the activity or expression of the Nic1 ERF gene.

[0207] In some embodiments, the activity or expression of the Nic2 ERF gene can be regulated, i.e., increased or decreased, by at least about 10%, 20%, 30%, or 40%, preferably at least about 50%, 60%, or 70%, and more preferably at least about 80%, 90%, 95%, or 100%, compared to the activity or expression of the Nic2 ERF gene in a plant not modified according to the present invention (e.g., tobacco plant).

[0208] In a preferred embodiment, the Nic2 ERF gene may be substantially inactive or expressionless, meaning that the plant may contain about 1% (preferably less than 0.1%) of activity or expression compared to a plant that has not been modified to inhibit the activity or expression of the Nic2 ERF gene.

[0209] As used herein, "ERF gene" refers to a gene for a transcription factor belonging to the subfamily of ethylene response factors (ERFs).

[0210] As used herein, the “Nic1 ERF gene” refers to the ERF gene identified by the inventors in the examples herein as a mapping to the Nic1 region. The Nic1 ERF genes used herein are listed in Table 1 below, along with their corresponding nucleotide, cDNA, cds, and amino acid sequence identifiers.

[0211] [Table 1]

[0212] Appropriately, the at least one Nic1 ERF gene for use in the present invention is one of those listed in Table 1.

[0213] The genome sequences of each Nic1 ERF and the Nic2 ERFs listed in the table above are identical to their corresponding coding sequences, with the exception of Nic1 ERF ERF17L3. The genome sequence of ERF17L3 (SEQ ID NO: 1) is not identical to the coding sequence of ERF17L3 (SEQ ID NO: 3).

[0214] As used herein, the “Nic2 ERF gene” refers to the ERF gene identified by the inventors in the examples herein as a mapping to the Nic2 region. The Nic2 ERF genes used herein are listed in Table 2 below, along with their corresponding nucleotide, cDNA, cds, and amino acid sequence identifiers.

[0215] [Table 2]

[0216] Appropriately, the Nic2 ERF gene for use in the present invention is one of those listed in Table 2.

[0217] In one embodiment, at least one Nic1 ERF gene as referred to herein may be encoded by a polynucleotide sequence comprising: i) Polynucleotide sequences shown herein as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33; or ii) A functional fragment of the polynucleotide sequence shown in i) which encodes the Nic1 ERF synthesis gene; or iii) In this specification, Sequence ID No. 4, Sequence ID No. 8, Sequence ID No. 12, Sequence ID No. 16, Sequence ID No. A polynucleotide encoding a polypeptide containing an amino acid sequence indicated as number 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36; or iv) Under high stringency conditions, as taught in i), ii), or iii) above Polynucleotide sequences that can hybridize with polynucleotides; or v) Polynucleotides as shown in i), ii), or iii) above, and at least 70 A polynucleotide sequence having identity of % (preferably 80%, preferably 85%, preferably 90%, preferably 95%, more preferably 96%, more preferably 97%, more preferably 98%); or vi) Due to the degeneracy of the genetic code, the polynucleus shown in i), ii), or iii) A polynucleotide sequence different from that of rheotide.

[0218] In one embodiment, at least one Nic2 ERF gene as referred herein may be encoded by a polynucleotide sequence comprising: i) In this specification, Sequence IDs 37, 41, 45, 49, Polynucleotide sequences indicated as sequence number 53, sequence number 57, sequence number 61, sequence number 65, or sequence number 69; or ii) A functional fragment of the polynucleotide sequence shown in i) which encodes the Nic1 ERF gene; or iii) In this specification, Sequence ID No. 40, Sequence ID No. 44, Sequence ID No. 48, Sequence ID No. 52, A polynucleotide encoding a polypeptide containing the amino acid sequence shown as SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72; or iv) Under high stringency conditions, as taught in i), ii), or iii) above Polynucleotide sequences that can hybridize with polynucleotides; or v) Polynucleotides as shown in i), ii), or iii) above, and at least 70 A polynucleotide sequence having identity of % (preferably 80%, preferably 85%, preferably 90%, preferably 95%, more preferably 96%, more preferably 97%, more preferably 98%); or vi) Due to the degeneracy of the genetic code, the polynucleus shown in i), ii), or iii) A polynucleotide sequence different from that of rheotide.

[0219] In one embodiment, at least one Nic1 ERF gene for use according to the present invention may be endogenous to a plant (e.g., tobacco plant).

[0220] In one embodiment, at least one Nic2 ERF gene for use according to the present invention may be endogenous to a plant (e.g., tobacco plant).

[0221] In this specification, references to “endogenous” genes refer not only to the gene in question found in its natural form (i.e., without any human intervention) in plants, but also to the same gene (or substantially homologous nucleic acid / gene) in an isolated form substantially (re)introduced into a plant (transgene) or plant cell. For example, a transgene containing such a transgene may experience a substantial reduction in the expression of the transgene and / or a substantial reduction in the expression of the endogenous gene. Isolated genes may be isolated from organisms or may be artificial, for example, chemosynthesized.

[0222] In another embodiment, at least one Nic1 ERF gene for use according to the present invention may be exogenous for a plant (e.g., tobacco plant).

[0223] In another embodiment, at least one Nic2 ERF gene for use according to the present invention may be exogenous for a plant (e.g., tobacco plant).

[0224] The term "exogenous gene" may mean that a gene transformed into an unmodified plant is of external origin, i.e., from a different species than the transformed plant. Exogenous ERF genes may contain nucleic acid sequences that are substantially identical or different from endogenous ERF genes in the unmodified plant. Exogenous genes may originate from genomic or cDNA sequences corresponding to ERF genes from any species. Exogenous genes may form chimeric genes. Exogenous genes may encode polypeptides containing the amino acid sequences presented in Table 1, or functional variants, fragments, or orthologues thereof. Exogenous genes may contain nucleotide sequences presented in Table 2, or functional variants, fragments, or orthologues thereof.

[0225] The present invention also provides the use of the Nic1 ERF gene for regulating the alkaloid content of plants.

[0226] In one embodiment, the present invention further provides the use of an additional ERF gene, wherein the additional ERF gene is the Nic2 ERF gene listed in Table 2 herein.

[0227] Methods for reducing the expression of a gene or gene product are well-established in the art. The activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene can be modified using any of the methods described herein for regulating the activity or expression of the Nic1 ERF gene.

[0228] In one embodiment, the activity or expression of the Nic1 ERF gene, or the activity or expression of both Nic1 ERF genes, can be inhibited by any method known in the Art. In another embodiment, the activity or expression of the Nic1 ERF gene, or the activity or expression of the Nic2 ERF gene, can be inhibited by any method known in the Art.

[0229] Methods for inhibiting the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, include gene editing, targeted mutagenesis, RNA interference, antisense, or sense co-repression (see Wang and Wagner 2003, Planta Volume 216, Issue 4, pp 686-691, incorporated herein by reference). In one embodiment, inhibition of gene activity or expression can be achieved by the use of gene editing. Gene editing can be performed using any method known in the art. Several non-limiting examples are presented herein.

[0230] In one embodiment, the activity or expression of the Nic1 ERF gene, or Nic1 Inhibition of the activity or expression of both the ERF gene and the Nic2 ERF gene can be achieved using CRISPR-based gene editing methods, including the use of the CRISPR / Cas9 system. CRISPR / Cas9 genome editing tools are commercially available, such as "Guide-it" from Clontech (Avenue du President Kennedy 78100 Saint-Germain-en-Laye, France). It is being done.

[0231] Appropriately, to generate the gene editing vector pRGEB-M24, the rice snoRNA U3 promoter in vector pRGEB31 is assisted by HindIII and BsaI in cloning to produce pSiM24 (Sahoo, DK, Dey, N., and Maiti, IB (2014). pSiM24 is a novel versatile gene expression vector for transient assays as well as stable expression of foreign genes in plants. PLoSOne 9, e98988, as specified herein by reference). It can be replaced with an amplified M24 promoter (which is incorporated). In order to maintain the integrity of the sgRNA sequence and the BsaI recognition site in the vector pRGEB-M24, the M24 promoter is replaced with First, the BsaI recognition site (HindIII_EcoRI_M24F:GATTACGCCAAGCTTTCCCGTATACCCCGGGGAATTCGT (Sequence number 139); BsaI_M24pro_R: gagacctcggtctccAGATGAGAGATTTCGATTCCG (Sequence number 139) It can be amplified with a primer bound to (Sequence No. 140). The diluted PCR product is amplified with a primer bound to the lost sgRNA sequence (HindIII_EcoRI_M24F;gRNA_BsaI_R:ttctagctctaaaacCGAGACCTCGGTCTCCAGATGA (Sequence No. 141)). See the table below. A pair of oligonucleotides can be designed to specifically target each of the candidate genes.

[0232] [Table 3]

[0233] The underlined bases in Table 3 above represent the sense or antisense sequence of the target site.

[0234] The oligo pairs are first annealed to produce double-stranded fragments with 4-nt5' overhangs at both ends, and then ligated to a pRGEB-M24 vector digested with BsaI.

[0235] Another method of gene editing involves using commercially available kits (e.g., Addgene, 1 Kendall Sq. Ste. B7102, Cambridge, MA 02139, USA) to create TALENs (transmission activators-like genes). Effector nuclease (transcription activator-like effector nuclease) technology This includes use. In one embodiment, activation or expression of at least one Nic1 ERF gene, or inhibition of the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene, can be achieved using TALEN.

[0236] In another embodiment, the method may include the use of a zinc finger nuclease, such as the CompoZr® zinc finger nuclease technology available from Sigma-Aldrich. Another embodiment is described in Silva et al. Curr Gene Ther. Feb 2011; 11(1): 11-27 (this method). The indication may include the use of a meganuclease (or further method) as described herein (as incorporated herein by reference).

[0237] In one embodiment, a method for inhibiting the activity or expression of the Nic1 ERF gene or the Nic2 ERF gene may be targeted mutagenesis. Any method of targeted mutagenesis may be used. In one embodiment, this method may involve KeyBase®, available from Keygene GmbH (Agro Business Park 90, 6708 PW Wageningen, Netherlands). This may be oligonucleotide-directed mutagenesis (ODM). In another embodiment, activation or expression of the Nic1 ERF gene, or inhibition of the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, may be achieved by the use of a construct or vector (e.g., plasmid).

[0238] The gene construct of the present invention may be in the form of an expression cassette, which is used to inhibit the activity or expression of the Nic1 ERF gene in a host cell, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, or to inhibit the activity or expression of the Nic1 ERF gene in a host cell, or the Nic1 ERF gene and the Nic2 It may be suitable for increasing the activity or expression of both ERF genes. The gene construct can be introduced into host cells without being incorporated into a vector. For example, a gene construct that may be a nucleic acid molecule can be incorporated into liposomes or viral particles. Alternatively, a purified nucleic acid molecule (e.g., histone-free DNA or naked DNA) can be directly inserted into host cells by appropriate means, such as direct endocytosis. The gene construct can be directly introduced into cells of a host target (e.g., a plant) by transfection, infection, microinjection, cell fusion, protoplast fusion, or ballistic impact. Alternatively, the gene construct of the present invention can be directly introduced into host cells using a particle gun.

[0239] Alternatively, the gene construct may be contained within or encapsulated in a recombinant vector for expression in a suitable host cell. The recombinant vector may be a plasmid, cosmid, or phage. Such recombinant vectors are very useful for transforming host cells having the gene construct of the present invention and for replicating the expression cassette in them. Those skilled in the art will understand that the gene construct of the present invention can be combined with many types of main-chain vectors for expression purposes. The main-chain vectors may be binary vectors, for example, Escherichia coli and Agrobacterium tumefaciene. It may be possible to replicate it in both Agrobacterium tumefaciens. For example, a suitable vector could be a pBIN plasmid such as pBIN19 (Bevan M., 1984, Nucleic Acids Research 12:8711-21).

[0240] Recombinant vectors may contain various other functional elements in addition to sequences that inhibit the activity or expression of at least one Nic1 ERF gene, or the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene. For example, a vector may contain a promoter. In addition, a recombinant vector may be designed to spontaneously replicate in the cytosol of a host cell. In this case, elements that induce or control DNA replication may be necessary in the recombinant vector. Alternatively, a recombinant vector may be designed to integrate into the genome of a host cell. In this case, DNA sequences that are favorable for targeted integration (e.g., by homologous recombination) are assumed.

[0241] Recombinant vectors may include DNA coding for genes that can be used as selectable markers in the cloning process, i.e., enabling the selection of transfected or transformed cells and cells containing vectors incorporating heterologous DNA. The vector may also include DNA involved in regulating the expression of coding sequences or for targeting expressed polypeptides to specific parts of host cells, such as trichomes or glandular trichomes. Thus, the vector may include at least one additional element selected from the group consisting of selectable marker genes (e.g., antibiotic resistance genes), polypeptide termination signals, and protein targeting sequences (e.g., transport peptides).

[0242] In one embodiment, the method or use involves using oligonucleotide interference to activate or express the Nic1 ERF gene, or the Nic1 ERF gene and Nic2 This may include inhibiting the activity or expression of both ERF genes. In one embodiment, the oligonucleotide is RNA-based. In one embodiment, the oligonucleotide is RNA interference (RNAi), e.g., dsRNAi. In one embodiment, this method inhibits the activity or expression of the Nic1 ERF gene, or This may include transforming plant cells (e.g., tobacco plants) with an RNAi molecule, such as dsRNAi, that inhibits the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene.

[0243] In one embodiment, the activity or expression of at least one Nic1 ERF gene is reduced by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, or up to 100%, compared to the activity or expression of the polypeptide in wild-type plants.

[0244] In one embodiment, the activity or expression of at least one Nic2 ERF gene is reduced by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, or up to 100%, compared to the activity or expression of the polypeptide in wild-type plants.

[0245] In one embodiment, the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene is reduced by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, or up to 100%, compared to the activity or expression of polypeptides in wild-type plants.

[0246] The activity or expression of at least one Nic1 ERF gene, or the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene, can be inhibited by any method known in the art. In any of the prior embodiments, the activity or expression of at least one Nic1 ERF gene, or the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene, can be inhibited by any method including the use of a CRISPR-Cas9 system, CRISPR-based gene editing methods, RNA interference (RNAi), antisense or sense co-repression, gene editing, or targeted mutagenesis. In any of the prior embodiments, the activity or expression of at least one Nic1 ERF gene, or the activity or expression of both at least one Nic1 ERF gene and at least one Nic2 The activity or expression of both ERF genes can be inhibited using RNAi methods, for example, with miRNA, siRNA, dsRNA, or shRNA.

[0247] In one embodiment, a construct that modulates the activity or expression of the Nic1 ERF gene, or the activity or expression of at least one Nic1 ERF gene and at least one Nic2 ERF gene, may be included in the vector. The vector may appropriately be a plasmid.

[0248] In one embodiment, the vector for use in the present invention is an Agrobacterium plasmid.

[0249] Therefore, in one embodiment, expression of the Nic1 ERF gene, or Nic1 The present invention provides plants (e.g., tobacco plants) and plant propagation materials (e.g., tobacco plant propagation materials), leaves (e.g., tobacco leaves), cut and harvested leaves, treated leaves (e.g., treated tobacco leaves), or cut and treated leaves (e.g., cut and treated tobacco leaves) in which the activity or expression of both the ERF gene and the Nic2 ERF gene is regulated.

[0250] In another embodiment, cells (e.g., tobacco cells), plants (e.g., tobacco plants) or parts thereof, and / or plant propagation material are used to activate or erode the Nic1 ERF gene. The construct may include a construct that modulates the activity or expression of either the Nic1 ERF gene or both the Nic2 ERF gene. In one embodiment, the construct reduces the activity or expression of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene. In another embodiment, the construct increases the activity or expression of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene.

[0251] In further embodiments, the cells (e.g., tobacco cells), plants (e.g., tobacco plants) or parts thereof, and / or plant propagation materials according to the present invention may include: i) Polynucleotide sequences shown herein as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33; or ii) A functional fragment of the polynucleotide sequence shown in i) which encodes the Nic1 ERF gene; or iii) In this specification, Sequence ID No. 4, Sequence ID No. 8, Sequence ID No. 12, Sequence ID No. 16, Sequence ID No. A polynucleotide encoding a polypeptide containing an amino acid sequence indicated as number 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36; or iv) Under high stringency conditions, as taught in i), ii), or iii) above Polynucleotide sequences that can hybridize with polynucleotides; or v) Polynucleotides as shown in i), ii), or iii) above, and at least 70 A polynucleotide sequence having identity of % (preferably 80%, preferably 85%, preferably 90%, preferably 95%, more preferably 96%, more preferably 97%, more preferably 98%); or vi) Due to the degeneracy of the genetic code, the polynucleus shown in i), ii), or iii) A polynucleotide sequence different from that of rheotide.

[0252] In one embodiment, cells (e.g., tobacco cells) proliferate in cell culture.

[0253] In one embodiment, at least one Nic1 ERF gene (or both at least one Nic1 ERF gene and at least one Nic2 ERF gene) is used to regulate the alkaloid content (e.g., nicotine content) in cells or cell cultures (e.g., tobacco cell cultures).

[0254] In advantageous embodiments, the activation or expression of at least one Nic1 ERF gene, or the inhibition of the activation or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene, may result in a reduction of alkaloid content. Preferably, the activation or expression of at least one Nic1 ERF gene, or the inhibition of the activation or expression of both at least one Nic1 ERF gene and at least one Nic2 ERF gene, may result in a reduction of nicotine content.

[0255] In another embodiment, increasing the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, may result in an increase in alkaloid content. Preferably, increasing the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, may result in an increase in nicotine content.

[0256] In one embodiment, the plant or part thereof is a tobacco plant. In one embodiment, the tobacco plant or part thereof according to the present invention is a burley or hot-air-dried plant modified according to the present invention. In one embodiment, the present invention is modified according to the present invention This relates to modified Burley or hot-air-dried plants. In one embodiment, the tobacco plant according to the present invention (e.g., modified tobacco plant) is an Oriental or Turkish tobacco plant.

[0257] In one embodiment, the tobacco plant or a part thereof is dried. In one embodiment, the tobacco plant or a part thereof is dried, for example, by air drying, hot air drying, thermal drying, or sun drying. In a further embodiment, the tobacco plant or a part thereof is hot air dried. In a further embodiment, the tobacco plant or a part thereof is air dried.

[0258] Hot air drying is well known in the art and refers to the process of drying tobacco using a supply pipe provided by a combustion box or gas fuel system. This process heat-dries the tobacco without exposure to smoke, slowly increasing the temperature during the drying process. This method produces tobacco with high sugar content and medium to high levels of nicotine. Smith's tobacco drying room is an example of a tobacco drying room that uses traditional hot air drying.

