Methods and compositions for treating amyloid deposition diseases
Humanized and chimeric antibodies targeting amyloid fibrils provide a therapeutic approach to reduce amyloid deposits and improve organ function in patients with primary amyloidosis, addressing the limitations of existing treatments by effectively clearing deposits and improving survival rates.
Patent Information
- Application Number
- JP2022063456
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2018-03-02
- Filing Date
- 2022-04-06
- Publication Date
- 2026-08-26
- Estimated Expiration
- 2038-07-24
AI Technical Summary
Current treatments for amyloid deposition diseases, particularly primary amyloidosis (AL), are ineffective in removing existing deposits and have limited efficacy due to asymptomatic progression until significant deposition occurs, leading to a high mortality rate with a 5-year survival rate of approximately 28%.
Development of humanized and chimeric antibodies that specifically bind to amyloid fibrils, targeting them for clearance by the immune system, using compositions and methods that include administering therapeutically effective doses of these antibodies to patients, thereby reducing amyloid deposits and improving myocardial and renal function.
The antibodies effectively reduce amyloid deposits, improving myocardial function by decreasing NT-proBNP levels and urinary protein levels, offering clinical benefits within weeks and lasting for several months, even in refractory cases, without causing serious adverse events.
Smart Images

Figure 0007911482000014 
Figure 0007911482000015 
Figure 0007911482000016
Abstract
Description
[Technical Field]
[0001] [Reference to sequence listings submitted via EFS-WEB] This application includes a sequence listing submitted electronically via EFS-Web, the entire contents of which are incorporated herein by reference. The ASCII file of this sequence listing, titled "8441-0009-1_ST25", was created on June 15, 2018, and is 17.4 KB in size.
[0002] [Government Rights] This invention was made with the support of the United States Federal Government under Grant FD-U-005110, awarded by the U.S. Food and Drug Administration. Accordingly, the United States Federal Government has certain rights in the invention as described herein and in the claims.
[0003] [Claiming priority] This application claims priority to U.S. Provisional Patent Application No. 62 / 539,821, filed on 1 August 2017, and U.S. Provisional Patent Application No. 62 / 637,609, filed on 2 March 2018, the contents of which are incorporated herein by reference in their entirety.
[0004] The present invention relates to humanized and chimeric (e.g., mouse-human) antibodies and their antigen-binding fragments useful for treating amyloid deposition diseases, particularly primary amyloidosis (AL), pharmaceutical compositions comprising such antibodies, and methods for treating amyloid deposition diseases using such antibodies and pharmaceutical compositions. Furthermore, the present invention relates to methods for treating amyloid deposition diseases with amyloid fibrillation-reactive antibodies. In particular, the present invention relates to methods for improving myocardial function in patients diagnosed with amyloid light chain amyloidosis (ALA), including cardiac involvement (i.e., amyloid deposition in or around the heart). Such patients may have ALA deposits comprising light chain λ amyloid or light chain κ amyloid. Furthermore, patients may have hematologically controlled or uncontrolled diseases. [Background technology]
[0005] The following explanation is provided solely to aid the reader's understanding and does not constitute a description or representation of prior art.
[0006] Natural antibodies are typically heterotetrameric glycoproteins of approximately 150,000 daltons, composed of two identical light chains and two identical heavy chains. Each light chain is linked to a heavy chain by one disulfide bond. The number of additional disulfide bonds between heavy chains varies depending on the antibody isotype. The simplest isotype is IgG, which contains only two light chains and two heavy chains, with the two heavy chains linked by two disulfide bonds. Each heavy chain has a variable domain (V) at one end. H Each light chain has a variable domain (V) at one end. L The antibody has a constant domain at the other end. Each variable domain of the light and heavy chains of the antibody contains three segments called complementarity-determining regions ("CDRs") or hypervariable regions. Each CDR of the light chain, together with the corresponding CDR of the adjacent heavy chain, forms the antigen-binding site of the antibody. Depending on their constant region, light chains have two main types: κ and λ. Both κ and λ light chains can bind to any of the various heavy chain types.
[0007] Amyloid light chain amyloidosis (AL amyloidosis, AL, or ALA), also known as primary amyloidosis, is the most common form of systemic amyloidosis in the United States. The term “amyloidosis” refers to a cluster of diseases that share a common feature: extracellular deposition of pathological insoluble fibrillary proteins in organs and tissues (Rodney et al., NEJM, 25:898). Amyloidosis is caused by dysfunction of antibody-producing cells in humans, leading to the production of abnormal protein fibrils, which aggregate to form insoluble amyloid deposits in organs and tissues. The type of amyloidosis is determined by the nature of the precursor proteins that form the fibrillary deposits. In primary amyloidosis, the fibrils contain fragments of immunoglobulin light chains, while in secondary amyloidosis, the fibrils contain amyloid A protein. Modern classifications of amyloidosis are based on the nature of the precursor plasma proteins that form the fibrillary deposits.
[0008] The precursor plasma proteins are diverse and unrelated. Nevertheless, all precursor deposits produce amyloid deposits that share a common typical β-pleated sheet structure, which is responsible for the typical staining properties of fibril deposits. The final stage of amyloidosis is the deposition of amyloid fibrils in the patient's organs. Amyloidosis has a high mortality rate, with the current 5-year survival rate being approximately 28%.
[0009] To date, the treatment of AL has focused on reducing the synthesis of amyloid-forming precursor light chains by attacking dysfunctional cells through conventional or high-dose cytotoxic chemotherapy. However, this approach has two drawbacks. First, fibrillary deposits are usually asymptomatic until significant deposition occurs. Therefore, it is unlikely that treatment will be administered before significant deposition has already occurred. Second, this treatment is at best effective in stopping the production of abnormal precursor proteins and is not effective in removing existing deposits, and the prognosis for AL patients remains very poor due to the persistence (or progression) of pathological deposits (Solomon et al., Int.J.Exp.Clin.Invest., 2:269). [Overview of the Initiative] [Problems that the invention aims to solve]
[0010] As a result, the therapeutic targeting and clearance of amyloid deposits is a medically intriguing area. However, the FDA has not yet approved any such therapeutic products, leaving a significant unmet medical need. The compositions and methods described herein fulfill this need. [Means for solving the problem]
[0011] This specification describes compositions and methods for treating amyloid deposition diseases, particularly primary (AL) amyloidosis. The compositions and methods described herein utilize humanized or chimeric antibodies or fragments thereof that specifically bind to amyloid fibrils (e.g., amyloid light chain fibrils) and target the fibrils for clearance by the immune system.
[0012] In one embodiment, the composition and method comprises a humanized or chimeric antibody (e.g., a mouse-human chimeric antibody) useful for the treatment of amyloid deposition diseases, particularly primary (ALA) amyloidosis. In some embodiments, the antibody described herein includes SEQ ID NO: 47. K V containing the region and sequence number 48 H It has a region. In some embodiments, the antibody contains a constant region derived from human IgG1. In some embodiments, the antibody binds to amyloid fibrils with higher affinity than its mouse equivalent. In some embodiments, the antibody has a constant region derived from human IgG1. K Region and V of Sequence ID 35 H The antibody binds to epitopes expressed by the β-pleated sheet structure of amyloid fibrils with higher affinity than mouse antibodies containing the region. In some embodiments, the antibody also binds to κ and λ amyloid fibrils in vivo.
[0013] In another embodiment, the present invention provides a pharmaceutical composition comprising a humanized or chimeric antibody as described herein and a pharmaceutically acceptable carrier.
[0014] Chimeric antibodies useful in this method and pharmaceutical composition may be produced by co-transfection of mammalian cells with vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200, or by transfection of mammalian cells with the supervector construct pG1KD200-11-1F4. In some embodiments, co-transfection of vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200 or transfection of the supervector construct pG1KD200-11-1F4 occurs in COS cells. The produced antibody is referred to as a "chimeric 11-1F4 antibody."
[0015] In another embodiment, the present invention provides a method for treating or improving amyloid deposition diseases, such as primary (AL) amyloidosis in humans requiring treatment, by administering a therapeutically effective amount of at least one of the antibodies or fragments described herein that treat or improve the symptoms of amyloid deposition diseases and / or diseases to a human patient requiring such treatment or improvement. In some embodiments, the antibodies described herein and a pharmaceutically acceptable carrier may be administered.
[0016] In some embodiments, the amyloid deposition disease is primary amyloidosis. In some embodiments, the antibody is approximately 500 mg / m². 2 The following doses are administered. In some embodiments, the effective dose of the chimeric 11-1F4 antibody is approximately 2200 mg. In some embodiments, the effective dose is approximately 1 mg / kg to 50 mg / kg.
[0017] In some embodiments, primary amyloidosis involves the involvement of at least one organ or tissue selected from the group consisting of the heart, kidneys, liver, lungs, gastrointestinal tract, nervous system, musculoskeletal system, soft tissues, and skin.
[0018] In some embodiments, if amyloidosis develops in the heart, the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) levels may decrease by at least about 30% or about 40% compared to baseline levels after administration of the antibody. In some embodiments, the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) levels may decrease to less than about 9100 ng / L, less than about 8000 ng / L, less than about 7000 ng / L, less than about 6000 ng / L, or less than about 5000 ng / L after administration of the antibody. In some embodiments, the patient is classified as New York Heart Association (NYHA) functional classification class II or III before administration of the antibody and is classified as class I after administration of the antibody.
[0019] In some embodiments, when amyloidosis develops in the kidneys, the patient's urinary protein levels may decrease by at least about 30% or about 40% compared to baseline levels after administration of the antibody. In some embodiments, the patient's urinary protein may decrease to less than about 7000 mg / 24 hours, less than about 6000 mg / 24 hours, less than about 5000 mg / 24 hours, or less than about 4000 mg / 24 hours after administration of the antibody.
[0020] In some embodiments, administration of the antibody does not cause serious adverse events.
[0021] This invention provides a method for treating ALA, including cardiac involvement. The method described herein can uniquely provide beneficial clinical outcomes in a patient population previously considered untreatable due to extremely short life expectancy, within approximately three weeks of initiating treatment.
[0022] In one aspect, the present invention provides a method of improving myocardial function in a patient diagnosed with amyloid light chain amyloidosis (ALA) including cardiac involvement. The method includes administering a therapeutically effective amount of a humanized or chimeric antibody or an antigen-binding fragment thereof to a patient diagnosed with ALA including cardiac involvement. The antibody or antigen-binding fragment has a variable heavy chain (V H ) having a complementarity-determining region (CDR) H1 comprising SEQ ID NO: 52, a CDRH2 comprising SEQ ID NO: 53, and a CDRH3 comprising SEQ ID NO: 54, and a variable light chain (V K ) having a CDRL1 comprising SEQ ID NO: 49, a CDRL2 comprising SEQ ID NO: 50, and a CDRL3 comprising SEQ ID NO: 51. Thereby, the myocardial function of the patient is improved within about 3 weeks from the administration of the antibody or its antigen-binding fragment.
[0023] In another aspect, the present invention provides a method of monitoring improvement of myocardial function in a patient diagnosed with light chain amyloidosis (ALA) including cardiac involvement. The method includes observing improvement of myocardial function in a patient diagnosed with ALA including cardiac involvement within about 3 weeks from the administration of a therapeutically effective amount of a humanized or chimeric 11-1F4 antibody or an antigen-binding fragment thereof to the patient.
[0024] In another aspect, the present invention provides a method of treating amyloid light chain amyloidosis (ALA) including cardiac involvement in a patient. In this method, ALA is not hematologically controlled. The method includes administering a therapeutically effective amount of a humanized or chimeric antibody or an antigen-binding fragment thereof to a patient having ALA characterized by cardiac involvement and lack of hematological control. The antibody or its antigen-binding fragment has a variable heavy chain (V H ) having a complementarity-determining region (CDR) H1 comprising SEQ ID NO: 52, a CDRH2 comprising SEQ ID NO: 53, and a CDRH3 comprising SEQ ID NO: 54, and a variable light chain (V K ) having a CDRL1 comprising SEQ ID NO: 49, a CDRL2 comprising SEQ ID NO: 50, and a CDRL3 comprising SEQ ID NO: 51.
[0025] In some embodiments of the above-described model, the antibody or its antigen-binding fragment may be a humanized antibody. In some embodiments, the antibody or its antigen-binding fragment may be a chimeric antibody.
[0026] In some embodiments of the above-described model, the V of the antibody or antigen-binding fragment K The region may include sequence number 47, V H The region may include sequence number 48.
[0027] In some embodiments of the above-described model, the antibody or antigen-binding fragment may include a constant region derived from human IgG1.
[0028] In some embodiments of the above-described aspects, the method may provide an improvement in myocardial function that lasts for at least three months from the administration of the antibody or its antigen-binding fragment. In some embodiments, the improvement may last for four, five, six, seven, eight, nine, ten, eleven, twelve months, or longer.
[0029] In some embodiments of the above-described models, the antibody or its antigen-binding fragment may be administered once, twice, three times, or four times or less within a three-month period. In some embodiments, the antibody or antigen-being fragment may be administered even less frequently, for example, once every two months or once every three months.
[0030] In some embodiments of the above-described aspects, the method provides improvement of myocardial function, which may include improvement of global longitudinal strain (GLS) compared to pre-treatment global longitudinal strain (GLS) levels.
[0031] In some embodiments of the above-described model, the patient exhibits a pretreatment NT-proBNP level greater than 650 pg / mL.
[0032] In some embodiments of the above-described aspects, a therapeutically effective dose or amount of antibody or antibody fragment is effective in causing a decrease in the patient's post-treatment NT-proBNP level of approximately 300 pg / mL or more compared to the patient's pre-treatment NT-proBNP level. In some embodiments, the decrease in NT-proBNP may be approximately 400 pg / mL or more, approximately 500 pg / mL or more, approximately 600 pg / mL or more, approximately 700 pg / mL or more, approximately 800 pg / mL or more, approximately 900 pg / mL or more, or approximately 1000 pg / mL or more.
[0033] In some embodiments of the above-described aspects, the method provides improvement in myocardial function, which may include a decrease of approximately 30% or more in post-treatment NT-proBNP levels compared to pre-treatment NT-proBNP levels.
[0034] In some embodiments of the above-described model, the patient may have recurrent or refractory ALA.
[0035] In some embodiments of the above-described model, ALA may be further characterized as including light chain λ amyloid cardiac involvement. In some embodiments, ALA may also be further characterized as including light chain κ amyloid cardiac involvement.
[0036] In some embodiments of the above-described model, ALA is hematologically uncontrollable. For example, the difference between involved and uninvolved free light chains in the subject's serum may be greater than 40 mg / L, or the subject may have detectable levels of toxic amyloid precursor protein in its blood or serum.
[0037] In some embodiments of the above-described model, the method may further include the step of administering a chemotherapy compound to a patient.
[0038] In another embodiment, the present invention provides a method for detecting amyloid deposition disease in a patient suspected of having amyloid deposition disease by administering a labeled antibody or an antigen-binding fragment thereof and detecting the presence of the label in the patient. In some embodiments, the label is 124 A radiative marker such as I may be used, but other types of markers can be easily conceived by those skilled in the art.
[0039] In another embodiment, the present invention provides a method for treating patients with amyloid deposition disease. The method comprises administering a therapeutically effective amount of a humanized or chimeric 11-1F4 antibody or its antigen-binding fragment to a patient at a frequency less than once a month. For example, in some embodiments, treatment may require administering a therapeutically effective amount of a humanized or chimeric 11-1F4 antibody or its antigen-binding fragment to a patient only once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, or once a year.
[0040] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody includes a constant region derived from human IgG1.
[0041] In some embodiments of this model, the amyloid deposition disease is primary light chain (AL) amyloidosis, and the disease may include aggregates of λ light chain fibrils. In some embodiments, the presence of λ light chain fibrils is significantly reduced after administration of the antibody.
