COMPOSITIONS USEFUL FOR THE TREATMENT OF HEMOGLOBINOPATHIES.

Abstract

The present invention relates to a guide RNA (gRNA) molecule comprising, from 5´ to 3´, [targeting domain]-SEQ ID NO: 231, wherein the targeting domain comprises SEQ ID N: 67.

Description

COMPOSITIONS ¥ METHODS FOR THE TREATMENT OF HEMOGI.OBINOPATÍAS .REFERENCE TO RELATED REQUESTS The present application claims priority to US Provisional Patent Application Number 62 / 455,464, filed on . February 6, 2017, which is incorporated in its entirety by reference. LIST OF SEQUENCES This application contains a sequence listing that has been filed electronically in ASCII format and is incorporated herein by reference in its entirety. Said ASCIl copy, created on January 30, 2018, has the name PAT057603-WO-PCT SL.txt and a size of 258,837 bytes. Background of the invention CRISPRs (clustered regularly interspersed short palindromic repeats) evolved in bacteria as a. adaptive immune system to defend against viral attack. Upon exposure to a virus, short segments of viral DNA are integrated into the crazy CRISPI! of the bacterial genome. The RNA is transcribed from a portion of the CRISPR locus that includes the viral sequence. That RNA, which contains a sequence complementary to the viral genome, mediates the targeting of a Cas9 protein to the sequence in the viral genome. The Cas9 protein cleaves and thus silences: the viral target. Recently, the CRISPR / Cas system has been adapted to genome editing in eukaryotic cells. The introduction of site-specific single-strand breaks (SSBs) or double-strand breaks (DSBs) allows for alteration of the target sequence by, for example, non-homologous end joining (Nl-ffi.l) or directed repair. by homology (HDR). SUMMARY OF THE INVENTION Without being bound by theory, the invention is based in part on the discovery that CRISPR systems, eg, Cas9 CRISPR systems, eg, as described herein, can be used to modify cells (eg, stem cells). hematopoietic stem cells (HSPC)), eg, in a nondeletional HPFH region, as described herein, to increase fetal hemoglobin (HbF) expression and / or decrease beta globin expression (eg, a beta globin gene having a disease-causing mutation), for example in the progeny, eg red blood cell progeny, of the modified cells, and that the modified cells (for example, modified HSPC) can 'be used to treat hemoglobinopathies , for example, sickle cell disease and beta thalassemia. In one aspect, surprisingly, it has been shown here that the introduction of gene editing systems, eg, CRISPR systems, eg, as described herein, into cells (eg, HSPC), which target, to regions of the genome where no HPFH mutation or deletion map creates modified HSPCs (eg, HSPCs comprising one or more indels, eg, as described herein) that can efficiently engraft into an organism, persist for long term in the grafted organism and differentiate, even in erythrocytes with increased expression of fetal hemoglobin. Furthermore, these modified HSPCs are capable of being cultured ex vivo, eg, in the presence of a stem cell expander (eg, as described herein) under conditions that cause them to expand and proliferate while maintaining potency. When gene editing systems, eg, CRISP.R systems, eg, as described herein, are introduced into. HPSC derived from patients with sickle cell disease, the modified cells and their progeny (eg, cryptroid progeny) surprisingly show not only upregulation of fetal hemoglobin, but also a significant decrease in sickle cell beta-globin, and a significant decrease in the number of phallus-shaped cells and increase in the number of normal red blood cells, relative to unmodified cell populations. Thus, in one aspect, the invention provides CRISPR systems. (eg, CRISPR Cas systems, eg, CRISPR Cas systems, eg, S. pyogenes CRISPR Cas9 systems) comprising one or more, eg, one, gRNA molecule as described herein. Any of the gRNA molecules described herein can be used in such systems, and in the methods and cells described herein. In one aspect, the invention provides a gRNA molecule including tm tra and crRNA, wherein the crRNA includes a targeting domain that: a) is complementary to a non-deletional HFPH region target sequence (eg , a human nc deletional HPFH region); b) is complementary to a target sequence within the genomic nucleic acid sequence in Chrl 1:5,249,833 a. Chrl 1:5,250,237, - strand, hg38;c) is complementary to a sequence, target within the genomic nucleic acid sequence in Chrl 1:5,254,738 to Chrl 1 :5,255,164, - strand, hg.38;d) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl 1:5,250,094-5,250,237, - chain, hg.38;e) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl 1:5,255,022-5,255, 164, -strand, hg38:f) is complementary to a target sequence within the genomic nucleic acid sequence in Civil; 5,249,833-5,249,927, - chain, hg38;g) is complementary to a target sequence within the genomic nucleic acid sequence in Chrl 1: 5,254,738-5,254,85I, - chain, hg38;h) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl 1:5,250,139-5,250.2'37,-strand. hg38; or i) their combinations. In certain embodiments, the address domain Includes, for example, is composed of, any Seq ID No.: 1 to Seo ID. No.: 72. In certain embodiments, the addressing domain includes, eg, is composed of, any Seq. Id. No.: 1, Seq. Id. No.: 6, Seq. Id. .'. 8, Seq Id No: 9, Seq Id No: 10, Seq Id No: 11, Seq Id No: 12, Seq Id No: 28, Seq Id No: 34, Seq Id No: 45, Seq Id No: 46, Seq Id No: 47, Seq Id No: 48, Seq. Id. No.; 50, Seq. Id. No.: 51, Seq. Id. No.: 53, id. Sec. No.: 54, 'Id. Sec ID No: 58, Sec Id No: 62, Seo Id No: 63, or Sec Id No: 67. In certain forms of. embodiment, the addressing domain includes, eg, is composed of, any a) Seq Id No: 6, Seq Id No: 8, Seq Id No: 28, Id, Sec. No.: 34, Sec. Id., No.: 48, Seo. Id. No.: 51., or Sec. ID No.: 67; or b) See ID. Sec Id No: 1. Sec Id No: 8, Sec Id No: 9, Sec Id No: 10, Sec Id No: 12, or Sec Id No.: 54. In certain embodiments, the gRNA molecule includes a targeting domain that includes, eg, is composed of, SEQ ID NO: §. In certain embodiments, the gRNA molecule includes a targeting domain including, for example, is comprised of Seo ID No: 67. In certain embodiments, the gRNA molecule includes a targeting domain. address that includes (eg, consists of) a fragment of any of the above sequences. In any of the foregoing aspects and embodiments, the gRNA molecule may further have the regions and / or properties described herein. In certain embodiments, the gRNA molecule includes a fragment of any of the aforementioned targeting domains. In certain embodiments, the targeting domain includes, eg, is composed of, 17, 18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences. In certain embodiments, the 17, 18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences are the 17, 18, 19, or 20 consecutive nucleic acids arranged at the 3' end of the sequence. address domain name listed. In. In other embodiments, the 17, 18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences are the 17, 18, 19, or 20 consecutive nucleic acids arranged at the 5! of the listed targeting domain sequence. In other embodiments, the 17, 18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences do not include nucleic acid 5' or 3' of the listed targeting domain sequence. In certain embodiments, the targeting domain is composed of the listed targeting domain sequence. In one aspect, including any of the foregoing aspects and embodiments, a portion of the crRNA and a portion of the bring hybridize to form a flagpole having SEQ ID NO: 182 or 183. In In one aspect, including-any of the preceding aspects and embodiments, the flagpole further includes a first flagpole extension, located 3' to the crRNA portion of the flagpole, wherein said first flagpole extension Flagpole includes Sec ID No: 184. In one aspect, including any of the foregoing aspects and embodiments, the flagpole further includes a second flagpole extension located 3" from the flagpole. crRN A portion of the flagpole and, if present, the first flagpole extension, wherein said second flagpole extension includes Sec. Id. No.: 185. In one aspect, including any of the foregoing aspects and embodiments, bringing includes SEQ ID NO: 224 or SEQ ID NO: 225. In one aspect, including any of the Foregoing aspects and embodiments, bringing includes SEQ ID NO: 232, optionally: including - further, at the end an additional 3 l, 2, 3.4, 5.6, or 7 uracil (Ü) nucleotides . In an aspect, including any of the preceding aspects and embodiments, the -crRNA includes, from 5' to 3\ [targeting domain]-; a) ID. OF SEQ. NRO.: 182, b) Sec. ID. No.: 183; c) Sec. ID. No.; 199; d) Sec ID, No.: 200; e) Sec. ID No.: 201; f) Id, of Sec. No.: 202; or g) Sec. ID No.: 226. In one aspect, including any of the foregoing aspects and embodiments, the bring includes, from 5' to 3': a) Seo ID. .; 1.87; b) Sec. ID No.; 188; c) Sec ID, No.: 20.3; d) Sec. ID No.: 204; e) Sec. ID No.: 224; f) Sec. ID No.: 225; g) Id, of Sec. No.; 232; h) Sec. ID No.: 227; i) (Seq. ID No.: 228; j) Seq. Id. No.: 229; k) any of a) to j), above, further including, at the 3-end, at least 1, 2, 3, 4, 5, 6 or 7 uracil nucleotides (Ü), for example, 1, 2, 3, 4, 5, 6, or 7 nucleotides of uracil (U); l) any of a) to k), above, further including, at the 3' end, at least 1,2,3,4, 5,6 or 7 adenine nucleotides (A), for example, 1,2,3 ,4, 5, 6, or 7 adenine nucleotides (A); ora) any of a) al), foregoing, including: in addition, at the 5-terminus (for example, at the 5-terminus), at least 1, 2, 3, .4, 5, 6, or 7 adenine nucleotides (A ), for example, 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides (A). In an aspect, including any of the preceding aspects and embodiments, the targeting and bringing domains are disposed on separate nucleic acid molecules. In one aspect, including any of the foregoing aspects and embodiments, the targeting and bringing domains are arranged on separate nucleic acid molecules, and the nucleic acid molecule including the targeting domain includes SEQ ID No.: 201, optionally disposed immediately 3' of the targeting domain, and the nucleic acid molecule including the targeting includes, for example, is composed of, Seq. Id. No.: 224. In one aspect , including any of the foregoing aspects and embodiments, the crRNA portion of the flagpole includes SEQ ID NO: 201 or SEQ ID NO: 202, In one aspect, including either of the foregoing aspects and embodiments, the bring includes Seq ID No: 187 or 188, and optionally, in the presence of a first flagpole extension, a first bring extension, disposed 5' from the Sec ID No.: 187 or 188, said first extension bring includes Seq ID No.: 189. In one aspect, including any of the preceding aspects and embodiments, the targeting domain and the bring are disposed on a single nucleic acid molecule, eg, where the bring is disposed 3'' to the targeting domain. In one aspect, the gRNA molecule includes a loop, disposed 3' to the targeting domain and 5' to the traverse. In certain embodiments, the loop includes SEQ ID NO; 186. In one aspect, including any of the preceding aspects and embodiments, the gRNA molecule includes, from 5' to 3\ [targeting domain]-: (a) SEQ ID NO: 195; (b) Sec. ID No.: 196; ic) Sec. ID No.: 197; (d). Sec. ID No.: 198; (e) Sec. ID No.: 231; or (f) any of (a) to (e), foregoing, further including, at the 3\ 1,2, 3,4, 5, 6 or 7 nucleotides end of uracil (U). In one aspect, including any of the preceding aspects and embodiments, the targeting and bringing domains are arranged in a single nucleic acid molecule, and wherein said nucleic acid molecule includes, for example, is composed of , said addressing domain and Seq ID No.: 231, optionally disposed immediately 3' to said addressing domain. In. one aspect, including any of the preceding aspects and embodiments, one, or optionally more than one, of the nucleic acid molecules including the gRNA molecule includes: a). one or more, for example, three, modifications phosphorothioate modifications at the 3' end of said nucleic acid molecule(s); b) one or more, for example, three, phosphorothioate modifications at the 5' end of said nucleic acid molecule(s): c) one or more, for example, three, 2'-O~methyl modifications at the 3' end of said nucleic acid molecule(s); d) one or more, for example, three, 2'-O-methyl modifications at the 5' end of said nucleic acid molecule(s); e) a 2' O-methyl en modification. each of the 3' 4th terminal, 3rd terminal and 2nd terminal residues of said nucleic acid molecule(s); f) a 2' O-methyl modification at each of the 5' 4th terminal residues, 3rd terminal and 2nd terminal of said nucleic acid molecule(s); or f) any combination thereof. In. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 74; (b) SEQ ID NO: 75 ; or(c) SEC ID No.: 76. In. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 77, and a bring that includes, for example, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 77, and a bring that includes, eg, is composed of, SEQ ID NO: 73; (c) a cRNA that includes, eg, is composed of, SEQ ID NO: 78 , and a bring-includes, for example, is composed of, Sec. Id. No.: 224; or (d) a cRNA that includes, eg, is composed of, SEQ ID NO: 78, and a trace that includes, eg, is composed of, SEQ ID NO: 73 . In one aspect, the invention provides a gRNA molecule, including, for example, consisting of, the sequence; (a) Seq. ID No.: 79; (b) Seq. ID No.: 80; or(c) kl. of Sec. No.: 81. In one aspect, the invention provides a gRNA molecule. that includes, for example, is composed of, the sequence: (a) a cRNA that includes, for example, is composed of, SEQ ID NO: 82, and a bring that includes, for example, is composed of de, SEQ ID NO: 224; (b) a cRNA including, for example, se. consists of, SEQ ID NO: 82, and a bring including, for example, consists of, SEQ ID NO: 73; (c) a cRNA including, for example, is made up of, ,1st Sec. Id. No.: 83, and a bring that includes, for example, is made up of, the id. of Sec. No.: 224; or(d) a cRNA that includes, eg, is composed of, Id. Sec. No.: 83, and a bring that includes, for example, is composed of, the Id, of Sec. No.: 73. In one aspect, the invention provides a gRNA molecule. which includes, for example, is composed of, the sequence: (a) Seq ID No.: 84; (b) Seq ID No.: 85; or(c) SEC ID No.: 86, In. In one aspect, the invention provides- a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 87 , and a bring that includes, for example, is composed of, Sec. ID No.»; 224;(b) a cRNA. including, eg, is composed of, SEQ ID NO: 87, and a bring including, eg, is composed of, SEQ ID NO: 73;(c) a cRNA that includes, for example, is made up of, Seq ID No.: 88, and a bring that includes, for example, is made up of, Sec ID No.: 224; or(d) a. cRNA including, for example, is-composed of, SEQ ID No.: 88, and a bring including, for example, is composed of, SEQ ID No.: 73. In a. aspect, the invention provides a gRNA molecule, which includes, for example, is composed of, the sequence: (a) SEQ ID NO: 89; (b) SEQ ID NO: 90: or(c) Sec. ID. No.: 91. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 92 , and a bring that includes, for example, is made up of, Sec. No.: 224; (b) a cRNA including, eg, consists of, Seq. ID No.: 92, and a port including, eg, consists of, Seo. ID. No.: 73; (e) a cRNA that includes, eg, is composed of, SEQ ID NO: 93, and a bring that includes, eg, is composed of, SEQ ID NO: 224 ; or fd) a cRNA including, eg, is composed of, Id. Sec. No.: 93, and a bring that includes, for example, is composed of, Sec. ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, consisting of, the sequence: (a) id. Sec. ID No.: 94; (b) Sec. ID No.: 95; or(c) SEC ID No.: 96. In one aspect, the invention provides a gRNA molecule, including, for example, consisting of, the sequence: (a) a cRNA including, for example, consisting of, SEQ ID NO. .: 97, and a bring .that includes, for example, is composed of leaves Seq ID No.: 224;(b) a cRNA that includes, for example, is composed of, Seq ID No. ,: 97, and a bring that includes, for example, is composed of, the ID of Seü. No.: 7.3;(c) tm cRNA including, eg, consisting of, Id. of Sec. No.: 98, and a bring that includes, for example, is composed of, the Id, of Sec. No.: 224; or(d) a cRNA that includes, for example, is composed of, SEQ ID No.: 98., and a bring that includes, for example, is composed of, SEQ ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 99; (b) SEQ ID NO: 100 ; or(c)id. of Sec. No.: .101. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 102 , and a bring that includes, for example, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 102 , and a bring that includes, for example, is composed of, Seq ID No.: 73; (c) a cRNA that includes, for example, is composed of, Seq ID No.: 103 , and a bring that includes, for example, is composed of, Sec. Id. No.: 224; or(d) a cRNA that includes, eg, is composed of, Seq ID No.: 103, and a bring that includes, eg, is composed of, ia Seq ID No.: 73. In one aspect, the invention provides a gRNA molecule, which includes, for example, is composed of, the sequence: (a) SEQ ID NO: 104; (b) SEQ ID NO: 105 ; or(c) ID. OF SEQ. NO.: 106. In one aspect, the invention provides a gRNA molecule, including, eg, composed of, the sequence: (a) a cRNA including, eg, composed of, SEQ ID NO. :107, and a bring that includes, for example, is composed of, Seq. ID No.: 224; (b) a cRNA that includes, for example, is composed of, Seq. ID No. .: 107, and a bring that includes, for example, is composed of, the Id, of Sec, No.: 73; (c) a cRNA including, eg, consists of, SEQ ID NO: IOS, and a port including, eg, consists of, SEQ ID NO: 224 ; or(d) a cRNA including, eg, is composed of. Ia Sec ID No.: 108, and a bring that includes, for example, is composed of, Sec ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 109; (b) SEQ ID NO: . 110; or(c) Sec. ID No.: 111. In one aspect, the invention provides a gRN A molecule, including, eg, consists of, the sequence: (a.) a cRNA including, eg, consists of, lald. desire. No.: 112, and a bring that includes, for example, is composed of, Sec. ID No.; 224; (b) a cRNA including, for example, is composed of, ia SEQ ID NO: 112, and a. (c) a cRNA including, for example, consists of, Seq ID No: i 13, and a bring that includes, eg, is composed of, SEQ ID No.: 224: or(d) a cRNA that includes, eg, is composed of. the Sec ID, No.; 113, and a bring that includes, for example, is composed of, Sec. ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO; i 14;(b) Seq. ID No.: 115; or(c) ID. OF SEQ. NO.: 116. In. One aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, Id, Seq. No.; 117, and"a bring that includes, eg, is composed of, SEQ ID No.: 224; (b) a cRNA that includes, eg, is composed of, SEQ ID No.: 224; : 117, and a bring that includes, for example, is composed of, Seq Id No.: 73;(c) a cRNA that includes, for example, is composed of, Seq Id No.: 118, and a bring that includes, for example, is composed of, SEQ ID No.: 224, or(d) a cRNA that includes, for example, is composed of, SEQ ID No., : 118, and a bring that includes, for example, is composed of, the Id, of Sec. No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 119; (b) SEQ ID NO: 120; or(c) Sec ID No.: 121. In one aspect, the invention provides a gRNA molecule, which includes, for example, is composed of the sequence: (a) a cRNA which includes, for example, is composed of, Sec. Id. No.: 122 , and a bring that includes, for example, is composed of, ia Sec. Id. No.: 224:(b) a. cRNA that includes, for example, is made up of, Seq. ID No.: 122, and a bring that includes, for example, is made up of, Seq. Id. No.: 73;(c) a gRNA that includes, eg, is composed of, SEQ ID NO: 123, and a bring that includes, eg, is composed of, SEQ ID NO: 224: o(d ) a cRNA that includes, for example, is composed of, SEQ ID No.: 123, and a bring that includes, for example, is composed of, SEQ ID, NO: 73. In. In one aspect, the invention provides a gRNA molecule, which includes, for example, is composed of the sequence: (a) Seq. Id. No.: 124; (b) Seq. Id. No.: 125; or(c) ID. OF SEQ. NRO,: 126. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 127 , and a bring that includes, for example, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 127 , and a bring that includes, eg, is composed of, ia Seq. ID No.: 73; (c) a cRNA that includes, eg, is composed of, .Seq. No.: 128, and a bring which includes, for example, is composed of, Sec.