Il-6 and / or il-1β inhibitor

Abstract

The present invention addresses the problem of providing a medicine for treating cardiovascular disease associated with inflammation of the cardiovascular system related to IL-6 and / or IL-1β. The present invention relates to an IL-6 and / or IL-1β inhibitor comprising a compound represented by formula (I) (in the formula, each symbol is as described in the specification.) or a pharmaceutically acceptable salt thereof. The present invention also relates to a medicine for treating cardiovascular disease associated with inflammation of the cardiovascular system related to IL-6 and / or IL-1β that contains as an active ingredient the abovementioned compound or a pharmaceutically acceptable salt thereof.

Description

IL-6 and / or IL-1β inhibitors

[0001] The present invention relates to prostaglandin derivatives that suppress excessive gene expression or production of IL-6 and / or IL-1β and are useful for treating cardiovascular diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β.

[0002] Interleukin-6 (IL-6) and interleukin-1β (IL-1β) are cytokines with diverse physiological functions and play important roles in regulating immune and inflammatory responses. However, excessive gene expression and continued production can cause various pathological conditions.

[0003] For example, immune cells and the cytokines they produce have been implicated in the development of heart failure. It is known that IL-6 levels in the blood increase in patients with heart failure or myocarditis, and that this is related to prognosis (Non-Patent Documents 1 and 2).

[0004] It has been reported that elevated levels of inflammatory cytokines such as IL-6 in the blood of patients with pulmonary hypertension are a factor in poor prognosis (Non-Patent Document 3). It has also been reported that in patients with pulmonary hypertension, membrane-bound IL-6 receptors are highly expressed in pulmonary artery vascular smooth muscle cells, and that IL-6 signaling contributes to pulmonary artery remodeling by conferring anti-apoptotic resistance to vascular smooth muscle cells (Non-Patent Document 4).

[0005] It has been confirmed that IL-6 is overexpressed in patients with systemic sclerosis, that IL-6 has a strong influence on fibrosis, and that IL-6 inhibitors have a therapeutic effect on interstitial lung disease associated with systemic sclerosis (Non-Patent Document 5).

[0006] Regarding pulmonary arterial hypertension, it has been confirmed that blood IL-6 levels are high, particularly in patients with pulmonary arterial hypertension associated with connective tissue disease or portal hypertension, and it has been reported that patients with higher blood IL-6 levels have a poorer prognosis (Non-Patent Document 6).

[0007] It has been reported that serum IL-6 levels increase in correlation with disease activity in patients with Takayasu's arteritis, and the efficacy of IL-6 inhibitors was subsequently demonstrated, leading to their clinical use (Non-Patent Documents 7, 8, and 9).

[0008] On the other hand, IL-1β is deeply involved in inflammatory responses and also plays an important role in the control of metabolic cardiac hypertrophy. Since favorable treatment outcomes have been obtained in clinical trials targeting IL-1β for cardiovascular events and heart failure, the control of chronic inflammation with IL-1β inhibitors has recently attracted attention as a new treatment for heart failure (Non-Patent Documents 10, 11).

[0009] For these reasons, agents that suppress excessive gene expression or production of IL-6 and / or IL-1β (hereinafter, sometimes referred to as "IL-6 and / or IL-1β suppressors") are expected to be useful as therapeutic agents for cardiovascular diseases accompanied by inflammation of the cardiovascular system.

[0010] Cardiac hypertrophy refers to a condition in which the heart muscle becomes enlarged and increases in myocardial mass. Specifically, it is a phenomenon that occurs when the load on the heart increases for some reason, and cardiac hypertrophy occurs as a compensatory mechanism. Hypertrophy due to thickening of the heart wall is often caused by hypertension, valvular disease, cardiomyopathy, etc., but can also be caused by myocardial abnormalities associated with hyperthyroidism or hypothyroidism, muscular dystrophy, etc. Cardiac hypertrophy is a risk factor for heart failure and coronary artery disease, so treatment to suppress or reduce cardiac hypertrophy is important.

[0011] Heart failure is defined as a clinical syndrome characterized by some form of cardiac dysfunction, i.e., organic and / or functional abnormalities in the heart, resulting in a breakdown of the cardiac pumping mechanism, resulting in dyspnea, fatigue, and edema, accompanied by a decrease in exercise tolerance. For example, acute myocarditis can lead to cardiac hypertrophy due to inflammatory cell infiltration and myocardial edema, leading to heart failure. Heart failure is known to progress to ventricular hypertrophy, dilation, systolic dysfunction, and diastolic dysfunction, a process known as myocardial remodeling. This process involves myocardial wall hypertrophy, cardiomyocyte hypertrophy, degeneration, and interstitial fibrosis. Improving myocardial remodeling is considered one of the key goals in the treatment of heart failure, and therapeutic agents with novel mechanisms of action are eagerly awaited.

[0012] Right-sided heart failure is a condition in which the function of the right heart system is impaired during the process in which venous blood returning from the body to the heart passes through the right heart system and is transported to the lungs. If left untreated, it can be a life-threatening disease. Right ventricular hypertrophy is one of the major changes in right-sided heart failure. The main cause of right-sided heart failure is impaired pulmonary circulation, particularly when the pulmonary circulation is affected by pulmonary embolism or pulmonary hypertension.

[0013] Pulmonary embolism is usually accompanied by characteristic clinical signs, such as acute shortness of breath, collapse-like symptoms, and chest pain. Pulmonary embolism usually occurs when a blood clot formed in the veins of the lower extremities for some reason travels through the blood vessels to the pulmonary artery and blocks it.

[0014] Pulmonary hypertension is an intractable disease accompanied by elevated pulmonary arterial pressure, which is caused by pulmonary vascular remodeling due to pulmonary arterial endothelial damage, smooth muscle proliferation, inflammation, and immune abnormalities.

[0015] Pulmonary vascular remodeling is primarily caused by the proliferation of arterial endothelial cells and smooth muscle cells in patients, and as symptoms progress, muscularization of pulmonary arterioles, medial and intimal hyperplasia, narrowing of the vascular lumen due to endothelial cell proliferation, plexiform lesions, etc. are observed. As mentioned above, it has been revealed that IL-6 levels are elevated in the serum and lungs of patients, indicating the involvement of inflammatory mechanisms in pulmonary vascular remodeling.

[0016] The current clinical classification of pulmonary hypertension includes five groups based on the 2013 Nice classification (Non-Patent Document 12).

[0017] Group 1: Pulmonary arterial hypertension (PAH); 1. Idiopathic PAH 2. Hereditary PAH 3. Drug / toxin-induced PAH 4. PAH associated with various diseases 4.1 Connective tissue disease 4.2 HIV infection 4.3 Portal hypertension 4.4 Congenital heart disease 4.5 Schistosomiasis Group 1': Pulmonary veno-occlusive disease (PVOD) and / or pulmonary capillary hemangiomatosis (PCH); Group 1'': Persistent pulmonary hypertension of the newborn (PPHN); Group 2: Pulmonary hypertension due to left heart disease; Group 3: Pulmonary hypertension due to lung disease and / or hypoxia; Group 4: Chronic thromboembolic pulmonary hypertension (CTEPH); Group 5: Pulmonary hypertension with unknown multifactorial mechanism.