[0042] In some embodiments of this model, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody or antigen-binding fragment is 500 mg / m². 2 The following applies. In some embodiments, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody or antigen-binding antibody fragment is approximately 2200 mg. In some embodiments, the therapeutically effective dose is approximately 1 mg / kg to 50 mg / kg.
[0043] In some embodiments of this model, a therapeutically effective dose of humanized or chimeric 11-1F4 mAb or antigen-binding fragment is administered every two months, every three months, every four months, every five months, or every six months. In some embodiments, a therapeutically effective dose of chimeric 11-1F4 mAb or antigen-binding fragment is administered only every six months or once a year.
[0044] In another embodiment, the present invention provides a method for treating patients with primary light chain (AL) amyloidosis involving the heart. The method comprises administering to a patient a dose of a humanized or chimeric 11-1F4 antibody effective in causing at least a 30% reduction in the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) levels after administration of the chimeric 11-1F4 antibody compared to pre-treatment levels. In some embodiments, AL amyloidosis is refractory.
[0045] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody includes a constant region derived from human IgG1.
[0046] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody is administered once a month. In some embodiments, the humanized or chimeric 11-1F4 antibody is administered once a week.
[0047] In some embodiments of this model, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is 500 mg / m². 2 The following applies. In some embodiments, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is approximately 2200 mg. In some embodiments, the effective dose is approximately 1 mg / kg to 50 mg / kg.
[0048] In some embodiments of this model, the reduction in NT-proBNP persists in the patient for at least about 6 months after administration of the chimeric 11-1F4 antibody.
[0049] In another embodiment, the present invention provides a method for treating patients with primary light chain (AL) amyloidosis involving the kidneys. The method comprises administering to a patient a dose of a humanized or chimeric 11-1F4 antibody or antigen-binding antibody fragment effective in causing at least a 40% reduction in the patient's proteinuria after administration of the humanized or chimeric 11-1F4 antibody compared to pre-treatment levels. In some embodiments, AL amyloidosis is refractory.
[0050] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody includes a constant region derived from human IgG1.
[0051] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody is administered once a month. In some embodiments, the humanized or chimeric 11-1F4 antibody is administered once a week.
[0052] In some embodiments of this model, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is 500 mg / m². 2 The following applies. In some embodiments, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is approximately 2200 mg. In some embodiments, the therapeutically effective dose is approximately 1 mg / kg to 50 mg / kg.
[0053] In some embodiments of this model, the reduction in proteinuria persists in the patient for at least about 6 months after administration of the chimeric 11-1F4 antibody.
[0054] In another embodiment, the present invention provides a method for reducing the amount of κ or λ light chain fibril aggregate deposits in patients who require a reduction in such amounts. The method comprises (a) V containing SEQ ID NO: 47 K (b) V containing sequence number 48 HThe procedure includes the step of administering to a patient an antibody having (c) a human IgG1 constant region, and (c) a certain dose, wherein the administration of the antibody is effective in reducing the amount of κ or λ light chain fibril aggregates deposited in the patient.
[0055] In some embodiments of this model, primary amyloidosis consists of λ light chain fibril aggregates. In some embodiments, primary amyloidosis consists of κ light chain fibril aggregates. In other embodiments, primary amyloidosis consists of κ and λ light chain fibril aggregates.
[0056] In some embodiments of this model, the humanized or chimeric 11-1F4 antibody is administered once a month. In some embodiments, the humanized or chimeric 11-1F4 antibody is administered once a week.
[0057] In some embodiments of this model, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is 500 mg / m². 2 The following applies. In some embodiments, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody is approximately 2200 mg. In some embodiments, the therapeutically effective dose is approximately 1 mg / kg to 50 mg / kg.
[0058] In another embodiment, the present invention provides a method for treating AL amyloidosis. The method comprises the step of administering a monoclonal containing a complementation-determining region (CDR) of an 11-1F4 antibody to a patient having AL amyloidosis. In this method, the antibody is not mouse 11-14F.
[0059] In some embodiments of this model, the antibody may be a mouse-human chimeric antibody.
[0060] In some embodiments of this model, the antibody includes the human IgG1 constant region.
[0061] In any of the several embodiments of the method described above, the patient's organ dysfunction decreases after administration of the antibody. In any of the several embodiments of the method described above, the patient shows signs of a therapeutic response within 5 weeks, sometimes within 4 weeks, sometimes within 3 weeks, and sometimes within 2 weeks after treatment. In some other embodiments, the patient shows signs of a therapeutic response within approximately 1 week after treatment.
[0062] The general description above and the detailed description below are illustrative and explanatory and are intended to provide further explanation of the present invention. [Brief explanation of the drawing]
[0063] [Figure 1] This diagram outlines the strategies used to clone mouse VH and VK genes from hybridoma cell lines. [Figure 2] This is a list of the DNA and amino acid sequences (SEQ ID NOs. 39 and 35, respectively) of the mouse 11-1F4 antibody VH region gene. [Figure 3] This is a list of the DNA and amino acid sequences (SEQ ID NOs. 40 and 36, respectively) of the mouse 11-1F4 antibody VK region gene. [Figure 4] This is a map of the immunoglobulin κ light chain expression vector pKN100. It consists of a pSV2 vector fragment and has an SV40 early promoter and an incomplete SV40 late promoter, an SV40 origin of replication and a Co1E1 origin of replication. It also has an ampicillin resistance gene and a neo gene. The incomplete SV40 late promoter drives the neo gene. It also has an HCMVi promoter, multiple cloning sites for inserting immunoglobulin variable region genes (including BamHI and HindIII restriction sites), and cDNA of a human κ constant region gene terminated by a spaC2 termination signal sequence ("Arnie") which is oriented in the same orientation as the κ light chain expression cassette. [Figure 5]This is a map of the immunoglobulin γ1 heavy chain expression vector pG1D200. It consists of a pSV2dhfr vector fragment containing an early SV40 promoter and an incomplete late SV40 promoter, an SV40 origin of replication, and a Co1E1 origin of replication. It also contains the ampicillin resistance gene and the dhfr gene. The incomplete late SV40 promoter drives the dhfr gene, resulting in low expression. This allows for the selection of multiple gene / high-expression level clones using relatively low levels of methotrexate. It also contains an HCMVi promoter fragment, multiple cloning sites, cDNA of the human γ1 constant region gene (intron-free), followed by a spaC2 termination signal sequence ("Arnie"). [Figure 6] This is a list of the DNA and amino acid sequences of the modified mouse 11-1F4 antibody VK region gene (SEQ ID NOs. 42 and 47, respectively), as well as the sequences of the oligonucleotide primers used to modify the VK gene (SEQ ID NOs. 41 and 43, respectively). [Figure 7] This is a list of the DNA and amino acid sequences of the modified mouse 11-1F4 antibody VH region gene (SEQ ID NOs. 45 and 48, respectively), as well as the sequences of the oligonucleotide primers used to modify the VH gene (SEQ ID NOs. 44 and 46, respectively). [Figure 8] This graph shows the results of an amyloid fibril binding ELISA assay. Cos cell supernatant containing chimeric 11-1F4 antibody was tested separately with purified mouse 11-1F4 antibody on the same ELISA plate. Absorbance was read using OD405. New sv = pG1KD200-11-1F4. New cotransfection = 11-1F4VHpG1D200 + 11-1F4VK.pKN100. [Figure 9]This figure shows the clearance of human ALκ and human ALλ amyloidoma in mice treated with mouse 11-1F4. Mice were treated with a single dose (Panel A) or multiple doses (Panel B) of mouse 11-1F4. The results show that mouse 11-1F4 rapidly removes ALκ amyloidoma, but in most cases, multiple doses were required to remove ALλ amyloidoma from the mice. [Figure 10] This figure shows the administration / evaluation scheme for the Phase 1a / b trial of Chimera 11-1F4. Panel A shows the Phase 1a scheme, and Panel B shows the Phase 1b scheme. Panel C shows the doses used in these trials. [Figure 11] This figure shows that administration of chimera 11-1F4 provides improvement in cardiac function in most patients. Panel A shows the results of the Phase 1a / b trial as a bar graph, and Panel B shows the results as a box plot. [Figure 12] This figure shows the cardiac response (NT-proBNP) of an exemplary patient during a Phase 1a / b clinical trial of the c11-1F4 antibody. [Figure 13] This figure shows that administration of chimera 11-1F4 provides improvement in renal function in most patients. Panel A shows the results of the Phase 1a / b trial as a bar graph, and Panel B shows the results as a box plot. [Figure 14] This figure shows the renal response (proteinuria) of an exemplary patient during a Phase 1a / b clinical trial of the chimeric 11-1F4 antibody.
[0064] Figure 15 is a graph showing the change in global strain along the long axis induced by the chimeric 11-1F4 monoclonal antibody.
[0065] Figure 16 is a graph showing the organ response (NT-proBNP) after treatment with the chimeric 11-1F4 antibody in patients who had no organ response before treatment with the chimeric antibody and had a partial hematological response to chemotherapy.
[0066] Figure 17 shows echocardiograms of amyloidosis patients, including cardiac involvement, at 0 and 12 weeks after treatment with chimeric 11-1F4 mAb. [Modes for carrying out the invention]
[0067] The present invention provides methods and compositions comprising humanized antibodies, chimeric antibodies (e.g., mouse-human antibodies), or antigen-binding fragments thereof, useful for administration to a person suffering from amyloid deposition disease or symptoms of the disease for the treatment or improvement of the disease. The antibodies and antibody fragments of the present invention bind to amyloid deposits and activate the patient's immune system to remove the bound substance, while causing little to no human anti-mouse antibody (HAMA) reaction. The present invention also provides pharmaceutical compositions comprising at least one of the antibodies or antibody fragments and a pharmaceutically acceptable carrier, as well as methods for treating or improving amyloidosis and the symptoms of amyloidosis. In the treatment or improvement method, the patient is administered an amount of the antibody or antibody fragment effective in removing at least a portion of the amyloid deposits from the patient's organs to treat or improve amyloid deposition disease and its symptoms.
[0068] Furthermore, the present invention provides a method for treating amyloid deposition diseases. In particular, the present invention relates to improving myocardial function in patients diagnosed with amyloid light chain amyloidosis (ALA), including cardiac involvement. The method comprises administering to a patient a humanized or chimeric antibody (e.g., a mouse-human antibody) or its antigen-binding fragment that binds to amyloid fibril deposits, circulating amyloid, and toxic amyloid precursor proteins. In particular, the present invention shows that when the amyloid fibril-binding antibody described herein is administered to a patient diagnosed with ALA, including cardiac involvement, an improved GLS (global strain) level in the long axis direction compared to pre-treatment, and / or a decrease in NT-proBNP levels compared to pre-treatment NT-proBNP levels. Furthermore, the patient can be effectively treated even when the disease is not hematologically controlled (i.e., the patient has detectable levels of toxic amyloid precursor protein in circulation, or the difference between involved and uninvolved free light chains is greater than 40 mg / L), and regardless of whether the disease involves κ or λ protein fibrils.
[0069] [Definition] It should be understood that this method is not limited to the specific embodiments described herein and may vary. It should also be understood that the terms used herein are used only to describe specific embodiments and are not intended to limit them. The scope of this technology is limited only by the appended claims.
[0070] Certain terms used herein may have the following defined meanings. The singular forms “a,” “an,” and “the” used herein and in the claims include singular and plural references unless the context explicitly indicates otherwise. For example, the term “a cell” includes a single cell and multiple cells (including mixtures thereof).
[0071] As used herein, the word “comprising” means that a composition and method includes the elements listed, but is not intended to exclude other elements. “Consisting essentially of,” when used to define a composition and method, means to exclude other elements that are essentially important to the composition or method. “Consisting of” means to exclude anything beyond trace elements of other components in the composition and substantial method steps defined in the claims. Embodiments defined by each of these transitional terms are included within the scope of the invention. Therefore, methods and compositions are intended to include additional steps and components (comprising), or to include non-essential steps and compositions (consisting essentially of), or to consist solely of the method steps or compositions as described herein (consisting of).
[0072] As used herein, "about" means plus or minus 10% of the given value.
[0073] As used herein, “optional” or “optionally” means that the events or circumstances described below may or may not occur, and that the descriptions include both cases in which such events or circumstances occur and cases in which they do not occur.
[0074] As used herein, the terms “individual,” “patient,” or “subject” may refer to an individual organism, vertebrate, mammal (e.g., a cow, dog, cat, or horse), or a human. In a preferred embodiment, the individual, patient, or subject is a human.
[0075] As used herein, the term “isolated antibody” is intended to refer to an antibody that substantially contains no other antibodies with different antigen specificities (for example, an isolated antibody that specifically binds to amyloid fibrils substantially contains no antibodies that do not bind to amyloid fibrils). However, an isolated antibody that specifically binds to an epitope of amyloid light chain fibrils (e.g., κ and / or λ fibrils) may cross-reactive to other proteins such as amyloid A fibrils, although such antibodies preferably always bind to human amyloid light chain fibrils. Typically, isolated antibodies substantially contain no other cellular material and / or chemicals.
[0076] As used herein, the terms “therapeutically effective amount” and “therapeutic level” refer to the dose or plasma concentration of an antibody administered to a subject requiring the aforementioned treatment, which provides a specific pharmacological effect, i.e., reduces, improves, or eliminates the effects or symptoms of amyloid deposition diseases such as AL amyloidosis. It is emphasized that a therapeutically effective amount or therapeutic level of a drug is not always effective in treating the conditions / diseases described herein, even if such a dose is considered therapeutically effective by those skilled in the art. The therapeutically effective amount may vary based on several factors, including the route of administration and dosage form, the subject’s age and weight, and / or the subject’s condition, including the type and stage of amyloidosis at the start of treatment.
[0077] As used herein with respect to amyloid diseases such as AL amyloidosis, the terms “treatment” or “treating” mean reducing, improving or eliminating one or more symptoms or effects of amyloidosis, including clearance or breakdown of amyloid plaques or deposits; improving organ function of affected organs (e.g., heart, kidneys, liver, etc.); and increasing patient life or five-year survival.
[0078] "Therapeutic response" refers to improvement in at least one measure of amyloid disease, such as a reduction in the size of existing amyloid deposits or plaques, a decrease in the rate of amyloid deposition, or improvement in organ function as measured by standard techniques. For example, in patients with amyloid deposits in the heart, improvement in organ function (i.e., therapeutic response) may be indicated by a decrease in the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) levels or a decrease in the patient's New York Heart Association (NYHA) functional classification level. In patients with amyloid deposits in the kidneys, improvement in organ function (i.e., therapeutic response) may be indicated by a decrease in urinary proteinuria or a decrease in the rate of protein excretion.
[0079] As used herein, the term "humanized antibody" refers to antibodies that include the CDR of antibodies derived from non-human mammals, as well as the framework region (FR) and constant region of human antibodies. Humanized antibodies are useful as therapeutically active ingredients in the therapeutic agents according to the present invention because their antigenicity in the human body is reduced.
[0080] As used herein, “cardiac involvement” means that a patient with amyloid disease has amyloid deposits in the heart. Cardiac amyloid deposits result in the release of NT-proBNP and elevated levels of NT-proBNP in the patient’s blood. Hereinafter, a patient is considered to have cardiac involvement if their NT-proBNP level is greater than 650 pg / mL.
[0081] As used herein, the term "not hematologically controlled" in relation to AL amyloidosis means that the disease is neither in complete remission nor in very good partial remission. For example, if a patient has detectable levels of toxic amyloid precursor protein in circulation (i.e., blood or serum), or if the difference between involved and uninvolved free light chains is greater than 40 mg / L in the patient's blood or serum, the disease is not hematologically controlled.
[0082] As used herein, the term “serious adverse event” means an adverse medical event that is fatal, life-threatening, requires hospitalization or extension of an existing hospitalization for a hospitalized patient, or results in a permanent or significant impairment of appearance or capacity, as defined in Federal Regulation 21, Chapter 312.32(a).