-ID No.: 224; or(d) a cRNA that includes, eg, is composed of, SEQ ID NO: 128, and a bring that includes, eg, is composed of, SEQ ID NO: 73 . In one aspect, the invention provides a gRNA molecule, which includes, for example, is composed of, the sequence: (a) SEQ ID NO: 129; (b) SEQ ID NO. No.: 130; or(c) SEC ID No.: 131. In one aspect, the invention provides a gRNA molecule, including, eg, consisting of, the sequence: (a) a cRNA including, eg, consisting of, id. (b) a cRNA including, eg, consists of, Seq. ID No.: 224; of Sec. No.: 132, and a. bring that includes, for example, is composed of, SEQ ID NO: 73; (c) a cRNA that includes, for example, is composed of, SEQ ID NO: 133, and a bring that includes, for example, is made up of, Sec. ID No.: 224; or (d) a cRNA that includes, eg, is composed of, SEQ ID NO: 133, and a CRNA that includes, eg, is composed of, SEQ ID NO.; 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 1.34; (b) SEQ ID NO: 1.34; of Sec, No.; 135; or(c) SEQ. ID. NO.: 136. In one aspect. The invention provides a gRNA molecule, which includes, for example, is made up of, the sequence: (a) a cRNA that includes, for example, is made up of, Seq. ID. No.: 137, and a bring including, for example, is composed of, Seq. ID No.: 224; (b) a cRNA including, for example, is composed of, lald.Seq., No.: .137,. and a bring which includes, for example, is composed of, Seq. ID No.: 73; (c) a cRNA which includes, for example, is composed of, Seq. ID No.: 138, and a bring that includes, for example, is composed of, Sec. Id. No.: 224; or (d) a cRNA that includes, eg, consists of, Seq. Id. No.: 138, and a trace that includes, eg, consists of, Seq. Id. of Sec. No.: 73, In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 139; (b) SEQ ID NO: 140; or(c) Sec. ID No.: 141, In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, Seq. Id. No.: 142 , and a bring that includes, for example, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 142 , and a bring that includes, for example, is composed of, SEQ ID NO:: 73; (c) a cRNA that includes, for example, is composed of, SEQ ID NO:: 143, and a bring that includes, eg, is composed of, See's ID. No.: 224; or (d) a cRNA that includes, eg, is composed of, "Seq ID No: 143", and a bring that includes, eg, is composed of, "Seq ID No: 73" . In one aspect, the invention provides a gRNA^ molecule including, for example, composed of, the sequence: (a) SEQ ID NO: 144; (b) SEQ ID NO. : 145; or(c) ID. OF SEQ. NO.: 146. In one aspect, the invention provides a gRNA molecule, including, eg, composed of, the sequence: (a) uft cRNA including, eg, comprised of, SEQ ID NO: 147 , and a bring that includes, eg, is composed of, SEQ ID NO: 224;(b) a cRNA that includes, eg, is composed of. Ia Sec. ID No.: 147, -and a bring that includes, for example, is composed of, Sec. Id. No.:. 73; (c) a cRNA that includes, eg, is composed of, SEQ ID NO: 148, and a trace that includes, eg, is composed of, SEQ ID NO: 224; or (d) a cRNA that includes, eg, is composed of, SEQ ID NO: 148, and a trace that includes, eg, is composed of, SEQ ID NO: 73 . In one aspect, the invention provides a gRNA molecule, including, eg, consisting of, the sequence; (a) Seq. ID No.: 149; (b) Seq. ID No.: 150; or .(c) Sec. ID No.: 151. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including^ eg, is composed of, SEQ ID NO: 152 , and a bring that includes, for example, is composed of, SEQ ID NO: 224:(b) a-cRNA that includes, for example, is composed of, SEQ ID NO: 152, and a bring that includes, for example, is composed of, Sec. Id. No.; 73;(c) a cRNA including, eg, is composed of, Seq ID No: 153, and a bring including, eg, is composed of, Seq ID No:: 224; or (d) a .cRNA that includes, eg, is composed of, "SEQ ID NO: 153", and a .cRNA that includes, eg, is composed of. Sec ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 154; (b) SEQ ID NO: 155 ; or (or) ID. OF SEQ. NO.: 156. In one aspect, the invention provides a gRNA molecule, including, eg, consists of, the sequence: (a) a cRNA including, eg, consists of, Seo ID. No.: 157, and a bring that includes, eg, is composed of, SEQ ID No.: 224; (b) a cRNA that includes, eg, is composed of, lald. of Sec. No.: 157, and a bring that includes, for example, is composed of. Sec. ID No.: 73; (e) a cRNA including, eg, consists of, SEQ ID NO: 158, and a trace including, eg, consists of, SEQ ID NO: 224; or (d) a cRNA that includes, eg, is composed of, lald. Sec. ID No.: 158, and a bring-in that includes, for example, is made up of, Sec. ID No.: 73. In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence:. (a) Seq ID No: 159; (b) Seq ID No: 160; or (c) Seq ID No: 161. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 162, and a. (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, for example, is composed of, SEQ ID NO: 162, and a bring that includes, for example, is composed of, Seq. Id. No.: 73; (c) a cRNA that includes, for example, is composed of, Seq. Id. No.: 163, and a bring that includes, for example, is composed of, Sec ID No.: 224; or (d) a cRNA including, for example, is composed of, SEQ ID NO: 163, and a. bring that includes, for example, is made up of, Sec. ID No.: 73. In a. aspect, the invention provides a gRNA molecule, which includes, for example, is composed of, the. sequence: (a) Seq. ID No.; 164;(b) Seq. ID No.: 165; or(c) ID. OF SEQ. NO.: 166. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 167 , and nn bring that includes, for example, consists of, Sec. ID No.; 224;(b) a cRNA that includes, for example, is composed of, SEQ ID NO: 167, and a bring that includes, for example, is composed of, SEQ ID NO: 73;(c) a cRNA including, eg, is composed of, Seq. ID No.: 168, and a bring including, eg, is composed of, Seq. Id. No.: 224; or(d) a cRNA that includes, eg, is composed of, SEQ ID NO: 168, and a bring that includes, eg, is-composed of, SEQ ID NO: 73 , In one aspect, the invention provides a gRNA molecule, including, for example, composed of, the sequence: (a) SEQ ID NO: 169; (b) SEQ ID NO: 170; either Ce) Sec. ID No.: 171. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of-, lald.Seq. No.: 172 , and a bring that 'includes, for example, is composed of, Seq. Id. No.: 224; (b) a cRNA that includes, for example, is composed of, Seq. Id. No.: 172, and a bring that includes, eg, is composed of, Seq. Id. No.: 73; (c) a cRNA that includes, eg, is composed of, Seq. Id. Sec. ID No.: 173, and a bring that includes, for example, is composed of, Sec. Id. No.: 224; or (d) a cRNA that includes, eg, is composed of, SEQ ID NO: 173, and a trace that includes, eg, is composed of, SEQ ID NO: 73 . In one aspect, the invention provides a gRNA molecule, including, for example, is composed of, the sequence: (a.) SEQ ID NO.: 1 / 4: (b) SEQ ID NO. .: 175; or “ID. OF SEQ. NO.: 176. In one aspect, the invention provides a gRNA molecule, including, eg, is composed of, the sequence: (a) a cRNA including, eg, is composed of, SEQ ID NO: 177 , and a bring that includes, eg, is composed of, SEQ ID NO: 224; (b) a cRNA that includes, eg, is composed of, SEQ ID NO: i 77, and a bring that includes, eg, is composed of, Seq. ID No.: 73; (c) a cRNA that includes, eg, is composed of, Seo. No.: 178, and a bring that includes, for example, is composed of, Sec ID No.: 224; or (d.) a cRNA that includes, eg, is composed of, SEQ ID NO: 178, and a -bring that includes, eg, is composed of, ia SEQ ID NO. : 73, In one aspect, including any of the preceding aspects and embodiments, the invention provides a gRNA molecule wherein: a) a CRISPR system (for example, an RNP as described herein) including the gRNA molecule is introduced into a cell, an indel is formed at or near the target sequence that would complement the. gRNA molecule targeting domain; and / or b) when a CRISPR system (eg, an RNP as described herein) that includes the gRNA molecule is introduced into a cell, a deletion is created that includes the sequence, eg, that includes substantially the entire sequence, between a sequence complementary to the gRNA-targeting domain (eg, at least 90% would complement the gRNA-targeting domain, eg, fully complementary to the gRNA-targeting domain) in the promoter region of HBG1 and a sequence complementary to the gRNA targeting domain (eg, at least 90% complementary to the gRNA targeting domain, eg, fully complementary to the gRNA targeting domain) in the promoter region of HBG2. In certain embodiments, the indel does not include a non-deleted HPFH nucleotide or transcription factor binding site. In one aspect, including any of the preceding aspects and embodiments, the invention provides a gRNA molecule, en. where when a CRISPR system (eg, an RNP as described herein) including the gRNA molecule is introduced into a population of cells. An indel is formed at or near the target sequence complementary to the targeting domain of the gRNA molecule by at least about 1%, eg, at least about 17%, eg, at least about 20%, for example, at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 55%, for example, at least about 60% eg, at least about 70%, eg, at least about 75%, of the cells in the population. In one aspect, including any of the preceding aspects and embodiments, the indel includes at least one nucleotide of one. HBG1 promoter region or at least one nucleotide of an HBG2 promoter region. In certain embodiments, at least about 15% of the cells in the population include an indel that includes at least one: nucleotide from an HBG1 promoter region and an indel that includes at least one nucleotide from a region. of HBG2 promoter. In one aspect, including any of the preceding aspects and embodiments, the percentage of cells in the population that include an indel that includes at least one nucleotide from an HBG1 promoter region differs from the percentage of cells in the population. of the population that include an indel that includes at least one nucleotide from an HBG2' promoter region in at least about 5%. eg, at least about 10%, eg, at least about 20%, eg, at least about 30%. In certain embodiments, the indel is measured by next generation sequencing (NGS). In one aspect, including any of the preceding aspects and embodiments, the invention provides a gRNA