[0018] Pulmonary arterial hypertension (PAH), the first type of pulmonary hypertension, is characterized by significant vasoconstriction and abnormal proliferation of cells in the pulmonary artery wall. This abnormal proliferation leads to severe constriction of blood vessels in the lungs, resulting in a significant increase in pulmonary vascular resistance (PVR) and a persistent increase in pulmonary artery pressure (PAP), leading to right heart failure and a poor prognosis for patients. Pulmonary hypertension accompanied by right heart failure is highly severe, and if left untreated, the average life expectancy of PAH patients is said to be 2.8 years from the time of diagnosis.

[0019] In PAH associated with connective tissue disease, immunosuppressive therapy using steroids or cyclophosphamide is effective for some types of PAH associated with connective tissue disease, but the prognosis for PAH associated with mixed connective tissue disease or systemic sclerosis is poor, and the prognosis for PAH associated with systemic sclerosis is particularly poor.

[0020] There is no therapeutic drug with clear clinical evidence for PAH associated with portal hypertension.

[0021] Group 2 pulmonary hypertension is postcapillary pulmonary hypertension caused by various left ventricular heart diseases, such as left ventricular systolic dysfunction, diastolic dysfunction, and valvular disease. Pulmonary artery remodeling is also involved in some cases, and the prognosis is worse than that of PAH, making it a factor that worsens the prognosis of heart failure. Clinical trials of vasodilators have been conducted as a treatment for Group 2 pulmonary hypertension, but no improvement in prognosis has been observed.

[0022] Group 3 pulmonary hypertension is associated with chronic lung diseases such as chronic obstructive pulmonary disease (COPD) and interstitial lung disease, as well as hypoxia. It is difficult to administer vasodilators to patients without impairing gas exchange function, and there are currently no approved therapeutic agents for patients with Group 3 pulmonary hypertension.

[0023] Chronic thromboembolic pulmonary hypertension (CTEPH), a fourth group of pulmonary hypertension, is a disease caused by organized thrombus in the pulmonary artery. CTEPH is treated by surgery or balloon pulmonary angioplasty, but certain vasodilators are also used. Three types of vasodilators are known to treat pulmonary hypertension: prostacyclin derivatives (epoprostenol, beraprost, treprostinil, selexipag, etc.) belonging to the prostacyclin pathway; endothelin receptor antagonists (bosentan, ambrisentan, etc.) belonging to the endothelin pathway; and NO-based phosphodiesterase 5 inhibitors (sildenafil, tadalafil, etc.) and guanylate cyclase stimulators (riociguat, etc.). These vasodilators are used for Group 1 PAH, and some are also used for Group 4 CTEPH. Although the prognosis of PAH has improved through combination therapy with these vasodilators, it is still not sufficient, and PAH remains a disease with a poor prognosis. In particular, PAH associated with connective tissue diseases, such as PAH associated with systemic sclerosis, is complicated by remodeling of not only the pulmonary arteries but also the pulmonary veins, and there are quite a number of patients for whom conventional vasodilators are ineffective or who develop fatal complications such as pulmonary edema due to pulmonary vein stenosis.

[0024] Prostacyclin derivatives exert vasodilatory effects by binding to prostacyclin receptors (IP receptors), but the existence of non-responders who show insufficient efficacy has been an issue. It is believed that one of the reasons for this is the reduced expression of IP receptors in patients with pulmonary hypertension (Non-Patent Documents 13 and 14). Furthermore, their use is limited due to various side effects such as shock, flushing, hypotension, headache, jaw pain, nausea / vomiting, diarrhea, and bleeding.

[0025] As described above, although the current main method of treating pulmonary hypertension is the administration of vasodilators, therapeutic agents that do not cause acute vasodilation are needed to avoid fatal complications such as pulmonary edema. In order to effectively treat serious diseases such as pulmonary hypertension that involve pulmonary vascular remodeling, there is a strong need for the development of new therapeutic agents with a mechanism of action different from that of conventional therapies that use vasodilators.

[0026] Large vasculitis includes Takayasu's arteritis and giant cell arteritis, and vascular inflammation can lead to serious complications such as aortic stenosis, aortic aneurysm, aortic dissection, pulmonary artery stenosis, heart failure, renal failure, pulmonary hypertension, and ophthalmic artery lesions. Takayasu's arteritis is characterized by necrosis of smooth muscle cells in the tunica media, destruction of elastic fibers, fibrosis, and inflammatory thickening of the tunica adventitia, while giant cell arteritis is characterized by vascular lesions such as the appearance of giant cells in the tunica media and intima, and occlusion of the lumen due to intimal thickening. IL-6 inhibitors have been shown to improve remodeling in these vascular lesions and are used as therapeutic agents (Non-Patent Document 15).

[0027] The present inventors have found that a compound represented by the following formula (1):

[0028]

[0029] (In the formula, R 1 and R 2 each independently represents a hydrogen atom or a linear alkyl group having 1 to 3 carbon atoms; R 3 represents a hydrogen atom, an alkyl group having 1 to 4 carbon atoms, an alkoxyalkyl group, an aryl group, a halogen atom, or a halogenated alkyl group. It has been found that a compound represented by the formula (1) or a pharmaceutically acceptable salt thereof exhibits therapeutic effects against ulcerative colitis and the like (Patent Documents 1 and 2, and Non-Patent Documents 16 and 17). The pharmacological effect of the same compound against knee osteoarthritis has also been reported (Non-Patent Document 18). However, it has not been known that the compound represented by the formula (1) exhibits an inhibitory effect on excessive gene expression or production of IL-6 and / or IL-1β, and therefore there have been no reports on its therapeutic effect against cardiovascular diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β.

[0030] International Publication No. 2010 / 029925 International Publication No. 2011 / 111714

[0031] J. Am. Coll. Cardiol., 1998, 31, 391-398J. Cardiology, 2021, 78, 157-165Circulation, 2010, 122, 920-927J. Clin. Invest., 2018, 128, 1956-1970Arthritis Rheumatol., 2022, 74, 13-27Eur. Resp. J., 2020, 55, 1901761Circulation, 1999, 100, 55-60Reumatology, 2006, 45, 545-548Ann. Reum. Dis., 2018, 77, 348-354N. Engl. J. Med., 2017, 377, 1119-1131 Circ. Heart Fail., 2018, 11, e005036 Clinical Practice Guidelines for Pulmonary Hypertension (2017 Revised Edition), pp. 8-11 Am. J. Respir. Crit. Care Med., 2010, 182, 1161-1170 Am. J. Respir. Crit. Care Med., 2001, 164, 314-318 Clinical Practice Guidelines for Vasculitic Syndromes (2017 Revised Edition), pp. 9-39 Eur. J. Pharmacol., 2015, 754, 179-189 J. Gastroenterol., 2019, 54, 608-620 Sci. Rep., 2019, 20329-20341

[0032] An objective of the present invention is to provide a medicament for treating cardiovascular diseases accompanied by IL-6 and / or IL-1β-related cardiovascular inflammation by suppressing excessive gene expression or production of IL-6 and / or IL-1β.