[0083] As used herein, the term “pharmaceutically acceptable carrier” means a material for which a pharmaceutical compound (e.g., a chimeric antibody) is miscible for administration to a patient, as described, for example, in “Ansel’s Pharmaceutical Dosage Forms and Delivery Systems,” 10th edition (2014).
[0084] [Anti-AL antibody] [[Mouse Antigen Fiber Antibody]] Recent animal studies have shown that administration of mouse 11-1F4 antibody and other mouse anti-human light chain-specific antibodies against epitopes common to the β-pleated sheet structure present in AL fibrils completely degrades human ALκ and ALλ amyloid deposits. Some of these mouse antibodies are described in U.S. Patent No. 8,105,594 (hereinafter referred to as "Patent No. 594"), which is incorporated herein by reference in its entirety.
[0085] Mouse antibodies are generally unsuitable for administration to other animal species (such as humans) because the recipient species recognizes the mouse antibody as antigenic and produces antibodies against it. Antigenicity when an antibody from one species is injected into another species is usually caused by a portion of the constant domain. Such antigenic responses interfere with or prevent the desired therapeutic effect of the mouse antibody. In humans, this antigenic response is called human anti-mouse antibody (HAMA). The antibodies described in Patent No. 594 may be highly immunogenic in humans via a human anti-mouse antibody (HAMA) response. Since the HAMA response usually results in rapid clearance of the mouse antibody from the human recipient, HAMA severely limits the potential human therapeutic benefit that the mouse antibody may have. Therefore, these mouse antibodies are unsuitable for administration to patients to stop or reverse amyloid fibrillation in the patient. Accordingly, the present invention provides compositions and methods for treating amyloid deposition diseases that are unlikely to produce an immunogenic HAMA response in the patient after administration.
[0086] [[Humanized and Chimeric Antigen Fiber Antibodies]] The present invention provides humanized and chimeric antibodies or antigen-binding fragments thereof for the treatment of amyloidosis. Typically, the antibody consists of four polypeptides, each comprising two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain has one N-terminal variable (V) H The light chain includes a region and three C-terminal constant (CH1, CH2, and CH3) regions, and each light chain has one N-terminal variable (V L or V K The antibody comprises a region and one C-terminal constant (CL) region. Furthermore, each variable domain of the light and heavy chains of the antibody contains three segments called complementarity-determining regions ("CDRs") or hypervariable regions. Each CDR of the light chain, together with the corresponding CDR of the adjacent heavy chain, forms the antigen-binding site of the antibody. The variable regions of each pair of light and heavy chains form the antigen-binding site of the antibody. Meanwhile, the constant regions provide structural support and regulate the immune response initiated by antigen binding.
[0087] Chimeric antibodies incorporate the variable region of a non-human antibody into the constant region of a human antibody. For example, chimeric 11-1F4 may be created by expressing a mouse variable region together with the Fc region of a human antibody such as human IgG1.
[0088] Humanized non-human (e.g., mouse) antibodies containing minimal sequences derived from non-human immunoglobulins can be obtained. Generally, humanized antibodies may contain one or more variable domains, where the variable region is derived from a non-human immunoglobulin and the framework region (FR) corresponds to a human immunoglobulin sequence. Thus, in some embodiments, humanized anti-AL antibodies include a human antibody framework region. These antibodies can be prepared by known techniques.
[0089] The mouse 11-1F4 monoclonal antibody is an anti-AL antibody produced by SP2 / 0 hybridoma cells deposited with Dr. Alan Solomon (University of Tennessee Medical Science Center, Knoxville, Tennessee, USA). The hybridoma cell line is available from the American Cell Culture and Cell Preservation Corporation (ATCC depositary PTA-105). The 11-1F4 antibody is V K Region (SEQ ID NO: 36) and V H The region (Sequence ID 35) is shown in Table 1 below. The CDR sequences of the heavy and light chains are shown in Table 2.
[0090] [Table 1]
[0091] [Table 2]
[0092] Using known human antibody sequences, the above V H and V KThe gene in the region can be cloned to produce a chimeric 11-1F4 antibody. The chimeric 11-1F4 antibody, like its mouse counterpart, binds to the epitopes expressed by the β-pleated sheet structure of amyloid. Surprisingly, as shown in Example 6 below, the chimeric antibody binds to AL amyloid fibrils with higher affinity than the 11-1F4 mouse antibody from which it is derived.
[0093] Humanized antibodies can also be produced by cloning the gene in the CDR region using known human antibody sequences. Similar to chimeric 11-1F4 antibodies, humanized antibodies may also have a higher binding affinity to amyloid fibrils than their mouse counterparts.
[0094] Those skilled in the art will understand that the humanized and chimeric antibodies described herein can utilize all different types of human constant regions and / or framework regions. For example, the humanized and chimeric antibodies described herein may include constant regions and / or framework regions of human IgG (including IgG1, IgG2, IgG3, and IgG4), IgA, IgE, IgH, or IgM. In a preferred embodiment, the humanized or chimeric 11-1F4 antibody described herein includes the human IgG1 constant region.
[0095] In some embodiments, the antibodies described herein may contain one or more substitutions, insertions, or deletions, as long as they maintain their ability to bind to amyloid fibrils (e.g., κ and / or λ light chain fibrils). For example, in some embodiments, the chimeric 11-1F4 antibody of the present invention may contain heavy and light chains having about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity compared to the corresponding heavy and light chain sequences described herein, as long as they maintain their ability to bind to amyloid fibrils. In some embodiments, the humanized 11-1F4 antibody of the present invention may contain a CDR having about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% identity with the corresponding CDR sequence described herein, as long as it maintains the ability to bind to amyloid fibrils.
[0096] In some embodiments, the humanized or chimeric antibodies described herein bind to amyloid fibrils with higher affinity in vitro and / or in vivo than their mouse equivalents, as determined, for example, by the direct-binding ELISA assay described in Example 6. It is believed, but is not limited to, that the humanized and chimeric 11-1F4 antibodies described herein can bind to and neutralize toxic circulating amyloid proteins that have not yet formed fibrils, and that the humanized and chimeric antibodies described herein can lyse amyloid deposits. Indeed, it has been demonstrated that chimeric 11-1F4 antibodies bind to fibrils and lyse human amyloidoma in mice. It is noteworthy that, since precursor light chain proteins are thought to be toxic to cardiomyocytes, therapeutic approaches that can target aggregated amyloid fibrils and circulating toxic amyloid precursor proteins deposited in organs may improve cardiovascular outcomes in patients with AL amyloidosis, including myocardial involvement, even if the patient's disease is not hematologically controlled (i.e., the patient has detectable levels of toxic amyloid precursor proteins in their blood or serum, or a difference of more than 40 mg / L between involved and uninvolved free light chains).
[0097] [Abbreviation] Dulbecco's modified Eagle medium (DMEM), fetal bovine serum (FBS), ribonucleic acid (RNA), messenger RNA (mRNA), deoxyribonucleic acid (DNA), copy DNA (cDNA), polymerase chain reaction (PCR), minutes (min), seconds (sec), Tris-borate buffer (TBE).
[0098] The amino acids are represented by the following IUPAC abbreviations: alanine (Ala), arginine (Arg), asparagine (Asn), aspartic acid (Asp), cysteine (Cys), glutamine (Gln), glutamic acid (Glu), glycine (Gly), histidine (His), isoleucine (Ile), leucine (Leu), lysine (Lys), methionine (Met), phenylalanine (Phe), proline (Pro), serine (Ser), threonine (Thr), tryptophan (Trp), tyrosine (Tyr), and valine (Val). Nucleotides are similarly represented as follows: adenine (A), cytosine (C), guanine (G), thymine (T), uracil (U), adenine or guanine (R), cytosine or thymine (Y), guanine or cytosine (S), adenine or thymine (W), guanine or thymine (K), adenine or cytosine (M), cytosine or guanine or thymine (B), adenine or guanine or thymine (D), adenine or cytosine or thymine (H), adenine or cytosine or guanine (V), and any base (N).
[0099] [Humanized or chimeric antibodies] To produce the chimeric antibody of the present invention, the heavy chain and κ light chain variable region genes of the mouse 11-1F4 monoclonal antibody described in U.S. Patent No. 8,105,594 were PCR-modified to promote the expression of the chimeric 11-1F4 antibody in mammalian cells. Detailed sequence analysis of the modified variable region genes was performed. The modified variable region genes were cloned into appropriate mammalian expression vectors to produce constructs 11-1F4VHpG1D200 and 11-1F4VK.pKN100. A single supervector construct pG1KD200-11-1F4 was prepared from the 11-1F4VHpG1D200 and 11-1F4VK.pKN100 constructs by EcoRI restriction enzyme digestion and ligation. Finally, the chimeric 11-1F4 antibody was transiently expressed in COS cells by both co-transfection and single supervector transfection. For convenience, COS cells were selected for cotransfection or transfection, but those skilled in the art will recognize that other mammalian cell lines can be used. The binding ability of the chimeric 11-1F4 antibody to amyloid fibrils was characterized by direct binding ELISA. Unexpectedly and beneficially, the chimeric 11-1F4 antibody bound to amyloid fibrils with higher affinity than the mouse 11-1F4 antibody.
[0100] Typically, an antibody consists of four polypeptides, each containing two identical copies of a heavy (H) chain polypeptide and two copies of a light (L) chain polypeptide. Typically, each heavy chain contains one N-terminal variable (V) polypeptide. H The light chain includes a region and three C-terminal constant (CH1, CH2, and CH3) regions, and each light chain has one N-terminal variable (V L or V K It includes a region and one C-terminal constant (CL) region. The variable regions of each light chain and heavy chain pair form the antigen-binding site of the antibody.
[0101] An antibody useful in the compositions and methods of the present invention is V of SEQ ID NO: 47 K Region and V of Sequence ID 48 HThese may be chimeric mouse-human monoclonal antibodies containing the region, or humanized monoclonal antibodies containing the CDR sequences of SEQ ID NOs. 49-54. These antibodies bind to epitopes expressed by the β-pleated sheet structure of amyloid fibrils. Furthermore, surprisingly, these antibodies bind to the V of SEQ ID NO. 36. K Region and V of Sequence ID 35 H The antibody binds to this epitope with higher affinity than the 11-1F4 mouse antibodies from which it is derived, including the region. The present invention includes a method for treating amyloid deposition disease in human patients requiring treatment of said disease. The method includes the step of administering to the patient a therapeutically effective dose of one of the above antibodies in a pharmaceutically acceptable carrier. The amount of antibody administered is effective, for example, to reduce the amount of amyloid fibrils deposited in the patient's tissue. The antibody composition may be administered by any conventional route of administration, but parenteral administration (such as intravenous administration) is preferred. Pharmaceutically acceptable carriers are well known in the art, and a suitable one can be selected by those skilled in the medical field. The amyloid deposition disease is preferably primary (AL) amyloidosis.
[0102] Chimeric antibodies (and methods for producing chimeric antibodies) useful for the compositions and methods described herein and claimed herein are described in the jointly owned Patent Cooperation Treaty application _________ (specification 8441-0004WO, priority under U.S. Patent Application No. 62 / 526835 filed June 29, 2017), which was filed on the same date and is incorporated herein in whole. Materials useful for producing these antibodies include vector constructs selected from the group consisting of 11-1F4VK.pKN100 and 11-F4VH.pG1D200, shown in Figures 5 and 6, respectively, as well as a superconstruct pG.1KD20011-1F4 produced from the above two vector constructs. Other useful materials include modified mouse 11-1F4 antibody V K Regional gene (SEQ ID NO: 42) and modified 11-1F4 antibody V HThe region gene (SEQ ID NO: 45) and its corresponding primers, SEQ ID NOs: 41, 43, 44, and 46, are included. This antibody may also be produced by cotransfection of suitable mammalian host cells, such as COS (Chinese hamster ovary) cells, with the vector constructs 11-1F4VK.pKN100 and 11-F4VH.pG1D200 or the superconstruct pG.1KD20011-1F4.
[0103] Methods for preparing, testing, and using humanized or chimeric 11-1F4 antibodies are described in more detail in the Examples section below.
[0104] [Pharmaceutical preparations] Pharmaceutical compositions suitable for use in the methods described herein may include a humanized or chimeric 11-1F4 antibody, humanized antibody, or antigen-binding anti-antibody fragment described herein, and a pharmaceutically acceptable carrier or diluent.
[0105] The composition may be formulated for intravenous, subcutaneous, intraperitoneal, intramuscular, oral, nasal, pulmonary, ocular, vaginal, or rectal administration. In some embodiments, the antibody is formulated for intravenous, subcutaneous, intraperitoneal, or intramuscular administration as a solution, suspension, emulsion, liposomal formulation, etc. The pharmaceutical composition may be formulated to be an immediate-release composition, a sustained-release composition, a delayed-release composition, etc., using techniques known in the art.
[0106] Pharmacologically acceptable carriers for various dosage forms are known in the art. For example, excipients, lubricants, binders, and disintegrants for solid formulations are known, and solvents, solubilizers, suspending agents, isotonic agents, buffers, and analgesics for liquid formulations are known. In some embodiments, the pharmaceutical composition includes one or more additional components such as one or more preservatives, antioxidants, and stabilizers.
[0107] Furthermore, the pharmaceutical compositions described herein may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for high drug concentrations. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Adequate fluidity can be maintained, for example, by the use of a coating such as lecithin, maintaining the required particle size in the case of a dispersion, and the use of a surfactant. In some embodiments, it is preferable to include an isotonic agent, such as sugar, polyhydric alcohols such as mannitol and sorbitol, or sodium chloride in the composition. Long-term absorption of the injectable composition can be achieved by including an absorption-delaying agent, such as monostearate and gelatin, in the composition.
[0108] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound, along with one or a combination of the components described above as needed, into a suitable solvent, and then by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required components from the other components described above. For sterile powders for preparing sterile injectable solutions, preferred preparation methods are vacuum drying and freeze-drying (lyophilization) resulting from a solution of the active ingredient and any additional desired components that has been previously sterile filtered.
[0109] The pharmaceutical compositions of the present invention can be administered in combination with other therapeutic agents that are part of the current standard of treatment for amyloidosis and amyloid diseases. Alternatively, the pharmaceutical compositions described herein may be administered to patients who have previously received conventional treatment for amyloidosis and amyloid diseases but have not responded to conventional treatment (i.e., the disease is refractory or continues to progress).
[0110] [Treatment method] In this invention, at least one chimeric antibody, humanized antibody, or antigen-binding antibody fragment is administered to a patient with amyloidosis (e.g., a human patient) to promote at least partial degradation and removal of amyloid fibrils deposited in the patient's organs and / or circulating in the patient's bloodstream. In some embodiments, a therapeutically effective amount of antibody is administered along with a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers are well known in the art, as described below. As is well understood by those skilled in the medical field, the typical route of administration is parenteral (e.g., intravenous, subcutaneous, or intramuscular). Of course, other routes of administration are also possible. The administration may be a single dose or multiple doses. The amount and frequency of administration of the antibody may be optimized by a physician for a particular patient.
[0111] Amyloidosis can occur in various organs in various people, and various types of amyloid exist. Amyloidosis frequently occurs in the heart, kidneys, liver, spleen, nervous system, and digestive tract. Severe amyloidosis can lead to life-threatening organ failure.
[0112] Signs and symptoms of amyloidosis include, but are not limited to, swelling of the ankles and lower extremities, severe fatigue and weakness, shortness of breath, numbness, tingling or pain in the hands and feet, pain especially in the wrists (carpal tunnel syndrome), diarrhea or constipation possibly with bleeding, significant unintentional weight loss, enlarged tongue, skin changes such as thickening or easy bruising, purpura around the eyes, irregular heartbeat, or difficulty swallowing.
[0113] Generally, amyloidosis is caused by the accumulation of an abnormal protein called amyloid. Amyloid is produced in the bone marrow and can be deposited in any tissue or organ. The specific cause of this condition depends on the type of amyloidosis.