[0259] Examples of air-dried tobacco include Burley tobacco, Maryland tobacco, and dark tobacco. A common factor is that the drying process is primarily carried out without artificial sources of heat and moisture. Burley tobacco is light to dark brown in color, high in oil, and low in sugar. Burley tobacco is air-dried in drying sheds. Major countries that cultivate Burley tobacco include Argentina, Brazil, Italy, Malawi, and the United States. Examples of Burley tobacco plants include Clay 402, Clay 403, Clay 502, Ky14, Ky907, Ky910, Ky8959, NC2, NC3, NC4, NC5, NC2000, TN86, TN90, TN97, R610, R630, R711, R712, NCBH129, Bu21×Ky10, HB04P, Ky14×L8, Kt200, Newton 98, Pedigo 561, Pf561, and Va509.

[0260] Maryland tobacco has good burnability, low nicotine content, and a neutral aroma. Major countries where Maryland tobacco is cultivated include the United States and Italy. Dark-colored air-dried tobacco is distinguished from other types primarily by its fermentation process, which gives it a dark brown color and a distinctive aroma. These leaves have a low sugar content but a high nicotine content. Dark-colored air-dried tobacco is mainly used in the production of chewing tobacco and snuff. The main regions where dark-colored air-dried tobacco is cultivated are Tennessee, Kentucky, and Virginia in the United States.

[0261] As used herein, the term “functional fragment” refers to a portion of a polynucleotide that has the ability to function in the same manner as the polynucleotide. For example, if the polynucleotide is an ERF gene, then the functional fragment must have the ability to function as an ERF gene, and for example, the functional fragment retains the activity of the ERF gene. The functional fragment may have a level of activity equal to or greater than that of the full-length polynucleotide.

[0262] In one embodiment, the functional fragment may be a portion of the Nic1 ERF gene discussed herein, comprising at least 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 consecutive nucleotides. In some embodiments, the functional fragment may comprise at least 150 nucleotides of the Nic1 ERF gene discussed herein.

[0263] In one embodiment, the functional fragment of the Nic2 ERF gene may be a portion of the Nic2 ERF gene discussed herein, comprising at least 50, 75, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 consecutive nucleotides. In some embodiments, the functional fragment may comprise at least 150 nucleotides of the Nic2 ERF discussed herein.

[0264] As used herein, the term “functional variant” refers to a variation that may occur in a genomic sequence without significant loss of activity in either the function of a gene or / or a protein. For example, several amino acids present in a polypeptide (or several nucleotides present in a polynucleotide) may be substituted without significant loss of activity. A functional variant may have a level of activity equal to or greater than that of a non-variant polynucleotide and / or polypeptide. A sequence that differs from the ERF gene disclosed herein due to degeneracy of the genetic code is a functional variant. A variant may differ from the desired sequence by as few as 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid.

[0265] As used herein, the term “genetic coding degeneracy” refers to the codon redundancy that codes for a polypeptide sequence, which is represented as a diverse combination of three codons that identify an amino acid. For example, in an mRNA molecule coding for a polypeptide having the amino acid isoleucine, isoleucine may be coded by AUU, AUC, or AUA. This means that a DNA molecule coding RNA can have multiple sequences, but the resulting polypeptide will have the same sequence. In other words, polymorphic nucleotide sequences can code for the same polypeptide product. This means that one nucleic acid sequence may code for the same polypeptide sequence but have very low sequence identity with a second sequence.

[0266] An amino acid sequence of a polypeptide having the specific properties described herein, or a sequence having a certain degree of sequence identity or sequence homology with any nucleotide sequence described herein, may be a functional variant.

[0267] As used herein, the term “ortholog” refers to a gene that originates from a common ancestral gene and is found in different species as a result of specification. Orthologs may share at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence identity at the nucleotide and / or amino acid sequence level. Orthologous genes often share the same or similar functions, i.e., they have conserved functions.

[0268] In some embodiments of the present invention, promoters may be provided. Promoters for use in the present invention may be one or more selected from the group consisting of constitutive promoters, aging-specific promoters, tissue-specific promoters, embryologically controlled promoters, and inductive promoters. In one embodiment, the promoter may be a constitutive promoter.

[0269] Constitutive promoters direct gene expression continuously across different parts of a plant during plant development, but genes may not be expressed at the same level in all cell types. A known example of a constitutive promoter is the cauliflower mosaic virus 35S transcript (Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences required for activity of the cauliflowermosaicvirus 35S promoter, Nature). Examples include those related to the rice actin 1 gene (Zhang W, McElroy D, Wu R. (1991) Analysis of rice Act1 5' region activity in transgenic rice plants (Plant Cell 31155-65)), and the maize ubiquitin 1 gene (Cornejo MJ, Luth D, Blankenship KM, Anderson OD, Blechl AE. (1993). Activity of a maizeubiquitin promoter in transgenic rice. Plant Molec. Biol. 23 567-81), which are incorporated herein by reference. Examples of constitutive promoters include the carnation etched ring virus (CERV) promoter. The DNA sequence of carnation etchd ring virus has been compared to that of cauliflower mosaic virus and retrovirus (Hull R, Sadler J, Longstaff M 1986 EMBO Journal, 5(2):3083-3090, which is incorporated herein by reference).

[0270] The constitutive promoter may be selected from the carnation etched-ring virus (CERV) promoter, the cauliflower mosaic virus (CaMV 35S promoter), the comeactin 1 gene, or the maize ubiquitin 1 gene. Preferably, the promoter may be the CERV promoter.

[0271] Alternatively, in some embodiments, the promoter may not be the cauliflower mosaic virus (CaMV 35S promoter). In one embodiment, the promoter may be a senescence-specific promoter. A “senescence-specific promoter” (SAG) may be a promoter associated with controlling the expression of senescence-related genes. Thus, this promoter can restrict the expression of coding sequences (i.e., genes) that are substantially exclusively ligated in senescent tissue. Therefore, a senescence-specific promoter may be a promoter capable of preferentially promoting gene expression in plant tissue in a developmentally controlled manner, such that the expression of the 3' protein coding region occurs substantially only when the plant tissue is undergoing senescence. It is understood that senescence tends to occur in older parts of the plant, such as older leaves, and not in younger parts of the plant, such as seeds.

[0272] One example of a plant known to express numerous aging-related genes is Arabidopsis thaliana. Therefore, this promoter is related to aging-related genes in Arabidopsis thaliana. It can be isolated from the gene. Gepstein et al. (The Plant Journal, 2003, 36, 629-642), incorporated herein by reference, used SAG and Arabidopsis thaliana as a model. Detailed studies of these promoters were conducted. The gene construct may include promoters derived from any of the SAGs disclosed in this paper. For example, suitable promoters may be selected from the group consisting of SAG12, SAG13, SAG101, SAG21, and SAG18, as well as their functional variants or functional fragments.

[0273] In one embodiment, the promoter may be a SAG12 or SAG13 promoter. In one embodiment, the promoter may be a SAG12 promoter known to those skilled in the art, or a functional variant or functional fragment thereof (Gan & Amasino, 1997, Plant Physiology, 113: 313-319, incorporated herein by reference). Appropriate promoters and their sequences can be found in International Publication No. 2010 / 097623 (incorporated herein by reference).

[0274] In another embodiment, the promoter may be a tissue-specific promoter. A tissue-specific promoter is typically a promoter that directs gene expression in one (or a small) part of a plant over the entire lifespan of that part of the plant. The category of tissue-specific promoters generally also includes promoters whose specificity is not absolute, i.e., they may also direct expression at a lower level in tissues other than the preferred tissue. Several tissue-specific promoters are known in the art, including potato clumps. Examples of promoters include those related to the patatin gene expressed in the stem, and the high molecular weight glutenin gene expressed in the endosperm of wheat, barley, or maize. Any of these promoters may be used in the present invention.

[0275] Appropriately, a tissue-specific promoter can be a leaf-specific promoter. Appropriately, an example of a leaf-specific promoter is asymmetric leaf 1 (AS1). It is possible.

[0276] In a particularly preferred embodiment, the tissue-specific promoter is a root-specific promoter.

[0277] In another embodiment, the promoter may be an embryologically controlled promoter. An embryologically controlled promoter directs changes in gene expression in one or more parts of a plant at specific times during plant development. The gene may be expressed at different (usually lower) levels in other parts of the plant at other times, and may also be expressed in other parts of the plant.

[0278] In one embodiment, the promoter may be an inducible promoter. An inducible promoter has the ability to direct gene expression in response to an inducer. In the absence of the inducer, the gene is not expressed. The inducer may act directly on the promoter sequence or by counteracting the effect of a repressor molecule. This inducer may be a chemical substance such as a metabolite, protein, growth regulator, or toxic element, a physiological stress such as heat, injury, or osmotic pressure, or an indirect result of the action of a pathogen or pest. Developmentally controlled promoters may be described as endogenous inducers produced by the plant, or as specific types of inducible promoters that respond to environmental stimuli at specific points in the plant's life cycle. Examples of known inducible promoters include the wound-responsive promoter described by reference in Warner SA, Scott R, Draper J. (1993) (Isolation of an asparagus intracellular PR gene (AoPR1) wound-responsive promoter by the inverse polymerase chain reaction and its characterization in transgenic tobacco. Plant J. 3 191-201), the temperature-responsive promoter disclosed by reference in Benfey & Chua (1989) (Benfey, PN, and Chua, NH. (1989) Regulated genes in transgenic plants. Science 244174-181), and the present specification by reference. Examples of promoters related to chemical induction, such as those described in Gatz (1995) (Gatz, C. (1995) Novel inducible / repressible gene expression systems. Methods in CellBiol. 50411-424), are incorporated into the book.

[0279] Thus, in one embodiment, the promoter may be selected from the group consisting of the CERV promoter, the (complete or truncated) cauliflower mosaic virus 35S promoter, the Rubisco promoter, the pea plastocyanin promoter, the nopalin synthase promoter, the chlorophyll r / b binding promoter, the high molecular weight glutenin promoter, the α,β-gliadin promoter, the hordein promoter, and the patatin promoter.

[0280] In one embodiment, the promoter may be a CaMV 35S promoter, or a modified 35S promoter having overlapping or dual enhancer regions (R. Kay et al. Science. 1987 Jun 5;236(4806):1299-302, incorporated herein by reference).

[0281] In one embodiment, the promoter may be a native promoter.

[0282] As used herein, “native promoter” refers to a promoter that is endogenous to a gene, that is, substantially operably linked to a gene.

[0283] Recombinant vectors may include DNA coding for genes that can be used as selectable markers in the cloning process, i.e., enabling the selection of transfected or transformed cells and cells containing vectors incorporating heterologous DNA. Vectors may also include DNA involved in regulating the expression of coding sequences or for expressing polypeptides to target a part of a host cell, such as chloroplasts. Thus, vectors may include at least one additional element selected from the group consisting of selectable marker genes (e.g., antibiotic resistance genes), polypeptide termination signals, and protein targeting sequences (e.g., chloroplast transport peptides).

[0284] Examples of suitable marker genes include antibiotic resistance genes such as those constituting resistance to kanamycin, genetisin (G418), and hygromycin (npt-II, hyg-B); herbicide resistance genes such as those constituting resistance to phosphinotricin and sulfonamide herbicides (bar and suI, respectively; European Patent Publication No. 242246 and European Patent Publication No. 0249637), which are incorporated herein by reference; and screening markers such as beta-glucuronidase (UK Patent No. 2197653), luciferase, and green fluorescent protein (GFP), which are incorporated herein by reference. The marker gene may be controlled by a second promoter that enables expression in cells where it may or may not be present in the seed, thereby allowing selection of cells or tissues containing the marker at any stage of plant development. Suitable second promoters are those derived from the nopalin synthase gene of Agrobacterium and the gene encoding the 35S cauliflower mosaic virus (CaMV) transcript. However, any other suitable second promoter may be used.

[0285] Commercially desirable traits In one embodiment, the plant of the present invention has a reduced total alkaloid content and / or a reduced content of one or more alkaloids selected from nicotine, nornicotine, anabasine, myosmin, and anatabine, and / or a reduced nicotine content, while at least flavor characteristics and / or other commercially desirable traits are maintained. In one embodiment, the plant of the present invention produces leaves of the same grade and / or quality as plants not modified according to the present invention.

[0286] In one embodiment, the plant of the present invention has a reduced nicotine content with no significant change in the plant's flavor characteristics (compared to, for example, the same plant not modified according to the present invention).

[0287] In one embodiment, the plant of the present invention has a reduced nicotine content and no significant changes (e.g., reductions) in other commercially desirable traits of the plant (compared to the same plant not modified according to the present invention). In particular, the yield of the modified plant is preferably not reduced compared to the same plant not modified according to the present invention.

[0288] Accordingly, in one embodiment, the method and use of the present invention relate to reducing the total alkaloid content and / or reducing one or more alkaloids selected from nicotine, nornicotine, anabasine, and anatabine, and / or reducing nicotine, and further relating to maintaining flavor characteristics and / or other commercially desirable traits (e.g., yield).

[0289] The term "commercially desirable traits" includes traits such as yield, height of mature plants, number of harvestable leaves, mean node length, cutter leaf length, cutter leaf width, quality, abiotic (e.g., drought) stress tolerance, herbicide tolerance, and / or biological (e.g., insect, bacterial, or fungal) stress tolerance.

[0290] The term “commercially desirable traits” as taught herein includes traits such as drought tolerance, pest tolerance, mature plant height, number of harvestable leaves, mean node length, cutter leaf length, cutter leaf width, and yield, which are equivalent to the traits in hot-air-dried parents of comparable plants when grown under similar field conditions.

[0291] Unless otherwise specified, as used herein, tobacco yield refers to the yield of dried tobacco leaves calculated based on the weight of dried tobacco leaves per acre under standard field conditions after standard agrochemical and drying practices.

[0292] In one embodiment, the plant of the present invention (e.g., tobacco plant), when grown under similar field conditions, yields of equivalent plants of 50% to 150%, 55% to 145%, 60% to 140%, 65% to 135%, 70% to 130%, 75% to 125%, 80% to 120%, 85% to 115%, 90% to 110%, 95% to 105%, 50% to 100%, 55% to 100%, 60% to 100%, 65% to The yield is between 100%, 70%-100%, 75%-100%, 80%-100%, 85%-100%, 90%-100%, 95%-100%, 100%-150%, 105%-150%, 110%-150%, 115%-150%, 120%-150%, 125%-150%, 130%-150%, 135%-150%, 140%-150%, or 145%-150%.

[0293] In another embodiment, the yield of the plant of the present invention (for example, tobacco) is approximately 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 times that of a comparable plant when grown under similar field conditions.

[0294] In another embodiment, the yield of the tobacco plant of the present invention is equivalent to the yield of equivalent plants that have been subjected to hot-air drying treatment, when grown under similar field conditions.

[0295] In one embodiment, the tobacco plant of the present invention provides a yield selected from the group consisting of approximately 1,200 to 3,500 pounds / acre, 1,300 to 3,400 pounds / acre, 1,400 to 3,300 pounds / acre, 1,500 to 3,200 pounds / acre, 1,600 to 3,100 pounds / acre, 1,700 to 3,000 pounds / acre, 1,800 to 2,900 pounds / acre, 1,900 to 2,800 pounds / acre, 2,000 to 2,700 pounds / acre, 2,100 to 2,600 pounds / acre, 2,200 to 2,500 pounds / acre, and 2,300 to 2,400 pounds / acre.

[0296] In another aspect, the tobacco plant of the present invention is suitable for growing in areas of approximately 1200-3500 pounds / acre, 1300-3500 pounds / acre, 1400-3500 pounds / acre, 1500-3500 pounds / acre, 1600-3500 pounds / acre, 1700-3500 pounds / acre, 1800-3500 pounds / acre, 1900-3500 pounds / acre, 2000-3500 pounds / acre, 2100-3500 pounds / acre, and 2200-3500 pounds / acre. The yield is selected from a group consisting of between 2,300 and 3,500 pounds / acre, between 2,400 and 3,500 pounds / acre, between 2,500 and 3,500 pounds / acre, between 2,600 and 3,500 pounds / acre, between 2,700 and 3,500 pounds / acre, between 2,800 and 3,500 pounds / acre, between 2,900 and 3,500 pounds / acre, between 3,000 and 3,500 pounds / acre, and between 3,100 and 3,500 pounds / acre.

[0297] In a further embodiment, the tobacco plant of the present invention yields yields between approximately 1,200 and 3,500 pounds / acre, between 1,200 and 3,400 pounds / acre, between 1,200 and 3,300 pounds / acre, between 1,200 and 3,200 pounds / acre, between 1,200 and 3,100 pounds / acre, between 1,200 and 3,000 pounds / acre, between 1,200 and 2,900 pounds / acre, between 1,200 and 2,800 pounds / acre, between 1,200 and 2,700 pounds / acre, between 1,200 and 2,600 pounds / acre, and between 1,200 and 2,500 pounds / acre. The system provides yields selected from a group consisting of 1200-2400 pounds / acre, 1200-2300 pounds / acre, 1200-2200 pounds / acre, 1200-2100 pounds / acre, 1200-2000 pounds / acre, 1200-1900 pounds / acre, 1200-1800 pounds / acre, 1200-1700 pounds / acre, 1200-1600 pounds / acre, 1200-1500 pounds / acre, and 1200-1400 pounds / acre.

[0298] plant Suitable plants according to the present invention include, for example, plants of the Solanaceae family, such as Datura stramonium, Eggplant, Mandrake, Lethal Black Nightshade (Belladonna), Capsicum (Paprika, Chili Pepper), Potato, and Tobacco.

[0299] In one embodiment, a suitable genus of the Solanaceae family is the Solanum genus, for example, the tomato.

[0300] In one embodiment, a suitable genus of the Solanaceae family is the genus Nicotiana, for example, Nicotiana tabacum or Nicotiana rustica.

[0301] A suitable species of the genus Nicotiana may be Nicotiana tabacum. Species of the genus Nicotiana may be referred to herein as tobacco plants or simply tobacco.

[0302] Tobacco plant The present invention provides methods and uses for plants (e.g., tobacco plants), as well as for cells (e.g., tobacco cells), plants (e.g., tobacco plants), and plant propagation materials.

[0303] As used herein, the term “tobacco” refers to plants of the genus Nicotiana used in the manufacture of tobacco products. Non-limiting examples of suitable “tobacco” plants include N. tabacum and N. rustica (e.g., N. tabacum L.) Examples include LA B21, LN KY171, TL 1406, Basma, Galpao, Perique, Beinhart 1000-1, and Petico.

[0304] In one embodiment, the suitable tobacco plant may be the germplasm, lineage, or variety of any N. tabacum.

[0305] In another embodiment, the suitable tobacco plant may be a non-Tabacum species.