[0033] As a result of extensive investigations to solve the above problems, the present inventors have discovered a compound represented by the following formula (I):

[0034]

[0035] (In the formula, R 1 and R 2are each independently a hydrogen atom or a methyl group.) (hereinafter, also referred to as "the compound of the present invention"), or a pharmaceutically acceptable salt thereof, is an excellent IL-6 and / or IL-1β inhibitor, and a pharmaceutical comprising the IL-6 and / or IL-1β inhibitor as an active ingredient is useful for treating cardiovascular diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, thereby completing the present invention.

[0036] That is, the present invention is as follows: [1] Formula (I):

[0037]

[0038] (In the formula, R 1 and R 2each independently represent a hydrogen atom or a methyl group.) or a pharmaceutically acceptable salt thereof. [2] The agent according to the above-mentioned [1], wherein the compound represented by formula (I) is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octan-3-ylidene]-1-(tetrazol-5-yl)butane. [3] The agent according to the above-mentioned [1] or [2], which is an IL-6 and IL-1β inhibitor. [4] A pharmaceutical for preventing and / or treating cardiovascular disease accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, comprising the agent according to any one of [1] to [3] above as an active ingredient (hereinafter, this may be referred to as "the pharmaceutical of the present invention"). [5] The pharmaceutical according to [4] above, wherein the cardiovascular system is pulmonary blood vessels. [6] The pharmaceutical according to [4] above, wherein the cardiovascular system is myocardium. [7] The pharmaceutical according to any one of [4] to [6] above, wherein the cardiovascular disease is selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis, and cardiomyopathy. [8] The pharmaceutical according to [4] above, wherein the cardiovascular disease is cardiac hypertrophy. [9] The pharmaceutical according to [4] above, wherein the cardiovascular disease is heart failure.

[10] The pharmaceutical according to [9] above, wherein the heart failure is right-sided heart failure.

[11] The pharmaceutical according to [4] above, wherein the cardiovascular disease is pulmonary hypertension accompanied by right-sided heart failure.

[12] The pharmaceutical according to [4] above, wherein the cardiovascular disease is pulmonary hypertension accompanied by left-sided heart disease.

[13] The medicament according to the above-mentioned [4], wherein the cardiovascular disease is pulmonary hypertension associated with lung disease and / or hypoxemia.

[14] The medicament according to the above-mentioned [4], wherein the cardiovascular disease is chronic thromboembolic pulmonary hypertension.

[15] The medicament according to the above-mentioned [4], wherein the cardiovascular disease is pulmonary arterial hypertension associated with connective tissue disease.

[16] The medicament according to the above-mentioned

[15] , wherein the connective tissue disease is mixed connective tissue disease or systemic sclerosis.

[17] The medicament according to the above-mentioned [4], wherein the cardiovascular disease is pulmonary arterial hypertension associated with portal hypertension.

[18] The medicament according to the above-mentioned [4], wherein the cardiovascular disease is selected from the group consisting of large-vessel vasculitis, aortic aneurysm, and aortic dissection.

[19] The medicament according to any of the above-mentioned [4] to

[18] , wherein the cardiovascular disease is for oral administration.

[20] The medicament according to

[19] above, which is orally administered twice or more times a day.

[21] The medicament according to any one of [4] to

[20] above, which is administered in combination with one or more other drugs.

[22] The medicament according to

[21] above, which is characterized in that the medicament according to [4] above and one or more other drugs are contained separately as active ingredients in different formulations and are administered simultaneously or at different times.

[23] The medicament according to

[21] above, which is characterized in that the medicament according to [4] above and one or more other drugs are contained in a single formulation.

[24] The medicament according to any one of

[21] to

[23] above, wherein the other drug is a vasodilator.

[25] A pharmaceutical composition containing the agent according to any one of [1] to [3] above and a pharmaceutically acceptable carrier (hereinafter, sometimes referred to as the "pharmaceutical composition of the present invention").

[26] A cardiovascular remodeling inhibitor containing the agent according to any one of [1] to [3] above as an active ingredient.

[27] A pulmonary artery muscularization inhibitor comprising the agent according to any one of the above [1] to [3] as an active ingredient.

[28] A compound of formula (I): for use in the prevention and / or treatment of cardiovascular diseases accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β.

[0039]

[0040] (In the formula, R 1 and R 2 each independently represent a hydrogen atom or a methyl group.) or a pharmaceutically acceptable salt thereof.

[29] The compound according to the above-mentioned

[28] or a pharmaceutically acceptable salt thereof, wherein the cardiovascular disease accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β is a disease selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension accompanied by connective tissue disease, pulmonary arterial hypertension accompanied by portal hypertension, large-vessel vasculitis, aortic aneurysm, and aortic dissection.

[30] A compound represented by formula (I):

[0041]

[0042] (In the formula, R 1 and R 2 each independently represent a hydrogen atom or a methyl group.) or a pharmaceutically acceptable salt thereof.

[31] The use according to the above-mentioned

[30] , wherein the cardiovascular disease accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β is a disease selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension accompanied by left heart disease, pulmonary hypertension accompanied by lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension accompanied by connective tissue disease, pulmonary arterial hypertension accompanied by portal hypertension, large-vessel vasculitis, aortic aneurysm, and aortic dissection.

[32] A pharmaceutically effective amount of a compound represented by formula (I):

[0043]

[0044] (In the formula, R 1 and R 2 each independently represent a hydrogen atom or a methyl group. A method for preventing and / or treating a cardiovascular disease accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β in a mammal, comprising administering to the mammal a compound represented by the following formula (I):

[0045] The compound of the present invention or a pharmaceutically acceptable salt thereof is useful as an IL-6 and / or IL-1β inhibitor. Furthermore, according to the present invention, it is possible to provide a medicament for preventing and / or treating a cardiovascular disease accompanied by IL-6 and / or IL-1β-related cardiovascular inflammation, particularly a disease selected from the group consisting of cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension associated with left heart disease, pulmonary hypertension associated with lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension associated with connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary arterial hypertension associated with portal hypertension, large vasculitis (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, and aortic dissection, characterized by containing an IL-6 and / or IL-1β inhibitor consisting of the compound of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient.