[0114] There are several types of amyloidosis or amyloid disease, including AL amyloidosis, AA amyloidosis, and hereditary amyloidosis.
[0115] AL amyloidosis (immunoglobulin light chain amyloidosis) is the most common type and can occur in the heart, kidneys, skin, nerves, and liver. Formerly known as primary amyloidosis, AL amyloidosis develops when the bone marrow produces abnormal antibodies that it cannot break down. These antibodies deposit in various tissues as amyloid plaques, interfering with the normal function of the tissue or organ.
[0116] AA amyloidosis, formerly known as secondary amyloidosis, commonly affects the kidneys, but can also occur in the gastrointestinal tract, liver, or heart. It usually occurs in conjunction with chronic infectious or inflammatory diseases such as rheumatoid arthritis or inflammatory bowel disease.
[0117] Familial amyloidosis (hereditary amyloidosis) is a genetic disorder that typically affects the liver, nerves, heart, and / or kidneys. Many different types of genetic abnormalities present at birth are associated with an increased risk of amyloid disease or hereditary amyloidosis. The type and location of the amyloid gene abnormality can influence the risk of certain complications, the age at which symptoms first appear, and the progression of the disease over time.
[0118] When amyloid disease develops in the heart, it can lead to a number of types of complications. Amyloid deposits or plaques reduce the heart's ability to fill with blood between heartbeats. Less blood is pumped with each beat, which can lead to shortness of breath. In addition, amyloid deposits or plaques within or around the heart can cause irregular heartbeat and congestive heart failure, among many other organ dysfunctions.
[0119] When amyloid disease develops in the kidneys, the kidneys' filtering ability is usually impaired, allowing proteins to leak from the blood into the urine (i.e., proteinuria). Furthermore, the kidneys' ability to remove waste products from the body is reduced, which can eventually lead to kidney failure.
[0120] This specification provides a method for treating amyloid deposition disease, such as primary (AL) amyloidosis, in a patient (e.g., a human patient) who requires treatment for such disease. The method comprises the step of administering to the patient an effective amount of humanized or chimeric 11-1F4 antibody and a pharmaceutically acceptable carrier for treating the amyloid deposition disease.
[0121] In some embodiments, amyloid deposition diseases (e.g., primary amyloidosis) involve the involvement of at least one organ or tissue selected from the group consisting of the heart, kidneys, liver, lungs, gastrointestinal tract, nervous system, musculoskeletal system, soft tissues, and skin.
[0122] In embodiments where the disease involves amyloid deposits or plaques in the patient's heart, treatment with the humanized or chimeric 11-1F4 antibody described herein may reduce the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) level by at least about 30% compared to a baseline level taken before administration of the antibody. In some embodiments, the NT-proBNP level may be reduced by at least about 40%, at least about 50%, at least about 60%, or more compared to a baseline level taken before administration of the antibody. In some embodiments, treatment with the human or chimeric 11-1F4 antibody described herein may reduce the patient's NT-proBNP level to less than about 9100 ng / L after administration of the antibody. In some embodiments, the patient's NT-proBNP level may be reduced to less than about 8000 ng / L, less than 7000 ng / L, less than 6000 ng / L, less than 5000 ng / L, or less than 4000 ng / L after administration of the antibody. In some embodiments, a patient may be classified as New York Heart Association (NYHA) functional classification class II or class III before initial administration of the antibody, but after treatment with the chimeric 11-1F4 antibody described herein, the patient may be classified as class I on the NYHA classification scale.
[0123] This specification provides methods for improving myocardial function in patients with amyloidosis, including cardiac involvement, and for treating specific subpopulations of patients, such as those with cardiac involvement (i.e., NT-proBNP greater than 650 pg / mL) and hematologically uncontrolled ALA.
[0124] When amyloid disease develops in the heart, it can lead to a number of types of complications, and this cardiac involvement is a sign of a poor prognosis. Amyloid deposits or plaques reduce the heart's ability to fill with blood between heartbeats. Less blood is pumped with each beat, which can lead to shortness of breath, among many other serious aggravating factors. Amyloid deposits or plaques within or around the heart can also cause irregular heartbeat and congestive heart failure, among many other organ dysfunctions.
[0125] This specification provides a method for improving myocardial function in patients diagnosed with amyloid light chain amyloidosis (ALA), including cardiac involvement. The method comprises administering a therapeutically effective amount of a humanized or chimeric 11-1F4 antibody or its antigen-binding fragment to a patient diagnosed with ALA. The antibody or its antigen-binding fragment may bind to amyloid fibrils with higher affinity than mouse 11-1F4 antibody, as determined by direct binding ELISA. Furthermore, improvements in myocardial function may become apparent within approximately three weeks after administration of the antibody or its antigen-binding fragment. For example, improvements in various measures of myocardial function may be observed within approximately one week, two weeks, three weeks, four weeks, five weeks, six weeks, seven weeks, eight weeks, nine weeks, ten weeks, eleven weeks, twelve weeks, thirteen weeks, fourteen weeks, or fifteen weeks after the start of treatment.
[0126] Cardiac function in patients with cardiac involvement can be determined by measuring N-terminal pro b-type natriuretic peptide (NT-proBNP) levels. Tissue damage caused by amyloid deposits in the heart of ALA patients elevates the patient's NT-proBNP levels. In some embodiments, patients diagnosed with ALA with cardiac involvement exhibit pre-treatment NT-proBNP levels greater than 650 pg / mL.
[0127] As described by Smiseth et al. in Eur Heart J, 37:1196, myocardial function and its improvement can be measured by measuring global strain (GLS) in the longitudinal direction using echocardiography. Echocardiography uses ultrasound to measure the mean deformation within segments of the myocardium. GLS is the mean of these segments as a measure of overall left ventricular function. Amyloid deposition can cause the left and right ventricular walls to thicken, resulting in stiff, non-diastolic ventricles with poor compliance, creating “strain” in the cardiovascular system. In echocardiographic terminology, the term “strain” is used to describe deformation of the myocardium. This may include, but is not limited to, local shortening, thickening, and / or lengthening of the myocardium. Strain can be used as a measure of ventricular function. Those skilled in the art will know how to determine GLS using echocardiography and will understand that it can be calculated in various ways. For example, Lagrange’s equation (ε L =(L-L0) / L0=ΔL / L0 (where L0 is the baseline length and L is the obtained length)) defines the strain with respect to the original length as a dimensionless measure. Shortening is negative and stretching is positive. This is usually expressed as a percentage. An alternative definition, the Euler strain, defines the strain with respect to instantaneous length: ε E =ΔL / L. In the case of changes over time, the Lagrangian strain is ε L =ΣΔL / L0, and the Euler strain is ε EThis is expressed as Σ(ΔL / L). This term was first used by Mirsky and Parmley to describe the local differences in deformation between normal and ischemic myocardium.
[0128] Accordingly, in some embodiments, patients in the methods described herein show improvement in longitudinal global strain (GLS) compared to pre-treatment GLS levels. For example, in a study of 19 patients treated with the chimeric antibody described herein, 10 of these patients included cardiac involvement by NT-proBNP level screening, and 8 patients were cardiac assessable by baseline NT-proBNP, with cardiac involvement defined as having NT-proBNP levels greater than 650 pg / mL. In some embodiments, patients with ALA including cardiac involvement may have baseline NT-proBNP of at least 650 pg / mL. Furthermore, in some embodiments, patients with ALA including cardiac involvement should have a dose of at least 700 pg / ml, 750 pg / ml, 800 pg / ml, 850 pg / ml, 900 pg / ml, 950 pg / ml, 1000 pg / ml, 1050 pg / ml, 1100 pg / ml, 1150 pg / ml, 1200 pg / ml, 1250 pg / ml, 1300 pg / ml, 1350 pg / ml, 1400 pg / ml, 1450 pg / ml, 1 The baseline NT-proBNP may be 500 pg / ml, 1550 pg / ml, 1600 pg / ml, 1650 pg / ml, 1700 pg / ml, 1750 pg / ml, 1800 pg / ml, 1850 pg / ml, 1900 pg / ml, 1950 pg / ml, 2000 pg / ml, 2050 pg / ml, 2100 pg / ml, 2150 pg / ml, 2200 pg / ml, 2250 pg / ml, or 2300 pg / ml or higher.
[0129] Nine of the ten patients, including those with cardiac involvement, described in Example 9 below, showed improved myocardial function upon exposure to the chimeric antibody described herein, as shown in Figure 15. Therefore, in some embodiments, patients treated with a therapeutically effective dose of the chimeric antibody show improvement in longitudinal global strain (GLS) compared to pre-treatment GLS levels. In addition to the decrease in GLS, patients treated with the antibody described herein may also show a decrease in NT-proBNP levels.
[0130] In some embodiments, improvement in GLS may occur within approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, or 15 weeks of treatment initiation. In some embodiments, improvement in GLS may be represented by a decrease in GLS of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, or more compared to baseline, as calculated by Lagrange's formula. A decrease in GLS levels of approximately 2% or more compared to baseline is considered clinically relevant.
[0131] In some embodiments, treatment with the humanized or chimeric 11-1F4 antibody or its antigen-binding fragment described herein may reduce a patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) level by at least about 30% compared to a baseline level taken before administration of the antibody. In some embodiments, NT-proBNP may be reduced by at least about 40%, at least about 50%, at least about 60%, or more compared to a baseline level taken before administration of the antibody. In some embodiments, treatment with the chimeric 11-1F4 antibody described herein may reduce a patient's NT-proBNP level to less than about 9100 ng / L after administration of the antibody. In some embodiments, a patient's NT-proBNP level may be reduced to less than about 8000 ng / L, less than about 7000 ng / L, less than about 6000 ng / L, less than about 5000 ng / L, or less than about 4000 ng / L after administration of the antibody. In some embodiments, a patient may be classified as New York Heart Association (NYHA) functional class II or III before initial administration of the antibody, but after treatment with the chimeric 11-1F4 antibody described herein, the patient may be classified as class I on the NYHA classification scale.
[0132] In some embodiments, the methods described herein include treating patients suffering from recurrent or refractory ALA. In some embodiments, the patient may have κALA. In some embodiments, the patient may have λALA.
[0133] Immunoglobulins are composed of four protein chains, including two light chains, either kappa (κ) or lambda (λ), and two heavy chains, of which there are several types. In AL amyloidosis, either the κ or λ light chain may be misfolded, forming amyloid fibrils or plaques. Therefore, in some patients, both the κ and λ fragments may be misfolded. Subgroup analysis revealed that patients with both λ and κ cardiac involvement showed improvement in GLS compared to pre-treatment levels, as shown in Example 8. Therefore, in some embodiments, patients are further characterized as having light chain λ amyloid cardiac involvement. In some embodiments, patients are further characterized as having light chain κ amyloid cardiac involvement.
[0134] In some embodiments, the therapeutic methods described herein may further include the step of administering a chemotherapeutic agent that may be intended to kill dysfunctional cells producing toxic precursor proteins. In some cases, such treatment may be successful, thereby resulting in a reduction in the number of dysfunctional cells and a concomitant reduction in the amount of circulating toxic amyloid precursor protein in the patient's blood. However, chemotherapy may be ineffective in reducing the number of dysfunctional cells and / or the ability of these cells to produce toxic amyloid precursor protein. Patients who continue to have detectable levels of circulating toxic amyloid precursor protein in their blood are said to have hematologically uncontrolled ALA.
[0135] The humanized and chimeric 11-1F4 antibodies described herein are thought to be able to bind to and neutralize circulating toxic amyloid precursor proteins even before the proteins aggregate and form amyloid deposits. Therefore, the therapeutic methods described herein may be particularly beneficial for patients who are hematologically uncontrolled (i.e., neither in complete remission nor very good partial remission). Complete remission is defined as negative serum and urine immunoconjugation and normal ratios in free light chain (FLC) assays, while very good partial remission is defined as having a difference of less than 40 mg / L between involved and uninvolved free light chains.
[0136] [[Monitoring improvements]] Echocardiography is non-invasive and can be used to monitor improvements in myocardial function in patients diagnosed with light chain amyloidosis (ALA), including cardiac involvement. This monitoring involves observing improvements in myocardial function in patients diagnosed with ALA, including cardiac involvement, within approximately three weeks of administration of a therapeutically effective dose of humanized or chimeric 11-1F4 antibody (c11-1F4 Ab) or its antigen-binding fragment. Humanized or chimeric 11-1F4 Ab or its antigen-binding fragment has a higher binding affinity to amyloid fibrils than mouse 11-1F4 antibody, as determined by direct binding ELISA. Therefore, as shown in Example 8, improvements in myocardial function may be observed approximately three weeks after administration of humanized or chimeric 11-1F4 antibody. In some embodiments, the improvement in myocardial function persists for at least three months after administration of humanized or chimeric 11-1F4 Ab or its antigen-binding fragment.
[0137] In embodiments in which the disease involves amyloid deposits or plaques in the patient's kidneys, treatment with the humanized or chimeric 11-1F4 antibody described herein may reduce the patient's urinary protein (i.e., proteinuria) levels by at least about 30% compared to a baseline level determined before administration of the antibody. In some embodiments, the patient's urinary protein may be reduced by at least about 40%, at least about 50%, at least about 60%, or more compared to a baseline level determined before administration of the antibody. In some embodiments, the patient's urinary protein excretion may be reduced to less than about 7000 mg / 24 hours, less than about 6000 mg / 24 hours, less than about 5000 mg / 24 hours, less than about 4000 mg / 24 hours, or less than about 3000 mg / 24 hours after administration of the antibody.
[0138] [[Therapeutic effective dose and administration regimen]] In some embodiments, a therapeutically effective dose of the antibody may be administered once, twice, three times, or four times or less within a three-month period. In some embodiments, the reduction in NT-proBNP or improvement in GLS persists in the patient for at least about three months after administration of the humanized or chimeric 11-1F4 antibody.
[0139] As will be readily apparent to those skilled in the art, the therapeutically effective doses and administration regimens of the methods described above may vary. The administration regimen may be adjusted to provide the optimal desired response (e.g., therapeutic clearance of amyloid plaques or reduction in the amount of deposited amyloid fibrils). For example, in some embodiments, the antibody may be administered as a single dose; in some embodiments, in several divided doses over time; or in subsequent doses, the dose may be proportionally reduced or increased depending on the circumstances. For example, in some embodiments, the antibody described herein may be administered once or twice a week by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibody or its antigen-binding fragment may be administered once or twice a month by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibody or its antigen-binding fragment may be administered once or twice a year by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibodies or antigen-binding fragments described herein may be administered once a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, twice a year, or once a year, depending on the situation or the patient's condition.
[0140] Furthermore, the data described herein demonstrate that patient responses to treatment with humanized or chimeric 11-1F4 antibodies are not only sustained but also rapid. In some embodiments, patients may experience a therapeutic response (i.e., a reduction in the size of amyloid deposits or plaques, a decrease in the rate of plaque formation, or an improvement in organ function) within one week or less, two weeks or less, three weeks or less, four weeks or less, five weeks or less, six weeks or less, seven weeks or less, eight weeks or less, nine weeks or less, ten weeks or less, eleven weeks or less, twelve weeks or less, or any time frame in between. For example, depending on the dose and administration regimen, patients may experience a therapeutic response in about one week or about four and a half weeks.
[0141] The therapeutically effective dose of the antibody administered to the patient (whether administered as a single dose or multiple doses) must be sufficient to reduce the amount of amyloid fibrils deposited in the patient. Such a therapeutically effective dose can be determined by evaluating the symptomatic changes in the patient or by evaluating the change in the amount of amyloid fibrils deposited (for example, 124 This can be determined by radioimmunodetection of deposited amyloid deposits using I-tagged antibodies. Therefore, the labeled antibodies of the present invention can be used to detect the presence of amyloid deposition disease in patients suspected of having the disease, while simultaneously determining the effectiveness of treatment.