[0306] The tobacco material may be derived from or obtainable from Nicotiana tabacum type varieties, generally known as Burley, flue, or light-colored varieties, and dark-colored varieties. In some embodiments, the tobacco material is derived from Burley, Virginia, or dark-colored tobacco plants. The tobacco plants may be selected from Burley tobacco, rare tobacco, specialty tobacco, expanded tobacco, etc.

[0307] The use of tobacco cultivars and superior tobacco cultivars is also considered herein. Therefore, the tobacco plants for use herein may be tobacco cultivars or superior tobacco cultivars. Particularly useful Nicotiana tabacum cultivars include hot-air dried Virginia, Burley, and Oriental types.

[0308] In some embodiments, the tobacco plant may be selected from, for example, one or more of the following varieties: L. Cultivar TI1068, AA37-1, B13P, Xanthi (Mitchell-Mor), KT D#3 Hybrid 107, Bel-W3, 79-615, Samsun Holmes NN, BU21×H F4 offspring from Hoja Parado hybrid, lineage 97, KTRDC#2 hybrid. 49, KTRDC#4 Hybrid 1 10, Burley 21, PM016, KTRDC#5 KY 160 SI, KTRDC#7 FCA, KTRDC#6 TN86 SI, PM021, K149, K326, K346, K358, K394, K399, K730, KY10, KY14, KY160, KY17, KY8959, KY9, KY907, MD609, McNair 373, NC2000, PG01, PG04, P01, P02, P03, RG11, RG17, RG8, Speight G-28, TN86, T N90, VA509, AS44, Banket A1, Basma Drama B84 / 31, Basma I Zichna ZP4 / B, Basma Xanthi BX2A, Batek, Besuki Jember, C104, Coker 319, Coker 347, Criollo Misionero, PM092, Delcrest, Djebel 81, DV H 405, Galpao Comum, HB04P, Hicks Broadleaf, Kabakulak Elassona, PM102, Kutsage E1, KY14×L8, KY171, LA BU21, Macnair -944, NC2326, NC71, NC297, NC3, PVH03, PVH09, PVH19, PVH2110, Red Russian, Samsung Saplak, Simmaba, Talgar 28, PM132 Wislica, Yayaldag, NC4, TR Madole Prilep HC-72, Prilep P23, Prilep PB156 / 1, Prilep P12-2 / 1, Yaka JK-48, Yaka JB125 / 3, TI-1068, KDH-960, TI-1070, TW136, PM204, PM205, Basma, TKF4028, L8, TKF2002, TN90, GR141, Basma Xanthi, GR149, GR153, and Petit Havana.

[0309] Non-limiting examples of varieties or cultivars are as follows: BD64, CC101, CC200, CC27, CC301, CC400, CC500, CC600, CC700, CC800, CC900, Coker 176, Coker 319, Coker 371 Gold, Coker 48, CD263, DF911, DT538 LC, Garpao Tobacco, GL26H, GL350, GL600, GL737, GL939, GL973, HB04P, HB04P LC, HB3307PLC, Hybrid 403LC, Hybrid 404LC, Hybrid 501 LC, K149, K326, K346, K358, K394, K399, K730, KDH959, KT200, KT204LC, KY10, KY14, KY160, KY17, KY171, KY907, KY907LC, KTY14×L8LC, Little Crittenden (Little Crittenden), McNair 373, McNair 944, ms KY14×L8, Narrow Leaf Madole, Narrow Leaf Madole LC, NBH98, N-126, N-777LC, N-7371 LC, NC100, NC102, NC2000, NC291, NC297, NC299, NC3, NC4, NC5, NC6, NC7, NC606, NC71, NC72, NC810, NC BH129, NC2002, Neal Smith Madole, Oxford Ford 207, PD7302 LC, PD7309 LC, PD7312 LC "Periq'e Tobacco", PVH03, PVH09, PVH19, PVH5 0, PVH51, R610, R630, R7-11, R7-12, RG17, RG81, RGH51, RGH4, RGH51, RS1410, Speight 168, Speight 172, Speight 179, Speight 210, Speight 220, Speight 225, Speight 227, Speight 234, Speight G-28, Speight G-70, Speight H-6, Speight H20, Speight NF3, Tl 1406, Tl 1269, TN86, TN86LC, TN90, TN97, TN97LC, TN D94, TN D950, TR (Tom Rosson (Tom Rosson)) Madore, VA309, VA359, AA37-1, B13P, Xanthi (Mitchell-Moe), Bel-W3, 79-615, Samsung Holmes NN, KTRDC No. 2 Hybrid 49, Burley 21, KY8959, KY9, MD609, PG01, PG04, P01, P02, P03, RG1 1, RG8, VA509, AS44, Banquet A1, Basma Drama B84 / 31, Basma I Zikuna ZP4 / B, Basma Xanthi BX 2A, Batek, Beski Jember, C104, Corker 347, Criollo Mishionero, Delcrest, Jebel 81, DVH405, Galpao Komam, HB04P, Hicks Broadleaf, Kabakrak Elasona, Kutsage E1, LA BU21, NC2326, NC297, PVH21 10, Red Russian, Samsung, Saprack, Sinmaba, Talgar 28, Wislica, Yayaldag, Prerep HC-72, Prerep P23, Prerep PB156 / 1, Prerep P12-2 / 1, Yaka JK-48, Yaka JB125 / 3, TI-1068, KDH-960, Tl-1070, TW136, Basma, TKF4028, L8, TKF2002, GR141, Basma Xanthi, GR149, GR153, Petit Havana. The above low-transition subvarieties should also be considered, even if not specifically identified herein.

[0310] The tobacco plant can be Burley, hot-air dried Virginia, or Oriental.

[0311] In one embodiment, the plant propagation material can be obtained from the plant of the present invention (e.g., tobacco). As used herein, “plant propagation material” refers to any plant body taken from a plant from which further plants can be produced. Suitablely, the plant propagation material may be seeds. Suitablely, the plant propagation material may be pollen.

[0312] In one embodiment, the cells (e.g., tobacco cells), plants (e.g., tobacco plants), and / or plant propagation materials of the present invention may include regulated activity or expression of the Nic1 ERF gene, or both the Nic1 ERF gene and the Nic2 ERF gene. In another embodiment, the cells (e.g., tobacco cells), plants (e.g., tobacco plants), and / or plant propagation materials may include a construct or vector according to the present invention. In another embodiment, the cells (e.g., tobacco cells), plants (e.g., tobacco plants), and / or plant propagation materials may be obtained by a method according to the present invention.

[0313] Appropriately, a plant (e.g., tobacco) or a part thereof according to the present invention may have regulated activity or expression of the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene) compared to a plant (e.g., tobacco) or a part thereof that has not been modified to regulate the activity or expression of the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene).

[0314] In one embodiment, the plant according to the present invention (e.g., tobacco plant) or a part thereof comprises the cells of the present invention (e.g., tobacco cells). In another embodiment, the plant propagation material can be obtained from the plant according to the present invention (e.g., tobacco plant).

[0315] In one embodiment, the use of cells (e.g., tobacco cells) provided for the aforementioned embodiment for the manufacture of a product (e.g., tobacco product) is provided. In addition, the use of plants (e.g., tobacco plants) described herein for breeding plants (e.g., tobacco plants) is provided.

[0316] In another embodiment, the present invention also provides the use of the plant (e.g., tobacco plant) of the above embodiment for the manufacture of a product (e.g., tobacco product). In another embodiment, the present invention provides the use of the plant (e.g., tobacco plant) for growing crops. In one embodiment, the use of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene according to the present invention results in the regulation of the alkaloid content of the plant (e.g., tobacco plant).

[0317] In one embodiment, the method or use of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene according to the present invention may result in a modification of alkaloid content. In another embodiment, the use of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene (e.g., a reduction in their activity or expression) may result in a reduction in the content of one or more alkaloids. Preferably, the content of one or more anatabin, anabasine, myosmin, nornicotine, or nicotine may be reduced. Preferably, the nicotine content is reduced. Preferably, this may be observed when the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, is reduced compared to wild-type plants.

[0318] In another embodiment, the use of the Nic1 ERF gene, or both the Nic1 ERF gene and the Nic2 ERF gene (e.g., increased activity or expression thereof), may result in an increase in the content of one or more alkaloids. Suitablely, the content of one or more anatabine, anabasine, nornicotine, or nicotine may increase. Suitablely, the nicotine content may be reduced. Suitablely, this may be observed when the activity or expression of the Nic1 ERF gene is increased compared to wild-type plants.

[0319] In one embodiment, a plant (e.g., tobacco plant) or a part thereof, e.g., leaves, or harvested leaves or harvested processed leaves, or a product containing the plant (e.g., tobacco product), appropriately comprises the modified (e.g., mutated or deleted) Nic1 ERF gene of the present invention (or the modified (e.g., mutated or deleted) Nic1 ERF gene in combination with the modified (e.g., mutated or deleted) Nic2 ERF gene according to the present invention).

[0320] In one embodiment, the present invention provides tobacco cell cultures (e.g., in vitro cultures). Tobacco cell cultures may be tobacco cell suspension cultures. These in vitro cultured tobacco cells can be incorporated into tobacco products, for example, as a substitute for conventional tobacco particles, shredded tobacco, or shredded or cut tobacco leaves, as an additive component, or as both a substitute and an additive.

[0321] In one embodiment, the present invention provides the use of tobacco cell cultures, such as collected and / or processed tobacco cell cultures, or extracts thereof, for the manufacture of tobacco products.

[0322] Tobacco cells extracted from in vitro cultures can be dried, for example, freeze-dried, to produce a powder.

[0323] Those skilled in the art are aware of known methods for establishing in vitro cultures of tobacco cells. For example, only the following methods may be used: collecting seeds from a desired tobacco plant and sterilizing their exterior to remove unwanted organisms; sowing the seeds to grow the desired tobacco plant; removing tissue from the tobacco plant (e.g., from tobacco stems) for use as an explant; establishing a callus culture from the tobacco explant; establishing a cell suspension culture from the callus culture; and taking culture material (e.g., including tobacco cells) to produce a tobacco cell culture.

[0324] Tobacco cells can be collected by various methods, including filtration, such as vacuum filtration. The sample may also be washed in the filter by adding water, and the remaining liquid is removed by filtration, such as vacuum filtration.

[0325] The collected tobacco cell cultures can be further dried by processing, such as air drying and / or freeze-drying. The collected tobacco cell cultures, or the dried collected tobacco cell cultures, or extracts thereof, can be incorporated into tobacco products according to the present invention.

[0326] In one embodiment, the present invention provides a tobacco plant or a portion thereof for use in molecular agriculture. Preferably, a plant or a portion thereof modified according to the present invention may be used in the production of therapeutic agents, such as antibiotics, virus-like particles, nutritional supplements, or proteins such as low molecular weight substances.

[0327] In one embodiment, the present invention provides a method for producing a protein (e.g., a therapeutic protein), comprising modifying a plant or a portion thereof capable of producing the protein (e.g., a therapeutic protein) by regulating the activity or expression of at least one Nic1 ERF gene, wherein at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, or SEQ ID NO: 36, or a functional variant, functional fragment, or orthologue thereof, or the ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 17, SEQ ID NO: 21, SEQ ID NO: 25, SEQ ID NO: 29, or SEQ ID NO: 33, or a functional variant, functional fragment, or orthologue thereof, and culturing the plant under conditions sufficient to enable the production of the protein (e.g., a therapeutic protein).

[0328] product The present invention also provides a tobacco product that can be obtained from or obtained from tobacco according to the present invention. The invention provides a tobacco product that can be obtained from or obtained from tobacco plants, in which the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, is regulated and contains a regulated alkaloid content.

[0329] As used herein, the term “Tobacco Industrial Products” means combustible smoking articles such as cigarettes, cigarillos, cigars, pipes or hand-rolled tobacco (based on any of tobacco, tobacco derivatives, expanded tobacco, recombined tobacco, tobacco substitutes or other smokeable materials); e-cigarettes, tobacco heating products, and combinations of base materials. Non-flammable aerosol dispensing systems such as hybrid systems for generating azoles, for example, hybrid systems containing liquid, gel, or solid substrates and aerosolizable substrate materials used in aerosol dispensing systems, and heating products that release compounds from non-combustible substrate materials; and intended to include non-aerosol delivery articles such as medicinal candies, gums, and patches, articles containing breathable powders, and smokeless tobacco products such as snus and snuff, the non-aerosol delivery articles may or may not deliver nicotine.

[0330] Appropriately, tobacco industrial products may be prepared from (for example, include) the tobacco plant or a part thereof according to the present invention.

[0331] Suitablely, tobacco industrial products can be prepared from tobacco cell cultures according to the present invention.

[0332] Appropriately, tobacco industrial products may be prepared from (for example, include) tobacco plants propagated from tobacco plant propagation material according to the present invention or from a portion thereof.

[0333] Suitablely, tobacco industrial products may be prepared (for example, include) harvested leaves of the tobacco plant according to the present invention.

[0334] Suitablely, tobacco industrial products may be prepared from (for example, include) processed tobacco leaves according to the present invention.

[0335] Suitablely, tobacco industrial products may be prepared from (for example, include) dried tobacco material according to the present invention.

[0336] Suitablely, tobacco industrial products may be prepared from (for example, include) tobacco blends according to the present invention.

[0337] In one embodiment, the tobacco product is a flammable smoking article selected from the group consisting of cigarettes, cigarillos, and cigar tobacco.

[0338] In one embodiment, the tobacco industrial product includes one or more components of a combustible smoking article, such as a filter, filter rod, filter rod segment, tobacco, tobacco rod, tobacco rod segment, additional release components such as a stopper, capsule, thread, beads, plug wrap, tip paper, or tobacco paper.

[0339] In one embodiment, the tobacco industry product is a non-flammable aerosol dispensing system.

[0340] In one embodiment, the tobacco industry product includes one or more components of a non-flammable aerosol supply system, such as a heater and an aerosolizable substrate.

[0341] In one embodiment, the aerosol dispensing system is an e-cigarette, also known as a tobacco inhalation device.

[0342] In one embodiment, the electronic cigarette includes a heater, a power supply capable of supplying powder to the heater, an aerosolizable substrate such as a liquid or gel, a housing, and may include a mouthpiece.

[0343] In one embodiment, the aerosolizable substrate is contained in a substrate container. In one embodiment, the substrate container is combined with or includes a heater.

[0344] In one embodiment, the tobacco industrial product is a heated product that releases one or more compounds by heating a base material, not by combustion. The base material is an aerosolizable material that may or may not contain tobacco or nicotine. In one embodiment, the heated product is a tobacco heated product.

[0345] In one embodiment, the heating product is an electronic device.

[0346] In one embodiment, the tobacco heating product includes a heater, a power supply capable of supplying powder to the heater, and an aerosolizable substrate such as a solid or gel material.

[0347] In one embodiment, the heating product is a non-electronic article.

[0348] In one embodiment, the heated product includes an aerosolizable substrate such as a solid or gel material, and a heat source capable of supplying thermal energy to the aerosolizable substrate by burning a combustible material such as charcoal, without any electronic means.

[0349] In one embodiment, the heating product also includes a filter capable of filtering out the aerosol generated by heating an aerosolizable substrate.

[0350] In some embodiments, the aerosolizable base material may include vapor or an aerosol generator, or a humectant such as glycerol, propylene glycol, triacetin, or diethylene glycol.

[0351] In one embodiment, the tobacco industrial product is a hybrid system that generates an aerosol not by combustion, but by heating a combination of base materials. The base materials may include, for example, solids, liquids, or gels, which may or may not contain nicotine. In one embodiment, the hybrid system includes a liquid or gel base and a solid base. The solid base may be, for example, tobacco, or other non-tobacco products which may or may not contain nicotine. In one embodiment, the hybrid system includes a liquid or gel base and tobacco.

[0352] In another embodiment, the product may comprise the construct of the present invention in which the activity or expression of the Nic1 ERF gene is regulated and the alkaloid content is reduced.

[0353] In another embodiment, the product may comprise one or more constructs of the present invention in which both the activity or expression of the Nic1 ERF gene and the activity or expression of the Nic2 ERF gene are regulated, and the product has a regulated alkaloid content.

[0354] In one embodiment, the use of the present invention (e.g., tobacco plant) for producing leaves (e.g., tobacco leaves) is provided. The leaves (e.g., tobacco leaves) may be subjected to further downstream applications such as processing. Thus, in one embodiment, the use of the above embodiment may provide processed leaves (e.g., processed tobacco leaves). The tobacco leaves may be subjected to drying, fermentation, sterilization, or a combination thereof.

[0355] In another embodiment, the leaves (e.g., tobacco leaves) may be cut. In some embodiments, the leaves (e.g., tobacco leaves) may be cut before or after drying, fermentation, sterilization, or a combination thereof.

[0356] In one embodiment, the present invention provides harvested leaves of the plant of the present invention (e.g., tobacco plant). In one embodiment, the harvested leaves can be obtained from a plant (e.g., tobacco plant) having regulated Nic1 ERF gene activity or expression, or regulated Nic1 ERF and Nic2 ERF gene activity or expression. Preferably, the harvested leaves have a regulated alkaloid content. In a further embodiment, the harvested leaves may be obtained (e.g., obtained) from a plant (e.g., tobacco plant) propagated from the propagating material of the present invention. In another embodiment, harvested leaves can be obtained from a method or use of the present invention. Preferably, the harvested leaves may be cut and harvested leaves. In some embodiments, the harvested leaves may contain viable cells (e.g., viable tobacco cells). In some embodiments, the harvested leaves may not contain viable cells (e.g., viable tobacco cells). In other embodiments, the harvested leaves may be subjected to further processing.

[0357] Some tobacco plants can be harvested by cutting the stem and harvesting all the leaves at the same time (for example, Burley tobacco). Other tobacco plants (for example, hot-air dried tobacco) can be harvested at a stage of the process such as priming, where individual leaves are removed from the stem as they mature.

[0358] As used herein, "priming" refers to the removal of leaves from tobacco plants. This may also refer to the removal of mature or ripe leaves from plants that have undergone hot-air drying.

[0359] Treated leaves (e.g., treated tobacco leaves) are also provided. Treated leaves (e.g., treated tobacco leaves) can be obtained from the plant of the present invention (e.g., tobacco plant). Preferably, treated leaves can be obtained from a plant obtained according to either the method and / or use of the present invention. In one embodiment, treated leaves (e.g., treated tobacco leaves) can preferably be obtained from a plant (e.g., tobacco plant) in which the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, is regulated and the alkaloid content is regulated, compared to a control leaf, i.e., compared to a leaf from a plant not modified by the present invention (e.g., tobacco plant). Treated leaves (e.g., treated tobacco leaves) may include regulation of the activity or expression of the Nic1 ERF gene, or the activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene, and a regulated alkaloid content.