molecule, wherein when a CRISPR system (eg, an RNP as described herein) including the gRNA molecule is introduced into a cell, fetal hemoglobin expression is increased in that cell or its progeny, eg, its entroid progeny, eg, its red blood cell progeny. In certain embodiments, when a CRISPR system (eg, an RNP as described herein) including the gRNA molecule is introduced into a population of cells, the percentage of F cells in said population or population of their progeny , for example, its erythroid progeny, for example, its red blood cell progeny, is increased in port minus about 15%, for example, at least about 17%, for example, at least about-20%, for example, at least about 25%, eg, at least about 30%, eg, at least about 35%, eg, at least about 40%, relative to the percentage of F cells in a population of cells into which the gRN A molecule was not introduced or a population of its progeny, eg its erythroid progeny, eg its red blood cell progeny. In certain embodiments, said cell or its progeny, eg, its erythroid progeny, eg, its red blood cell progeny, produces at least about 6 picograms (eg, at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or between about 8 and about 9 picograms, or between about 9 and about 10 picograms) of fetal hemoglobin per cell. In one aspect, including any of the preceding aspects and embodiments, the invention provides a gRNA molecule, wherein when a CRISPR system (eg, an RNP as described herein) including the gRNA molecule is introduced into a cell, no off-target indels are formed in that cell, e.g., no indels are formed off-target from the HBG1 and / or HBG2 promoter regions (e.g., within a gene, e.g. eg, a coding region of a gene), eg, as detected by next-generation sequencing and / or a nucleotide insertion assay. In one aspect, including any of the preceding aspects and embodiments, the invention provides a gRNA molecule, wherein when a CRISPR system, (eg, an RNP as described herein) including the gRNA molecule is introduced into a population of cells, no unwanted indels, eg, no unwanted indels outside the promoter regions of HBG1 and / or HBG2 (eg, within a gene, eg, a region coding for a gene), is detected in greater than about 5%, eg, greater than about 1%, eg, greater than about 0.1%, eg, greater than about 0.01%, of efe cells. the cell population, eg, as detected by next generation sequencing and / or a nucleotide insertion assay. In one aspect, including any of the aforementioned aspects and embodiments, the cell is (or the population of cells includes) a mammalian, primate, or human cell, for example, it is a human cell, for example, the cell is (or the population of cells includes) an HSPC, eg, the HSPC is CD34+, eg, the HSPC is CD344CD90+, In certain embodiments, the cell is autologous to a patient to whom said cell is to be administered. cell. In other embodiments, the cell is allogeneic with respect to a patient to whom said cell will be administered. In one aspect, the gRN A molecules, genome editing systems (eg, CRISPR systems), and / or methods described herein relate to cells, eg, as described herein, that include or result in one or more of the following properties: (a) at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80% at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the cells in a population, of cells described herein comprise an indel at or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule described herein, optionally wherein the indel is selected from an indel listed in Table 2-7 , optionally te wherein no cell-in the population comprises a deletion of a nucleotide disposed between 5,250,092 and 5,249,833, -chain (hg38); (b) a cell (eg, the population of cells) described herein is capable of differentiating in a differentiated cell of an erythroid lineage (eg, a red blood cell), and wherein said differentiated cell exhibits a higher level of fetal hemoglobin, eg, relative to an unaltered cell (eg, population of cells); (c) a population of cells described herein is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (for example, a population of red blood cells), and wherein said population of differentiated cells has a higher percentage of F cells (for example, at least about 15%, at least about 20%, at least about .25%, at least about 30%, or at least about . e 40% more of-cells F) for example, relative to a-population of. cells-unaltered; (d) a cell (eg, population of cells) described herein is capable of differentiating into a differentiated cell, eg, a cell of an erythroid lineage (eg, a red blood cell), and wherein said cell differentiated (eg, population of differentiated cells) produces at least about 6 picograms (eg, at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 10 picograms, or between about 8- and about 9 picograms, or between about 9 and about 10 picograms) of fetal hemoglobin per cell; (e) unwanted indels are not formed in a cell described herein, for example, no indels are formed .undesired outside the HBGI and / or HBG2 promoter regions (eg, within a gene, eg, a coding region of a gene), eg, as detectable by new sequencing generation and / or a nucleotide insertion assay; (f) no unwanted indels, eg, no unwanted indels outside the promoter regions of H'BGl and / or HBG2 (eg, within a gene, e.g. example, a coding region of a gene), is detected in greater than about 5%, eg, greater than about 1%, eg, greater than about 0.1%, eg, greater than about 0.01%, of cells of A population of cells described herein, eg, as detectable by next generation sequencing and / .or a nucleotide insertion assay; .(g) a cell described herein or its progeny is detectable, for example, detectable in bone marrow, or detectable in peripheral blood, in a patient to whom it is transplanted at more than 16 weeks, more than 20 weeks or more than 24 weeks after transplantation, optionally detected by detecting an indel in or near a genomic DNA sequence complementary to the targeting domain of a gRN A molecule according to any of Claims 1-22, optionally where the.indel is selected from an indel listed in Table 2-7, optionally wherein the indel is a high deletion indel; (h) a population of cells described herein is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (for example, a population of red blood cells), and wherein said population of differentiated cells includes a small percentage of sickle cells (eg, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 40%, at least less about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% fewer sickle cells) for example, relative to a population, of unaltered cells ; and / or (i) a cell or the population of cells described in. hereby is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (for example, a population of red blood cells), and wherein said population of differentiated cells includes cells that produce a reduced level (eg, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% less) sickle hemoglobin (HbS), eg, relative to a population of unaltered cells. In one aspect, the invention provides a composition that includes 1) one or more gRNA molecules (including a first gRNA molecule) described herein, for example, any of the aforementioned gRNA aspects and embodiments, and a Cas? molecule, eg, described herein; 2) one or more gRNA molecules (including a first, gRNA molecule) described herein, eg, from any of the aspects and embodiments of gRNAs mentioned above, and nucleic acid encoding a Cas9 molecule, eg, described herein; 3) nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) described herein, eg, of any of the aforementioned gRNA aspects and embodiments, and a Cas9 molecule, for example, described herein; 4) nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) described in the present, for example, of. any of the aforementioned gRNA aspects and embodiments, and nucleic acid encoding a Cas.9 molecule, eg, described herein; or 5) any of 1.) to 4), above, and a nucleic acid template; or 6) any of 1) to 4), above, and nucleic acid including the sequence encoding a template nucleic acid. In one aspect, the invention provides a composition that includes a first gRNA molecule described herein, eg, of any of the aforementioned gRNA aspects and embodiments, which further includes a Cas? molecule, eg, described herein, for example, .wherein the Cas9 molecule is a Cas9 of s. pyogenes active or inactive, for example, wherein the Cas9 molecule includes SEQ ID NO: 205. In certain aspects, the Cas9 molecule includes, for example, is composed of: (a) SEQ ID NO. , No.: 233; (b) Seq. ID No.: 234; (c) Sec. ID No.: 235; (d) Sec. ID No.: 236; (e) Sec. ID No.: 2.37; (f) Sec. ID No.: 238; (g) Seq. ID No.: 239; (h) id. of Sec. No.: 240; (i) Sec ID No.: 241; (j) Seq ID No: 242: (k) Seq ID No: 243 or (1) Seq ID No: 244. In one aspect, including any of the aforementioned aspects and embodiments of the composition, the first gRNA molecule and the Cas?' molecule. they are present in a complex of ribonucleoproteins (RNP). In one aspect, including any of the aforementioned aspects and embodiments of the composition, the invention provides a composition that further includes a second -gRNA molecule; a second gRNA molecule and a third gRNA molecule; or a second gRNA molecule, optionally a third gRNA molecule, and. optionally, a fourth gRNA molecule, wherein the second gRNA molecule, la. optional third gRNA molecule, and optional fourth gRNA molecule are one. gRNA molecule described herein, for example, are a gRNA molecule of any of the aspects and embodiments of the aforementioned gRNA molecule, and wherein- each gRNA molecule of the composition is complementary to a target sequence , different. In certain embodiments, two or more of the first gRNA molecule, the second gRNA molecule, the optional third gRNA molecule, and the fourth optional gRNA molecule are complementary to target sequences within the same gene or region. In certain embodiments, the first gRNA molecule. the second gRNA molecule, the third optional gRNA molecule, and the fourth optional gRNA molecule are complementary to the target sequences to no more than 6000 nucleotides, no more than 5000 nucleotides, no more. than .500, not more than 400 nucleotides, not more than 300, not more than 200 