[0142] Exemplary doses may vary depending on the size and health of the individual being treated, as well as the condition being treated. In some embodiments, the therapeutically effective dose of the humanized or chimeric 11-1F4 antibody described herein is approximately 500 mg / m². 2 The dose may be less than the following; however, depending on the circumstances, the dose may be higher. In some embodiments, the therapeutically effective dose is 10 mg / m². 2 ~1000mg / m 2 , 25 mg / m² 2 ~900mg / m 2 50 mg / m² 2 ~800mg / m 2 75 mg / m² 2 ~700mg / m 2 , 100 mg / m² 2 ~600mg / m 2 or any value in between. For example, in some embodiments, the therapeutically effective dose is about 1000 mg / m². 2 , about 975mg / m 2 , about 950mg / m 2 , about 925mg / m 2 , about 900mg / m 2 , about 875mg / m 2 , about 850mg / m 2 , about 825mg / m 2 , about 800mg / m 2 , about 775mg / m 2 , about 750mg / m 2 , about 725mg / m2 , about 700mg / m 2 , about 675mg / m 2 , about 650mg / m 2 , about 625mg / m 2 , about 600mg / m 2 , about 575mg / m 2 , about 550mg / m 2 , about 525mg / m 2 , about 500mg / m 2 , about 475mg / m 2 , about 450mg / m 2 , about 425mg / m 2 , about 400mg / m 2 , about 375mg / m 2 , about 350mg / m 2 , about 325mg / m 2 , about 300mg / m 2 , about 275mg / m 2 , about 250mg / m 2 , about 225mg / m 2 , about 200mg / m 2 , about 175mg / m 2 , about 150mg / m 2 , about 125mg / m 2 , about 100mg / m 2 , or even less.
[0143] Similarly, in some embodiments, the effective dose of humanized or chimeric 11-1F4 antibody is approximately 2200 mg. However, the dose may be higher or lower depending on the circumstances. In some embodiments, the therapeutically effective dose may be 50 mg to 5000 mg, 60 mg to approximately 4500 mg, 70 mg to 4000 mg, 80 mg to 3500 mg, 90 mg to 3000 mg, 100 mg to 2500 mg, 150 mg to 2000 mg, 200 mg to 1500 mg, 250 mg to 1000 mg, or any dose in between. For example, several effectively therapeutically effective doses: approximately 50 mg, approximately 60 mg, approximately 70 mg, approximately 80 mg, approximately 90 mg, approximately 100 mg, approximately 150 mg, approximately 200 mg, approximately 250 mg, approximately 300 mg, approximately 350 mg, approximately 400 mg, approximately 450 mg, approximately 500 mg, approximately 550 mg, approximately 600 mg, approximately 650 mg, approximately 700 mg, approximately 750 mg, approximately 800 mg, approximately 850 mg, approximately 900 mg, approximately 950 mg, approximately 1000 mg, approximately 1100 mg, approximately 1200 mg, approximately 1300 mg, approximately 1400 mg, approximately 1500 mg, approximately 1600 mg, approximately 1700 mg, approximately 1800 mg, approximately 1900 mg. The amount may be approximately 2000 mg, approximately 2100 mg, approximately 2200 mg, approximately 2300 mg, approximately 2400 mg, approximately 2500 mg, approximately 2600 mg, approximately 2700 mg, approximately 2800 mg, approximately 2900 mg, approximately 3000 mg, approximately 3100 mg, approximately 3200 mg, approximately 3300 mg, approximately 3400 mg, approximately 3500 mg, approximately 3600 mg, approximately 3700 mg, approximately 3800 mg, approximately 3900 mg, approximately 4000 mg, approximately 4100 mg, approximately 4200 mg, approximately 4300 mg, approximately 4400 mg, approximately 4500 mg, approximately 4600 mg, approximately 4700 mg, approximately 4800 mg, approximately 4900 mg, approximately 5000 mg, or more.
[0144] Similarly, in some embodiments, the effective dose of humanized or chimeric 11-1F4 antibody is about 25 mg / kg. However, in some embodiments, the concentration may be higher or lower. In some embodiments, the effective dose may be about 1 mg / kg to 50 mg / kg, about 5 mg / kg to 40 mg / kg, about 10 mg / kg to 30 mg / kg, or about 15 mg / kg to 25 mg / kg, or any value in between. For example, in some embodiments, the effective dose is 1 mg / kg, 2 mg / kg, 3 mg / kg, 4 mg / kg, 5 mg / kg, 6 mg / kg, 7 mg / kg, 8 mg / kg, 9 mg / kg, 10 mg / kg, 11 mg / kg, 12 mg / kg, 13 mg / kg, 14 mg / kg, 15 mg / kg, 16 mg / kg, 17 mg / kg, 18 mg / kg, 19 mg / kg, 20 mg / kg, 21 mg / kg, 22 mg / kg, 23 mg / kg, 24 mg / kg, 25 mg / kg, The dosage may be 26 mg / kg, 26 mg / kg, 28 mg / kg, 29 mg / kg, 30 mg / kg, 31 mg / kg, 32 mg / kg, 33 mg / kg, 34 mg / kg, 35 mg / kg, 36 mg / kg, 37 mg / kg, 38 mg / kg, 39 mg / kg, 40 mg / kg, 41 mg / kg, 42 mg / kg, 43 mg / kg, 44 mg / kg, 45 mg / kg, 46 mg / kg, 47 mg / kg, 48 mg / kg, 49 mg / kg, 50 mg / kg, or more.
[0145] Depending on the circumstances, the treatment methods described herein may be combined with other known treatment methods. For example, the current standard of treatment for AL amyloidosis generally includes autologous hematopoietic stem cell transplantation (ASCT) or autologous bone marrow transplantation. Many of the same chemotherapeutic agents used to treat multiple myeloma are used for AL amyloidosis to stop the proliferation of abnormal or dysfunctional cells that produce amyloid / toxic amyloid precursor proteins. Therefore, in some embodiments, the humanized or chimeric 11-1F4 antibodies described herein may be administered before, after, or concurrently with other known treatments. In some embodiments, the humanized or chimeric 11-1F4 antibodies described herein may be administered only after other treatment options have failed or the disease has continued to progress. In other words, in some embodiments, the antibodies described herein are used to treat refractory amyloid diseases such as refractory AL amyloidosis.
[0146] In embodiments in which the disease involves amyloid deposits or plaques in the patient's kidneys, treatment with the chimeric 11-1F4 antibody described herein may reduce the patient's urinary protein (i.e., proteinuria) levels by at least about 30% compared to a baseline level determined before administration of the antibody. In some embodiments, the patient's urinary protein may be reduced by at least about 40%, at least about 50%, at least about 60%, or more compared to a baseline level determined before administration of the antibody. In some embodiments, the patient's urinary protein excretion may be reduced to less than about 7000 mg / 24 hours, less than about 6000 mg / 24 hours, less than about 5000 mg / 24 hours, less than about 4000 mg / 24 hours, or less than about 3000 mg / 24 hours after administration of the antibody.
[0147] This specification provides a method for treating patients with amyloid deposition disease (e.g., AL amyloidosis). The method comprises administering a therapeutically effective amount of humanized or chimeric 11-1F4 antibody to patients requiring it at a frequency less than once a month. In some embodiments, AL amyloidosis may contain aggregates of λ light chain fibrils. In this case, the presence of λ light chain fibrils is significantly reduced after administration of the antibody.
[0148] In some embodiments, a therapeutically effective dose of the antibody may be administered every two months, every three months, every four months, every five months, every six months, or every six months. More specific dosing regimens are described below.
[0149] This specification provides a method for treating patients with primary light chain (AL) amyloidosis involving the heart. The method includes administering to the patient a dose of a humanized or chimeric 11-1F4 antibody effective in causing at least a 30% reduction in N-terminal pro b-type natriuretic peptide (NT-proBNP) levels after administration of the humanized or chimeric 11-1F4 antibody compared to pre-treatment levels. This specification also includes a method for treating patients with primary light chain (AL) amyloidosis involving the kidneys. The method includes administering to the patient a dose of a humanized or chimeric 11-1F4 antibody effective in causing at least a 40% reduction in proteinuria after administration of the humanized or chimeric 11-1F4 antibody compared to pre-treatment levels.
[0150] In some embodiments, the reduction in NT-proBNP and / or proteinuria persists in patients for at least about 6 months following administration of humanized or chimeric 11-1F4 antibodies.
[0151] As described above, immunoglobulins are composed of four protein chains, two light chains of either kappa (κ) or lambda (λ) type, and two heavy chains of several types. In AL amyloidosis, either the κ or λ light chain can be misfolded and form amyloid fibrils or plaques. In some patients, both κ and λ fragments can be misfolded. Thus, provided herein is a method for reducing the amount of κ and / or λ light chain fibril aggregate deposits in a patient who needs to reduce such amount. The method comprises administering to a patient having primary amyloidosis comprising κ or λ light chain fibril aggregate deposits, a therapeutically effective dose of (i) a V K region comprising SEQ ID NO: 47, a V H region comprising SEQ ID NO: 48, or (ii) an antibody comprising CDR sequences comprising SEQ ID NOs: 49- to 54 and a human IgG1 constant region.
[0152] In some embodiments, the primary amyloidosis consists of λ light chain fibril deposits or plaques. Also, in some embodiments, the primary amyloidosis consists of κ light chain fibril aggregate deposits. Also, in some embodiments, the primary amyloidosis consists of κ and λ light chain fibril aggregate deposits.
[0153] Surprisingly, it has been discovered herein that chimeric 11-1F4 is unexpectedly effective in the removal of λ light chain fibrils. Indeed, preclinical experiments such as the mouse study provided in Example 7 suggested that λ fibrils are resistant to clearance and multiple repeated treatments are required to remove deposits. However, as shown in Example 8, when the chimeric 11-1F4 antibody was administered to humans, treatment resulted in a reduction of λ chain amyloid deposits after a single dose. This result was completely unexpected prior to the implementation of the methods described herein. The humanized 11-1F4 antibody is thought to exhibit a similar ability to remove λ light chain fibrils.
[0154] In any of the methods described above, administration of the humanized or chimeric 11-1F4 antibody described herein is expected to reduce organ dysfunction. Furthermore, in any of the methods described above, the constant region of the antibody may be the human IgG constant region. More specifically, in some embodiments, the constant region of the antibody may be the human IgG1 constant region.
[0155] As will be readily apparent to those skilled in the art, the therapeutically effective dose and administration regimen of the methods described above may vary. The administration regimen may be adjusted to provide the optimal desired response (e.g., therapeutic response clearance of amyloid plaques or reduction in the amount of deposited amyloid fibrils). For example, in some embodiments, the antibody may be administered as a single bolus, in some embodiments, as divided doses over time, or the dose may be proportionally reduced or increased in subsequent administrations as needed. For example, in some embodiments, the antibody described herein may be administered once or twice a week by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibody or functional fragment described herein may be administered once or twice a month by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibody or functional fragment described herein may be administered once or twice a year by subcutaneous, intravenous, or intramuscular injection. In some embodiments, the antibodies described herein may be administered once a week, once every two weeks, once every three weeks, once every four weeks, once a month, once every two months, once every three months, once every four months, once every five months, once every six months, once every seven months, once every eight months, once every nine months, once every ten months, once every eleven months, twice a year, or once a year, depending on the situation or the patient's condition.
[0156] Furthermore, the data described herein demonstrate that patient responses to treatment with humanized or chimeric 11-1F4 antibodies are not only sustained but also rapid. In some embodiments, patients may experience a therapeutic response (i.e., a reduction in the size of amyloid deposits or plaques, a decrease in the rate of plaque formation, or an improvement in organ function) within one week or less, two weeks or less, three weeks or less, four weeks or less, five weeks or less, six weeks or less, seven weeks or less, eight weeks or less, nine weeks or less, ten weeks or less, eleven weeks or less, twelve weeks or less, or any time frame in between. For example, depending on the dose and administration regimen, patients may experience a therapeutic response in about one week or about four and a half weeks.
[0157] The following examples are provided to illustrate the present invention. However, the present invention is not limited to the specific conditions or details described in these examples. All publications referenced herein are incorporated herein by reference. [Examples]
[0158] [PCR cloning and DNA sequencing of mouse 11-1F4 antibody] The heavy and light chain variable region genes of the mouse 11-1F4 monoclonal antibody were cloned by PCR, and detailed sequence analysis was performed on all isolated variable region genes (probable and functional). Detailed DNA and amino acid sequences of the mouse 11-1F4 antibody heavy and light chain variable region genes were obtained.
[0159] [material] Culture medium components and all other tissue culture materials were obtained from Life Technologies Ltd. (UK). RNA solution kits were obtained from Stratagene Ltd. (USA), and the first-strand cDNA synthesis kit was purchased from Pharmacia Ltd. (UK). All components and equipment for the RCR reaction, including AmpliTaq® DNA polymerase, were purchased from PerkinElmer Ltd. (USA). The TOPO TA Cloning® kit was obtained from Invitrogen Ltd. (USA). Agarose (UltraPure®) was obtained from Life Technologies Ltd. (UK). The ABI PRISM® Big Dye® Terminator Cycle Sequencing Preparation Kit premix cycle sequencing kit and the ABI PRISM® 310 sequencing machine were both purchased from PE Applied Biosystems Ltd. (USA). All other molecular biological products were obtained from New England Biolab Ltd. (USA) and Promega Ltd. (USA).
[0160] [method] From a hybridoma cell line producing the mouse monoclonal antibody 11-1F4, mouse V H and V K Figure 1 outlines the strategies used for PCR cloning of genes.
[0161] Two clones (B2C4 and B2D6) of the SP2 / 0 hybridoma cell line producing the α-human light chain monoclonal antibody 11-1F4 were kindly provided by Dr. Alan Solomon, MD, University of Tennessee Medical Science Center, Knoxville, Tennessee, USA. The hybridoma cell line is available from the American Cell Culture Lineage Preservation Service (ATCC depositary PTA-105). The cell line was cultured in DMEM medium supplemented with 20% (v / v) FBS, penicillin / streptomycin, and L-glutamine. 10 8 The cells were cultured until the total number of viable cells reached the specified number.
[0162] Cells were harvested separately from each clone as follows: Mouse hybridoma cell lines were suspended in appropriate culture medium for approximately 10 minutes. 8 The cells were grown to a sufficient quantity to provide a total number of viable cells. The culture supernatant was harvested, and the hybridoma cells were pelleted using a benchtop centrifuge (250 g, 5 min). The cells were gently resuspended in 20 ml of PBS, and a 100 μl aliquot was taken for viable cell counting. The aliquot cells were pelleted again, and 200 μl of PBS and 200 μl of trypan blue were added to 100 μl of the cells and gently mixed. 10 μl of this mixture was pipetted onto a disposable cell counting slide, and the number of leukocytes in nine small squares was counted under a microscope. Blue cells (i.e., dead cells) were not counted. The counting process was repeated, the results were averaged, and the average result was 9 × 10⁶. 5 Multiplying by the ratio obtained the number of viable cells in 20 ml of PBS. A sufficient number of cells were harvested and resuspended in 10 ml of solution D for RNA isolation (using Stratagene RNA isolation kit, see below).