[0046] Figure 1 shows the administration method for each group. Figure 2 shows the effect of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension after three weeks of administration. The left figure shows the effect on right ventricular systolic pressure, and the right figure shows the effect on right ventricular hypertrophy. Figure 3 shows the effect of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension after three weeks of administration. The left figure shows the effect on left ventricular systolic pressure, and the right figure shows the effect on heart rate. Figure 4 shows the inhibitory effect on pulmonary arterial medial wall thickness measured by lung histopathological analysis after three weeks of administration of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension. Figure 5 shows the inhibitory effect on muscularization of pulmonary small arteries measured by lung histopathological analysis after three weeks of administration of KAG-308 (2 mg / kg / day) on rats with monocrotaline-induced pulmonary hypertension. Figure 6 shows the inhibitory effect of inflammatory macrophage infiltration in rats with monocrotaline-induced pulmonary hypertension after 3 weeks of administration of KAG-308 (2 mg / kg / day) by lung histopathological analysis. Figure 7 shows the results of quantitative RT-PCR analysis in rats with monocrotaline-induced pulmonary hypertension after 3 weeks of administration of KAG-308 (2 mg / kg / day). The left graph shows the mRNA expression level of IL-6, and the right graph shows the mRNA expression level of IL-1β.

[0047] The definitions of the terms and symbols used in this specification are explained below. Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this invention belongs.

[0048] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of the tetrazole group moiety of the compound of the present invention with a non-toxic base, including inorganic and organic bases, which is acceptable as a medicament, and is a compound in which the hydrogen atom of the tetrazole group is replaced with a cation. Examples of such cations include Na ＋ , K. ＋ Alkali metal cations such as 1 / 2Ca ２＋ , 1 / 2Mg ２＋ , 1 / 2Zn ２＋ , 1 / 3Al ３＋ metal cations other than alkali metals, such as NH ４ ＋ and ammonium cations of organic amines and amino acids such as triethanolamine, diethanolamine, ethanolamine, tromethamine, lysine, arginine, etc. Preferred cations are sodium and potassium ions.

[0049] Specific examples of salts derived from pharmaceutically acceptable non-toxic inorganic bases include the above-mentioned sodium salts, potassium salts, calcium salts, magnesium salts, zinc salts, aluminum salts, ammonium salts, etc., as well as lithium salts, copper salts, ferric salts, ferrous salts, manganic salts, manganous salts, etc. Among these, sodium salts, potassium salts, calcium salts, magnesium salts and ammonium salts are preferred, with sodium salts and potassium salts being particularly preferred.

[0050] Specific examples of salts derived from pharmaceutically acceptable non-toxic organic bases include salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins. Examples of organic bases other than the specific examples of organic amines and amino acids mentioned above include isopropylamine, diethylamine, triethylamine, trimethylamine, tripropylamine, ethylenediamine, N,N'-dibenzylethylenediamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, morpholine, N-ethylmorpholine, piperazine, piperidine, N-ethylpiperidine, betaine, caffeine, choline, glucamine, glucosamine, histidine, hydrobromide, methylglucamine, polyamine resins, procaine, purine, theobromine, etc.

[0051] As used herein, the term "pharmaceutically acceptable carrier" refers to various organic or inorganic carrier substances commonly used as formulation materials, including excipients, disintegrants, binders, fluidizing agents, lubricants, etc. in solid preparations, solvents, solubilizing agents, suspending agents, isotonicity agents, buffers, soothing agents, etc. in liquid preparations, and bases, emulsifiers, wetting agents, stabilizers, dispersants, plasticizers, pH adjusters, absorption enhancers, gelling agents, preservatives, fillers, solubilizers, solubilizing agents, suspending agents, etc. in semi-solid preparations. Furthermore, additives such as preservatives, antioxidants, colorants, sweeteners, etc. are also included, if necessary.

[0052] As used herein, the term "IL-6 and / or IL-1β inhibitor" refers to a drug that suppresses excessive gene expression or production of IL-6 and / or IL-1β, which are cytokines that play an important role in regulating immune responses and inflammatory reactions. The "IL-6 and / or IL-1β inhibitor" may be a drug that suppresses gene expression or production of either IL-6 or IL-1β, but is more preferably a drug that suppresses gene expression or production of both IL-6 and IL-1β (dual inhibitor).

[0053] As used herein, the term "cardiovascular disease accompanied by inflammation of the cardiovascular system associated with IL-6 and / or IL-1β" refers to a cardiovascular disease accompanied by inflammation of the cardiovascular system (specifically, pulmonary blood vessels or myocardium) due to excessive gene expression or production of IL-6 and / or IL-1β. Specific examples of such cardiovascular diseases include cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension associated with left heart disease, pulmonary hypertension associated with lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension associated with connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary arterial hypertension associated with portal hypertension, large-vessel vasculitis (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, aortic dissection, etc.

[0054] In this specification, "cardiovascular remodeling" refers to the remodeling of the ventricle and vascular structures caused by various stresses under physiological or pathological conditions, and is called ventricular remodeling and vascular remodeling, respectively. Although these remodelings are purposeful adaptive responses for the body at a certain point in time, they are known to be important factors in the progression of pathological conditions in the long term.

[0055] As used herein, the term "cardiovascular remodeling inhibitor" refers to a drug that improves cardiovascular remodeling by slowing the progression of cardiovascular remodeling or preventing the progression to irreversible pathological remodeling.

[0056] As used herein, the term "pulmonary artery muscularization inhibitor" refers to a drug for inhibiting thickening of the pulmonary arterial media and adventitia and muscular arterialization of pulmonary microvessels, which are caused by vascular smooth muscle cell proliferation promoted by shear stress, hypoxic environment, inflammation, etc.

[0057] As used herein, the term "pharmaceutically effective amount" means the amount of Compound (I) of the present invention or a pharmaceutically acceptable salt thereof administered orally or parenterally (topical, rectal, intravenous, intramuscular, subcutaneous, etc.) to a mammal.

[0058] As used herein, the term "mammal" includes, but is not limited to, humans and non-human mammals (e.g., mice, rats, hamsters, guinea pigs, rabbits, cats, dogs, pigs, cows, horses, sheep, monkeys, etc.).

[0059] As used herein, "prevention" means inhibiting, suppressing, controlling, slowing down, or stopping the onset of clinical symptoms of a disease or the like in a patient (or subject) who may develop a disease or the like but has not yet developed the disease, or who is at risk of recurrence of the disease or the like after treatment of the disease or the like.

[0060] As used herein, "treatment" means remission, alleviation, or delay of worsening of clinical symptoms of a disease, illness, disorder, etc. (hereinafter referred to as "disease, etc.") in a patient (or subject) who has developed the disease, etc.

[0061] (Compound of the Present Invention) The compound of the present invention is a compound of the following formula (I):

[0062]

[0063] (In the formula, R 1 and R 2 are each independently a hydrogen atom or a methyl group.