[0360] In another embodiment, treated leaves (e.g., treated tobacco leaves) can be obtained from plants (e.g., tobacco plants) propagated from plant (e.g., tobacco plants) propagating material according to the present invention. Treated leaves (e.g., treated tobacco leaves) of the present invention can be obtained by treating harvested leaves according to the present invention.

[0361] As used herein, the term “treated leaf” refers to a leaf that has undergone one or more treatment steps that are used in the art. A “treated leaf” does not contain or substantially contains living cells.

[0362] As used herein, the term “treated tobacco leaves” refers to tobacco leaves that have undergone one or more processing steps that tobacco is subjected to in the art. “Treated tobacco leaves” do not contain or substantially contain living cells.

[0363] The term "surviving cell" refers to a cell that is capable of proliferating and / or is metabolically active. Thus, when a cell is said to be unable to survive, it is also called "non-surviving," and therefore, the cell does not exhibit the characteristics of a living cell.

[0364] The term "substantially no viable cells" means that less than approximately 5% of the total cells are surviving. Preferably, less than approximately 3% of the total cells are surviving, more preferably less than approximately 1%, and even more preferably less than approximately 0.1%.

[0365] In one embodiment, the treated tobacco leaves may be treated by one or more of the following: drying, fermentation, and / or sterilization. Preferably, the treated tobacco leaves may be treated by drying. Tobacco leaves may be dried by any method known in the art. In one embodiment, tobacco leaves may be dried by one or more drying methods selected from the group consisting of air drying, thermal drying, hot air drying, and sun drying. Preferably, tobacco leaves may be air dried. Preferably, tobacco leaves may be hot air dried.

[0366] Typically, air drying is achieved by hanging the tobacco leaves in a well-ventilated room to dry. This usually takes place over a period of 4 to 8 weeks. Air drying is particularly suitable for Burley tobacco.

[0367] Ideally, tobacco leaves can be heat-dried. Heat drying is typically achieved by hanging the tobacco leaves in a large room where a hardwood fire is maintained continuously or intermittently at a low smoldering temperature, and this process usually takes between 3 days and 10 weeks, depending on the process and the type of tobacco.

[0368] In another embodiment, tobacco leaves may be subjected to hot-air drying. Hot-air drying may involve arranging the tobacco leaves in a single row on tobacco sticks and suspending them from a stack of poles in a drying chamber. The chamber typically has an air supply pipe leading from an externally supplied firebox. Typically, this results in tobacco that has been heat-dried without exposure to smoke. The temperature usually rises slowly during the drying process, with the entire process taking approximately one week.

[0369] Ideally, tobacco leaves can be sun-dried. This method typically involves exposing uncovered tobacco to sunlight.

[0370] Properly processed tobacco leaves can be processed by fermentation. Fermentation can be carried out by any method known in the art. Typically, during fermentation, the tobacco leaves are stacked in a dry-processed tobacco stack (bulk) covered, for example, with burlap to retain moisture. The combination of the remaining moisture inside the leaves and the weight of the tobacco generates natural heat that ripens the tobacco. The temperature of the center of the bulk is monitored daily. In some methods, the entire bulk is opened weekly. The leaves are then removed, vibrated, moistened, and the bulk is rotated so that the inner leaves are on the outside and the bottom leaves are on top of the bulk. This ensures uniform fermentation throughout the bulk. Moisture is added to the leaves, and the heat generated by the leaves themselves rotating releases natural ammonia from the tobacco, reduces nicotine, and at the same time darkens the color and improves the tobacco's aroma. Typically, the fermentation process continues for up to six months, depending on the tobacco variety, the position of the leaf stems, the thickness of the leaves, and the intended use.

[0371] Appropriately, processed tobacco leaves may be treated by sterilization. Sterilization may be particularly preferred when the tobacco leaves are used to make smokeless tobacco products, most preferably snus. Sterilization of tobacco leaves may be carried out by any method known in the art. For example, sterilization is described in J Foulds, L Ramstrom, M Burke, K Fagerstrom. Effect of smokeless tobacco (snus) on smoking and public health in Sweden. Tobacco Con This can be done as detailed in trol (2003) 12: 349-359, and this instruction is provided in reference to This is incorporated herein by reference.

[0372] During the production of snus, sterilization is typically carried out by a process in which the tobacco is heated in vapor for 24 to 36 hours (reaching a temperature of approximately 100°C). This results in a nearly sterile product, and although we do not wish to be bound by theory, it is thought that this consequently limits further TSNA formation.

[0373] In one embodiment, sterilization may be performed by steam sterilization.

[0374] In some embodiments, the treated tobacco leaves may be cut. The treated tobacco leaves may be cut before or after processing. Preferably, the treated tobacco leaves may be cut after processing.

[0375] In some embodiments, tobacco plants, harvested tobacco leaves, and / or processed tobacco leaves may be used to extract nicotine. Nicotine extraction can be achieved using any method known in the art. For example, a method for extracting nicotine from tobacco is taught in U.S. Patent No. 2,162,738, which is incorporated herein by reference.

[0376] In one embodiment, the present invention provides a dried tobacco material made from a tobacco plant or a part thereof according to the present invention.

[0377] In another aspect, the present invention provides a tobacco blend comprising tobacco material made from tobacco plants or a portion thereof according to the present invention. In one aspect, the present invention provides a tobacco blend comprising dried tobacco material according to the present invention.

[0378] Appropriately, the tobacco blend according to the present invention may contain approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 10% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 20% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 30% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 40% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 50% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 60% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 70% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 80% tobacco from the tobacco plant or a portion thereof according to the present invention. Appropriately, the tobacco blend may contain approximately 90% tobacco from the tobacco plant or a portion thereof according to the present invention.

[0379] In one embodiment, the tobacco blend product of the present invention comprises at least about 5 percent, 10 percent, 20 percent, 30 percent, 40 percent, 50 percent, 60 percent, 70 percent, 80 percent, 90 percent, or 95 percent by the dry weight of dried tobacco, derived from the tobacco plant or a portion thereof according to the present invention.

[0380] Appropriately, dried tobacco material may be air-dried. Appropriately, dried tobacco material may be hot-air dried. Appropriately, dried tobacco material may be sun-dried. It can be dried.

[0381] The tobacco product or smoking article according to the present invention may include the tobacco material according to the present invention (for example, dried tobacco material).

[0382] In another embodiment, the present invention provides tobacco products. Preferably, the tobacco product may be a blended tobacco product. In one embodiment, the tobacco product may be prepared from the tobacco plant of the present invention or a portion thereof. In one embodiment, the tobacco product is Nic1 Tobacco plants may be prepared in which the activity or expression of the ERF gene, or the activity or expression of both the Nic1 ERF and Nic2 ERF genes, is regulated. Tobacco products may contain reduced activity or expression of the Nic1 ERF gene and reduced alkaloid content. Appropriately, tobacco plants or parts thereof may be propagated from tobacco plant propagation material according to the present invention.

[0383] As used herein in the context of plants (e.g., tobacco plants), the term “part of it” refers to a part of the plant (e.g., tobacco plants). Preferably, “part of it” is a leaf of the plant (e.g., tobacco plants).

[0384] In another embodiment, the tobacco product may be prepared from harvested leaves of the present invention. In a further embodiment, the tobacco product may be prepared from treated tobacco leaves of the present invention. Preferably, the tobacco product may be prepared from tobacco leaves treated by one or more of the following: drying, fermentation and / or sterilization. Preferably, the tobacco product may optionally include tobacco leaves treated and cut according to the embodiments described above.

[0385] In one embodiment, a tobacco product may be a smoking article. As used herein, the term “smoking article” may include smokeable products such as rolled tobacco, cigarettes, cigars and cigarillos, which are based on tobacco, tobacco derivatives, expanded tobacco, recombined tobacco or tobacco substitutes.

[0386] In another embodiment, the tobacco product may be a smokeless tobacco product. As used herein, the term “smokeless tobacco product” refers to a tobacco product that is not intended to be smoked and / or burned. In one embodiment, a smokeless tobacco product may be snus, snuff, chewing tobacco, etc.

[0387] In further embodiments, the tobacco product may be a tobacco heating device, a hybrid device, or an e-cigarette. Typically, in a heating device or hybrid device, the aerosol is generated by the transfer of heat from a heat source to a physically separated aerosol-forming substrate or material, which may be located inside, around, or downstream of the heat source. During smoking, volatile compounds are released from the aerosol-forming substrate by heat transfer from the heat source, taking in air drawn through the smoking article. As the released compounds cool, they condense to form an aerosol that is inhaled by the user.

[0388] Aerosol generating articles and devices for consuming or smoking tobacco heating devices are known in the art. These may include, for example, electronically heated aerosol generating devices in which the aerosol is generated by transferring heat from one or more electronic heating elements of the aerosol generating device to an aerosol-forming substrate of the tobacco heating device. Typically, the tobacco heating device may be the aerosol generating device.

[0389] Preferably, the tobacco heating device may be a heat-not-burn device. Heat-not-burn devices are publicly known in the art. This involves releasing compounds by heating tobacco, but not by combustion. Examples of suitable heat-not-burn devices can be taught in International Publication No. 2013 / 034459 or British Patent No. 2515502, which are incorporated herein by reference.

[0390] In one embodiment, the aerosol-forming substrate of a tobacco heating device may be the tobacco product according to the present invention.

[0391] In one embodiment, the tobacco heating device may be a hybrid device.

[0392] Polynucleotide / polypeptide / construct In one embodiment of the present invention, a construct that modulates the activity or expression of at least one Nic1 ERF gene (or both at least one Nic1 ERF gene and at least one Nic2 ERF gene) can be appropriately transformed into plant cells under promoter direction.

[0393] In one embodiment of the present invention, a construct that reduces (i.e., inhibits) the activity or expression of the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene) can be used to transform plant cells under promoter direction. The gene construct may be a gene editing construct or may contain RNAi molecules that may include small interfering RNA (siRNA) or short hairpin loop (shRNA) molecules.

[0394] In one embodiment of the present invention, a construct that increases the activity or expression of the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene) can be used to transform plant cells under the direction of a promoter, for example, a construct encoding the endogenous Nic1 ERF gene.

[0395] The construct can be introduced into a plant according to the present invention by a suitable vector, for example, a plant transformation vector. The plant transformation vector may include an expression cassette comprising, at 5'-3' in the direction of transcription, a promoter sequence, a construct sequence targeting the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene), and a 3' untranslated terminator sequence containing a stop signal for RNA polymerase and a polyadenylation signal for polyadenylase. The promoter sequence may be present in one or more copies, such copies may be identical to or variants thereof of the promoter sequence described above. The terminator sequence may be obtained from a plant, bacterial, or viral gene. Suitable terminator sequences include, for example, the pea rbcS E9 terminator sequence, the nos terminator sequence derived from the Agrobacterium tumefaciens nopalin synthase gene, and the 35S terminator sequence derived from cauliflower mosaic virus. Those skilled in the art are readily aware of other suitable terminator sequences.

[0396] The constructs of the present invention may also include gene expression enhancement mechanisms for increasing promoter strength. An example of such an enhancer element is derived from a portion of the promoter of the pea plastocyanin gene, which is the subject of International Patent Application Publication No. 97 / 20056, incorporated herein by reference. Suitable enhancer elements may be, for example, the nos enhancer element derived from the nopalin synthase gene of Agrobacterium tumefaciens, and the 35S enhancer element derived from cauliflower mosaic virus.

[0397] These regulatory regions may originate from the same gene as the promoter DNA sequence, or from different genes from Nicotiana tabacum or other organisms, such as plants of the Solanaceae family or the Cestroideae subfamily. All regulatory regions It must have the ability to manipulate cells within the tissue being transformed.

[0398] The promoter DNA sequence may be derived from the same gene as the desired gene, for example, the gene that the promoter directs, for example, the gene encoding the Nic1 ERF of the present invention, which is the coding sequence used in the present invention, or it may be derived from Nicotiana tabacum or other organisms, for example, from plants of the Solanaceae family or from a different gene of the Mycobacterioideae subfamily.

[0399] The expression cassette can be incorporated into basic plant transformation vectors such as pBIN 19 Plus, pBI 101, pKYLX71:35S2, pCAMBIA2300, or other suitable plant transformation vectors known in the art. In addition to the expression cassette, the plant transformation vector contains such sequences necessary for the transformation process. These may include the Agrobacterium vir gene, one or more T-DNA boundary sequences, and selectable markers or other means of identifying the transgenic plant cells.

[0400] The term "plant transformation vector" refers to a construct capable of expression in vivo or in vitro. Preferably, the expression vector is integrated into the genome of an organism. The term "integrated" preferably extends to stable integration into the genome.

[0401] Techniques for transforming plants are well known within this field, such as Agrobacterium-mediated transformation. The basic principle in constructing genetically modified plants is to insert genetic information into the plant genome so that the desired genetic material can be stably maintained. A general overview of the techniques is provided by Potrykus (Annu Rev Plant Physiol PlantMolBiol

[1991] 42:205-225) and Christon (AgroFood-Industry Hi-Tech March / April 1994 17-27). These can be found in articles, which are incorporated herein by reference.

[0402] Typically, in Agrobacterium-mediated transformation, a binary vector carrying the desired exogenous DNA, i.e., the Nic1 ERF construct, is transferred from a suitable Agrobacterium strain to the target plant by co-culturing Agrobacterium with explants from the target plant. The transformed plant tissue is then regenerated on a selective medium containing selectable markers and plant growth hormones. An alternative method is the floral dipping method (Clough & Bent, 1998 Plant J. 1998 Dec;16(6):735-43, which is incorporated herein by reference), in which intact plant flower buds are brought into contact with a suspension of Agrobacterium strains containing the chimeric gene, and after seed setting, transformed individuals are identified by germination and growth on a selective medium. Direct infection of plant tissues with Agrobacterium is a widely used and simple technique described in Butcher DN et al., (1980), Tissue Culture Methods for Plant Pathologists, eds.: DS Ingrams and JP Helgeson, 203-208, which is incorporated herein by reference.

[0403] Further suitable transformation methods include, for example, the direct transfer of genes to protoplasts using polyethylene glycol or electroporation technology, particulate guns, microinjection, and silicon carbide fibers. Plant transformation using ballistic transformation, including silicon carbide whisker technology, is incorporated herein by reference by Frame BR, Drayton PR, Bagnaall SV, Lewnau CJ, Bullock WP, Wilson H M, Dunwell J. This is taught in M, Thompson JA & Wang K (1994). Silicon carbide whisker-mediated The production of fertile genetically modified maize plants by transformation is incorporated herein by reference. The viral transformation technique is taught in The Plant Journal 6: 941-948, which is incorporated herein by reference, for example, in Meyer P, Heidmann I & Niedenhof I (1992). The use of cassava mosaic virus as a vector system for plants is taught in Gene 110: 213-217, which is incorporated herein by reference. Further teachings on plant transformation can be found in European Patent Application Publication No. 0449375, which is incorporated herein by reference.

[0404] In a further embodiment, the present invention relates to a vector system for carrying a construct and introducing it into the genome of an organism such as a plant, preferably a tobacco plant. The vector system may contain one vector, or it may contain two vectors. In the case of two vectors, the vector system is usually referred to as a binary vector system. Binary vector systems are described in more detail in Gynheung Anetal, (1980), Binary Vectors, Plant Molecular Biology Manual A3, 1-19, which is incorporated herein by reference. It can be done.

[0405] One widely used system for plant cell transformation is incorporated herein by reference: Anetal., (1986), Plant Physiol. 81, 301-305 and Butcher DNet al., (1980), Tissue Culture Methods for Plant Pathologists, eds.: DSIngrams and Derived from Agrobacterium tumefaciens as described in JP Helgeson, 203-208. Ti plasmid, or from Agrobacterium rhizogenes The original Ri plasmid is used. Following each method of introducing the desired exogenous gene according to the present invention into a plant, the presence and / or insertion of further DNA sequences may be required. The use of T-DNA for the transformation of plant cells has been extensively studied and is described in European Patent Application Publication No. 120516; Hoekema: The Binary Plant Vector System Offset-drukkerij Kanters B.B., Amsterdam, 1985, Chapter V; Fraley, et al., Crit. Rev. Plant Sci., 4:1-46; and Anetal., EMBO J(1985) 4:277-284, which are incorporated herein by reference.

[0406] Plant cells transformed with constructs that regulate the activity or expression of the Nic1 ERF gene or both the Nic1 ERF gene and the Nic2 ERF gene can be grown and maintained according to well-known tissue culture methods, such as culturing the cells in a suitable culture medium supplemented with necessary growth factors such as amino acids, plant hormones, and vitamins.

[0407] In relation to the present invention, the term "genetically modified plant" includes any plant comprising a construct that modulates the activity or expression of the Nic1 ERF gene (or both the Nic1 ERF gene and the Nic2 ERF gene) according to the present invention. Therefore, a genetically modified plant is a plant transformed with the construct according to the present invention. Preferably, a genetically modified plant exhibits regulated Nic1 ERF activity or expression (or activity or expression of both the Nic1 ERF gene and the Nic2 ERF gene) and regulated alkaloid content according to the present invention. The term "genetically modified plant" does not extend to the native nucleotide coding sequences present in their natural environment, if they are under the control of their native promoters, which are also present in their natural environment.

[0408] In one embodiment, the Nic1 ERF gene, construct, plant transformation vector, or plant cell according to the present invention is an isolated form. The term “isolated” means that the sequence is naturally related in nature and does not contain at least substantially any other component found in nature.

[0409] In one embodiment, the Nic1 ERF gene, construct, plant transformation vector, or plant cell according to the present invention is in a purified form. The term "purified" means This means a relatively pure state, for example, at least about 90% purity, or at least about 95% purity, or at least about 98% purity.

[0410] As used herein, the term “nucleotide sequence” refers to an oligonucleotide sequence or a polynucleotide sequence, as well as their variants, homologs, fragments, and derivatives (including parts thereof). A nucleotide sequence may be of genomic or synthetic or recombinant origin, and may be double-stranded or single-stranded, with or without representing sense or antisense strands.

[0411] In relation to the present invention, the term "nucleotide sequence" includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably, it means the DNA, more preferably cDNA sequence, that is coded in relation to the present invention.

[0412] In preferred embodiments, the nucleotide sequence includes, when relating to and encompassing the scope of the invention itself, i.e., the Nic1 ERF gene, the native nucleotide sequence in its natural environment and when bound to a naturally related sequence that is also in its natural environment. For ease of reference, we will refer to this preferred embodiment as the “native nucleotide sequence.” In this context, the term “native nucleotide sequence” means the entire nucleotide sequence in its native environment, and if it is operably bound to a naturally related promoter, that promoter is also in its native environment.