nucleotides, not more than 100 nucleotides, or more than 90 nucleotides, not more than 80 nucleotides, not more than 70 nucleotides, not more than 60 nucleotides , no more. than 50 nucleotides, not more than 40 nucleotides, «or more than 30 nucleotides, not more than 20 nucleotides, or not more than 10 nucleotides. In certain embodiments, two or more of the first gRNA molecule, the second gRNA molecule, the third optional gRNA molecule, and the fourth optional gRNA molecule include at least: one gRNA molecule that includes a domain of targeting complementary to a target sequence of a promoter region of HBG1 and at least one gRNA molecule that includes a targeting domain complementary to a target sequence of a promoter region of HBG.2. In one aspect, including any of the aforementioned aspects and embodiments of the composition, the composition includes (eg, is comprised of) a first gRNA molecule and a second gRNA molecule, wherein the first gRNA molecule gRNA and the second gRNA molecule are: (a) independently selected and target a non-deletional HPFH region, eg, described herein, and are complementary to distinct target sequences; (b) independently selected from among the gRNA molecules in Table 1, and are complementary to distinct target sequences; c) independently selected from among the gRNA molecules in Table 2, and are complementary to different target sequences; or (d) independently selected from the gRNA molecules of Table 3a and are complementary to distinct target sequences, (e) independently selected from the gRNA molecules of Table 3b and are complementary to distinct target sequences; or (f) independently selected from the gRNA molecules of any of the aforementioned aspects and embodiments, and are complementary to different target sequences. In one aspect, including any of the aspects and embodiments of the aforementioned composition, the composition includes a first gRNA molecule and a second gRNA molecule, wherein: a) the first gRNA molecule is complementary to a sequence target that includes at least 1 nucleotide (eg, that includes 20 consecutive nucleotides) within: i) Chrl 1:5,249,833 to Chrl 1:5,250,237 (hg38);ii) Chrl 1:5,250,094-5,250,237 (hg38);iii) Chrl 1: 5,249,833-5,249,927 (hg38); or iv) Chrl 1:5,250,139-5,250,237 (hg38): b) the second gRNA molecule is complementary to a target sequence that includes at least 1 nucleotide (eg, comprises 20 consecutive nucleotides) within: i) Chrl 1 :5,254.73.8 to Chrl 1:5,255,164 (hg38); ii) Chrl 1:5,255,022-5,255,164 (hg38); or ÍÍÍ) Chrl 1: 5,254,738-5,254,851 (hg38). In one aspect, in relation to the gRNA molecule components of the composition, the composition is comprised of a first gRNA molecule and a second gRNA molecule. In one aspect, including any of the aforementioned aspects and embodiments of the composition, each of said gRNA molecules is in a ribonucleoprotein (RNP) complex with a Cas9 molecule, for example, described herein. In one aspect, including any of the aforementioned aspects and embodiments of the composition, the composition includes a template nucleic acid, wherein the template nucleic acid includes a nucleotide that corresponds to a nucleotide in or near the sequence target of the first gRNA molecule. In certain embodiments, the template nucleic acid includes nucleic acid that encodes: (a) human beta globin, eg, human beta globin that includes one or more of the mutations G16D, E22A, and T87Q, or a fragment thereof : or (b) human gamma globulin, or a fragment thereof. In one aspect, including any of the aforementioned aspects and embodiments of the composition, the composition is formulated in a medium suitable for electroporation. In one aspect, including any of the aforementioned aspects and embodiments of the aforementioned composition, each of said gRNA molecules of said composition is in an RNP with a Case molecule described herein, and wherein each RNP is at a concentration of less than about 10uM, eg, less than about 3uM, eg, less than about 10uM, eg, less than about 0.5uM, eg, less than about 0.3uM, eg, less of about 0. luM. In certain embodiments, the RNP is at a concentration of about μM. In certain embodiments, the RNP is at a concentration of about 2 uM. In certain embodiments, said concentration is the concentration of RNP in a composition comprising the cells, eg, according herein, optionally wherein the composition comprising the cells and RNP is suitable for electroporation. In one aspect, the invention provides a nucleic acid sequence encoding one or more gRNA molecules described herein, eg, any of the aforementioned gRNA molecule aspects and embodiments. In certain embodiments, the nucleic acid includes a promoter operably linked to the sequence encoding the single or more gRNA molecules, eg, the promoter is a promoter recognized by RNA polymerase II or RNA polymerase III, or, eg, the promoter is a U6 promoter or an I I l promoter. In a. aspect, including any of the aforementioned aspects and embodiments of the nucleic acid, the nucleic acid further encodes a Cas? molecule, eg, a Cas9 molecule including, eg, is composed of, any of the M. de Sec. No. 205, Sec. Id. No.: 233, Sec. Id. No.: 234, Sec. Id. No. 235, Sec. Id. No.: 236, Sec. Sec. No.: 23'7, Sec. Id. No.: 238, Sec. Id. No.: 239, Id, Sec. No.: 240, Sec. Id, No.: 241, Id No. 242, Seq. Id. No.: 243 or Seq. Id. No.: 244. In certain embodiments, said nucleic acid includes a promoter operably linked to the sequence encoding a Cas9 molecule, eg, an EF-1 promoter, a CMVIE gene promoter, an EF-1α promoter, a ubiquitin C promoter, or a phosphoglycerate kinase (PGK) promoter. In one aspect, the invention provides a vector that includes the nucleic acid of any of the aforementioned nucleic acid aspects and embodiments. In certain embodiments, the vector is selected from the group consisting of a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a minicircle, a nano plasmid and an RNA vector. In one aspect, the invention provides a method of altering a cell (eg, a population of cells), (eg, by altering the structure (eg, sequence) of nucleic acid) at or near a target sequence within of said cell, including contacting (eg, introducing into) said cell (eg, the population of cells) with: 1) one or more gRNA molecules described herein (eg, from any of the aspects and -embodiments-of the aforementioned gRNA molecule) and a Cas? molecule, for example, described herein; 2) one or more gRNA molecules described herein (for example, from any of the aspects and embodiments of the aforementioned gRNA molecule) and nucleic acid encoding a Cas9 molecule, eg, described herein; 3). Nucleic acid encoding one or more gRNA molecules described herein (eg, of any of the aspects and ways of performing tion of the aforementioned gRNA molecule) and a Cas? molecule, eg, described herein; 4) nucleic acid encoding one or more gRNA molecules described herein (eg, any of the aspects and embodiments of the aforementioned gRNA molecule) and nucleic acid encoding a Cas? molecule, for example, described herein; 5) any of 1) to 4), above, and a nucleic acid template; 6) any of 1) to 4), above, and nucleic acid including sequence encoding a template nucleic acid; 7) a composition described herein, for example, a composition of any of the aspects and embodiments of the aforementioned composition;, o8) a vector described in. hereby, for example, a vector of any of the aspects and embodiments of the aforementioned vector. In one aspect, which includes any of the aspects and embodiments of the aforementioned method, the gRNA molecule or nucleic acid encoding the gRNA molecule, and the Cas9 molecule or nucleic acid encoding the Cas9 molecule. are formulated in a unique composition. In another aspect, the gRNA molecule or nucleic acid encoding the gRNA molecule, and the Cas9 molecule or nucleic acid encoding the Cas9 molecule, are formulated in more than one composition. In one aspect, the more than one composition is administered simultaneously or sequentially. In one aspect of the methods described herein, including any of the aforementioned method aspects and embodiments, the cell is an animal cell, for example, the cell is a mammalian, primate, or human cell, for example. For example, the cell is a hematopoietic stem or progenitor cell (HSPC) (eg, a population of HSPCs), for example, the cell is a CD34+ cell, for example, the cell is a CD34+CD90+ cell. In certain embodiments of the methods described herein, the cell is arranged in a composition that includes one. cell population that has been enriched for CD34+ cells. In certain embodiments of the methods described herein, the cell (eg cell population) has been isolated from bone marrow, mobilized peripheral blood or umbilical cord blood. In certain embodiments of the methods described herein, the cell is autologous or allogeneic, eg, autologous, with respect to a patient to whom said cell is to be administered. In an aspect of the methods described herein, including any of the aspects and embodiments of the. aforementioned method, a) the alteration results in an indel at or near a genomic DNA sequence complementary to the targeting domain of the single or more gRNA molecules; or b) the alteration results in a defect that includes the sequence, e.g., substantially all of the sequence, between a sequence complementary to the targeting domain of the single or more gRNA molecules (e.g., at least 90% complementary to the targeting domain). gRNA targeting domain, eg, fully complementary to the gRNA targeting domain.) in the promoter region of HBGI and a sequence complementary to the targeting-domain of the single or more gRNA molecules (eg, at least 90% complementary to the gRNA targeting domain, eg, fully complementary to the gRNA targeting domain) in the promoter region of HBG2, In certain aspects of the method, the indel is an insertion or deletion of less than about 40 nucleotides, eg, less than 30 nucleotides, eg, less than 20 nucleotides, eg, less than 10 nucleotides, eg, is a single nucleotide deletion. In one aspect of the methods described herein, including any of the aforementioned method aspects and embodiments, the method results in a population of cells wherein at least about 15%, eg, at least about 17%, eg, at