[0064] Preferred R in the compound of the present invention represented by the formula (I) 1 and R 2 The combinations of R are as follows: 1 is a hydrogen atom, and R 2 is a hydrogen atom. 1 is a methyl group, and R 2 is a hydrogen atom. 1 is a hydrogen atom, and R 2 is a methyl group. 1 is a methyl group, and R 2 is a methyl group. Among the above, the preferred combinations are as follows, from the viewpoint of high suppression of excessive gene expression and production of IL-6 and / or IL-1β: 1 is a methyl group, and R 2 is a hydrogen atom. 1 is a hydrogen atom, and R2 is a methyl group. Furthermore, a particularly preferred compound of the present invention is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octan-3-ylidene]-1-(tetrazol-5-yl)butane (sometimes referred to herein as "KAG-308"). Because the compound of the present invention has an asymmetric carbon in its structure, various stereoisomers and optical isomers exist, and the present invention encompasses all of these stereoisomers, optical isomers, and mixtures thereof. Furthermore, the compounds of the present invention or pharmaceutically acceptable salts thereof also encompass solvates thereof (e.g., hydrates, ethanolates, etc.).

[0065] (Method for producing the compound of the present invention) The compound of the present invention or a pharmaceutically acceptable salt thereof can be produced by known methods, for example, the methods described in Patent Document 1 (WO 2010 / 029925) or Patent Document 2 (WO 2011 / 111714) related to the invention by the present inventors.

[0066] (Characteristics of the Compound of the Present Invention) The compound of the present invention or a pharmaceutically acceptable salt thereof is a prostaglandin (PG) derivative that is resistant to metabolism in vivo and has improved stability. Because the carboxy group of the PG skeleton is converted to a tetrazole group, it is resistant to metabolism by β-oxidation, which is known as a common metabolic pathway for fatty acids such as PG. Therefore, compared to compounds having a carboxy group in the PG skeleton, it has a longer half-life in blood and can maintain an effective blood concentration for a longer period of time. Furthermore, this improved metabolic stability can improve the bioavailability of drugs.

[0067] The compound of the present invention or a pharmaceutically acceptable salt thereof acts as an IL-6 and / or IL-1β inhibitor. Preferred examples of the compound exhibiting such an activity are the same as the preferred embodiments of the compound of the present invention described above.

[0068] (Pharmaceuticals Comprising the Compound of the Present Invention or a Pharmaceutically Acceptable Salt Thereof (or an IL-6 and / or IL-1β Inhibitor Comprising the Compound of the Present Invention or a Pharmaceutically Acceptable Salt Thereof) as an Active Ingredient) The pharmaceutical of the present invention may be a pharmaceutical consisting solely of the compound of the present invention or a pharmaceutically acceptable salt thereof, or may be a pharmaceutical composition further comprising a pharmaceutically acceptable carrier and, if necessary, other therapeutic ingredients (preferably, one or more vasodilators).

[0069] The dosage when the medicament (or pharmaceutical composition) of the present invention is administered to a mammal (patient or subject), including a human, varies depending on the subject, disease, symptoms, dosage form, administration route, etc. For example, in the case of a human, when administered to an adult patient (body weight approximately 60 kg), the daily dosage varies depending on the patient's age, body weight, condition, and severity, etc., but when converted to the compound of the present invention (active ingredient), it is usually 0.0001 to 10 mg, preferably 0.01 to 1 mg, administered once or several times in divided doses. For example, for oral administration, 0.001 to 3 mg is preferred, with 0.02 to 0.5 mg being particularly preferred. For intravenous administration, 0.0001 to 1 mg is preferred, with 0.001 to 0.2 mg being particularly preferred. The dosage can be increased or decreased as appropriate depending on the disease or condition. Furthermore, in the case of an injection, continuous infusion may be desirable as the administration form.

[0070] When used as a medicine (or pharmaceutical composition), it can be administered to the body orally or parenterally (for example, intravascular (intravenous or intraarterial) administration, subcutaneous administration, rectal administration, etc.). Examples of dosage forms include oral dosage forms such as tablets, capsules, and syrups, and parenteral dosage forms such as liquid injections such as solutions, emulsions, and suspensions, drip infusions, suppositories, nasal drops, patches, and inhalants. Among these, oral administration is desirable, and oral administration in two or more divided doses per day is particularly preferred.

[0071] The pharmaceutical composition of the present invention (hereinafter sometimes referred to as the "formulation of the present invention") is produced by appropriately mixing an appropriate amount of the compound of the present invention or a pharmaceutically acceptable salt thereof with at least one or more pharmaceutically acceptable carriers, etc., according to a method known in the technical field of pharmaceutical formulation. For example, when the formulation is a powder, granule, tablet, etc., it can be produced using any pharmaceutically acceptable carrier (e.g., excipient, lubricant, disintegrant, binder, etc.) suitable for producing a solid formulation. The content of the compound of the present invention or a pharmaceutically acceptable salt thereof in the formulation or medicament varies depending on the dosage form, dosage, etc., but is, for example, 0.1 to 100% by weight of the entire formulation or medicament.

[0072] Pharmaceutically acceptable carriers that can be used when the formulation of the present invention is a solid formulation are not particularly limited. Examples of "excipients" include lactose, sucrose, D-mannitol, D-sorbitol, corn starch, dextrin, microcrystalline cellulose, crystalline cellulose, carmellose, carmellose calcium, carboxymethyl starch sodium, low-substituted hydroxypropyl cellulose, calcium carbonate, sodium carbonate, calcium phosphate, sodium phosphate, alginic acid, gum arabic, etc.; "lubricants" include magnesium stearate, calcium stearate, stearic acid, talc, etc.; "disintegrants" include carmellose, carmellose calcium, carmellose sodium, carboxymethyl starch sodium, croscarmellose sodium, crospovidone, low-substituted hydroxypropyl cellulose, hydroxypropyl methylcellulose, crystalline cellulose, etc.; and "binders" include hydroxypropyl cellulose, hydroxypropyl methylcellulose, povidone, crystalline cellulose, sucrose, dextrin, starch, gelatin, carmellose sodium, gum arabic, etc. Alternatively, the solid dosage forms may be uncoated or may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period, for example, by employing a time delay material, such as glyceryl monostearate or glyceryl distearate.

[0073] The formulation of the present invention may also be provided as a hard gelatin capsule in which the compound of the present invention is mixed with an inert solid diluent such as calcium carbonate, calcium phosphate, or kaolin, or as a soft gelatin capsule in which the compound of the present invention is mixed with a water-miscible solvent (e.g., propylene glycol, polyethylene glycol, ethanol, etc.) or an oil medium (e.g., peanut oil, liquid paraffin, olive oil, etc.).

[0074] Furthermore, when the formulation of the present invention is a syrup or liquid, it can be prepared by appropriately selecting, for example, stabilizers, suspending agents, flavoring agents, fragrances, etc. When the pharmaceutical of the present invention is an injection, it can be prepared aseptically by dissolving the active ingredient in distilled water for injection together with a pH adjuster such as hydrochloric acid, sodium hydroxide, lactose, sodium lactate, acetic acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc., and an isotonicity agent such as sodium chloride or glucose. Alternatively, it may be prepared using an inert non-aqueous diluent such as propylene glycol, polyethylene glycol, olive oil, ethanol, polysorbate 80, etc., and further adding mannitol, dextrin, cyclodextrin, gelatin, etc., followed by vacuum lyophilization to prepare an injection to be dissolved immediately before use. Furthermore, liposome formulations and lipid emulsions can be prepared by known methods to improve stability and targeting ability and can be used as injections.