[0413] A nucleotide sequence encoding either a protein having properties specific to the Nic1 ERF gene as defined herein, or a protein suitable for modification, can be identified and / or isolated and / or purified from any cell or organism producing the protein. Various methods for identifying and / or isolating and / or purifying nucleotide sequences are well known in the art. For example, PCR amplification techniques for preparing more sequences can be used as soon as a suitable sequence is identified and / or isolated and / or purified.

[0414] In a further alternative, the nucleotide sequence encoding the ERF transcription factor may be obtained using established standard methods, such as the phosphoramidite method described in Beucage SL et al., (1981) Tetrahedron Letters 22, pp. 1859-1869, which is incorporated herein by reference. Alternatively, they may be synthetically prepared by the method described in Matthes et al., (1984) EMBO J. 3, pp. 801-805, which is incorporated herein by reference. In the phosphoramidite method, oligonucleotides are synthesized, purified, annealed, ligated, and cloned in a suitable vector, for example, using an automated DNA synthesizer.

[0415] As used herein, the term "amino acid sequence" is synonymous with the terms "polypeptide" and / or "protein." In some instances, the term "amino acid sequence" is synonymous with the term "peptide." In some instances, the term "amino acid sequence" is synonymous with the term "enzyme."

[0416] The present invention also includes the use of polypeptides having specific properties as defined herein, or any nucleotide sequence, i.e., sequences having a certain degree of sequence identity or homology with the amino acid sequence of an ERF gene encoding such polypeptide (hereinafter referred to as “homologous sequence”). Here, the term “homolog” means an entity having a certain homology with the amino acid sequence and nucleotide sequence of interest. Here, the term “homology” can be considered identical to “identity.”

[0417] Homologous amino acid sequences and / or nucleotide sequences and / or fragments must provide and / or encode polypeptides that maintain and / or enhance the functional activity of the ERF gene. Typically, homologous sequences contain, for example, the same active site as the amino acid sequence of interest, or encode the same active site. Homologousity can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), but in the context of the present invention, this is preferred to describe homology in terms of sequence identity. Homologous sequences typically retain a functional domain or motif.

[0418] In one embodiment, a homologous sequence is interpreted as comprising an amino acid sequence or nucleotide sequence having one, two, or more additions, deletions, and / or substitutions compared to the sequence in question.

[0419] Comparison of homology or identity can be performed by eye, or more commonly, with the help of readily available sequence comparison programs. These commercially available computer programs can calculate the homology percentage between two or more sequences. The homology percentage or identity percentage may also be calculated for consecutive sequences, i.e., one sequence is aligned with another, and each amino acid in one sequence is directly compared, one residue at a time, with the corresponding amino acid in the other sequence. This is called a “gapless” alignment. Typically, such gapless alignment is performed only for a relatively short number of residues.

[0420] While this is a very simple and steady method, it does not take into account, for example, that a single insertion or deletion in another identical pair of sequences may cause the alignment to fail at the following amino acid residue, which can lead to a significant decrease in homology % when global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments by considering possible insertions and deletions without imposing an excessive penalty on the overall homology score. This is achieved by inserting "gaps" into the sequence alignment in an attempt to maximize local homology.

[0421] However, these more complex methods assign a "gap penalty" to each gap in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible—reflecting a higher relevance between the two compared sequences—achieves a higher score than one with many gaps. Typically, an "affine gap cost" is used, which imposes a relatively high cost for the presence of gaps and a smaller penalty for each subsequent residue within the gap. This is the most commonly used gap scoring system. Naturally, a high gap penalty produces an optimized alignment with fewer gaps. Most alignment programs allow for correction of the gap penalty. However, when using such software for sequence comparison, it is preferable to use the default values.

[0422] Therefore, calculating the maximum homology % requires first generating an optimal alignment that takes gap penalties into account. A suitable computer program for performing such alignments is Vector NTI (Invitrogen Corp.). Examples of software capable of sequence comparison include, but are not limited to, the BLAST package (see Ausubel et al. 1999 Short Protocols in Molecular Biology, 4th Ed-Chapter 18), BLAST2 (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov), FASTA (Altschul et al. 1990 J. Mol. Biol. 403-410), and AlignX. At least BLAST, BLAST2, and FASTA are available for offline and online searches. (See Ausubel et al. 1999, pages 7-58 to 7-60).

[0423] While the final homology percentage can be measured in terms of identity, the alignment process itself is not typically based on absolute pairwise comparisons. Instead, a tuned similarity score matrix is ​​commonly used, which assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a commonly used matrix is ​​the BLOSUM62 matrix, which is the default matrix for a set of BLAST programs. Vector NTI programs generally use either publicly available default values ​​or custom symbol comparison tables, if provided (see the user manual for further details). For some applications, it is preferable to use the default values ​​for the Vector NTI package.

[0424] Alternatively, the percentage of homology is calculated based on an algorithm similar to CLUSTAL (Higgins DG & Sharp PM (1988), Gene 73(1), 237-244), using Vector NTI (Invitrogen Corp.). This can be calculated using multiple alignment features. Once the software has generated the optimal alignment, it is possible to calculate the homology%, preferably the sequence identity%, %. The software typically does this as part of the sequence comparison and generates the calculation result.

[0425] When determining sequence identity, a gap penalty must be used, and consequently, the following parameters are preferably used for pairwise alignment.

[0426] [Table 4]

[0427] In one embodiment, CLUSTAL may be used in conjunction with the set of gap penalties and gap expansions defined above. In some embodiments, the gap penalties used for BLAST or CLUSTAL alignment may differ from those detailed above. Those skilled in the art will understand that the standard parameters for performing BLAST and CLUSTAL alignment may change periodically, and that at that time it may be possible to select appropriate parameters based on the standard parameters detailed for the BLAST or CLUSTAL alignment algorithm.

[0428] Appropriately, the degree of identity with respect to the nucleotide sequence is such that at least 50 consecutive nucleotides, preferably at least 60 consecutive nucleotides, preferably at least 70 consecutive nucleotides, preferably at least 80 consecutive nucleotides, preferably at least 90 consecutive nucleotides, preferably at least 100 consecutive nucleotides, preferably at least 150 consecutive nucleotides, preferably at least 200 consecutive nucleotides, preferably at least 250 consecutive nucleotides. A sequence of nucleotides is determined, preferably a sequence of at least 300 nucleotides, preferably a sequence of at least 350 nucleotides, preferably a sequence of at least 400 nucleotides, preferably a sequence of at least 450 nucleotides, preferably a sequence of at least 500 nucleotides, preferably a sequence of at least 550 nucleotides, preferably a sequence of at least 600 nucleotides, preferably a sequence of at least 650 nucleotides, or preferably a sequence of at least 700 nucleotides.

[0429] Appropriately, the degree of identity with respect to nucleotide, cDNA, cds, or amino acid sequences can be determined over the entire sequence.

[0430] The sequence may also include deletions, insertions, or substitutions of amino acid residues that result in silent changes and produce functionally equivalent substances. Planned amino acid substitutions may be made based on the similarity of the residues' polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilicity, as long as the secondary binding activity of the substances is preserved. For example, negatively charged amino acids include aspartic acid and glutamic acid, positively charged amino acids include lysine and arginine, and amino acids with uncharged polar head groups and similar hydrophilic values ​​include leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, and tyrosine.

[0431] Conservative substitutions can be carried out, for example, according to the table below. Amino acids in the same block in the second column, and preferably in the same column in the third column, can be substituted for each other.

[0432] [Table 5]

[0433] The present invention also includes possible homologous substitutions (both substitution and replacement are used herein to mean the exchange of an existing amino acid residue with an alternative residue), namely homogeneous substitutions such as basic for basic, acidic for acidic, polar for polar, etc. Non-homologous substitutions include, i.e., substitutions that may result from one class of residue to another, or the inclusion of non-natural amino acids such as ornithine (hereinafter referred to as Z), ornithine diaminobutyrate (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyrylalanine, thienylalanine, naphthylalanine, and phenylglycine.

[0434] Substitutions may also be made with non-natural amino acids, including: alpha * and alpha-disubstituted *Amino acids, N-alkyl amino acids * , lactic acid * , trifluorotyrosine * , p-Cl-phenylalanine * , p-Br-phenylalanine * , p-I-phenylalanine * and other halide derivatives of natural amino acids such as L-allyl-glycine * , β-alanine * , L -α-aminobutyric acid * , L-γ-aminobutyric acid * , L-α-aminoisobutyric acid * , L-ε-aminocaproic acid # , 7-aminoheptanoic acid * , L-methionine sulfone #* , L-norleucine * , L-norvaline * , p-nitro-L-phenylalanine * , L-hydroxyproline # , L-thioproline * , 4-methyl-Phe * , pentamethyl-Phe * and other methyl derivatives of phenylalanine (Phe) such as L-Phe(4-amino) # , L-Tyr(methyl) * , L-Phe(4-isopropyl) * , L-Tic(1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid) * , L-diaminopropionic acid # and L-Phe(4-benzyl) * . The symbol * is used to indicate the hydrophobicity of the derivative for the purposes of the above discussion (relating to identical or non-identical substitutions), while # is used to indicate the hydrophilicity of the derivative, and #* indicates amphiphilic properties.

[0435] The variant amino acid sequence may include an amino acid spacer such as a glycine or β-alanine residue, as well as a suitable spacer group that can be inserted between any two amino acid residues in the sequence containing an alkyl group such as a methyl, ethyl, or propyl group. Further variations include the presence of one or more amino acid residues in peptoid form, as well as will be well understood by those skilled in the art. To avoid misunderstanding, “peptoid form” is used to refer to a variant amino acid residue in which the α-carbon substituent is located on the nitrogen atom of a residue that is not α-carbon. Processes for preparing peptides in peptoid form are known in the art, for example, Simon RJ et al., PNAS (1992) 89(20), 9367-9371 and Horwell DC, Trends Biotechnol. (1995) 13(4), 132-134.

[0436] The nucleotide sequences for use in the present invention may include synthetic or modified nucleotides. Several different types of modifications to oligonucleotides are known in the art. These include the addition of methylphosphonate and phosphorothioate backbone chains, and / or acridine or polylysine chains at the 3' and / or 5' ends of the molecule. For the purposes of the present invention, it should be understood that the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be made to enhance the in vivo activity or lifetime of the nucleotide sequences of the present invention.

[0437] The present invention also includes sequences complementary to the nucleic acid sequences of the present invention, or sequences capable of hybridizing with either the sequences of the present invention or sequences complementary thereto. As used herein, the term “hybridization” includes “the process by which a nucleic acid chain is linked to a complementary chain by base pairing” and the amplification process performed by polymerase chain reaction (PCR) technology.

[0438] The present invention also relates to nucleotide sequences that can hybridize the nucleotide sequences of the present invention (including sequences complementary to those shown herein). Preferably, hybridization is determined under stringency conditions (e.g., 50°C and 0.2×SSC{1×SSC=0.15M NaCl, 0.015M sodium citrate, pH 7.0}). More preferably, hybridization is determined under high stringency conditions (e.g., 65°C and 0.1×SSC{1×SSC=0.15M NaCl, 0.015M sodium citrate, pH 7.0}).

[0439] In one embodiment, the sequences for use in the present invention are synthetic sequences, i.e., sequences prepared by in vitro chemical or enzymatic synthesis. This includes, but is not limited to, sequences prepared in a manner that optimizes the use of codons for a host organism.

[0440] The term "expression vector" means a construct capable of being expressed in vivo or in vitro. In one embodiment, the vector of the present invention is described herein. The vector expresses the Nic1 ERF gene. In one embodiment, the vector of the present invention further expresses the Nic2 ERF gene described herein. Preferably, the expression vector is integrated into the genome of a suitable host organism. The term “integrated” preferably extends to stable integration into the genome.

[0441] The nucleotide sequences for use in the present invention may be present in a vector operably linked to a regulatory sequence capable of providing expression of the nucleotide sequence by a suitable host organism. The constructs for use in the present invention may be transformed into suitable host cells as described herein to provide expression of the polypeptide of the present invention. The choice of vector, e.g., plasmid, cosmid, or phage vector, often depends on the host cell into which the vector is introduced. The vector may be used, for example, in vitro for RNA generation, or it may be used to transfect, transform, transduce, or infect host cells.

[0442] In some applications, the nucleotide sequences for use in the present invention are operably ligated to a control sequence capable of providing expression of the nucleotide sequence, such as by selection of a host cell. For example, the present invention extends to a vector comprising the nucleotide sequence of the Nic1 ERF gene described herein operably ligated to such a control sequence, i.e., the vector is an expression vector. Preferably, the vector may further comprise the nucleotide sequence of the Nic2 ERF gene described herein operably ligated to a control sequence.

[0443] The term "operably linked" refers to a proximal relationship between the listed components that enables them to function in the way they are intended. A control sequence "operably linked" to a coding sequence is linked in such a way that the expression of the coding sequence is achieved under conditions that match the control sequence.

[0444] The term “regulatory sequence” includes promoters and enhancers, as well as other expression regulatory signals. The term “promoter” is used in the common sense in the art, e.g., an RNA polymerase binding site. A nucleotide sequence within a construct encoding the Nic1 ERF gene or the Nic1 ERF gene and the Nic2 ERF gene can be operably ligated to at least a promoter.

[0445] The term "construct," which is synonymous with terms such as "cassette" or "vector," includes a nucleotide sequence for use according to the present invention that binds directly or indirectly to a promoter.

[0446] An example of indirect binding is the provision of a suitable spacer group, such as an intron sequence, such as a Sh1-intron or ADH-intron, intermediate between the promoter and nucleotide sequence of the present invention. The same applies to the term “fusion” in the present invention, which includes direct or indirect binding. In some examples, the term does not extend to the natural combination of nucleotide sequences encoding proteins originally associated with the promoter of a wild-type gene, and when both are present in their natural environment. The construct may contain or even express a marker, which allows for the selection of gene constructs.

[0447] An overview of common techniques used to transform plants can be found in the articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol

[1991] 42:205-225) and Christou (Agro-Food-IndustryHi-TechMarch / April 1994 17-27), which are referenced by Further teachings on plant transformation can be found in European Patent Application Publication No. 0449375, which is incorporated herein by reference.

[0448] In one embodiment, a SNP for use in genotyping of the Nic1 locus in a plant (e.g., tobacco) is provided herein.

[0449] In one embodiment, a marker for use in genotyping of the Nic1 locus in a plant (e.g., tobacco) is provided herein. In one embodiment, a pair of primers for use in genotyping of the Nic1 locus in a plant (e.g., tobacco) is provided herein. In one embodiment, primers for genotyping of the Nic1 locus in tobacco are shown in Table 4.

[0450] In one embodiment, a marker for use in genotyping of the Nic2 locus in plants (e.g., tobacco plants) is provided herein. In one embodiment, a pair of primers for use in genotyping of the Nic2 locus in plants (e.g., tobacco plants) is provided herein. In one embodiment, primers for genotyping of the Nic2 locus in tobacco plants are presented in Tables 5 and 6.

[0451] As used herein, “SNP” or “single nucleotide polymorphism” refers to sequence variation that occurs when a single nucleotide (A, T, C, or G) in a genome sequence is modified or variable relative to a reference sequence. “SNP marker” is present when an SNP is mapped to a site in the genome.

[0452] As used herein, “marker” or “SNP marker” means a nucleic acid sequence or amino acid sequence that is unique enough to characterize a particular gene locus in a genome. A polymorphic trait can be used as a marker if it is differentially inherited and exhibits linkage disequilibrium with a desired phenotypic trait. Where it is stated that a trait is linked to a given marker, it is understood that the actual DNA segment whose sequence affects the trait is usually co-segregated with the marker.

[0453] In one embodiment, any SNP identified in Table 4 may be used in a method of genotyping a plant (e.g., tobacco) to identify the presence, absence, or modification of the Nic1 locus. In one embodiment, any primer pair identified in Table 4 may be used in a method of genotyping a plant (e.g., tobacco) to identify the presence or absence of the Nic1 locus.

[0454] In one embodiment, any SNP identified in Table 5 or Table 6 is for use in a method of genotyping a plant (e.g., tobacco) to determine the presence or absence of the Nic2 locus. In one embodiment, any primer pair identified in Table 4 or Table 7 may be used in a method of genotyping a plant (e.g., tobacco) to determine the presence or absence of the Nic1 locus.

[0455] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art of the field to which this disclosure pertains. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULARBIOLOGY, 20 ED., John Wiley and Sons, New York (1994) and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) are among the terms used herein. A general dictionary is provided to those skilled in the art.

[0456] This disclosure is not limited to the exemplary methods and materials disclosed herein, and any methods and materials similar to or equivalent to those described herein may be used in the embodiments of this disclosure. It can be used in applications or tests. Numerical ranges include the numbers that define the range. Unless otherwise indicated, any nucleic acid sequence is written from left to right in the 5' to 3' direction, and amino acid sequences are written from left to right in the amino to carboxy direction.

[0457] The headings provided herein are not intended to limit the various aspects or embodiments of the Disclosure that can be obtained by referring to this specification as a whole. Therefore, the terms defined immediately below are more fully defined by referring to this specification as a whole.

[0458] In this specification, amino acids are referred to by their full names, three-letter abbreviations, or one-letter abbreviations. As used herein, the term “protein” includes proteins, polypeptides, and peptides. As used herein, the term “amino acid sequence” is synonymous with the terms “polypeptide” and / or “protein.” In some examples, the term “amino acid sequence” is synonymous with the term “peptide.” In some examples, the term “amino acid sequence” is synonymous with the term “enzyme.”

[0459] In this disclosure and claims, conventional one-letter and three-letter notations for amino acid residues may be used. The three-letter notations for amino acids are defined in accordance with the Joint Commission on Biochemical Nomenclature (JCBN) of IUPAC and IUB. It is also understood that polypeptides may be encoded by sequences of two or more nucleotides resulting from genetic coding degeneracy.

[0460] Other definitions of terms may be evident throughout this specification. Before describing exemplary embodiments in more detail, it should be understood that this disclosure is not limited to the specific embodiments described and is, of course, subject to change. Furthermore, since the scope of this disclosure is limited only by the appended claims, it should be understood that the terminology used herein is intended solely to describe, and not to limit, specific embodiments.

[0461] Where a range of values ​​is provided, unless the context explicitly indicates otherwise, it is understood that the values ​​between the upper and lower limits of that range, and the values ​​between them, are also specifically disclosed to the extent of one-tenth of the lower limit. Any mentioned value or value between any mentioned values ​​within the mentioned range, and each smaller range between any other mentioned values ​​or values ​​between any mentioned values ​​within the mentioned range, are included in this disclosure. The upper and lower limits of these smaller ranges may, independently, be included in or excluded from the range, and each range in which either, either, or both limitations are included in the smaller range also includes in this disclosure any specific exclusion of any limitations within the mentioned range. If the mentioned range includes one or both limitations, the range excluding either or both of the limitations is also included in this disclosure.