[0163] Next, according to the manufacturer's instructions, total RNA was isolated individually from the cells of each clone using the Stratagene RNA isolation kit. 1 ml of 2 M sodium acetate (pH 4.0) was added to the sample, and the tube was inverted repeatedly to thoroughly mix the contents of the tube. 10.0 ml of phenol (pH 5.3 - 5.7) was added to the tube and inverted to remix the contents completely. 2.0 ml of chloroform-isoamyl alcohol mixture was added to the mixture, the tube was capped and shaken vigorously for 10 seconds, and the tube was incubated in ice for 15 minutes. The sample was transferred to a pre-cooled 50 ml thick-walled round-bottom centrifuge tube on ice, and the tube was rotated at 10000×g in a centrifuge at 4°C for 20 minutes. After centrifugation, two phases were visible in the tube. The upper aqueous phase contained RNA, and the lower phenol phase and the intermediate phase contained DNA and protein. The RNA-containing upper aqueous phase was transferred to a new centrifuge tube, and the lower phenol phase was discarded. An equal volume of isopropanol was added to the aqueous phase, the contents were inverted and mixed, and then the tube was incubated at -20°C for 1 hour to precipitate the RNA. The tube was rotated at 10000×g in a centrifuge at 4°C for 20 minutes. After centrifugation, the pellet at the bottom of the tube containing RNA was removed, and the supernatant was discarded. (Note: Up to this point, the RNA had been protected from ribonuclease by the presence of guanidinium isothiocyanate, but it was no longer protected here.) The pellet was washed with 75% (v / v) ethanol (DEPC-treated water (25%)), and the pellet was dried under vacuum for 2 - 3 minutes. The RNA pellet was resuspended in 0.5 - 2 ml of DEPC-treated water.
[0164] Not I-d(T) attached to the first-strand cDNA synthesis kit of Amersham Pharmacia Biotech 18Using primers, single-stranded DNA copies of 11-1F4 hybridoma mRNA were produced according to the manufacturer's instructions. As described below, one reaction was performed on each of the two isolated RNA samples. The components used were bulk first-strand cDNA reaction mix, cloning FPLCpure® mouse reverse transcriptase, RNAguard®, BSA, dATP, dCTP, dGTP and dTTP, 200 mM DIT aqueous solution, Not Id(T) 18 Primer: 5'-d[AACTGGAAGAATTCGCGGCCGCAGGAA 18 The samples were ]-3' and DEPC-treated water.
[0165] Approximately 5 μg of total RNA from 20 μl of DEPC water was heated at 65°C for 10 minutes, and then cooled on ice. The bulk first-strand cDNA reaction mix was gently pipettered to obtain a homogeneous suspension, and the reaction was set up in a 0.5 ml microcentrifuge tube as follows: 33 μl total volume of 20 μl denatured RNA solution, 11 μl bulk first-strand cDNA reaction mix, and 1 μl Not Id(T) 18 Primer and 1 μl of DTT solution. The reactants were pipetted together and gently mixed, then incubated at 37°C for 1 hour.
[0166] Next, mouse heavy chain and κ light chain variable region genes (V H Genes and V K The gene was PCR-amplified from an ssDNA template using the method described by Jones and Bendig (Bio / Technology, 9:88).
[0167] Appropriate steady-state primer (V H Regarding MHC1-MHC3 and V K Using an equimolar mixture of MKC, a denatured leader sequence-specific primer (V H Regarding MHV1-MHV12 and V K Separate PCR reactions were prepared for each of the following (MKV1-MKV11). Tables 1 and 2 show the results for each of the following: H and VK The primers used to amplify the regional genes are described in detail. In total, 12 heavy-chain reactions and 11 κ-light-chain reactions were performed. In all cases, as described below, the template cDNA was amplified using AmpliTaq® DNA polymerase.
[0168] The completed cDNA first-strand synthesis reaction product was heated at 90°C for 5 minutes to denature the RNA-cDNA double helix and inactivate the reverse transcriptase, and then cooled on ice. Eleven GeneAmp® PCR reaction tubes were labeled with MKV1-11. For each tube, a 100 μl reaction mixture was prepared containing 69.3 μl of sterile water, 10 μl of 10× PCR buffer II, 6 μl of 25 mM MgCl2, 2 μl of 10 mM stock solution of dNTPs, 2.5 μl of either a 10 mM MKC primer or a 2.5 μl 10 mM MKV primer, and 1 μl of RNA-cDNA template mix. Then, 0.7 μl of AmpliTaq® DNA polymerase was added to each tube, and 50 μl of mineral oil was added to the completed reaction mix.
[0169] A similar series of reaction mixtures were prepared as described above, and mouse heavy chain variable region genes were PCR cloned. However, this time, 12 reaction tubes were labeled, and one of 12 MHV primers and an appropriate MHC primer were added to each. For example, an MHC G1 primer was used to PCR amplify the mouse γ1 heavy chain variable domain gene.
[0170] The reaction tube was loaded into a DNA thermal cycler and processed for 25 cycles at 94°C for 1 minute, 50°C for 1 minute, and 72°C for 1 minute (after initial thawing at 94°C for 1.5 minutes). Following the last cycle, a final extension step was performed at 72°C for 10 minutes, after which it was cooled to 4°C. A 30-second ramp time was used between each step of the cycle, except for the annealing (50°C) step and the extension (72°C) step, which used an extended ramp time of 2.5 minutes. 10 μl aliquots from each PCR reaction were run on a 1% (w / v) agarose / 1×TBE buffer gel containing 0.5 μg / ml ethidium bromide to determine which leader primer produced the PCR product. The size of the positive PCR clones was approximately 420–500 bp.
[0171] The above PCR amplification process was repeated two more times, and the PCR reaction that was expected to amplify the fully variable-length domain gene was selected. Six μl aliquots of each potential PCR product were directly cloned into the pCR®II vector provided by the TA Cloning® kit, as described in the manufacturer's instructions. Aliquots of 10.0% (v / v), 1.0% (v / v), and 0.1% (v / v) transformed E. coli cells were pipetteed onto individual 90 mm diameter LB agar plates containing 50 μg / ml ampicillin, topped with 25 μl X-Gal stock solution and 40 μl IPTG stock solution, and incubated overnight at 37°C. Positive colonies were identified by PCR screening.
[0172] [Table 3]
[0173] [Table 4]
[0174] 5 μl aliquots from each PCR reaction were electrophoresed on a 1% agarose / TBE (pH 8.8) gel to determine which PCR products produced the correct size (approximately 450 bp). These putative positive PCR products identified in this way were directly cloned into the pCR2.1 vector provided by the TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies containing plasmids with the correct-sized insert were identified by PCR screening of the colonies using 1212 and 1233 oligonucleotide primers (Table 3) according to the method of Gussow and Clackson (Nucleic Acids Res., 17:4000). These putative positive clones identified in this way were sequenced using a double-stranded plasmid DNA sequencer with an ABI PRISM 310 Genetic Analyzer and an ABI PRISM BigDye® terminator. H and V K Three positive clones of each gene were sequenced, and V from the B2D6 hybridoma cell line clone was obtained. K Four positive clones of the gene and V H The six genes were sequenced in the same way.
[0175] [Table 5]
[0176] Table 4(a) shows the results of 12 PCR reactions performed on each hybridoma clone (B2C4 and BCD6) to amplify the mouse 11-1F4 antibody heavy chain variable region gene.
[0177] The denaturing leader sequence primer MHV7, when combined with a mix of MHCGI-3 constant region primers (Table 1), produced approximately 600 bp of PCR product from template cDNA derived from both B2C4 and B2D6 hybridoma cell lines. This band represents the mean V HThe gene was larger than the expected size (450 bp), so no further investigation was conducted. Conversely, the denaturing leader sequence primer MHV6, when combined with a mix of MHCGI-3 constant region primers (Table 1), was found to be able to translocate V from template cDNA derived from both B2C4 and B2D6 hybridoma cell lines. H PCR products of the gene with the predicted size (450 bp) were produced.
[0178] Table 4 shows the results of PCR amplification performed to clone the mouse 11-1F4 monoclonal antibody heavy chain variable region gene (a) and light chain variable region gene (b) from SP2 / 0 hybridoma cell lines B2C4 and B2D6. The third column records the actual PCR results. Where a band was observed with a specific primer combination, the base pair size (bp) was recorded in the appropriate space.
[0179] [Table 6]
[0180] Sequence analysis of three clones from B2C4-derived PCR products and five clones from B2D6-derived PCR products revealed the single heavy chain variable region sequence (Figure 2).
[0181] The cloning strategy used (amplification of the entire variable region gene by using primers adjacent to this region, i.e., leader sequence and constant region sequence-specific primers) allowed us to identify the complete FR1 sequence. All eight sequenced clones had identical sequences in this region (Figure 2).
[0182] Table 4(b) shows the results of 11 PCR reactions performed on each hybridoma clone (B2C4 and BCD6) to amplify the mouse 11-1F4 antibody κ light chain variable region gene.
[0183] The denatured leader sequence primer MKV6, when combined with the MKC constant region primer (Table 2), produced a PCR product of approximately 200 bp from template cDNA derived only from the B2C4 hybridoma cell line. This band represents V K Since it was much smaller than the predicted size of the gene (450 bp), we did not investigate it further.
[0184] The denatured leader sequence primer MKV2, when combined with the MKC constant region primer (Table 2), produced PCR products with a band size smaller than the expected 450 bp from template cDNA derived from both B2C4 and B2D6 hybridoma cell lines (as observed on agarose gel). Furthermore, the previous V K Cloning revealed that the MKV2 primer amplifies the well-known κ light chain pseudogene. Therefore, this product is identified as mouse 11-1F4 antibody V K To confirm that the product was a pseudogene rather than a real gene, a sequence analysis was performed on one clone of each PCR product. This sequence analysis revealed that the PCR clone in question was indeed a pseudogene.
[0185] Finally, when the denaturing leader sequence primer MKV1 is combined with the MKC constant region primer (Table 1), it can denature V from template cDNA derived from both B2C4 and B2D6 hybridoma cell lines. K The gene produced a PCR product of approximately the expected size (450 bp).
[0186] Sequence analysis of three clones of PCR products derived from B2C4 and four clones of PCR products derived from B2D6 revealed single κ light chain variable region sequences that could not be identified as pseudogenes.
[0187] Therefore, the 11-1F4 antibody heavy chain variable region gene was cloned from hybridoma mRNA (using constant region-specific and leader sequence-specific primers) and sequenced.
[0188] When translated, the sequence showed a TVSS peptide sequence. 122 rearranged human V peptides recorded in the Kabat database (Kabat et al., Sequences of Proteins of Immunological Interest) H Genetic analysis revealed that 84% of these sequences contained TVSS peptide sequences. Therefore, isolated V H It was concluded that the gene was the correct 11-1F4 antibody gene sequence.
[0189] The mouse 11-1F4 antibody variable region κ light chain gene is also non-functional V K Similar to the pseudogene, cloning and sequencing were successful. This pseudogene was first identified by Carroll et al. (Molecular Immunology (1988) 25:991). The sequence arises from an abnormal mRNA transcript present in all standard fusion partners derived from the original MOPC-21 tumor (including SP2 / 0). As a result of the abnormal mRNA, the invariant cysteine at position 23 is replaced by a tyrosine residue, the VJ joint goes out of frame, and a stop codon occurs at position 105.
[0190] Lymphoid cells or hybridoma cells commonly synthesize two or more rearranged light immunoglobulin mRNAs. These mRNAs are usually functional V K These are unproductive due to the presence of stop codons or frameshifts not typically found in genes. These false messengers, despite not encoding functional polypeptides, are excellent substrates for V-region PCR, often causing significant problems when cloning immunoglobulin genes from hybridomas.
[0191] 11-1F4 antibody V K The gene sequence was identified after detailed sequence analysis of seven distinct PCR clones isolated from two different PCR products, yielding Sequence ID No. 36. Since all sequences were identical, this was accepted as the correct 11-1F4 antibody κ light chain variable region sequence.
[0192] Cloning V H and V K Using the regional gene, we produced a chimeric mouse-human 11-1F4 monoclonal antibody, which was then analyzed to confirm its specific binding to AL fibrils. [Examples]
[0193] [Construction of Chimeric Mouse-Human 11-1F4 (c11-1F4) Antibody] V 11-1F4 as part of a chimeric mouse-human antibody in mammalian cells. H and V K To enable transient expression of variable region genes, it was necessary to modify the 5' and 3' ends using specifically designed PCR primers (Table 5). The oligonucleotide primers F39836 and F39837 were used to modify the 11-1F4 V K The gene was PCR modified and 11-1F4 was obtained using primers F39835 and F58933. H The gene was modified by PCR. Reverse (BAK) primers F39836 and F39835 were used. K and V H A HindIII restriction site, a Kosack translation initiation site, and an immunoglobulin reader sequence were introduced into the 5' end of each gene. The forward (FOR) oligonucleotide primer F39837 was used. K A splice donor site and a BamHI restriction site were introduced at the 3' end of the gene. The forward (FOR) oligonucleotide primer F58933 was used. H The first 22 base pairs of the γ-1CH1 gene, including the ApaI restriction site, were added to the 3' end of the gene.
[0194] [Table 7]
[0195] The Kozak consensus sequence is essential for the efficient translation of variable region sequences (Kozak, J Mol Bio, 196:947). It defines the correct AUG codon from which ribosomes initiate translation, and the single most important base is adenine (or slightly preferred guanine) at position 3 upstream of the AUG start.
[0196] The immunoglobulin leader sequence ensures that the expressed antibody is secreted into the culture medium and therefore easily harvested and purified. The leader sequence used in this example is V H and V K V of mouse 11-1F4 cloned from hybridoma cDNA during the cloning process K and V H It was a leader arrangement.
[0197] The splice donor sequence correctly attaches the light chain variable region to the appropriate constant region, and therefore the 130 bp V K :C K This is crucial for excising introns during splicing. Since the heavy chain variable region was directly attached to its appropriate constant region gene via the Apal site, the need for a splice donor site was eliminated.
[0198] Subcloning restriction sites HindIII and BamHI, as well as HindIll and Apal, are modified V, respectively. K and V H Variable region genes are sandwiched between the vectors. The use of various unique restriction sites ensured directional subcloning to appropriate mammalian expression vectors.
[0199] The 11-1F4 light chain variable region gene was first carefully analyzed to identify undesirable splice donor sites, splice acceptor sites, and Kozak sequences (see Table 6). Both the heavy chain and light chain variable region genes were analyzed for the presence of extra subcloning restriction sites that would later interfere with the subcloning and / or expression of the functional whole antibody. Nothing was found.
[0200] [Table 8]
[0201] For each variable region gene, a separate PCR reaction was prepared as follows: V of plasmid 11-1F4 as described above. H V for .pCR2.1 and 11-1F4 K.pCR2.1 was used as a template. 100 μl of reaction mixture was prepared in each PCR tube. Each mixture contained up to 41 μl of sterile water, 10 μl of 10× PCR buffer I, 8 μl of 10 mM stock solution of dNTPs, 1 μl of 10 mM 5' forward primer, 1 μl of 10 mM 3' reverse primer, and 1 μl of 1 / 10 diluted template DNA. Finally, 0.5 μl of AmpliTaq® DNA polymerase (2.5 units) was added, followed by 50 μl of mineral oil on top of the completed reaction mixture. The reaction tubes were loaded into a DNA thermal cycler and processed for 25 cycles at 94°C for 30 seconds, 68°C for 30 seconds, and 72°C for 50 seconds (after initial thawing at 94°C for 1 minute). Following the last cycle, a final extension step was performed at 72°C for 7 minutes, and the mixture was cooled to 4°C. Ten μl aliquots from each PCR reaction tube were electrophoresed on a 1.2% (w / v) agarose / 1×TBE buffer gel containing 0.5 μg / ml ethidium bromide to determine the size and presence of the PCR product. The size of the positive PCR clones was approximately 420 bp. These putative positive PCR products thus identified were directly cloned into the pCR2.1 vector provided by the Topo TA Cloning® kit and transformed into TOP10 competent cells as described in the manufacturer's protocol. Colonies were PCR-screened using 1212 and 1233 oligonucleotide primers (Table 3) according to the Gussow and Clackson method to identify colonies containing plasmids with correctly sized inserts. The putative positive clones were double-stranded plasmid DNA sequenced using an ABI PRISM 310 Genetic Analyzer and an ABI PRISM BigDye® terminator. H and V K Two positive clones of the gene were sequenced.