[0075] Other embodiments of the formulation of the present invention include rectal administration formulations using suppository bases such as cocoa butter, fatty acid triglycerides, fatty acid diglycerides, fatty acid monoglycerides, and polyethylene glycol; and rectal injection ointments prepared to an appropriate viscosity using water-soluble bases such as polyethylene glycol, polypropylene glycol, glycerin, and glycerogelatin, and oily bases such as white petrolatum, hard fat, paraffin, liquid paraffin, plastibase, lanolin, and purified lanolin.

[0076] The compound of the present invention or its pharmaceutically acceptable salt can be administered topically to the skin or mucosa, i.e., transdermally or transmucosally. Typical dosage forms for this purpose include gels, hydrogels, lotions, solutions, creams, ointments, dusting powders, dressings, foam preparations, films, skin patches, wafers, implants, sponges, fibers, bandages, microemulsions, etc. Pharmaceutically acceptable carriers that can be used for this purpose include alcohol, water, mineral oil, liquid paraffin, white petrolatum, glycerin, polyethylene glycol, propylene glycol, etc.

[0077] To improve the solubility, dissolution rate, bioavailability, and stability of the compounds of the present invention for use in any of the aforementioned dosage forms, they can be mixed with soluble polymeric units such as cyclodextrin and its suitable derivatives or polyethylene glycol-containing polymers. For example, drug-cyclodextrin complexes and the like have been found to be generally useful for most dosage forms and administration routes. Both inclusion and non-inclusion complexes can be used. As an alternative to direct complexation with the compounds of the present invention, cyclodextrins can be used as auxiliary additives, i.e., carriers, excipients, or solubilizers. For these purposes, α-, β-, and γ-cyclodextrins and the like are commonly used.

[0078] The compound of the present invention or a pharmaceutically acceptable salt thereof can be used in combination with other drugs (concomitant drugs) as long as the efficacy of the compound is not impaired.

[0079] The other drug (concomitant drug) suitable for use in combination with the compound of the present invention or a pharmaceutically acceptable salt thereof is not particularly limited, and for example, one or more known drugs conventionally used in the treatment of cardiovascular diseases selected from the group consisting of hypertension, heart failure, pulmonary arterial hypertension, thrombosis, arrhythmia, ischemic heart disease, cardiomyopathy, aortic disease, myocarditis, and arteriosclerosis, autoimmune diseases, and respiratory diseases can be suitably used. Specific examples include vasodilators such as prostacyclin derivatives (epoprostenol, beraprost, iloprost, treprostinil, selexipag, etc.), endothelin receptor antagonists (bosentan, ambrisentan, macitentan, etc.), phosphodiesterase 5 (PDE5) inhibitors (sildenafil, tadalafil, etc.) and guanylate cyclase stimulators (riociguat, etc.); steroids such as prednisolone, methylprednisolone, dexamethasone, etc.; immunosuppressants such as MTX, azathioprine, cyclophosphamide, mycophenolate mofetil, tacrolimus, cyclosporine, etc.; biological preparations such as tocilizumab and TNF inhibitors; and antiplatelet drugs such as aspirin. Among these, vasodilators are particularly preferred.

[0080] Furthermore, concomitant drugs that complement and / or enhance the therapeutic effect of the compound of the present invention or a pharmaceutically acceptable salt thereof also include drugs that have not been discovered so far but will be discovered in the future, based on the above-mentioned mechanism (i.e., the mechanism of suppressing excessive gene expression or production of IL-6 and / or IL-1β).

[0081] When a concomitant drug is used, the administration timing is not limited, and they may be administered to the subject at the same time, or at a different time from the administration of the medicament of the present invention (i.e., with a time lag). The administration with a time lag may involve administering the medicament of the present invention first and the concomitant drug later, or the concomitant drug first and the medicament of the present invention later. The administration methods may be the same or different. Furthermore, the compound of the present invention or a pharmaceutically acceptable salt thereof and the concomitant drug may be administered in combination as a single preparation (combined preparation). Examples of pharmaceutically acceptable carriers that may be used in the preparation of such a combination preparation include those used in the pharmaceutical composition of the present invention described above.

[0082] The dosage of the concomitant drug can be appropriately selected based on the dosage normally used in clinical practice. The compounding ratio of the compound of the present invention or a pharmaceutically acceptable salt thereof to the concomitant drug can be appropriately selected depending on the subject (the subject's age, body weight, general health condition, sex, severity of disease, etc.), administration route, type of disease, type of concomitant drug, etc.

[0083] The mass ratio of the compound of the present invention or a pharmaceutically acceptable salt thereof to the concomitant drug is not particularly limited.

[0084] The medicament or pharmaceutical composition of the present invention may be provided in the form of a kit together with instructions for administration and the like. The drugs contained in the kit are supplied in a container made of a material that maintains the activity of the components of the medicament or pharmaceutical composition effectively for a long period of time, does not adsorb to the inside of the container, and does not alter the components. For example, a sealed glass ampoule may contain a buffer or the like sealed in the presence of a neutral, non-reactive gas such as nitrogen gas. The kit may also include instructions for use. The instructions for use of the kit may be printed on paper or stored on an electromagnetically readable medium such as a CD-ROM or DVD-ROM and provided to the user.

[0085] (Uses of Pharmaceuticals Comprising the Compound of the Present Invention or a Pharmaceutically Acceptable Salt Thereof as an Active Ingredient) Pharmaceuticals comprising, as an active ingredient, an IL-6 and / or IL-1β inhibitor comprising the compound of the present invention or a pharmaceutically acceptable salt thereof can be applied to the treatment of diseases associated with IL-6 and / or IL-1β, particularly cardiovascular diseases accompanied by inflammation in the cardiovascular system induced by excessive gene expression or production of IL-6 and / or IL-1β. The pharmaceuticals of the present invention are particularly useful for cardiovascular diseases accompanied by inflammation of the pulmonary blood vessels or myocardium.

[0086] The pharmaceutical agent of the present invention exhibits strong inhibitory effects on cardiovascular remodeling, right ventricular systolic pressure reducing effects, and anti-inflammatory effects, and is therefore useful as a therapeutic agent for cardiac hypertrophy (particularly right ventricular hypertrophy) among cardiovascular diseases.

[0087] The pharmaceutical agent of the present invention exhibits therapeutic effects not only on cardiac hypertrophy but also on pulmonary hypertension, and also has potent inhibitory effects on cardiovascular remodeling, right ventricular systolic pressure reducing effects, and anti-inflammatory effects, and is therefore useful as a therapeutic agent for heart failure (particularly right heart failure).