[0462] It should be noted that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include the plural form unless the context explicitly indicates otherwise. Thus, for example, a reference to “enzyme” or “nitrate reductase” includes multiple such candidate drugs and their equivalents known to those skilled in the art.

[0463] Superiority Surprisingly, we have found that the alkaloid and / or TSNA content of plants can be regulated by regulating the activity or expression of the Nic1 ERF gene, as taught herein. As a result, the regulated alkaloid and / or TSNA content desired by consumers of tobacco products, as well as commercially desired content, can be achieved. It is possible to manufacture tobacco products with desirable characteristics.

[0464] The inventors have surprisingly discovered a method for regulating the alkaloid content, such as nicotine content and / or TSNA content, of tobacco plants by regulating the activity or expression of the Nic1 ERF gene. The nicotine content or TSNA content of tobacco plants can be reduced by inhibiting the activity or expression of the Nic1 ERF gene. Prior to the present invention, it was not known that the regulation of the activity or expression of the Nic1 ERF gene described herein could be used to regulate the alkaloid content and / or TSNA content.

[0465] The inventors have found that regulating the Nic1 ERF gene can reduce the alkaloid content of modified plants to remarkably low levels.

[0466] As demonstrated herein, a single knockout mutation in ERF199 in a wild-type background results in a greater reduction in alkaloid content than the nic1 mutation in LI(aaBB).

[0467] LI (low intermediate, aaBB) lines typically produce about half the alkaloid content compared to HA (high alkaloid, AABB) lines. However, in Example 13, we produced EMS lines equivalent to the LI lines. We produced EMS lines with a mutation in Nitab4.5_0003090g0030.1(ERF199). These mutant EMS lines produced about one-third the alkaloid content compared to the HA lines, which was much lower than expected for the LI lines.

[0468] As demonstrated herein, in an HI background (AAbb), the knockout mutation in ERF199 surprisingly yields a much lower alkaloid content than LA Burley 21 (aabb).

[0469] The Nic1 ERF gene Nitab4.5_0003090g0030.1 (ERF199) was knocked out by gene editing in the HI line (AAbb), and the alkaloid content of the knockout line was significantly lower than that of the equivalent LA line (aabb) (see Example 14). Surprisingly, these data suggest that the regulation of the activity or expression (e.g., knockdown or knockout of activity or expression) of the Nic1 ERF gene alone (e.g., Nitab4.5_0003090g0030.1 or ERF199) is sufficient to regulate (e.g., reduce) the alkaloid content of a plant or a part thereof.

[0470] When the nic2 mutation in HI(AAbb) is combined with the ERF199 mutation in a single plant, the reduction in alkaloids is far greater than the combined additive effect suggested by epistasis.

[0471] The publications discussed herein are provided solely for their disclosure prior to the filing date of this application. This specification should never be construed as an admission that such publications constitute prior art to the claims attached herein. [Examples] [Examples]

[0472] Alkaloid analysis of near-isogenic lines of Burley-21 The inventors attempted to identify the Nic1 gene responsible for changes in alkaloid content in plants. Specifically, they identified four NILs in Burley-21 (B21) that cause normal / high alkaloid B12. 21 (HA-B21), high intermediate alkaloid B21 (HI-B21), low intermediate alkaloid B21 (LI-B21), and low alkaloid B21 (LA-B21) (hereinafter referred to as HA, HI, LI, and LA in this specification) were grown in a greenhouse with five containers of PRO-MIX soil. The plants were grown in 6.5-inch deep × 6.5-inch diameter pots with drainage holes until they were 2 months old, and root samples were collected for RNA-seq analysis. Three different F2 isolates were independently derived from the hybrids HA(AABB)×LI(aaBB), HA(AABB)×LA(aabb), and HI(AAbb)×LA(aabb). 200 F2 individuals from the HA×LA and HA×LI hybrids were grown in the field, and alkaloid levels were measured for all lines at 3 months old. 600 F2 individuals of HI×LA were grown in the field until they were 3 months old, and their alkaloid content was assayed as described above.

[0473] Results - Phenotyping of F2 generation from HA(AABB)×LI(aaBB) and HA(AABB)×LA(aabb) crosses The total alkaloid levels of F2 plants derived from HA×LI and HA×LA hybrids were found to be continuous (Figure 1, panel A shows the total alkaloid levels of F2 derived from the parent line and HA×LI hybrids, and panel B shows the nicotine levels of F2 derived from the parent line and HA×LA(B) hybrids), and therefore, the genotype of Nic1 for both populations could not be clearly inferred based on phenotypic values. This was particularly true for the F2 population derived from HA×LI, where the range of phenotypic values ​​for the parent line overlapped (Figure 1A). To map to the Nic1 locus, we selected the lowest 20 and 24 F2 lines, and the highest 24 and 20 F2 lines, respectively, from the HA×LI and HA×LA populations. The F2 plants with the lowest or highest alkaloid levels (88 in total) could be genotyped as homozygous recessive (aa) or dominant (AA). [Examples]

[0474] Marker development and linkage analysis To determine candidate genes that alter alkaloid content, 44 F2 individuals from Example 1 with the highest or lowest alkaloid levels from the HA×LA and HA×LI F2 populations were selected using their respective parents and tested on a specially ordered tobacco 30K Infinium iSelect HD BeadChip (Illumina Inc., San Diego, California). The SNP cluster was selected for SNP genotyping using NEAR. GenomeStudio version 2011.1 (Illumina Inc., San Diego, California) was used. All polymorphic markers were generated and identified for further analysis. Gene linkage maps for both populations were created using the Joinmap function. John 3.0 (Stam, P. (1993). Construction of integrated genetic linkage maps by means of a new computer package - Joinmap. (PlantJournal 3, 739-744) software The software was used and built with default settings. For a simple mapping of the Nic1 and Nic2 loci, interval mapping was performed for the two populations using MapQTL version 6.0 (Van Ooijen JW (2009). MapQTL 6: Software for the mapping of quantitative trait loci inexperimentalpopulations of diploid species. Wageningen (The Netherlands): Kyazma BV, incorporated herein by reference) with selected selective genotyping options and a step size of 1 cM.

[0475] In the two populations described above, SNPs identified by RNA-seq or by using a specially ordered 30K Infinium iSelectHDBeadChip were sequenced to determine their respective genotypes. Verification was performed by comparing the sequence with that of HA. All identified SNPs were identified using CAPS or dCAPS markers (Neff, MM, Turk, E., and Kalishman, M. (2002). Web-based primer design for single nucleotide polymorphism analysis). Trends in Genetics 18, 613-5 (as incorporated herein by reference) This was used to generate a map for the F2 population of HI×LA. The gene map for this population was constructed using Joinmap with the settings described above. The DNA used for genotyping is obtained using the CTAB method (Doyle, JJ and JLDoyle. 1987. A rapid DNA isolation procedure for small quantities of freshleaftissue. Phytochemical Bulletin 19: 11-15, incorporated herein by reference). Extracts were obtained from leaf samples of all strains.

[0476] RNA isolation and RNA sequencing Following the manufacturer's instructions, total RNA was isolated using the QIAGEN Plant RNeasy mini kit (QIAGEN), treated with DNase I, and any remaining DNA contamination was removed. The quantity and quality of RNA samples were evaluated using BioAnalyzer 2100 (Agilent Genomics). RNA-seq libraries were prepared using the Illumina TruSeqRNA Sample Prep Kit (Illumina). The libraries were constructed using ). All libraries were sequenced on the Illumina Hiseq RapidMode150-Cycle platform. Base calling and sample demultiplexing were performed. This is done using Illumina HiSeq Control software and CASAVApipeline software. .

[0477] RNA-seq data analysis and SNP calling Sample isolation and adapter / barcode trimming were performed using standard Illumina software, and the quality of the trimmed reads was checked with FastQC. Two reference transcriptomes were used for RNA sequencing data mining. One was from Rushton PJ, Bokowiec MT, Han SC, Zhang HB, Brannock JF, Chen XF, Laudeman TW, It contains 239 ERF genes annotated by Timko MP. 2008. Tobacco transcription factors: Novel insights into transcriptional regulation in the Solanaceae. Plant Physiology 147: 280-295 (incorporated herein by reference). Another one is the TN 90 draft genome (Sierro, N., Battey, JN, Ouadi, S., Bakaher, The genes were generated by gene prediction in N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobaccogenome sequence and its comparison with those of tomato and potato. Nature Communications 5, 3833 (incorporated herein by reference). RNA-seq reads were generated by TopHat v2.0.9 calling Bowtie2 v2.1.0 (Langmead, B., and Salzberg, SL (2012). Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357-9 (incorporated herein by reference)). Alignment was performed to a tobacco reference transcriptome with a general feature format file (GFF) using ). SNPs in four lines were called using the Genome AnalysisToolkit Unified Genotyper (GATK; version 2.8-1-g932cd3a), and a multisample variant call format (VCF) file (McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky, A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., and DePristo, MA (2010). The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Research 20, 1297-303 (incorporated herein by reference). Subsequently, less than 20 quality The variant call was removed using a VCF filter.

[0478] Physical mapping and identification of candidate genes SNP markers known to be genetically close to and linked to either the Nic1 or Nic2 locus are aligned to the high-density consensus gene map for tobacco (Nicotiana tabacum 30k Infinium HD consensus map 2015; https: / / solgenomics.net / cview / map.pl?map_version_id=178, incorporated herein by reference). Improved tobacco genome assembly (Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst,R.,White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP,Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacumenablesmap-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Uniquely fixed to BMC Genomics 18, 448 (as incorporated herein by reference) Using markers within desired regions around the Nic1 and Nic2 loci, which can be determined, BioNano hybrid scaffolds (i.e., pseudochromosomal regions) corresponding to the two regions can be created. The region was identified. Subsequently, gaps in the sequence were identified using the Basic Local Alignment Search Tool (BLAST) version 2.2.24+ (https: / / BLAST.ncbi.nlm.nih.gov / BLAST.cgi) with default settings and the MegaBlast option. Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC The sequences of the gene model (coding region) in two desired regions were filled in from the genome of Genomics18,448 (mentioned above) by identifying equivalent superscaffolds from the tobacco variety TN90 (Sierro, N., Battey, JN, Ouadi, S., Bakaher, N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobacco genome sequence and its comparison with those of tomato and potato. Nature Communications 5, 3833, incorporated herein by reference). Then, cross-BLAST comparisons were performed using BioNano Super Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., in two areas that cannot be mapped to a scaffold. Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous lociimplicated in nitrogen utilization efficiency. BMCGenomics 18, 448 (mentioned above) uses a genome scaffold. To further identify these, the TN90 superscaffold was used. Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Superscaffolds were included in the list only if the majority of the scaffolds in BMC Genomics 18, 448 could be mapped to TN90. Markers that can be uniquely mapped to the genome scaffold but are not present in the BioNano hybrid scaffold were also included in the consensus HA×L Based on their relative locations in the A or HA×LI gene map, corresponding scaffolds were positioned within the two desired regions. Then, candidate gene models in the two updated regions were identified using RNA-seq data (Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., HumphryM., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, R. S., and Mueller, L. A. (2017) A. reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genomics 18, 448, supra. We compared it with the above and made corrections as necessary.

[0479] The region identified in this study is referred to as Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1 (see reference). To compare with the region incorporated herein by Edwa, BLAST analysis was performed. rds, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD,Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley,JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017)Areference genome for Nicotiana tabacum enables map-based cloning ofhomeologousloci implicated in nitrogen utilization efficiency. Adams, AC, De Godoy Lusso, MS,Pramod, S., andXu, D. (2016). Compositions and Methods for Producing TobaccoPlants andProducts Having Altered Alkaloid Levels. US patent The procedure was performed using the genome sequence from application20160374387A1 (mentioned above). A hit showing at least 99% identity over at least 1kb of the sequence was considered evidence of a match.

[0480] result Selected F2 iSelect HD BeadChip Genotype derived from HA×LA and HA×LI Ping Using a custom-ordered 30K Infinium iSelect HD BeadChip, we identified several other unlinked groups in both HA×LI and HA×LA populations (data not shown), indicating that more Nic1 and Nic2 regions are separated between HA and LA. This suggests that it is unlikely to find Nic1 regions solely from mapping polymorphism markers between the two parents. QTL analysis using a selective genotyping method in MapQTL identified linkage groups containing several markers common to both HA×LI and HA×LA F2 populations that were significantly associated with total alkaloid content (maximum LOD scores of 31.13 and 26.95, respectively), explaining the 51.2% and 46.2% variability in this trait, respectively. These markers were identified in N. tabacum using 30k Infinium HD. Consensus Map 2015 Chain Group 7 (Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS,and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMCGenomics 18, 448 (as mentioned above) The marker is located at the same location as the pseudochromosome7) of the genome. It was placed there.

[0481] Figure 2 shows the 2015 consensus map of N. tabacum's 30kInfiniumHD. This section compares the gene maps of selected F2 individuals derived from HA×LI and HA×LA hybrids. Dashed lines represent markers identified between the F2 map and the consensus map, while chain lines represent markers identified between two F2 maps. Bold font indicates markers common to two or more maps. Only markers identified in either the HA×LA or HA×LI map are shown in the consensus map, with the positions of other markers indicated by black horizontal lines.

[0482] In addition to this group, we also identified another group that showed a significant association with total alkaloid content in the F2 population of HA×LA (maximum LOD score of 14.01), but explained only about half of the variability for this trait as a marker in linkage group 7 (maximum 27.6% of variability was explained). This group also had a dominant gene-specific marker for Nic2 (Qin, The markers from this group included linkage group 19 of the consensus map (Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum ena). Map-based cloning of homeologous loci implicated in nitrogenutilization efficiency. BMC Genomics 18, 448 (as mentioned above) Similar to markers in pseudochromosomes of the genome 19) It is located in one place, which coincides with the proposed genomic region of the Nic2 locus (Kajikawa, M., Sierro, N., Kawaguchi, H., Bakaher, N., Ivanov, NI, Hashimoto, T., and Shoji, T. (2017). Genomic insights into the evolution of thenicotinebiosynthesis pathway in tobacco. Plant Physiology 174, 999-1011).

[0483] Identification of SNPs in the ERF gene based on RNA sequencing Annotation of transcription factors with the tobacco genome revealed 239 ERF genes in the tobacco genome (Rushton PJ, Bokowiec MT, Han SC, Zhang HB, Brannock JF, Chen XF, Laudeman TW, Timko MP. 2008. Tobacco transcription factors: Novel insights into transcriptional regulation in the Solanaceae. Plant Physiology 147: 280-295 (incorporated herein by reference). RNA-s of HA, HI, LI and LA SNP identification based on eq analysis revealed one SNP in ERF110 (Nitab4.5_0006382g0040.1; Table 1) with the help of restriction enzyme BstZ17I. Therefore, the SNP in ERF110 was converted to a CAPS marker and designated as SNP4 (Table 7). Linkage analysis of 88 selected F2 individuals derived from HA×LI and HA×LA hybrids demonstrated that SNP4 is linked to the Nic1 locus by six recombinants detected from the 44 F2 individuals with the lowest alkaloid levels (Figure 3).

[0484] [Table 6] TIFF0007832967000007.tif255149

[0485] Furthermore, linkage analysis of SNP4 using the 30K Infinium iSelect HD BeadChip marker showed that it was closely linked to the marker in linkage group 7, which was significantly associated with total alkaloid content in both populations (Figure 2). However, due to the fact that the genotype of individual F2 plants cannot be accurately determined from their phenotypic data as previously described, the observed recombination may be due to misphenotyping. Therefore, it is necessary to isolate populations that are more suitable for mapping the Nic1 locus. [Examples]

[0486] Comparison of phenotypes for NIL in B21 Next, 30 plants were selected for each NIL of B21, and their alkaloid content was measured (Figure 4). Total alkaloid or nicotine levels for different strains can be easily identified phenotypically on an average basis. However, identification on a single plant basis is inconsistent due to considerable phenotypic overlap among individual plants of different strains, such as LI and HI, LI and HA, and HI and HA (Figure 4).

[0487] Even within the same lineage, total alkaloid or nicotine levels can vary very dramatically between individual plants, with the exception of the LA lineage. Therefore, we generated F2 populations derived from hybrids between HI and LA and performed total alkaloid analysis on these populations (Figure 5). [Examples]

[0488] Genotyping of 600 F2 hi-la NPs using SNP4 CAPS markers Based on the results from genotyping of HA×LI and HA×LA populations, we decided to test the diagnostic capability of SNP4 CAPS markers in a larger population.

[0489] Genotyping of 600 F2 plants derived from HI×LA with SNP4 revealed a segregation ratio of AA:Aa:aa of 150:289:161, which was different from the expected 1:2:1(X 2 The formula fits to (=1.21, df=2, P=0.55). For alkaloid analysis, we selected 150 predicted homozygous dominant (AA) and 161 predicted homozygous recessive (aa) F2 plants. These two F2 groups were segregated without overlap. All individuals with the predicted aa genotype had low alkaloid levels (0.17–0.41%) within the range of the LA parent (0.18–0.38%) (Figure 5).

[0490] Similarly, alkaloid levels were high in the predicted AA plants, none of which were within the range of the LA parent. However, some predicted AA plants were observed to be outside the range of the HI parent. To confirm the Nic1 genotype in plants genotyped as AA but containing the lowest nicotine content (indicated by arrows in Figure 5), we checked for segregation of genotype and alkaloid phenotype in the next generation of these individuals. All F3 lines retained the predicted AA genotype when assayed with the SNP4 marker.

[0491] Chemical analysis of 40 F3 plants derived from this line revealed that all plants contained equivalent levels of alkaloids relative to HI (Figure 6), and that none of the plants were within the alkaloid level range of LA, thus supporting our hypothesis that the selected F2 plants were homozygous and that the SNP marker we developed was co-segregated at the Nic1 locus. [Examples]

[0492] Genetic mapping of Nic1 in the F2 population of HI×LA. We sequenced four B21 NILs using 30K Infinium iSelect HD BeadChip to confirm the polymorphism of sequences identified as being closely linked to the Nic1 locus (Figure 3). Six of these SNPs were convertible to PCR-based CAPS or dCAPS markers (Table 4 shows the SNPs identified and converted markers based on custom 30K Infinium iSelect HD BeadChip analysis for the Nic1 region). To identify more markers for gene mapping of the Nic1 locus, we used the publicly available TN90 genome reference sequence (Sierro, N., Battey, JN, Ouadi, S., Bakaher, N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobacco genome sequence and its comparison with those of tomato and potato. Nature Communications 5, 3833, referenced by We performed SNP identification based on RNA sequencing using (included). More than 6 SNPs were detected among the NILs of B21 isolated for Nic1, and all of these were converted to CAPS or dCAPS markers (Table 7). We also generated CAPS markers for two SNPs from previous studies analyzing potential Nic1 deletion regions, and labeled them as SNP13 and SNP14 in Figure 7 and Table 7 (Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. In addition, we obtained a 500kb deletion from the same publication (Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions The primers used to characterize the Nic1 locus (annotated as Sequence IDs 3 and 4 in US patent application 20160374387A1, "and Methods for Producing Tobacco Plants and Products Having AlteredAlkaloidLevels") were utilized. Gene mapping of the Nic1 locus was performed using 161 recessive F2 plants (aa) derived from HI×LA, with markers in Tables 4 and 7 (Figure 7). As can be seen from the gene map, the Nic1 locus, cosegregated with SNP4, is adjacent to SNP3 and SNP5 (Figure 7), Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, The region is genetically distinct from the region identified by D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1 (incorporated herein by reference).