[0202] The correctly modified 11-1F4 V H and V of 11-1F4 KWe identified clones containing the gene and subcloned modified V genes from these clones into their respective expression vectors to promote the expression of chimeric heavy and κ light chains in mammalian cells. Modified 11-1F4 V K The gene was subcloned as the HindIII-BamHI fragment into the expression vector pKN100 (Figure 4). This vector contains the human κ constant region gene (allotype: Km(3 Ala153, Ser191)). Modified 11-1F4 V H The gene was also subcloned as the HindIII-ApaI fragment into the expression vector pG1D200 (Figure 5). This vector contains the human γ1 constant region gene (allotype: G1m(-1 Glu377, Met38I, -2 Ala462, 3 Arg222, Ser229)). Both the κ constant region allotype and the γ1 constant region allotype used are commonly found in Caucasian populations. Subsequently, DH5α-competent cells were transformed using the ligated expression constructs, 11-1F4VK.pKN100 and 11-1F4VH.pG1D200, and positive clones were identified using the PCR screening method described above with the original modified PCR primers (Table 4). The expression vectors are readily available. [Examples]
[0203] [Construction of a single supervector for transient expression of chimeric 11-1F4 in COS cells] A single supervector expressing both immunoglobulin chains of the chimeric 11-1F4 antibody was constructed as follows: The 11-1F4κ light chain expression cassette (containing the HCMVi promoter, 11-1F4κ light chain variable region gene, and κ light chain constant region gene) was digested by restriction enzymes from the 11-1F4VK.pKN100 construct (Figure 4) (EcoRI at positions 1 and 2490) and then ligated to the 11-1F4VHpG1D200 construct via a unique EcoRI (position 4297, Figure 5). This ligation constructed the supervector construct pG1KD200-11-1F4, which contains both the heavy and κ light chains of the 11-1F4 chimeric antibody. [Examples]
[0204] [Transient expression of all antibodies against chimeric γ1 / κ.11-1F4 in COS cells] The chimeric 11-1F4 antibody was transiently expressed in COS cells from the European Cell Culture Collection (ECACC) using the following two methods: (i) Cotransfection was performed using 10 μg each of the vector constructs 11-1F4VK.pKN100 and 11-1F4VH.pG1D200. Cotransfection was performed in two sequences. (ii) Transfection with 13 μg of a single supervector construct pG1KD200-11-1F4. Supervector transfection was performed five times.
[0205] The following transfection method was used: COS cell lines were transfected at 150 cm². 2 Cells were grown in flasks in DMEM ("Culture Medium") supplemented with 10% (v / v) FCS, 580 μg / ml L-glutamine, and 50 units / ml penicillin / 50 μg / ml streptomycin until confluent. The cells were trypsinized, centrifuged in a benchtop centrifuge (250 g, 5 minutes), then resuspended in 6 ml of medium, and then in three 150 cm³ chambers, each containing 25 ml of fresh preheated medium. 2 The cells were evenly divided into flasks. They were incubated overnight in 5% CO2 at 37°C and harvested the following day while they were growing exponentially. Each flask contained approximately 1 × 10⁶ cells. 7 It contained 10 cells. The cells were again trypsinized, pelletized as before, washed with 20 ml of PBS, and then the cell concentration was reduced to 1 × 10⁶. 7Resuspended in sufficient PBS to a concentration of cells / ml. 700 μl of these washed COS cells were pipetted into a Gene Pulser® cuvette, and then 1 μl of both the heavy chain expression vector DNA and κ light chain expression vector DNA (10 μg each) or 13 μg of the supervector construct was added thereto. Using a Bio-Rad Gene Pulser® apparatus, an electrostatic capacitance pulse of 1900 V and 25 μF was applied to the mixture. The pulse was repeated for each experimental transfection and the "no DNA" control (where COS cells were electroporated without DNA). To test the efficiency of COS cells, a positive control of a previously expressed antibody was also performed.
[0206] The COS cells were allowed to recover at room temperature for 10 minutes and then gently pipetted into a 10-cm diameter tissue culture dish containing 8 ml of pre-warmed DMEM supplemented with 10% (v / v) FBS without γ-globulin, 580 μg / ml of L-glutamine, and 50 units / ml of penicillin / 50 μg / ml of streptomycin, and incubated at 37 °C in 5% CO2 for 72 hours. After incubation for 72 hours, the COS cell supernatant was harvested for analysis. After 72 hours of incubation, the medium was collected, rotated to remove cell debris, and analyzed by ELISA for chimeric antibody production and antigen binding of the c11-1F4 antibody.
Example
[0207] [Quantification of chimeric γ1 / κ11-1F4 antibody via capture ELISA] After expression, the entire IgG molecule present in the COS cell supernatant was quantified using a capture ELISA assay. IgG molecules were captured on Nunc-Immuno MaxiSorb™ plates via immobilized goat anti-human IgG, Fcγ fragment-specific antibodies and detected via anti-human κ light chain peroxidase conjugate antibodies. Standard curves were created by capturing and detecting known concentrations of standard IgG antibody on the same plates using the same method as described below. Each well of a 96-well immunoplate was coated with a 100 μl aliquot of 0.4 μg / ml goat anti-human IgG antibody diluted in PBS and incubated overnight at 4°C. Excess coating solution was removed, and the plate was washed three times with 200 μl / well of wash buffer (1x PBS, 0.1% TWEEN). 100 μl of SEC buffer was dispensed into all wells except for wells B through G of the second column. A standard solution of human IgG1 / κ antibody in SEC buffer at a concentration of 1 μg / ml was prepared, and 200 μl / well was pipetteed into the wells in rows B and C of the second column. The culture medium of the transfected cos cells was centrifuged (250 g, 5 min), and the supernatant was saved. A 200 μl aliquot of the supernatant from the "DNA-free" control (cos cells transfected in the absence of DNA) was pipetteed into the well in row D of the second column, and a 200 μl / well aliquot of the experimental supernatant was pipetteed into the wells in rows E, F, and G of the second column. The 200 μl aliquots from the wells in rows B through G of the second column were mixed, and then 100 μl was transferred from each well to the adjacent well in the third column. This process was continued up to the 11th row with a series of 2x dilutions of standard, control, and experimental samples, then all were incubated at 37°C for 1 hour, and all wells were rinsed six times with 200 μl aliquots of wash buffer. Goat anti-human κ light chain peroxidase conjugate was diluted 5000-fold with SEC buffer, and 100 μl of the diluted conjugate was added to each well, with the incubation and rinsing steps repeated. 150 μl of K-BLUE substrate was added to each well and incubated in the dark at 25°C for 10 minutes. The reaction was stopped by adding 50 μl of RED STOP solution to each well, and the optical density was read at 655 nm. [Examples]
[0208] [Binding analysis of chimeric 11-1F4 antibody] The chimeric 11-1F4 antibody was tested for binding to amyloid fibrils using a direct binding ELISA assay. Synthetic fibrils were formed from immunoglobulin light chain proteins and used to monitor antibody reactivity in a solid-phase ELISA-based assay using a "low-binding" polystyrene plate (Costar, no. 3474). Immediately before coating the plate, a 250 μg mass of fibrils was diluted to 1 ml with coating buffer (0.1% bovine serum albumin in phosphate-buffered saline at pH 7.5). The sample was then sonicated for 20 seconds using a Tekmar Sonic Disruptor ultrasound probe at a power set to 40% of the maximum to obtain a solution of short fibrils, each consisting of up to 2–5 protofilaments. This solution was then diluted to 5 ml, thoroughly mixed by vortexing, and divided equally into the plate wells. This process yielded 50 μl of fibril solution at a concentration of 50 μg / ml in each well. Next, the plate was placed in a 37°C incubator without a lid and dried overnight.
[0209] Next, within 48 hours of plate preparation, the ELISA assay was performed as follows: Wells were blocked by adding 100 μl of 1% BSA in PBS and incubated on a shaker at room temperature for 1 hour. The plate was washed three times with PBS and 0.05% Tween 20 (v / v). 50 μl of c11-1F4 solution (3 μg / ml antibody in 0.1% BSA / PBS) was added to each well of the plate, and the plate was incubated on a shaker at room temperature for 1 hour. The plate was washed three times again (as before), and detection of conjugated antibodies was achieved using biotinylated goat anti-mouse IgG antibody (Sigma number B-8774, anti-heavy chain and light chain).
[0210] [result] V successfully modified H and V K Gene sequence analysis revealed the existence of the correct sequence. The modified 11-1F4 VK and V H Detailed DNA and amino acid sequences of the gene are shown in Figures 3 and 4. Modified V K and V H We successfully cloned the gene into the mammalian expression vectors pG1D200 and pKN100, respectively, and used the resulting 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs for cotransfection of mammalian cells.
[0211] Next, a single supervector (pG1KD200-11-1F4) expressing chimeric 11-1F4 antibodies in mammalian cells was also constructed using the 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs. The levels of chimeric 11-1F4 antibody expression from both co-transfection and supervector transfection of ECACC COS cells were analyzed. The expression level observed from transfection with the pG1KD200-11-1F4 supervector (10326 ng / ml) was 3.7 times higher than the level observed from corresponding co-transfection with the 11-1F4VK.pKN100 and 11-1F4VHpG1D200 constructs (2820 ng / ml).
[0212] Following expression and quantification, the binding of the chimeric 11-1F4 antibody to the target antigen (amyloid fibrils kindly provided by the NCI) was tested by direct-binding ELISA. The results of the binding ELISA are shown in Figure 8. The supernatants from two best individual pG1KD200-11-1F4 supervector transfections were analyzed in parallel with one supernatant from the corresponding co-transfection.
[0213] The results showed that the chimeric 11-1F4 antibody bound to amyloid fibrils with higher affinity than its mouse equivalent. This result was surprising and unexpected, as chimeric antibodies are typically expected to have binding affinity comparable to the original mouse antibody. While not intended to be constrained by any specific mechanism, the inventors believe that the net effect obtained by combining the 11-1F4 mouse V region with the human γ1 / κC region used to create the chimeric 11-1F4 antibody may have resulted in an antibody with higher affinity.
[0214] The sample of CHO cells (identified as CAEL-101) secreting the chimeric 11-1F4 monoclonal antibody used herein was deposited on June 27, 2018, by the American Cell Culture and Cell Lineage Preservation Service (ATCC deposit number: PTA-125146) in accordance with the Budapest Convention. [Examples]
[0215] [Testing of mouse amyloidosis using mouse 11-1F4] Amyloid was extracted from humans and characterized. Specifically, 30-40 g of fresh-frozen (-80°C) or 10 g of freeze-dried spleen or liver obtained postmortem from patients with AL amyloidosis was homogenized in approximately 300 ml of cold saline using a Virtis-Tempest apparatus (VirTis, Gardiner, New York, USA). The homogenate was centrifuged at 17,000 rpm for 30 minutes at 6°C, and the OD of the resulting supernatant was A 280Homogenization and washing were repeated until the concentration was less than 0.10 to remove residual saline-soluble material. The pellet was then repeatedly homogenized, washed with cold deionized water, centrifuged, and the amyloid-containing supernatant was freeze-dried. The amount of recovered protein was approximately one-third to one-fifth of the starting material weight. The light chain composition and VL subgroup of amyloid were determined by amino acid sequencing of peptides separated by high-performance liquid chromatography (Procise Protein Sequencing System by Applied Biosystems, Inc., Foster, California, USA) and ionization mass spectrometry (PE SCIEX API 150 EX by PerkinElmer, Inc., Norwalk, Connecticut, USA) obtained by trypsin digestion of reduced and pyridylethylated proteins extracted from the water-soluble material with 6 mol / L guanidine HCl. The presence of proteoglycan heparan sulfate was established using the Azure assay.
[0216] The composition of the amyloid extracts was determined by chemistry, immunoblotting, amino acid sequencing, and ionization mass spectrometry. The main protein species were found to be, in most cases, primarily the variable region (VL) and the constant region (CL) of the first approximately 50 residues, and elsewhere, κ or λ light chain-related molecules consisting of VL fragments or intact molecules. Furthermore, these extracts contained the expected amyloid-related P component, as well as proteoglycan heparin sulfate.
[0217] Freeze-dried water-soluble amyloid extract was suspended in 25 ml of sterile saline and homogenized using a PCU-2 Polytron system (Brinkman, Lucerne, Switzerland). The fibrils were precipitated by centrifugation at 17,000 rpm for 30 minutes at 6°C, and the resulting pellet was resuspended in 1 ml of sterile saline and rehomogenized. This solution was subcutaneously injected between the scapulae of BALB / c, CD-18 null, and CB-17 SCID mice using an 18-gauge needle attached to a 6 ml syringe. The size of the resulting amyloidoma was measured by daily palpation and confirmed by autopsy. High-resolution computed tomography images were acquired using a microCat system (Oak Ridge National Laboratory, Oak Ridge, Tennessee, USA).
[0218] The injected substance formed easily visible, palpable lumps on the animals' backs, their size depending on the amount injected (e.g., maximum diameter 0.2–2.5 cm). The amyloidomas remained localized and unchanged for approximately 10–24 days, as evidenced by high-resolution X-ray computed tomography. After that point, the amyloidomas began to regress and eventually disappeared in approximately 4 days. This reaction occurred regardless of the κ or λ nature or the VL subgroup of the amyloid extract. However, in a study involving five different κ and seven λ amyloidomas, the ALλ extract typically degraded more slowly than ALk (ALλ, 18+ / -6 days vs. ALκ, 13+ / -3 days). Regardless of the tissue source of the amyloid, sufficient material was available to repeat the experiment at least four times in 8 of the 12 cases in which this effect was found to be reproducible in healthy young animals. However, the lysis of induced amyloidoma was consistently delayed for more than 3 months in older mice (over 18 months old) and immunodeficient mice.
[0219] Histological examination to determine the fate of degenerative amyloidoma demonstrated that amyloid was not redistributed to other mouse tissues, as evidenced by Congo red staining. Furthermore, the amyloidoma was infiltrated by polymorphonuclear cells, i.e., neutrophils, which were positive for naphthol AS-D chloroacetate and negative for α-naphthylacetate. In contrast, this cellular response did not occur in CD-18 null mice, and the resolution of human AL amyloidoma took a considerably longer period (i.e., 3 months). Moreover, amyloidolysis was delayed in animals that developed severe neutropenia upon co-administration of 250 mg of anti-neutrophil mAb Gr-1 at the time of amyloidoma induction and again on day 3.
[0220] Amyloid removal also depended on humoral mouse responses to human light chain-containing materials. Approximately 10–20 days after amyloidoma induction, the inventors demonstrated in immunoblotting experiments that mouse serum contained antibodies that recognized not only the light chain components of the injected amyloid protein but also heterologous ALκ or ALλ extracts. In contrast, there was no reactivity with homologous amyloid precursor proteins, i.e., Bence-Jones protein or other monoclonal light chains tested. When the same amyloid preparation was re-administered to these immunized animals, the elimination rate increased by approximately twofold.
[0221] To test the therapeutic efficacy of mouse 11-1F4, a series of experiments were initiated in which pairs of mice bearing human AL amyloidomas were administered a 100 μg dose of the antibody. In the case of ALk, a test involving two different extracts revealed that even a single injection of the antibody caused amyloid tumors to disappear rapidly and completely compared to untreated animals (Table 7, Figure 9). The mass of the ALkλ amyloidomas decreased by more than 90% within 4 days after antibody injection compared to control animals. However, multiple administrations of the reagent were required to achieve a similar response with certain ALλ-type amyloidomas. These were administered as a series of 100 μg injections starting at the time the amyloidomas were induced (day 0), and then again on days 2, 4, and 6 (Figure 9B). As shown in Table 7, in an experiment testing five different human ALλ amyloidomas in the mouse model, treatment with 11-1F4 was found to reduce the elimination time of amyloid tumors by a factor of four. In particular, single or repeated administrations of two other anti-light chain mAbs that recognize AL fibrils (e.g., 31-8C7) promoted amyloid degradation, and the 11-1F4 reagent was unique in that it accelerated the removal of both ALκ and ALλ amyloid at different rates. In contrast, the other three anti-light chain mAbs tested lacked such activity.