[0088] The medicament of the present invention has a strong inhibitory effect on cardiovascular remodeling, particularly on pulmonary arterial muscularization, a right ventricular systolic pressure reducing effect, an anti-inflammatory effect, and an immunosuppressive effect, and is therefore useful for pulmonary hypertension, among other cardiovascular diseases. The medicament of the present invention is particularly useful as a therapeutic agent for a disease selected from the group consisting of pulmonary hypertension associated with right heart failure, pulmonary hypertension associated with left heart disease, pulmonary hypertension associated with lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension associated with connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), and pulmonary arterial hypertension associated with portal hypertension.

[0089] The pharmaceutical agent of the present invention has a strong inhibitory effect on cardiovascular remodeling, particularly an inhibitory effect on arterial muscularization, an anti-inflammatory effect, and an immunosuppressive effect, and is therefore useful as a therapeutic agent for treating cardiovascular diseases, particularly diseases selected from the group consisting of large vasculitis (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, and aortic dissection.

[0090] EXAMPLES The present invention will be specifically explained below with reference to examples, but the present invention is not limited to these examples.

[0091] Example 1 (Method) A monocrotaline (MCT)-induced rat pulmonary hypertension model was prepared according to the method described in Abe K, Circ Res, 94: 385-393, 2004. Male Sprague-Dawley rats (SD rats) aged 5 to 6 weeks (body weight 150-200 g) were subcutaneously injected with monocrotaline (Sigma-Aldrich) once at a dose of 60 mg / kg. KAG-308, a compound of the present invention, was orally administered twice daily at a dose of 1 mg / kg (2 mg / kg / day) using a probe from the day of subcutaneous injection of monocrotaline until the day before measurement ("MCT + KAG-308" in Figure 1). The untreated pulmonary hypertension model received the same volume of vehicle (water for injection) for the same period ("MCT" in Figure 1). The normal control group, which did not receive monocrotaline or KAG-308, was aged the same ("Normal" in Figure 1). Three weeks after monocrotaline injection, right ventricular systolic pressure, systemic arterial pressure, heart rate, and right ventricle-left ventricle weight ratio (right ventricular hypertrophy) were measured. Right ventricular systolic pressure was measured by right heart catheterization under isoflurane inhalation anesthesia. Systemic arterial pressure and heart rate were measured from the carotid artery using a conductance catheter. After measurements, the rats were euthanized with a lethal dose of pentobarbital intravenously, and the hearts were excised. The weight of the left ventricle (LV), including the ventricular septum (Sep), relative to the right ventricle (RV) was measured, and the ratio was used as an index of right ventricular hypertrophy.

[0092] (Results) (1) Effects on right ventricular systolic pressure and right ventricular hypertrophy As shown in the left panel of Figure 2, KAG-308 significantly inhibited the increase in right ventricular systolic pressure (RVSP) observed in monocrotaline-induced pulmonary hypertension rats. Furthermore, as shown in the right panel of Figure 2, KAG-308 also significantly inhibited the increase in the weight ratio of the left ventricle (LV) including the interventricular septum (Sep) to the right ventricle (RV) (RV / LV+Sep) observed in monocrotaline-induced pulmonary hypertension rats.

[0093] (2) Effects on left ventricular systolic pressure and heart rate As shown in FIG. 3, there were no significant differences in left ventricular systolic pressure and heart rate among any of the groups.

[0094] From the above results, it was confirmed that KAG-308 significantly suppresses the increase in right ventricular systolic pressure and right ventricular hypertrophy without affecting left ventricular systolic pressure or heart rate.

[0095] Example 2 (Histopathological Analysis) Histopathological analysis was carried out to examine the effect of 3 weeks of administration of KAG-308 (2 mg / kg / day) in the monocrotaline-induced rat pulmonary hypertension model shown in Example 1.

[0096] (Method) Lungs taken from the rats used in the test in Example 1 were inhaled at 20 cmH. ２ After dilatation under O2 pressure, the tissue was fixed overnight in 10% formalin. Then, paraffin-embedded tissue sections were cut at 5 μm and subjected to Elastica Van Gieson (EVG) staining and immunohistological staining. The mean medial wall thickness of the pulmonary artery and the muscularization of the pulmonary small arteries were calculated using Graphpad Prism 8.

[0097] (Results) (1) Effect on medial wall thickness of pulmonary arteries Pulmonary arteries with an outer diameter of 50 to 100 μm were analyzed, and the mean medial wall thickness was measured in a blinded manner (mean medial wall thickness = (outer diameter - inner diameter) / outer diameter). The results are shown in Figure 4.

[0098] 4, the mean medial wall thickness increased in the monocrotaline-administered group, but the increase in mean medial wall thickness was significantly suppressed by administration of KAG-308. These results confirmed the inhibitory effect of KAG-308 on smooth muscle proliferation and thickening due to pulmonary artery remodeling.

[0099] (2) Inhibitory effect on muscularization of small pulmonary arteries Muscularization of small pulmonary arteries with an outer diameter of 50 μm or less was analyzed by immunostaining using anti-α-SMA (smooth muscular actin) antibody. Pulmonary arteries were defined as non-muscular (<25%), partially muscular (25-75%), or totally muscular (>75%) based on the percentage of smooth muscle in their circumference, and at least 70 small pulmonary arteries from each specimen were evaluated in a blinded manner. The results are shown in Figure 5.

[0100] 5, in the KAG-308 administration group, the non-muscular ratio increased and the totally muscular ratio decreased. These results confirmed that administration of KAG-308 had a clear inhibitory effect on the muscularization of pulmonary small arteries.

[0101] (3) Inhibitory effect on inflammatory macrophage infiltration Macrophages were measured by immunostaining using anti-CD68 antibody. Observation was performed using a laser scanning microscope FV1200 IX83 (OLYMPUS) at 400x magnification, and the number of CD68-positive cells was counted in 15 randomly selected fields centered on small blood vessels. The results are shown in Figure 6.

[0102] As shown in Figure 6, in rats with monocrotaline-induced pulmonary hypertension, the infiltration of inflammatory CD68-positive macrophages increased, but the increase was significantly suppressed by administration of KAG-308, confirming the inhibitory effect on the infiltration of inflammatory macrophages.

[0103] Example 3 (Quantitative RT-PCR Analysis) To investigate the effect of KAG-308 (2 mg / kg / day) in the monocrotaline-induced rat pulmonary hypertension model shown in Example 1, quantitative analysis of IL-6 and IL-1β mRNA was performed using PCR according to the method described in Abe, K. et al. Cardiovasc Res. 2016, 111, 16.

[0104] (Method) Lungs collected from the rats used in the test in Example 1 were crushed, and total RNA was extracted from the whole lung using a Qiagen RNeasy Mini Kit. ReverTra Ace qPCR Kit (Toyobo) and SYBR Premix Ex Taq (Takara Bio) were used for reverse transcription and amplification, respectively. Analysis was performed using TB Green Premix Ex Taq II (Takara Bio) and a 7500 real-time PCR system (Applied Biosystems). The primers used are shown below.