[0493] [Table 7] [Examples]

[0494] Genetic mapping of Nic2 in the F2 population of HA×LA. To develop PCR-based markers in the region surrounding Nic2, we sequenced SNP chip markers found to link to this locus based on HA×LA F2 individuals, as described above. Six of these SNPs could be converted into PCR-based CAPS or dCAPS markers (Table 5).

[0495] Similar to the Nic1 locus, we used RNA-seq to identify more SNPs linked to the Nic2 locus. We identified more than three SNPs that could be converted to dCAPS markers (Table 6). Gene mapping of the Nic2 locus was performed using 188 F2 HA×LA cells with the markers shown in Tables 5 and 6 (Figure 8). As can be seen from the gene map, the Nic2 locus (defined by the NIC1 marker from Qin, Q., Li, D., Dai, X., Zhao, P., Miller, R., Jack, A., and Yang, S. (2015) Development of user-friendly marker for Nic2 in tobacco. SRC, Tobacco Science Research Conference, 69, abstract 79) is co-separated with SNPs 17 and 18 (Figure 8).

[0496] [Table 8]

[0497] [Table 9] [Examples]

[0498] Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologousloci implicated in nitrogen utilization efficiency. BMC Genomics Based on 18,448 genome sequences. Physical localization of Nic1 and Nic2 N. Tabacam's 30k Infinium HD Consensus Map 2015 and HA×LI and HA× Using markers identified as closely linked by comparison with the LA F2 gene map, we identified a fusion genomic region encompassing the Nic1 locus fixed by the markers Nt1AB6591 and Nt1AA9777. Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., HumphryM., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacumenables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Using the BioNano hybrid assembly from BMC Genomics 18, 448 (incorporated herein by reference), we were able to identify scaffolds mapped to pseudochromosomes covering a large portion of this region (see Figure 82, “Evidence” column in Table 8). Sierro, N., Battey, JN, Ouadi, S., Bakaher, N., Bovet, L., Willig, A., Goepfert, S., Peitsch, MC, and Ivanov, NV (2014). The tobaccogenomesequence and its comparison with those of tomato and potato.NatureCommunications From genome assemblies 5,3833 (incorporated herein by reference) Mutual BLAST analysis of the TN90 super scaffold fills potential gaps in this region in sequence assembly. Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genomics 18, 448 scaffolds can be further identified. Yes, there was (see Figure 82 and the "TN90 Super Scaffold" column in Table 8). Finally, although it is not possible to integrate based on any of the above methods, Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) Areference genome for Nicotiana tabacum enables map-based cloning of homeologousloci implicated in nitrogen utilization efficiency. BMC Genomics 18,448 genomes scaffold Markers that could be uniquely mapped to the scaffold were integrated based on their positions in either the consensus HA×LA or HA×LI gene map (Figure 82). Where there was conflicting evidence regarding the scaffold location, BioNano hybrids were used. The location of the scaffold in the head assembly was used.

[0499] To fine-map the Nic1 region, we utilized a gene map from an F2 population derived from HI×LA (Figure 7). SNP markers generated from both 30K Infinium iSelect HD BeadChip and RNA-seq (Tables 4 and 5) were mapped to the fusion genome region fixed with the markers identified above. A scaffold containing a new SNP marker was added to the fusion genome region, similar to the consensus HA×LA and HA×LI gene maps described above. Based on the recombination identified in the F2 population of HI×LA (Figure 7), we mapped our desired region to the fusion genome adjacent to the Nitab4.5_0003553 and Nitab4.5_0007027 scaffolds. We limited the analysis to the syngenomic region (Figure 82). This region contains a cluster of nine genes annotated as ERF transcription factors (Table 8). Next, to improve the gene model for the genes within this identified region in Table 8 (sequence numbers are shown in Table 1), we consulted Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017). A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMC Genomics18, 448 (Reference) RNA-seq information (which is incorporated herein by reference) was used.

[0500] Next, we identified the Nic1 region as being deleted in the LI line identified by Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. USpatentapplication 20160374387A1 (incorporated herein by reference). This was compared to the scaffold (SEQ ID NO: 85). This was compared to Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino,J. P., Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotianatabacum enables map-based cloning of homeologous loci implicated innitrogenutilization efficiency. BMC Genomics 18, 448 (incorporated herein by reference) This was performed by BLAST analysis of this sequence on the genome scaffold. Consistent with the gene mapping results (Figure 7), the region previously identified by Adams, AC, De Godoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1 is the physical region upstream of the Nic1 region we identified. It is located there (see Figure 82).

[0501] To better characterize the Nic2 region, we performed the same analysis on genomic regions fixed with the markers Nt1AA9370 and Nt1AC6499 (Figure 2). This region was further demarcated using the markers SNP15 and SNP18 / 19, which were used in the fine mapping of Nic2 (Figure 8). Gene evaluation in this region included many previously identified genes (Shoji, T., Kajikawa, M., and Hashimoto, T. (2010). Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. The PlantCell 22, 3390-3409; Kajikawa, M., Sierro, N., Kawaguchi, H., Bakaher, N., Ivanov, NI, Hashimoto, T., and Shoji, T. (2017). Genomic insights into the evolution of the nicotine biosynthesis pathway into tobacco. Plant Physiology 174, 999-1011), 9 genes annotated as ERF transcription factors We showed that it contains the cluster (Table 9). To improve the gene model for the ERF genes within this identified region (Table 9; sequence numbers are shown in Table 2), we consulted the RNA-seq information from Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. BMCGenomics 18, 448. This region was identified by BLAST analysis as the Nic1 region (Sequence ID 2 in Adams, AC, DeGodoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. USpatentapplication 20160374387A1), as described in Adams, AC, DeGodoy Lusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent Identified by application 20160374387A1 (incorporated herein by reference) The sequence was also compared with the previously obtained sequence. The results of this comparison showed that the sequence for Nic2 in Adams, AC, De GodoyLusso, MS, Pramod, S., and Xu, D. (2016). Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels. US patent application 20160374387A1 (incorporated herein by reference) was compared with the previous result (Shoji, T., Kajikawa, M., and Hashimoto, T. (2010). Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. The PlantCell 22, 3390-3409 (reference). (as incorporated herein by) and Kajikawa, M., Sierro, N., Kawaguchi, H., Bakaher, N., Ivanov, NI, Hashimoto, T., and Shoji, T. (2017). Genomic insights into In accordance with the evolution of the nicotine biosynthesis pathway in tobacco (Plant Physiology 174, 999-1011 (incorporated herein by reference)), Nic2 This coincided with a region of our genome (see Figure 83).

[0502] [Table 10]

[0503] [Table 11] [Examples]

[0504] Bioinformatics analysis of genes in the desired Nic1 / Nic2 region Given the incidence of clusters of ERF transcription factors in both desired regions, we can conclude that they are homologous genes (i.e., N. sylvestris and N. sylvestris from the ancestral genome) We were interested in whether it could represent an equivalent gene derived from N. tomentosiformis. Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, andMueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloningof Homeologous loci implicated in nitrogen utilization efficiency. Each ERF gene for the genome in BMC Genomics 18,448 (incorporated herein by reference). BLAST analysis of the coding sequences of the current gene model for the offspring (using the blastn option by default) showed that for many genes, the most similar hits were ERF genes located in equivalent but opposing regions (Table 10). This suggests that many ERFs in the two regions represent homologous genes.

[0505] To extend the analysis of the two desired regions demarcated by scaffolds in Tables 8 and 9, we were interested in whether the entire region could represent a homologous chromosomal segment. Examination of the scaffolds in the putative Nic1 and Nic2 regions showed that they were largely of N. silvestris or N. tomentosiformis origin, respectively (data not shown), supporting the hypothesis that they are homologous chromosome origins.

[0506] BLAST analysis of each gene in the two desired regions (as described above) showed that the best hits for numerous genes were located in opposing regions. In addition, the gene order for both regions was largely preserved, suggesting that very minor genomic rearrangements occurred in these two regions after the formation of N. tabacum. Based on the presence of homologous genes between the two identified genomic regions, we focused on genes annotated as ERF transcription factors in the Nic1 region for further analysis.

[0507] [Table 12] TIFF0007832967000014.tif255153 TIFF0007832967000015.tif255153 [Examples]

[0508] Vector construction To generate an overexpression vector for the Nic1 candidate gene, a cDNA fragment of the protein-coding region was amplified and gateway cloning technology was used (Chakrabarty, R., Banerjee, R., Chung, SM, Farman, M., Citovsky, V., Hogenhout, SA, Tzfira, T., and Goodin, M. (2007). PSITE vectors for stable integration or transient expression of autofluorescent protein fusions in plants: probing Nicotianabenthamiana-virus interactions. Molecular Plant-Microbe Interactions20, 740-50, by reference The Nic1 candidate was inserted into the pSITE-4NB vector by (as incorporated herein). Table 11 lists primers that have gateway recombinant sequences used for amplification of the coding sequence. Attb refers to the gateway recombinant sequence. Attb1:GGGGACAAGTTTGTACAAAAAAGCAGGCT(Sequence ID 105) Attb2:GGGGACCACTTTGTACAAGAAAGCTGGGT (Sequence ID 106)

[0509] [Table 13]

[0510] To construct vectors for Nic1 candidates under the control of their native promoters, genomic sequences including the coding region, promoter, and 3'-UTR were amplified with primers (Table 12) conjugated to adapters of the HindIII recognition site. The linearized vectors were then... The 16 homologous base pairs at the end of the 'Tar' are shown in lowercase letters, while the uppercase letters indicate the tobacco gene sequence. Following digestion in III, the amplified product was cloned into the vector pCAMBIA1305.1 by infusion cloning (Zhu, B., Cai, G., Hall, EO, and Freeman, GJ (2007). In-fusion assembly: seamless engineering of multidomain fusion proteins, modular vectors, and mutations. Biotechniques 43, 354-9, incorporated herein by reference).

[0511] [Table 14] [Examples]

[0512] Bacterial artificial chromosome (BAC) sequencing To identify bacterial artificial chromosomes (BACs) that consistently match the scaffold within a desired Nic1 region, fixed with a Whole Genome Profiling (WGP) sequence tag and an SNP marker to further assist in scaffold assembly, Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, A. D., Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, SP, Bromley,JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017)Areference The genome for Nicotiana tabacum enables map-based cloning of homeologousloci implicatedin nitrogen utilization efficiency. BMC Genomics 18, 448 Aligned to the fold. The DNA was used with the QIAGEN Plasmid Midi Kit. The BAC clones were extended, straightened, and sequenced using an Oxford Nanopore MinION device according to the manufacturer's instructions (QIAGEN) to provide long reads for mapping. Illumina's products were also used. Paired-end sequence reads provide precise short reads of the BAC clone. The tobacco genome scaffold, identified as being located within the Nic1 region, is a duplicate of the BAC clone. The Oxford Nanopore / Illumina sequence reads of the loan were remapped to a combination of leads. Create a sequel sequence. The gene model is based on the work of Edwards, KD, Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, AD, Bombarely, A., Allen, F., Hurst, R., White, B. Kernodle, SP, Bromley, JR, Sanchez-Tamburrino, JP, Lewis, RS, and Mueller, LA (2017) A reference genome for Nicotiana tabacum enables map-based cloning of homeologous loci implicated in nitrogen utilization efficiency. Developed for the improved Nic1 region as described in BMCGenomics 18, 448. [Examples]

[0513] Overexpression of Nic1 ERF due to hairy root transformation Materials and methods The candidate Nic1 ERF gene was overexpressed in tobacco plants by hairy root transformation. Tobacco plants used for hairy root transformation were grown from a magenta box, and leaves were cut into 0.5 cm × 0.5 cm sections. The leaf sections were infected with Agrobacterium rhizogenes strain Aqua1 containing a binary vector. Bactericidal and drug resistance selection was performed in solidified Murashige and Skoog media containing 150 mg / L kanamycin sulfate and 250 mg / L ticarcillin. Genetically modified roots were identified using a red fluorescence reporter with a confocal microscope. Selected root lines were maintained by subculturing every two weeks in 10 ml of liquid Gamborg B5 medium with constant shaking at 80 rpm in the dark.

[0514] Tobacco transformation Stable gene-transformed plants are transformed via Agrobacterium tumefaciens (Schardl et al., 1987 Gene, Volume 61, Issue 1, 1987, Pages 1-11, as specified herein). The transformation was initiated by (being incorporated into). Agrobacterium strain GV3101 was used to infect sterile leaf discs. The growth chamber used for tobacco transformation was programmed to 16 hours in light at 23°C and 8 hours in darkness at 20°C. Briefly, tobacco leaves were excised from plants grown in a magenta box and cut into 0.4 cm discs. The leaf discs were then subjected to a suspension of Agrobacterium tumefaciens containing the target plasmid (OD 600The plants were incubated in 0.3-1 oz for 30 minutes. After co-culturing in MS medium for 3 days, the leaf discs were transferred to TOM medium (MS medium with 20 g sucrose / L, 1 mg / L IAA, and 2.5 mg / L BAP) for regeneration or selection. Excess Agrobacterium was killed using ticarcillin (250 mg / L). Kanamycin sulfate (300 mg / L) for the pSITE-4NB construct, or hygromycin B (40 mg / L) and the gene-editing construct for pCAMBIA1305.1, were used as transformation selections, respectively. The regenerated shoots were removed from the leaf discs and transferred to MS medium containing ticarcillin (250 mg / L) for rooting. After 3 or 4 roots (at least 2 cm) had developed, the plantlets were transplanted into soil.

[0515] result We evaluated the gene function of Nic1 ERFs using hairy root transformation. Chemical analysis revealed that all constructs increased alkaloid levels in LA hairy roots (Figure 9). However, we failed to collect hairy roots for Nitab4.5_0004620g0090.3. Hairy roots transformed with this gene initially developed normally but gradually turned black during subculturing and were unable to survive. The lethal effect may have been caused by high levels of nicotinic acid in these hairy roots and needs further investigation. Based on hairy root transformation, at least six ERFs at the Nic1 locus are capable of regulating alkaloid biosynthesis with different effects: Nitab4.5_0003090g0030.1(ERF199); Nitab4.5_0003665g0040.1(JRE 5L2);Nitab4.5_0004620g0010.1(ERF210);Nitab4.5_0004620g0030.1(ERF91);Nitab4.5_0004620g0080.1(ERF29) and Nitab4.5_0004620g0095.1(ERF16). [Examples]

[0516] Expression of the Nic1 ERF gene in plants with stable gene transfer We also validated the function of Nic1 ERF using a stable transformation assay. Overexpression of Nic1 ERF under 35S promoter control yielded at least 12 transgenic plants. Chemical analysis was performed on Nitab4.5_0003090g0030.1, Nitab4.5_0004620g0080.1, and Nitab4.5_000462 in LA plants. 0 We revealed that overexpression of g0090.3 significantly increased the alkaloid content. In particular, overexpression of Nitab4.5_0003090g0030.1 resulted in alkaloid levels comparable to those of HI plants.

[0517] We transposed a genome sequence containing the native promoter, coding region, and 3'-UTR (untranslated region) for Nitab4.5_0003090g0030.1 into LA plants. Chemical analysis in T0 plants showed that alkaloid production was significantly improved by gene transformation with Nitab4.5_0003090g0030.1. It is noteworthy that alkaloid levels in transformants containing the Nitab4.5_0003090g0030.1 genome construct were slightly lower than those of HI, which may be due to hemizygosity in T0 plants. [Examples]

[0518] Induced EMS Nic1 variant Complementation studies using stable transformation of Nic1 ERFs demonstrated that the nic1 phenotype can be repaired. However, we wanted to determine whether knockout of any of these genes could phenotypically mimic the nic1 phenotype itself.

[0519] Therefore, approximately 2000 EMS mutant lines were generated from the TI1068 variety for the purpose of identifying tobacco plants containing the mutated gene. From Table 1 above, mutations in the ERF gene in the desired Nic1 region and mutations in ERF189 (Nitab4.5_0015055g0010.2) from the Nic2 region were identified by Rigola, D., van Oeveren, J., Janssen, A., Bonne, A., Schneiders, H., van der Poel, HJA, van Orsouw, N. Identification was made by DNA sequencing using pooled M2 lineages derived from this population, as described in J., Hogers, RCJ, de Both, MTJ, and van Eijk, MJT (2009) High-Throughput Detection of Induced Mutations and Natural Variation Using KeyPoint™ Technology. PLOS ONE 4, e4761. https: / / doi.org / 10.1371 / journal.pone.0004761 (incorporated herein by reference).

[0520] M2 mutant lines derived from the M2 seed pool, which were identified as containing the mutation in Nitab4.5_0003090g0030.1, were grown in a greenhouse, and at 11 weeks of age, their alkaloid content was assayed as described above.

[0521] Homozygous and heterozygous M2 mutant lines of this gene were identified by DNA sequencing, and ineffective segregates were used as control plants for each mutant line. Mean alkaloid levels were determined from each genotype class, and significant differences between the wild type and the mutant / heterozygous groups were determined by Student's t-test (Figure 84). The minimum values ​​from four individuals in each genotype class were used for this analysis. The analysis is for immature stop codons (amino acid change Q25). *We showed that a homozygous mutation in Nitab4.5_0003090g0030.1, which causes [the specified mutation], resulted in plants with approximately one-third the alkaloid content compared to wild-type controls. [Examples]

[0522] gene editing We determined whether it was possible to generate plants equivalent to the LA line by using gene editing to mutate the Nic1 ERF gene in an HI background.

[0523] A heterozygous mutant line called L1, caused by a 1bp insertion of A, was identified in Nitab4.5_0003090g0030.1 at T0.