[0222]
Table 9
[0223] It was also determined that 11-1F4 recognizes other types of amyloid, as demonstrated by immunohistochemical analysis of AA-, ATTR-, ALyS-, AApoA1- and Ab-containing tissues. In each case, similar reactivity patterns were obtained with 11-1F4 and antibodies specific for these five different types of amyloid proteins.
Example
[0224] [Phase 1a / b Trial of Chimeric 11-1F4 Antibody] GMP-grade amyloid fibril-reactive chimeric IgG1 mAb 11-1F4 was manufactured by the NCI's Division of Bioresources for a Phase 1a / b trial treating patients with refractory AL amyloidosis. The CHO cell line producing chimeric IgG1 mAb 11-1F4 has been identified as CAEL-101.
[0225] Patients with relapsed or refractory AL amyloidosis who had previously received antiplasmacytic therapy were enrolled. Patients received chimeric IgG1 mAb 11-1F4 as a single intravenous infusion (Phase 1a) or as a series of weekly infusions over 4 weeks (Phase 1b). 0.5 mg / m² 2 , 5 mg / m² 2 , 10 mg / m² 2 50 mg / m² 2 , 100 mg / m² 2 , 250 mg / m² 2 , and 500 mg / m² 2 A dose-escalation "up-down" design was used in both Phase 1a and Phase 1b, where continuous doses were administered.
[0226] The primary objective of this study is to establish the maximum tolerated dose of chimeric 11-1F4, with secondary objectives being: (1) to demonstrate a reduction in amyloid load as evidenced by a reduction in affected organ enlargement and / or improvement in organ function; (2) to determine the pharmacokinetics of 11-1F4 when administered as a single IV infusion (Phase 1a) or a series of weekly IV infusions (Phase 1b); and (3) 250 mg / m² 2 Dosage and 500 mg / m² 2 This included determining the difference in dosage.
[0227] The primary inclusion criteria included patients aged 21 or older, those who had previously received systemic therapy, those who did not require plasma cell-targeted therapy, and those with an East Coast Cancer Group (ECOG) performance status of 3 or less.
[0228] The primary exclusion criteria included intraventricular septum greater than 2.5 mm, creatine clearance less than 30 cc / min, alkaline phosphatase more than three times the upper limit of the institutional normal range, and bilirubin greater than 3.0 mg / dL.
[0229] In the Phase 1a trial, dose escalation followed an "up-down design." After tolerability was achieved, patients each received progressively higher doses of chimeric 11-1F4 mAb, with two patients receiving 500 mg / m². 2 Registered by dosage: 500 mg / m² 2 Even patients who received the dose did not report dose-limiting toxicity. As shown in Figure 9A, patients were evaluated at week 0, administered chimera 11-1F4 at week 1, and re-evaluated at weeks 2, 3, 4, and 8.
[0230] In the Phase 1b trial, the dosage was 0.5 mg / m². 2 Treatment began with a dose of 11-1F4 mAb and continued with weekly infusions for four weeks. After tolerance was achieved, patients gradually received higher doses of chimera 11-1F4 mAb, with six patients receiving 500 mg / m². 2 The dosage was registered. The administration scheme is shown in Figure 9B.
[0231] [result] Twenty-seven patients were treated with the chimeric 11-1F4A antibody. Twenty-six patients were evaluable for response. Eight patients completed Phase 1a, and 19 patients completed Phase 1b. The median age for both Phase 1a and Phase 1b was 68 years. All patients received the given dose of mAb chimeric 11-1F4 and the maximum dose level of 500 mg / m² in both Phase 1a and Phase 1b. 2It was well-tolerated up to that point. There were no drug-related grade 4 or 5 adverse events (AEs) or dose-limiting toxicities. Two patients developed a grade 2 rash 3-4 days post-infusion. One patient developed a skin rash upon withdrawal in phase 1a (dose level 4) and phase 1b. Skin biopsy by immunohistochemical staining showed binding of chimeric 11-1F4 to amyloid fibrils with concomitant neutrophil infiltration. This patient and another patient developed a similar rash in phase 1b. This further provides clinically correlative data that chimeric 11-1F4 directly binds to light chain amyloid fibrils. Overall, 63% (5 out of 8) of evaluable patients demonstrated an organ response after a single infusion of mAb c11-1F4 in phase 1a. The mean time to response in phase 1a was 4.5 weeks after completion of treatment. In Phase 1b, 61% of evaluable patients (11 out of 18) showed a significant organ response, with an average time to response of one week after the start of treatment, and a tendency for faster responses with higher doses.
[0232] The patient characteristics of a subset of evaluable patients are shown in Table 8 below.
[0233] [Table 10]
[0234] At the end of the Phase 1a / b trial, 18 patients showed an evaluable response (N=1 had no measurable disease, and N=2 did not complete the procedure). Twelve of the 18 patients (67%) showed improved organ response. Specifically, in Phase 1a, 63% (5 out of 8) of patients with measurable disease burden demonstrated an organ response after a single infusion of mAb 11-1F4 (2 for kidney, 2 for heart, and 1 for GI). In Phase 1b, 70% (7 out of 10) of patients with measurable disease burden showed an organ response. Three out of four patients evaluated for responses including cardiac involvement showed a cardiac response. Four out of four patients evaluated for responses including renal involvement showed a renal response. One patient with a GI response was evaluated. One patient with a soft tissue response showed improvement in arthritis from 3 to 1.
[0235] [Cardiac response] Eight patients were evaluated for cardiac response. The metrics evaluated included NT-proBNP and NYHA class criteria. All of these patients had baseline levels of ≥650 pg / ml. Five patients (63%) showed significant improvement in response (i.e., a ≥30% decrease in NT-proBNP and / or transition from NYHA class III to class I), two patients remained stable, and only one showed any signs of disease progression. Cardiac outcomes for the patient group are shown in Figure 11. A decrease in NT-proBNP in one exemplary patient is shown in Figure 12.
[0236] [Kidney response] Eight patients were evaluated for renal response. Proteinuria was the primary metric used to determine responsiveness. Six patients (75%) showed significant improvement in response (i.e., a reduction of 30% or more in proteinuria, or a reduction to less than 0.5 g / 24 hours without renal progression), and two patients remained stable. No patients showed signs of renal disease progression (a deterioration of more than 25% in eGFR). Renal outcomes for the patient group are shown in Figure 13. The reduction in proteinuria in one exemplary patient is shown in Figure 14.
[0237] [Summary of test results] Treatment with Chimera 11-1F4 was well-tolerated and safe. 500 mg / m² 2Up to the MTD, there were no drug-related grade 4 or 5 adverse events (AEs) or dose-limiting toxicities. Furthermore, Chimera 11-1F4 is clinically effective. Most patients experienced early, sustained organ responses as a single infusion or as weekly infusions over four weeks. Improved response was observed across tissues / organs, including cardiac, renal, GI, skin, and soft tissue responses. In fact, Chimera 11-1F4 safely promoted amyloid thawing in 67% of patients, and even in patients with ALλ deposition, improved organ function resulted after a single dose. Patient responses to Chimera 11-1F4 were rapid and sustained. Indeed, Chimera 11-1F4 delivered positive responses faster than other known therapies targeting amyloid fibrils, with median response times of 4.5 weeks in Phase 1a and just 1 week in Phase 1b. The rapid destruction of amyloid fibrils by chimeric 11-1F4 improves organ function and, consequently, significantly reduces mortality in patients with this uniformly fatal disease. [Examples]
[0238] [Cardiac response to chimeric fibrillary-reactive monoclonal antibody 11-1F4 in patients with AL amyloidosis using long-axis global strain: Results of a Phase 1b trial] We have completed an open-label Phase 1b clinical trial of Chimera 11-1F4 mAb, yielding the following promising results. This trial was conducted to evaluate the cardiomyocyte response to mAb administration using axial global strain (GLS).
[0239] Nineteen patients with relapsed or refractory AL amyloidosis were enrolled in the study (age ± SD, 63 ± 12, 68% male). 53% had light chain κ amyloid, and 52% had cardiac involvement as defined by NT pro-BNP levels >650 pg / ml. NT pro-BNP screening and baseline levels for the 19 patients are shown in Table 9 below. These cardiac patients included two patients who did not participate in the primary clinical analysis assessable by the heart due to differences in screening and baseline NT-proBNP levels.
[0240] [Table 11]
[0241] The mAb was administered at a dose escalation design of 0.5 mg / m². 2 , 5 mg / m² 2 , 10 mg / m² 2 50 mg / m² 2 , 100 mg / m² 2 , 250 mg / m² 2 , and 500 mg / m² 2 The drug was administered weekly in a continuous dose for 4 weeks. Clinical echocardiography (ECHO) was compared between baseline and 12 weeks after treatment. Several echocardiographic variables were obtained, including left ventricular ejection fraction (LVEF) (calculated using Simpson's two-way method) and longitudinal global strain (GLS). GLS was measured using speckle tracking (TomTec-Arena 1.2 from TomTec, Germany) and calculated as the mean of 4, 2, and 3 chamber-based measurements. Echocardiographic variables at baseline and 12 weeks after mAb treatment were compared using a paired Student's t-test. The analysis of echocardiographic parameters is shown in Table 10 below.
[0242] [Table 12]
[0243] For the overall cohort, there were no significant changes in LVEF (56.2±8.6% vs. 56.2±9.5%, p=0.985) or GLS (-19.04±-5.11% vs. -19.73±-4.1%, p=0.119) from baseline to the 12-week trial. However, patients with cardiac involvement showed improvement in GLS (pre--15.58±-4.14% vs. post--17.37±-3.53%, p=0.004), as illustrated in Figure 15. Exemplary echocardiograms of patients with cardiac involvement before and at 12 weeks post-treatment with chimeric 11-1F4 mAb are shown in Figure 17. The patient shown in Figure 17 had a baseline NT-proBNP level of 2549 pg / mL and a GLS value of -9.58 before treatment. Following 12 weeks of treatment with chimeric 11-1F4 mAb, patients showed a reduction in GLS to -13.39 and a reduction in NT-proBNP to 1485 pg / mL. Subgroup analyses showed improvements in GLS in patients with λ-amyloid cardiac involvement (pre--14.3±-4.38% vs. post--16.17±-3.74%, p=0.02) and a trend towards improvement in κ-amyloid cardiac involvement (pre--16.60±-4.10% vs. post--18.16±-3.48%, p=0.07). Furthermore, the cardiac disease evaluable population as defined in the clinical analysis of the trial (using baseline NT-proBNP values rather than screening values) also yielded a statistically significant reduction in GLS% (p-value 0.0163), which was numerically similar to the reduction (-1.71) provided by the ECHO group (-1.69). Table 11 below shows an analysis of the reduction in GLS in patients with cardiac disease versus patients with assessable cardiac disease and patients without cardiac disease.
[0244] [Table 13]
[0245] In conclusion, this trial demonstrates a significant improvement in GLS after exposure to antigen fiber-specific mAbs in subjects including those with AL amyloid cardiac involvement. As shown in Figure 15, 9 out of 10 patients, including those with cardiac involvement, showed improvement in GLS%. The probability of 9 or more patients showing improvement under the null hypothesis of no drug effect is approximately 0.0107, suggesting that observing improvement in 9 out of 10 patients is a very unlikely outcome unless the drug is truly effective. This preliminary data is useful for designing larger clinical trials. Furthermore, large-scale trials utilizing GLS to assess myocardial function are justified. [Examples]
[0246] [Organ responses to the chimeric fibrillation-reactive monoclonal antibody 11-1F4 in patients who are not hematologically controlled] Patients who had received six rounds of chemotherapy and achieved a partial hematological response with treatments that did not produce organ responses were administered the chimeric amyloid fibrillation-reactive monoclonal antibody (mAb) 11-1F4. A consistent decrease in NT-proBNP was observed after 11-1F4 treatment over three consecutive periods following administration, and the patients achieved organ responses as shown in Figure 16. However, when the antibody was discontinued, free light chains increased, and the patients' condition deteriorated. Furthermore, organ progression was observed after completion of the study. Based on this patient's response pattern, the researchers concluded that the organ response was due to chimeric 11-1F4 antibody treatment and unrelated to the hematological response caused by chemotherapy.
[0247] The word “comprise,” as used in this description and in the claims, and its variations, including “comprises” and “comprising,” are not intended to exclude other features, additives, ingredients, integers, or steps unless otherwise explicitly stated. The scope of these words is to be interpreted broadly to have an inclusive rather than exclusive meaning.
[0248] The compositions and methods of the present invention have been described herein with reference to examples. However, it will be understood that the present invention is not limited thereto, and various modifications are possible as known to those skilled in the art without departing from the teachings of the invention as defined by the appended claims.
Claims
1. A pharmaceutical composition for treating primary amyloidosis in human patients requiring treatment for said primary amyloidosis, The aforementioned primary amyloidosis is associated with the heart, The treatment includes administering the pharmaceutical composition to the patient. The pharmaceutical composition comprises a chimeric mouse-human antibody and a pharmaceutically acceptable carrier. The aforementioned chimeric mouse-human antibody comprises a VK region containing SEQ ID NO: 47 and a VH region containing SEQ ID NO:
48. The pharmaceutical composition is a multiple therapeutically effective dose for treating the amyloid deposition disease of primary amyloidosis, The aforementioned chimeric mouse-human antibody binds to the epitopes of amyloid fibrils with higher affinity than the mouse antibody containing the Vκ region of SEQ ID NO: 36 and the VH region of SEQ ID NO:
35. Here, by administering multiple effective therapeutic doses, the patient's N-terminal pro b-type natriuretic peptide (NT-proBNP) level is reduced compared to the baseline level determined before administration of the chimeric mouse-human antibody. The level of NT-proBNP is reduced by at least approximately 30% over a period of 4–12 weeks after administration. Here, by administering effective multiple therapeutic doses, the level of global longitudinal strain (GLS) in patients with cardiac involvement is reduced compared to the baseline level determined before administration of the antibody. The GLS is calculated using the Lagrangian formula and measured after 12 weeks of administration of the chimeric mouse-human antibody, in a pharmaceutical composition.
2. Approximately 500mg / m 2 The pharmaceutical composition according to claim 1, administered in the following doses.
3. The pharmaceutical composition according to claim 1, wherein the effective dose is approximately 1 mg / kg to 50 mg / kg.
4. The pharmaceutical composition according to claim 1, wherein the primary amyloidosis involves the involvement of at least one organ or tissue selected from the group consisting of the heart, kidneys, liver, lungs, gastrointestinal tract, nervous system, musculoskeletal system, soft tissues, and skin.
5. The pharmaceutical composition according to claim 1, wherein the patient shows signs of a therapeutic response within about one week.
6. The pharmaceutical composition according to claim 5, wherein the primary amyloidosis includes cardiac involvement.
7. The pharmaceutical composition according to claim 1, wherein the effective dose of the chimeric mouse-human antibody is approximately 2200 mg.
8. The pharmaceutical composition according to claim 5, wherein the patient is classified as New York Heart Association (NYHA) functional class II or III before administration of the chimeric mouse-human antibody and is classified as class I after administration of the chimeric mouse-human antibody.
9. The pharmaceutical composition according to claim 5, wherein the primary amyloidosis includes renal involvement.
10. The pharmaceutical composition according to claim 1, wherein the chimeric mouse-human antibody comprises a constant region derived from human IgG1.
11. The pharmaceutical composition according to claim 1, wherein the primary amyloidosis is primary light chain (AL) amyloidosis.
12. The pharmaceutical composition according to claim 11, wherein the AL amyloidosis comprises aggregates of λ light chain fibrils.
13. The pharmaceutical composition according to claim 1, wherein the therapeutically effective amount of the chimeric mouse-human antibody is administered once every two months, once every three months, once every four months, once every five months, or once every six months.
14. The pharmaceutical composition according to claim 1, wherein the therapeutically effective amount of the chimeric mouse-human antibody is administered every six months.
15. The pharmaceutical composition according to claim 11, wherein the AL amyloidosis is intractable.