least about 20%, eg, at least about 30%, eg, at least about 40%, eg, at least about 50%. for example, at least about 55%, for example, at least about 60%, for example, at least about 70%, for example, at least about 75% of the population has been altered, for example, include an indel. In one aspect of the methods described herein, including any of the aspects and embodiments of the aforementioned method, the alteration results in a cell (eg, the population of cells) that is capable of differentiating into a differentiated cell of an erythroid lineage (eg, a red blood cell), and wherein said differentiated cell exhibits a higher level of fetal hemoglobin, eg, relative to an unaltered cell (eg, the population of cells). In one aspect of the methods described herein, including any of the aspects and embodiments of the aforementioned method, the alteration results in a population of cells that is capable of differentiating into a population of differentiated cells, for example , a population of cells of an erythroid lineage (eg, a population of red blood cells), and wherein said population of differentiated cells has a higher percentage of F cells (eg, at least about 15%, at least about 20%, at least about 25%, at least about 30%, or at least about 40% more cells F) for example, relative to a population of unaltered cells. In one aspect of the methods described herein, including any of the aspects and embodiments of the aforementioned method, the alteration results in a cell that is capable of differentiating into a differentiated cell, for example, a cell from a . erythroid lineage (eg, a red blood cell), and wherein said differentiated cell produces at least about 6 picograms (eg, at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, for at least about 10 picograms, or between about 8 and about 9 picograms, or between about 9 and about 10 picograms) of fetal hemoglobin per cell. In one aspect, the invention provides a cell, altered by a method described herein, eg, a. method of any of the aforementioned aspects and embodiments of the method. In one aspect, the invention provides a cell, obtainable by a method described herein, eg, a method of any of the aforementioned method aspects and embodiments. In one aspect, the invention provides a cell, including a first gRNA molecule described herein, eg, a method of any of the aforementioned gRNA molecule aspects and embodiments, or a composition described in the present, for example, of any of the aspects and embodiments of the aforementioned composition, a nucleic acid described herein, for example, of any of the aspects or embodiments of! aforementioned nucleic acid, or a vector described herein, eg, any of the aspects or embodiments of the aforementioned vector. In one aspect of the cell described herein, including any of the aforementioned aspects and embodiments of the cell, the cell further includes- a C-as? molecule, eg, described herein, for example, -a Cas9 molecule including any Seq. Id. No.: 205, Seq. Id. No.: 233, Seq. Id. No.: 234, Seo. Sec. Id. No.: 235, Sec. Id. No.: 2.36, Sec. Id. No.: 237, Sec. Id. No.: 238, Sec. Id. No.: 239, Sec. Id Sec Id No: 240, Sec Id No: 241, Sec Id No: 242, Sec Id No: 243 or Sec Id No: 244. In one aspect of the cell described in the. present, which includes any of the aspects and embodiments of the. aforementioned cell, the cell includes, has included, or will include a second gRNA molecule described herein, eg, a. method of any of the aforementioned gRNA molecule aspects and embodiments, or nucleic acid encoding said gRNA molecule, wherein the first gRNA molecule and the second gRNA molecule include non-identical targeting domains. In a. aspect of the cell described herein, including any of the aforementioned aspects and embodiments of the cell, fetal hemoglobin expression is increased in: said cell or its progeny (eg, its erythroid progeny, eg, its red blood cell progeny) in relation to a cell or its progeny of the same cell type that has not been modified to include a gRNA molecule. In one aspect of the cell described herein, including any of the aforementioned cell aspects and embodiments, the cell is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g. , a red blood cell), and wherein said differentiated cell exhibits a higher level of fetal hemoglobin, for example, relative to a cell of the same type that has not been modified to include a gRNA molecule. In one aspect of the cell described herein, including any of the aforementioned cell aspects and embodiments, the differentiated cell (eg, cell of an erythroid lineage, eg, red blood cell) produces at least 'about 6 picograms (for example, at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, at least about 1.0 picograms, or between about 8 and about 9 picograms, or between about 9 and about 10 picograms) of hemoglobin, for example, relative to my differentiated cell of the same type that has not been modified to include a gRNA molecule. In one aspect of the cell described herein, including any of the aforementioned cell aspects and embodiments, the cell has been contacted, eg, in ex vivo contact, with a stem cell expander. , for example, a stem cell expander selected from: a) (IrNrj-N'-t^-benzyl-V-C?.-methyl"2H-tetrazoE5-yl)-9II-pyrim!do[4,5-b] indole-4-i1)cyclo.hexane-1.,4-diamine;b) methyl 4-(3-piperidin-1-Í'lpropiIamino)-9H-pyrimido[4J5-b]indole-7-.carboxylate e) 4-(2-(2-(benzo[blthiophen~3-ii)"9-isopropyl-9H-purin~6-ylamino)ethyl)phenol; d) (S)-2-(6-(2-(lH-indole-3-iI)ethylamino)--2-(5-fiuorGpyridin-3-II)-9H-purin-9-iI)propan-l -ol; or e) their combinations (for example, a combination of (.lr.4r)-N1~(2-benzyl-7-(2-methyl-2H-tetrazol-5-:ly9I-I" pyrimido[4,5-b ]indol-4-yl)cyclQhexane-l,4-diamine and (S)-2-(6-(2-(lH-Ind.ol-3-yl)ethylamino)-2-(5-fluoropyridin-3- Íl)-9H-purin-9-ii)proparí4-ol).In certain embodiments, the stem cell expander is (S)-2-(6-(2-(I.H-indol~3-yl)ethylamino )-2-(5--iluoropyridin~3-ij)-9H.-purin-9-yl)propau-l-oI. In one aspect of the cell described herein, including any of the aforementioned cell aspects and embodiments, the cell includes: a) an indel at or near a genomic DNA sequence complementary to the d® domain targeting a gRNA molecule described herein, eg, a method of any of the aforementioned gRNA molecule aspects and embodiments; or b) a deletion that includes the sequence, eg, substantially the entire sequence, between a sequence complementary to the targeting domain of a gRNA molecule described herein, eg, a method of any of the aspects and embodiments of. the aforementioned gRNA molecule (eg, at least 90% complementary to the gRNA targeting domain, eg, fully complementary to the gRNA targeting domain) in the promoter region of HBGI and a sequence complementary to the gRNA domain targeting of a gRNA molecule described herein, eg, a method of any of the aforementioned gRNA molecule aspects and embodiments (eg, at least 90% complementary to the gRNA targeting domain ., for example, fully complementary to the gRNA targeting domain) in the promoter region of HBG2. In one aspect, the indel is an insertion or deletion of less than about 40 nucleotides, eg, less than 3.0 nucleotides, eg, less than 20 nucleotides, eg, less than 10 nucleotides, eg, the indel is a deletion single nucleotide. In one aspect of the cell described herein, including any of the aforementioned cell aspects and embodiments, the cell is an animal cell, for example, the cell is a mammalian, primate, or mammalian cell. human. In one aspect, the cell is a hematopoietic stem or progeitor cell (HSPC) (eg, a population of HSPCs), and eg, the cell is a CD34+ cell, eg, the cell is a CD34+CD90+ cell. In certain forms of embodiment, the cell (eg population of cells) has been isolated from bone marrow, mobilized peripheral blood or umbilical cord blood In other embodiments, the cell is autologous with respect to a patient to whom said cell will be administered In certain embodiments, the cell is allogeneic with respect to a patient to whom said cell is to be administered. In one aspect, the invention provides a population of cells described herein, eg, a population of cells including a cell described herein, eg, a cell of any of the aspects and embodiments thereof. the cell mentioned above. In certain aspects, the invention provides a population of cells, wherein at least about 50%, eg, at least about 60%, eg, at least about 70%, eg, at least about 80 %, eg, at least about 90% (eg, at least about 95%, at least about 96%, parlo-minus about 07%, at least about 98%, or at least about 99% ) of population cells is a cell described herein, eg, a cell of any of the aforementioned aspects and embodiments of the cell. In certain aspects, the population of cells (for example, a cell of the population of cells) is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (for example, a population of red blood cells), and wherein said differentiated cell population has a higher percentage of F cells (eg, at least about 15%, at least about 17%, at least about 20%, at least about 25% , at least about 30%, or at least about 40% more cells F) for example, relative to a population of unmodified cells of the same type. In certain aspects, the F cells of the population of differentiated cells produce an average of at least about 6 picograms (eg, at least about 7 picograms, at least about 8 picograms, at least about 9 picograms, for at least about 10 picograms, or between about 8 and about 9 picograms, or between about 9 and about 10 picograms) of fetal hemoglobin per cell. In one aspect, which includes any of the aspects and forms of embodiment of the population of cells mentioned above, the invention provides a population of cells, which includes: 1) at least 1 eo CD34+ cells / kg of body weight of the patient to whom the cells will be administered; 2) at least 2e6 GD34+Zkg cells of patient body weight a! which cells will be administered; 3) at least 3e6 CD'34-t cells / kg body weight of the patient to whom the cells will be administered; 4) at least 4e6 CD34+ cells / kg body weight of the patient to whom the cells will be administered; or 5) between 2eo and 10e6 CD34+ cells / kg body weight of the patient to whom the cells are to be administered. In