[0105] Primer sequence IL-6 F: AGCGATGATGCACTGTCAGAA IL-6 R: AACGGAACTCCAGAAGACCAG IL-1β F: CCCTGAACTCAACTGTGAAATAGCA IL-1β R: CCCAAGTCAAGGGCTTGGAA

[0106] (Results) Figure 7 shows that in rats administered monocrotaline, the mRNA expression level of the inflammatory cytokine IL-6 increased by more than 60-fold (left panel), and the mRNA expression level of IL-1β increased by more than 2-fold (right panel). On the other hand, in rats administered KAG-308 (2 mg / kg / day), the increase in the mRNA expression levels of IL-6 and IL-1β was significantly suppressed. In particular, the increase in the mRNA expression level of IL-6 was suppressed by 89%.

[0107] These results demonstrate that the compounds of the present invention significantly suppress right ventricular systolic pressure, right ventricular hypertrophy, and pulmonary arterial muscularization compared to untreated monocrotaline-induced pulmonary hypertension patients, without altering heart rate or left ventricular systolic pressure. Furthermore, the mechanisms underlying these suppressions were confirmed to be the suppression of excessive gene expression and production of IL-6 and / or IL-1β, resulting in the prevention and treatment of pulmonary hypertension and the suppression of right ventricular hypertrophy. These results demonstrate that the compounds of the present invention are useful for the treatment of pulmonary hypertension and cardiac hypertrophy through the suppression of IL-6 and / or IL-1β.

[0108] Formulation Example 1: Production of capsules 1) Compound of the present invention (KAG-308) 0.05 mg 2) Microcrystalline cellulose 20 mg 3) Lactose 29 mg 4) Magnesium stearate 1 mg 1), 2), 3) and 4) are mixed and filled into a gelatin capsule.

[0109] Formulation Example 2: Preparation of tablets 1) Compound of the present invention (KAG-308) 30 mg 2) Lactose 70.0 g 3) Cornstarch 50.0 g 4) Soluble starch 7.0 g 5) Magnesium stearate 3.0 g The compound of the present invention (30 mg) and magnesium stearate (3.0 g) are granulated with an aqueous solution of soluble starch (70 mL) (7.0 g as soluble starch), dried, and mixed with lactose (70.0 g) and cornstarch (50.0 g) (lactose, cornstarch, soluble starch, and magnesium stearate are all products conforming to the 14th edition of the Japanese Pharmacopoeia). The mixture is compressed to obtain tablets.

[0110] The compound of the present invention or a pharmaceutically acceptable salt thereof is useful as an IL-6 and / or IL-1β inhibitor. Furthermore, according to the present invention, it is possible to provide a pharmaceutical composition for treating cardiovascular diseases accompanied by IL-6 and / or IL-1β-related cardiovascular inflammation, particularly diseases selected from the group consisting of cardiac hypertrophy (e.g., right heart hypertrophy), heart failure (e.g., right heart failure), myocarditis, cardiomyopathy, pulmonary hypertension accompanied by right heart failure, pulmonary hypertension associated with left heart disease, pulmonary hypertension associated with lung disease and / or hypoxemia, chronic thromboembolic pulmonary hypertension, pulmonary arterial hypertension associated with connective tissue disease (e.g., mixed connective tissue disease, systemic sclerosis), pulmonary arterial hypertension associated with portal hypertension, large-vessel vasculitis (e.g., Takayasu's arteritis, giant cell arteritis), aortic aneurysm, and aortic dissection.

[0111] This application is based on Japanese Patent Application No. 2022-080531 filed on May 16, 2022 in Japan, the contents of which are incorporated in their entirety herein.

Claims

1. Formula (I): 【Chemistry 1】 (In the formula, R 1 and R 2 each independently represents a hydrogen atom or a methyl group, or a pharma- ceutical acceptable salt thereof.

2. The compound represented by formula (I) is 4-[(Z)-(1S,5R,6R,7R)-6-[(1E,3R,4R)-3-hydroxy-4-(m-tolyl)-1-pentenyl]-7-hydroxy-2-oxa-4,4-difluoro-bicyclo[3.3.0]octan-3-ylidene]-1-(tetrazol-5-yl)butane. The agent according to claim 1.

3. The agent according to claim 1 or 2, which is an IL-6 and IL-1β suppressor.

4. A medicine for treating cardiovascular disease accompanied by cardiovascular inflammation associated with IL-6 and / or IL-1β, comprising the agent according to claim 1 as an active ingredient.

5. The pharmaceutical composition according to claim 4, wherein the cardiovascular system is the pulmonary blood vessels.

6. The pharmaceutical composition according to claim 4, wherein the cardiovascular system is the myocardium.

7. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is selected from the group consisting of cardiac hypertrophy, heart failure, myocarditis, and cardiomyopathy.

8. The pharmaceutical composition according to claim 7, wherein the cardiovascular disease is cardiac hypertrophy.

9. The pharmaceutical composition according to claim 7, wherein the cardiovascular disease is heart failure.

10. The pharmaceutical composition according to claim 9, wherein the heart failure is right heart failure.

11. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is pulmonary hypertension accompanied by right heart failure.

12. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is pulmonary hypertension associated with left heart disease.

13. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is pulmonary hypertension associated with a lung disease and / or hypoxemia.

14. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is chronic thromboembolic pulmonary hypertension.

15. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is pulmonary arterial hypertension associated with a connective tissue disease.

16. The pharmaceutical composition according to claim 15, wherein the connective tissue disease is mixed connective tissue disease or systemic sclerosis.

17. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is pulmonary arterial hypertension associated with portal hypertension.

18. The pharmaceutical composition according to claim 4, wherein the cardiovascular disease is selected from the group consisting of large vessel vasculitis, aortic aneurysm, and aortic dissection.

19. The pharmaceutical composition according to any one of claims 4 to 18, which is for oral administration.

20. The pharmaceutical composition according to claim 19, which is orally administered in two or more divided doses per day.

21. The pharmaceutical composition according to any one of claims 4 to 18, which is administered in combination with one or more other drugs.

22. The pharmaceutical agent according to claim 21, characterized in that the pharmaceutical agent according to claim 4 and one or more other pharmaceutical agents are contained separately as active ingredients in different formulations and are administered simultaneously or at different times.

23. The pharmaceutical composition according to claim 21, characterized in that the pharmaceutical composition according to claim 4 and one or more other pharmaceutical agents are contained in a single formulation.

24. The pharmaceutical composition of claim 21 , wherein the other drug is a vasodilator.

25. A pharmaceutical composition comprising the agent according to claim 1 or 2 and a pharma- ceutical acceptable carrier.

26. 3. A cardiovascular remodeling inhibitor comprising the agent according to claim 1 or 2 as an active ingredient.

27. 3. A pulmonary artery muscularization inhibitor comprising the agent according to claim 1 or 2 as an active ingredient.

28. A pharmaceutical composition comprising the agent according to claim 3 and a pharma- ceutically acceptable carrier.

29. A cardiovascular remodeling inhibitor comprising the agent according to claim 3 as an active ingredient.

30. A pulmonary artery muscularization inhibitor containing the agent described in claim 3 as an active ingredient.

Images