[0524] An early stop codon was introduced into the mutant allele of Nitab4.5_0003090g0030.1 in L1, and gene function was disrupted accordingly (Figure 85). To better characterize the phenotypic effect induced by Nitab4.5_0003090g0030.1, we collected L1 seeds and performed chemical analysis in the T1 generation. The genotypes of T1 plants, wild type (WT-T1), heterozygote (Het-T1), and homozygous mutant (Mut-T1) were determined by DNA sequencing. The total alkaloid levels of WT-T1 were comparable to those of HI plants (Figure 86A).

[0525] While the reduction in alkaloid levels in Het-T1 plants was not statistically significant, on average, the values ​​for these phenotypes were reduced to half the levels of WT-T1 plants. For the homozygous mutant Mut-T1, the alkaloid content was barely recognizable and was significantly lower than that of LA plants (Figure 86A). As can be seen in Figure 86B, knockout of Nitab4.5_0003090g0030.1 in the HI line resulted in alkaloid levels nearly 1 / 10 of those of LA plants.

[0526] To understand why the alkaloid levels of Mut-T1 were significantly lower than those of LA plants, we examined the sequence and expression level polymorphisms of the Nitab4.5_0003090g0030.1 allele between HI and LA lines.

[0527] We determined the coding sequence approximately 2.2kb upstream of the start codon and the sequence approximately 1.2kb downstream of the stop codon, but no SNPs were identified between these two alleles. Real-time PCR analysis was performed using Nitab4.5_00030. We revealed that 90g0030.1 is specifically expressed in roots, which explains why nicotine biosynthesis is root-specific.

[0528] In comparison with the HI line, the expression of Nitab4.5_0003090g0030.1 is downregulated in the LA line (Figure 87). Therefore, the phenotypic difference between HI and LA is introduced by the different expression of the Nic1 gene.

[0529] Weak expression of Nic1 results in low alkaloid levels of LA, but we expect that ultra-low alkaloid content can be achieved by complete disruption of Nic1, which is consistent with our observations in Mut-T1 plants (Figure 86B).

[0530] All publications referenced in the above specification are incorporated herein by reference. Various modifications and variations of the methods and systems described in the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the present invention has been described in relation to certain preferred embodiments, it should be understood that the claims of the present invention should not be excessively limited to such specific embodiments. In fact, biochemistry and biotechnology Various modifications of the described form for carrying out the invention, which are obvious to those skilled in the art of the science or related fields, are intended to be within the scope of the following claims.

[0531] (References) Adams, A. C., De Godoy Lusso, M. S., Pramod, S., and Xu, D. (2016).Compositions and Methods for Producing Tobacco Plants and Products Having AlteredAlkaloidLevels. US patent application 20160374387A1. Bindler, G., Plieske, J., Bakaher, N., Gunduz, I., Ivanov, N., Hoeven,R.,Ganal, M., and Donini, P. (2011). A high density genetic map of tobacco(Nicotianatabacum L.) obtained from large scale microsatellite markerdevelopment.Theoretical and Applied Genetics 123, 219-230. Collins, G. B., Legg, P. D., and Kasperba.Mj (1974). Use ofAnther-DerivedHaploids in Nicotiana.1. Isolation of breeding lines differingin totalalkaloid content. Crop Science 14, 77-80. Chakrabarty, R., Banerjee, R., Chung, S. M., Farman, M., Citovsky,V.,Hogenhout, S. A., Tzfira, T., and Goodin, M. (2007). PSITE vectors for stableintegration or transient expression of autofluorescent protein fusions in plants:probingNicotiana benthamiana-virus interactions. Molecular Plant-MicrobeInteractions20, 740-50. Edwards, K. D., Fernandez-Pozo, N., Drake-Stowe, K., Humphry M., Evans, A.D.,Bombarely, A., Allen, F., Hurst, R., White, B., Kernodle, S. P., Bromley,J.R., Sanchez-Tamburrino, J. P., Lewis, R. S., and Mueller, L.A. (2017)Areference genome for Nicotiana tabacum enables map-based cloning ofhomeologousloci implicated in nitrogen utilization efficiency. BMC Genomics 18,448. Hibi, N., Higashiguchi, S., Hashimoto, T., and Yamada, Y. (1994).Gene-Expression in Tobacco Low-Nicotine Mutants. Plant Cell 6, 723-735. Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D., Rogers, S. G.,andFraley, R. T. (1985). A simple and general method for transferring genesintoplants. Science 227, 1229-1231. Kajikawa, M., Sierro, N., Kawaguchi, H., Bakaher, N., Ivanov, N. I.,Hashimoto,T., and Shoji, T. (2017). Genomic insights into the evolution of thenicotinebiosynthesis pathway in tobacco. Plant Physiology 174, 999-1011. Kidd, S. K., Melillo, A. A., Lu, R. H., Reed, D. G., Kuno, N., Uchida,K.,Furuya, M., and Jelesko, J. G. (2006). The A and B loci in tobacco regulateanetwork of stress response genes, few of which are associated withnicotinebiosynthesis. Plant Mol Biol 60, 699-716. Langmead, B., and Salzberg, S. L. (2012). Fast gapped-read alignment withBowtie 2. Nat Methods 9, 357-9. Legg P, Chaplin J, Collins G. (1969). Inheritance of percent total alkaloidsinNicotiana tabacum L.: populations derived from crosses of low alkaloidlineswith burley and flue-cured varieties. Journal of Heredity 60: 213-217. Legg P., and G., C. (1971). Inheritance of percent total alkaloids inNicotianatabacum L. II. genetic effects of two loci in Burley21 X LA Burley21populations. Canadian Journal of Genetics and Cytology 13, 287-291. Legg PD, Collins GB, Litton CC. 1970. Registration of La Burley-21TobaccoGermplasm. Crop Science 10(2): 212. McKenna, A., Hanna, M., Banks, E., Sivachenko, A., Cibulskis, K., Kernytsky,A., Garimella, K., Altshuler, D., Gabriel, S., Daly, M., and DePristo, M. A.(2010).The Genome Analysis Toolkit: a MapReduce framework for analyzingnext-generationDNA sequencing data. Genome Research 20, 1297-303. Neff, M. M., Turk, E., and Kalishman, M. (2002). Web-based primer design forsin gle nucleotide polymorphism analysis. Trends in Genetics 18, 613-5. Nielsen, M. T., Legg, P. D., and Collins, G. B. (1988). Registration of HIandLI burley 21 tobacco germplasms. Crop Science 28, 206-207. Qin, Q., Li, D., Dai, X., Zhao, P., Miller, R., Jack, A., and Yang, S.(2015)Development of user-friendly marker for Nic2 in tobacco. SRC, TobaccoScienceResearch Conference, 69, abstract 79. Reed, D. G., and Jelesko, J. G. (2004). The A and B loci of Nicotianatabacumhave non-equivalent effects on the mRNA levels of four alkaloidbiosyntheticgenes. Plant Science 167 1123-1130. Rigola, D., van Oeveren, J., Janssen, A., Bonne, A., Schneiders, H., vanderPoel, H. J. A., van Orsouw, N. J., Hogers, R. C. J., de Both, M. T. J., andvanEijk, M. J. T. (2009) High-Throughput Detection of Induced Mutations andNaturalVariation Using KeyPoint TM Technology. PLOS ONE 4,e4761.https: / / doi.org / 10.1371 / journal.pone.0004761. Rushton PJ, Bokowiec MT, Han SC, Zhang HB, Brannock JF, Chen XF, LaudemanTW,Timko MP. 2008. Tobacco transcription factors: Novel insightsintotranscriptional regulation in the Solanaceae. Plant Physiology 147: 280-295. Sahoo, D. K., Dey, N., and Maiti, I. B. (2014). pSiM24 is a novel versatilegene expression vector for transient assays as well as stable expression offoreigngenes in plants. PLoS One 9, e98988. Shoji, T., Kajikawa, M., and Hashimoto, T. (2010). Clusteredtranscriptionfactor genes regulate nicotine biosynthesis in tobacco. The Plant Cell 22,3390-3409.Sierro,N., Battey, J. N., Ouadi, S., Bakaher, N., Bovet, L., Willig,A., Goepfert, S.,Peitsch, M. C., and Ivanov, N. V. (2014). The tobacco genomesequence and itscomparison with those of tomato and potato. NatureCommunications 5, 3833.Stam,P. (1993). Construction of integrated geneticlinkage maps by means of a newcomputer package - Joinmap. Plant Journal 3,739-744. Valleau W. 1949. Breeding low-nicotine tobacco. Journal of AgriculturalResearch 78: 171-181. Van Ooijen J. W. (2009). MapQTL 6: Software for the mapping ofquantitativetrait loci in experimental populations of diploid species. Wageningen(TheNetherlands): Kyazma BV. Voelckel, C., Krugel, T., Gase, K., Heidrich, N., van Dam, N. M., Winz, R.,andBaldwin, I. T. (2001). Anti-sense expression of putrescineN-methyltransferaseconfirms defensive role of nicotine in Nicotiana sylvestrisagainst Manducasexta. Chemoecology 11, 121-126. Zhu, B., Cai, G., Hall, E. O., and Freeman, G. J. (2007). In-fusionassembly:seamless engineering of multidomain fusion proteins, modular vectors,andmutations. Biotechniques 43, 354-9.

Claims

1. A method for adjusting the alkaloid content of a plant or a part thereof, or a plant cell culture, wherein the method comprises modifying the plant or plant cell culture by adjusting the expression of at least one Nic1 ERF gene or the activity of a protein encoded by at least one Nic1 ERF gene, (a) The at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 28, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 28 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 28; or (b) The Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25; The method wherein the plant or plant cells are derived from the genus Nicotiana.

2. A method for adjusting the content of tobacco-specific nitrosamine (TSNA) precursors in a tobacco plant or a part thereof, wherein the method comprises modifying the plant or plant cell culture by adjusting the expression of at least one Nic1 ERF gene or the activity of a protein encoded by at least one Nic1 ERF gene, (a) The at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 28, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 28 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 28; or (b) The Nic1 ERF gene includes the nucleotide sequence presented in SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25; The aforementioned method.

3. The use of at least one Nic1 ERF gene for regulating the alkaloid content of plant cells, plants or parts thereof, or plant cell cultures, (a) The at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 28, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 28 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 28; or (b) The Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25; The use wherein the plant or plant cells are derived from the genus Nicotiana.

4. A method for producing a plant or part thereof, a plant cell culture, a leaf, a cut and harvested leaf, a treated leaf, or a cut and treated leaf, wherein the method comprises modifying the plant or plant cell culture to regulate the expression of at least one Nic1 ERF gene or the activity of a protein encoded by at least one Nic1 ERF gene. (a) The at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 28, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 28 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 28; or (b) The Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25; The method wherein the plant or plant cells are derived from the genus Nicotiana, and the treated leaves are treated by drying, fermentation, sterilization, or a combination thereof.

5. The method according to claim 4, wherein the alkaloid content is regulated compared to a plant or plant cell culture that has not been modified to regulate the expression of at least one Nic1 ERF gene or the activity of a protein encoded by at least one Nic1 ERF gene.

6. A modified plant or a part thereof, or a modified plant cell culture, in which the alkaloid content is adjusted compared to an unmodified plant or an unmodified plant cell culture, wherein the modification is the expression of at least one Nic1 ERF gene or the regulation of the activity of a protein encoded by at least one Nic1 ERF gene. (a) The at least one Nic1 ERF gene encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 28, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 28 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 28; or (b) The Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25; The aforementioned plant or plant cells are derived from the genus Nicotiana. The modified plant or a part thereof, or a modified plant cell culture.

7. Seeds that can be obtained from the modified plant described in claim 6, or from a plant produced by the method described in claim 4 or 5.

8. A modified plant or a part thereof, or a modified plant cell culture, or a seed according to claim 7, wherein the alkaloid content of the plant is reduced compared to a plant or plant cell culture that has not been modified to regulate the expression of at least one Nic1 ERF gene or the activity of a protein encoded by at least one Nic1 ERF gene.

9. A modified plant or a part thereof, or a modified plant cell culture, or a seed according to claim 8, wherein the expression of at least one Nic1 ERF gene or the activity of at least one protein encoded by the Nic1 ERF gene is reduced.

10. A modified plant or a part thereof, or a modified plant cell culture, according to claim 6, 8, or 9, or a seed according to any one of claims 7 to 9, wherein the total alkaloid content of the plant or plant cell culture is adjusted.

11. A modified plant or a part thereof, or a modified plant cell culture, according to any one of claims 6 or 8 to 10, or a seed according to any one of claims 7 to 10, wherein the content of one or more alkaloids selected from nicotine, nornicotine, anabasine, myosmin, and anatabin is adjusted.

12. A modified plant or a part thereof according to claim 11, or a modified plant cell culture, or a seed according to claim 11, wherein the nicotine content is reduced.

13. (a) at least one Nic1 ERF gene encodes a polypeptide containing the amino acid sequence presented in SEQ ID NO: 28; or (b) At least one Nic1 ERF gene comprises the nucleotide sequence presented in SEQ ID NO: 25; A modified plant or a part thereof according to any one of claims 6 and 8 to 12, or a modified plant cell culture, or a seed according to any one of claims 7 to 12.

14. Additional ERF genes are regulated, (a) The additional ERF gene is at least one Nic2 ERF gene and encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72 by 1 to 10 amino acids, and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, or SEQ ID NO: 72; or (b) The additional ERF gene is at least one Nic2 ERF gene and includes the nucleotide sequence presented in SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49, SEQ ID NO: 53, SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65, or SEQ ID NO: 69; A modified plant or a part thereof according to any one of claims 6 and 8 to 13, or a modified plant cell culture, or a seed according to any one of claims 7 to 13.

15. Additional ERF genes are regulated, (a) The additional ERF gene is at least one Nic2 ERF gene and includes the nucleotide sequence presented in SEQ ID NO: 69, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 69; or (b) The additional ERF gene is at least one Nic2 ERF gene that encodes a polypeptide comprising the amino acid sequence presented in SEQ ID NO: 72, or a functional variant or ortholog thereof; the functional variant differs from the amino acid sequence presented in SEQ ID NO: 72 by 1 to 10 amino acids; and the ortholog has at least 90% sequence identity with the amino acid sequence presented in SEQ ID NO: 72; A modified plant or a part thereof according to any one of claims 6 and 8 to 14, or a modified plant cell culture, or a seed according to any one of claims 7 to 14.

16. Use of a modified plant or a part thereof according to any one of claims 6 and 8 to 15, or a modified plant cell culture, or a plant produced by the method of claim 4 or 5, for the purpose of breeding plants.

17. Use of a modified plant or a part thereof according to any of claims 6 and 8 to 15, or a modified plant cell culture, or a plant produced by the method described in claim 4 or 5, for the manufacture of a product.

18. The use of a modified plant or a part thereof according to any of claims 6 and 8 to 15, or a plant produced by the method described in claim 4 or 5, for the purpose of producing crops.

19. Use of a modified plant or a part thereof according to any one of claims 6 and 8 to 15, or a plant produced by the method of claim 4 or 5, for the production of leaves.

20. Harvested leaves that can be obtained from a modified plant according to any one of claims 6 and 8-15, or from a plant propagated from seeds according to any one of claims 7-15, or from a plant obtained by the use according to any one of claims 3, 16, and 18, or from a plant produced by the method of claim 4 or 5.

21. The harvested leaves according to claim 20, wherein the harvested leaves are cut and harvested leaves.

22. Treated leaves that have been treated by drying, fermentation, sterilization, or a combination thereof, Can it be obtained from plants that can be obtained from the use described in claim 3, 16, or 18? This can be obtained by processing the modified plant according to any one of claims 6 and 8 to 15, It can be obtained from a plant propagated from seeds according to any one of claims 7 to 15, This can be obtained by processing the harvested leaves as described in claim 20 or 21, or Can be obtained from a plant produced by the method described in claim 4 or 5. The treated leaves.

23. The treated leaf according to claim 22, which is a leaf that has been cut.

24. A dried tobacco material made from a modified plant or a part thereof, or an extract thereof, as described in any of claims 6 and 8 to 15.

25. A tobacco blend comprising the dried tobacco material described in claim 24.

26. A modified plant or a part thereof according to any one of claims 6 and 8 to 15, or a modified plant cell culture according to any one of claims 6 and 8 to 15; A plant propagated from seeds according to any one of claims 7 to 15 or a part thereof, a harvested leaf according to claim 20 or 21, The treated leaves according to claim 22 or 23, or Plants produced by the method described in claim 4 or 5 Tobacco industrial products prepared from tobacco.

27. Tobacco products (a) Flammable smoking articles; (b) Smokeless tobacco products; (c) Non-flammable aerosol supply system; The tobacco product according to claim 26.

28. Use of the modified plant cell culture according to any one of claims 6 and 8 to 15 for adjusting the alkaloid content in the plant cell culture.

29. A flammable smoking article, a non-flammable aerosol dispensing system, a smokeless tobacco product, or a tobacco heating device comprising a modified plant or a part thereof according to any one of claims 6 and 8 to 15, or a modified plant cell culture according to any one of claims 6 and 8 to 15, or a dried tobacco material according to claim 24, or a tobacco blend according to claim 25.

30. The use of a nucleotide sequence of at least one Nic1 ERF gene selected from SEQ ID NO: 25, or an ortholog thereof having at least 90% sequence identity with the nucleotide sequence presented in SEQ ID NO: 25, for selecting a plant having a controlled alkaloid content and / or a controlled content of tobacco-specific nitrosamine (TSNA) precursors, wherein the plant is of the genus Nicotiana.

31. A mutant plant of the genus Nicotiana having a genetic mutation in the nucleotide sequence of at least one Nic1 ERF gene, wherein the Nic1 ERF gene without the genetic mutation contains a nucleotide sequence selected from SEQ ID NO: 5 or SEQ ID NO:

25. The mutant plant wherein the genetic mutation reduces the expression of the at least one Nic1 ERF gene or the activity of the protein encoded by the at least one Nic1 ERF gene, and the mutant plant has a reduced alkaloid content and / or a reduced tobacco-specific nitrosamine (TSNA) precursor content compared to an equivalent plant without the genetic mutation.

32. The offspring or seeds of the mutant plant according to claim 31.

33. Harvested leaves, treated leaves, or dried tobacco material produced from a plant of the genus Nicotiana containing a modification in the nucleotide sequence of at least one Nic1 ERF gene, The aforementioned unmodified at least one Nic1 ERF gene contains the nucleotide sequence of SEQ ID NO: 25, The modification reduces the expression of the at least one Nic1 ERF gene or the activity of the protein encoded by the at least one Nic1 ERF gene. The plant has a reduced alkaloid content and / or a reduced tobacco-specific nitrosamine (TSNA) precursor content compared to an equivalent plant that does not have the modification in at least one Nic1 ERF gene, and The treated leaves are subjected to drying, fermentation, sterilization, or a combination thereof. The harvested leaves, processed leaves, or dried tobacco material.