certain embodiments, at least about 40%, eg, at least about 50%, (eg, at least about 60%, at least about 70%, at least about 80%, or by at least about 90%) of the cells in the population are CD3'4+ cells. In certain embodiments, at least about 5%, eg, at least about 10%, eg, at least about 15%, eg, at least about 20%, eg, at least about 30%, of the cells in the population are CD34+CD90+ cells. In certain embodiments, the cell population is derived from umbilical cord blood, peripheral blood (eg, mobilized peripheral blood), or bone marrow, eg, derived from bone marrow. In certain embodiments, the cell population includes, eg, is composed of, mammalian cells, eg, human cells. In certain embodiments, the cell population is autologous relative to a patient to which it will be administered. In other embodiments, the population of cells; is allogeneic in relation to a patient to whom I know you will be administered. In one aspect, the invention provides a composition that includes a cell described herein, for example, a cell of any of the aforementioned aspects and embodiments of the cell, or a population of cells described in herein, for example, a population of cells of any of the aforementioned cell population aspects and embodiments. In one aspect, the composition includes a pharmaceutically acceptable medium, eg, a pharmaceutically acceptable medium suitable for cryopreservation. In one aspect, the invention provides a method of treating one. hemoglobinopathy, including administering to a patient a cell described herein, eg, a cell of any of the aforementioned aspects and embodiments of the cell, a population of cells described therein. present, for example, a population of cells of any of the aspects and embodiments of the aforementioned cell population, or a composition described herein, for example, a composition of any of the aspects and embodiments of the aforementioned composition. In one aspect, the invention provides a method of increasing fetal hemoglobin expression in a mammal, including administering to a. patient a cell described herein, for example, a cell of any of the aforementioned aspects and embodiments of the cell, a population of cells described herein, for example, a population of cells of any of the aforementioned cell population aspects and embodiments, or a composition described herein, eg, a composition of any of -aspects, and embodiments of the aforementioned composition. In some respects, hemogiobinopathy is beta thalassemia. In some respects, hemogiobinopathy is sickle cell disease. In one aspect, the invention provides a method of preparing a cell (eg, a population of cells) that-includes: (a) providing a cell (eg, a population of cells) (eg, to HSPC (eg, a population of HSPCs)); (b) culturing said cell (eg, said population of cells) ex vivo in a cell culture medium including a stem cell expander; e(c) introducing into said cell a first gRNA molecule, eg, described herein, eg, a first gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a nucleic acid molecule encoding a first gRNA molecule; a composition described herein, eg, a composition of any of the aforementioned aspects and embodiments of the composition; or a vector described in . hereby, for example, a vector any of the aforementioned aspects and embodiments. In certain aspects of the method, following the introduction of step (c), said cell (eg population of cells) is capable of differentiating into a differentiated cell (eg population of differentiated cells), eg a cell of an erythroid lineage (eg, a population of cells of an erythroid lineage), eg, a red blood cell (eg, a population of red blood cells), and wherein said cell-differentiated (eg, a population of cells differentiated) results in an increase in fetal hemoglobin, for example, relative to the same cell that has not been subjected to step (e). In certain aspects of the method, the stem cell expander is: a) (lr,4r)-Nl-(2-benzyl-7-(2-methyl-2H-tetrazoi-5-ii)-9H-pii'imido[ 4,5-biindoI-4-yl)cyclohexane-I,4-diamine; b) methyl 4-(3"piperi.dm-l~ylpropylamino)-9H-pyrimidoi4,5-b]indoi-7-carboxylate; c)- 4-(2-(2-(benzo[b]thiophen-3 -!l)-9-isopropii-9.H.-puriii-6-ylamhio)ethyl)phenol;d).(S)-2-(6-(2-(I.H-indol-3-yl)ethyl) -2-(5-fluoropyridi»-3-yl)-9H-pürin-9-Íl)propan-l--oi; or e) their combinations (for example, a combination of (lr,4.r)-NI- (2-benzyl-7-(2-methyl-2H-tetrazol-5-ií)-9H-pyrimido[4,5-b]tndol-4-yl)cyclohexa.r !c-l,4--diamine and (S )-2-(6-(2-(ÍH-indoi-3-.yl)ethylamin0)-2-(5-fluoíOpi.ridi.n-3-yl)-9H.-pu.rín-9-yl) propan-I-oí).In certain embodiments, the stem cell expander is (S)-2-(6-(2-(IH-mdol-3-yl)ethiainino)"2-(5-fluoropyridm~ 3-yl)-9í1.-purm-9-ír)propan-l-ol. In certain aspects, cell culture medium includes thrombopoietin (ypo), Flt3 ligand (Flt-3L), and human stem cell factor (SC.F). In certain aspects, the cell culture medium further includes human Interleukin-6 (]L-6). In certain aspects, the cell culture medium includes thrombopoietin (Tpo), FIt3 ligand (Flt-3L), and human stem cell factor (SCF) each at a concentration ranging from about 1 ng / mL to about 100.0 n.g / mL, for example, each at a concentration of about 50 ng / mL, for example, each at a concentration of about 50 ng / mL. In certain aspects, the cell culture medium includes human interleukin-6 (IL-6) at a concentration ranging from about 10 ng / mL to about 1000 ng / mL, for example, at a concentration of about 50 ng / mL, for example, at a concentration of -approximately 50 ng / niL. In certain aspects, the cell culture medium includes a stem cell expander at a concentration ranging from about 1 nM to about 1 mM, for example, at a concentration ranging from about 1 u.M to about 100 nM. , for example, at a concentration ranging from about 500 nM to about 750 nM. In certain aspects, the cell culture medium includes a stem cell expander at a concentration of about 500 -nM, for example, at a concentration of about 500 nM. In certain aspects, the cell culture medium includes a stem cell expander. at a concentration of about 750 nM, eg, at a concentration of about 750 nM. In certain aspects of the method of preparing a cell (eg, a population of cells), the culture of step (b) includes a period of culture before the introduction step (c), for example, the period of culture before of -input step (c) is at least 12 hours, for example, is -a period of from about 1 day to about 12 days, for example, is a period of from about 1 day to about 6 days , for example, is from about 1 day to about 3 days, eg, is from about 1 day to about 2 days, eg, is from about 2 days. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding method aspects and embodiments, the culturing of step (b) includes a period of culturing after the introduction of step (c), for example, the culture period after the introduction of step (c) is at least 12 hours, for example, is from about 1 day to about 12 days, for example , is from about 1 day to about 6 days, for example, is from about 2 days to about 4 days, for example, is from about 2 days, or is a period of about 3 days or is a period of about 4 days. In certain aspects of the method of preparing a. cell (eg, a population of cells), including any of the foregoing aspects and embodiments of the method, the population of cells is expanded by at least 4-fold, eg, by at least 5-fold, eg, by at least 10-fold, for example, relative to cells that are not cultured according to step (b). In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding method aspects and embodiments, the introduction of step (c) includes electroporation. In certain aspects, electroporation includes 1 to 5 pulses, eg, 1 pulse, and wherein each pulse has a pulse voltage ranging from 700 volts to 2000 volts and has a pulse duration ranging from 10 ms. and 100 ms. In certain aspects, electroporation includes, eg, is comprised of, 1 pulse. In certain aspects, the voltage of the pulse (or more than one pulse) ranges from 1500 to 1900 volts, for example it is 1700 volts. In certain aspects, the pulse duration of the single or more pulses ranges from 10 ms to 40 ms. for example, it is 20 ms. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding aspects and embodiments of the method, the cell (eg, population of cells) provided in step (a) is a human cell (eg, a population of human cells). In certain aspects of the method of preparing a cell (eg, population of cells), including any of the foregoing aspects and embodiments of the method, the cell (eg, population, of cells) provided in the step (a) is isolated from bone marrow, peripheral blood (eg, mobilized peripheral blood), or umbilical cord blood. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding aspects and embodiments of the method, the cell (eg, population of cells) provided in step (a) is isolated from bone marrow, for example, is isolated from the bone marrow of a patient suffering from a hemoglobinopathy. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding aspects and embodiments of the method, the population of cells provided in step (a) is enriched for cells. CD34+. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the preceding aspects and embodiments of the method, after the introduction of step (c), 1st cell ( eg, the cell population) is cryopreserved. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the foregoing aspects and embodiments of the method, after the introduction of step (c), the cell (eg, the cell population) includes: a) an indel at or near a genomic DNA sequence complementary to the targeting domain of the first gRNA molecule; or b) a deletion that includes the sequence, e.g., substantially the entire sequence , between a sequence complementary to the targeting domain of the first gRNA molecule (eg, at least 90% complementary to the gRNA targeting domain, eg, fully complementary to the gRNA targeting domain) in the promoter region of HBGi and a sequence would complement the address-domain of the first gRNA molecule. (eg, at least 90% complementary to the gRNA targeting domain, eg, fully complementary to the gRNA targeting domain) in the promoter region of HBG2. In certain aspects of the method of preparing a cell (eg, a population of cells), including any of the foregoing aspects and embodiments of the method, after the introduction of step (c), at least about 40 %, at least about 50%, at least about 60%, at least about 70%, at least about 80%. at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the cells in the population of cells include an indel in or near a genomic DNA sequence complementary to the targeting domain of the first gRNA molecule. In one aspect, the invention provides a cell (eg, population of cells), obtainable by a method of preparing one. cell (eg, a population of cells) described herein, eg, described in any of the aspects and methods of the above-mentioned method of preparing a cell. In one aspect, the invention provides a method of treating hemogiobinopathy in a human patient, including administering to a human patient a composition that includes a cell described herein, for example, a. cell of any of the aforementioned aspects and embodiments of the cell: or a population of cells described herein, eg, a population of cells of any of the cell population aspects and embodiments aforementioned. In some respects, the hemogiobinopathy is beta thalassemia. In certain aspects, hemogiobinopathy is sickle cell disease. In. In one aspect, the invention provides a method of increasing the expression of fetal hemoglobin in a human patient, including administering to said human patient a composition that includes a cell described herein, for example, a cell of any of the aspects and forms of embodiments of the aforementioned cell; or a population of cells described in. hereby, for example, a population of ".cells" of any of the aforementioned cell population aspects and embodiments. In certain respects, human patients have beta thalassemia. In certain aspects, the human patient has sickle cell disease. In certain aspects of the method of treating hemogiobinopathy or the method of increasing fetal hemoglobin expression, a composition including at least about 16 cells (eg, cells described herein) is administered to the human patient. per kilogram of human patient body weight, eg, at least about 16 CD34+ cells (eg, the cells described herein) per kilogram of human patient body weight. In certain aspects of the method of treating a hemogiobinopathy or the method of increasing the expression of fetal hemoglobin, a composition including at least about 2e.6 cells (eg, the cells described in present) per kilogram of human patient body weight, eg, at least about 2e6 CD34% cells (eg, the cells described herein) per kilogram of human patient body weight. In certain aspects of the method of treating a hemoglobinopathy or the method of increasing fetal hemoglobin expression, a composition including about 2e6 cells (eg, the cells described herein) per kilogram of body weight is administered to the human patient. of the human patient, eg, about 2&6 CD34-:- cells (eg, the cells described herein) per kilogram of body weight of the human patient. In certain aspects of the method of treating a hemoglobinopathy or the method of increasing fetal hemoglobin expression, a composition including at least about 3e6 cells (eg, the cells described herein) per kilogram is administered to the human patient. of body weight of the human patient, eg, at least about 3e6 CD34+ cells (eg, the cells described herein) per kilogram of body weight of the human patient. In certain aspects of the method of treating a hemoglobinopathy or the method of increasing fetal hemoglobin expression, the human patient is administered a composition that includes about 36 cells (eg, the cells described herein) per kilogram of body weight. body weight of the human patient, eg, about 3eo CD34+ cells (eg, the cells described herein) per kilogram of body weight, of the human patient. In certain aspects of the method of treating a hemoglobinopathy or the method of increasing the expression of fetal hemoglobin, a composition including from about 26 to about 60 cells (eg, the cells described herein) is administered to the human patient by kilogram of body weight of the human patient, eg, between about 2c6 and about 0.06 CD34-J-cells (eg, the cells described herein) per kilogram of body weight of the human patient. In one aspect, the invention provides: a gRNA molecule described herein, eg, a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, eg, a composition of any of the aspects and embodiments, of the aforementioned composition, a nucleic acid described in. hereby, for example, a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, for example, a -vector of any of the aspects and embodiments of the aforementioned -vector: a cell described herein, for example, a -cell of any of the aspects and forms of forms realization of the aforementioned cell; or a population of cells described herein, eg, a population of cells from any of the aforementioned cebala population aspects and embodiments, for use as a medicament. In one aspect, the invention provides: a gRNA molecule described herein, for example, a gRNA molecule of any of the -aspects and embodiments of the aforementioned gRNA molecule; a composition described herein, for example, a composition of any of the aspects and embodiments of the aforementioned composition, a nucleic acid described herein, for example, a nucleic acid of any of the aspects and forms embodiment of the aforementioned nucleic acid; a vector described herein, eg, a vector of any of the aspects and embodiments of the aforementioned vector; a cell described herein, for example, a cell of any of the aspects and forms of embodiments of the cell mentioned above;, or a population of cells described herein, for example, a population of cells of any of the aspects and embodiments of the aforementioned population of cells, for use in the manufacture of a medicament. In one aspect, the invention provides: a gRNA molecule described herein, for example, a gRNA molecule of any of the aforementioned aspects and embodiments of the gRNA molecule, a composition described herein, for example , a composition of any of the aspects and embodiments of the aforementioned composition-, a. nucleic acid described herein, eg, a nucleic acid of any of the aforementioned nucleic acid aspects and embodiments; a vector described herein, eg, .a vector of any of the aspects and embodiments of the aforementioned vector; a cell described herein, eg, a cell-of any of the aforementioned cell aspects and embodiments; or 'a population- of cells described herein, eg, a population of cells of any of. the aspects and embodiments of the aforementioned population of cells, for use in the treatment of a disease. In one aspect, the invention provides: a gRNA molecule described herein, eg, a gRNA molecule of any of the aforementioned gRNA molecule aspects and embodiments; a composition described herein, for example, a composition of any of the aspects and embodiments of the aforementioned composition, a nucleic acid described herein, for example, a nucleic acid of any of the aspects and forms of embodiment of the aforementioned nucleic acid; a vector described herein, eg, a vector of any of the aspects and embodiments of the aforementioned vector; a cell described herein, eg, a cell of any of the aforementioned cell aspects and embodiments; or a population of cells described herein, eg, a population of cells of any of the aforementioned aspects and embodiments of the aforementioned population of cells, for use in treating a disease, wherein the disease is a hemoglobinopathy , for example, beta-thalassemia or sickle cell disease. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: HbF induction 7 days after editing. For each gRNA target sequence analyzed, the percentage of cells with induced HbF expression corrected for background levels based on control transfection is shown, as mean with an error bar indicating standard deviation. The gRNA GS against exon 2 - of BCL11A serves as a positive control. A dotted line at 17% indicates the threshold level chosen for analysis. Various gray shadings, as indicated in the legend, relate the degree of HbF induction to the degree of editing in the HBG1 or HBG2 target loe-i. Figure 2: Editing efficiency at the HBGl target locus. For each gRNA tested the percentage of indels detected by NGS is illustrated as a mean with an error bar indicating the standard deviation. Ei gRNA G8 against si exon 2 of BCL i 1 A served as a positive control. Two guides for which no NGS data were obtained are indicated by arrowheads. Figure 3:; Editing efficiency at the HBG2 target locus. For each gRNA tested the percentage of indels detected by NOS is illustrated as mean with: an error bar indicating the standard deviation. The gRNA G8 against the exon. 2 of BCL1 IA serves as a positive control. Sixteen guides for which no NGS data were obtained are indicated by arrowheads. Figure 4: Overview of the location of high-yield gRNA target sequences (eg, >17% upregulation of HbF- at day 7), known nondelecianal.es HPFH polymorphisms and binding factor binding site. transcription in the HBGL promoter area The Figure discloses SEQ ID NOs. 293-312. .respectively, in order of appearance. Figure 5: Overview of the location of high-throughput gRNA target sequences (eg, >17% up-regulation, HbF positive at day 7), known non-deletional HFPH polymorphisms, and transcription factor-binding site in the HBG2 promoter area. The Figure discloses Seq. ID Nos. 3.13-332, respectively, in order of appearance. Figure 6r Editing efficiency at the target B2M locus in CD34+ HSPC by different Cas9 variants, as assessed by NGS and flow cytometry. NLS-SV40 NLS; Hisó (SEQ ID NO: 247) or His8 (SEQ ID NO: 248) refers to 6 (SEQ ID NO: 247) or 8 (SEQ ID NO: 248). : 248) -residues- of histidine, respectively; TEV - tobacco etch virus cleavage site; Cas9 = Cas 9 from wild-type S.pyogenes - mutations or variants are indicated). Figure 7: Detection and quantification of HbF-positive cells by flow cytometry at 7 (black bars), 14 (light gray bars), or 21 (dark gray bars) days after erythroid differentiation post-transfusion. electroporation of HSPC with RNPs containing sgRNA of the indicated targeting domain. The percentage of HbF+ cells for control cultures not treated with sgRNA at each time point was subtracted. Mean > standard deviation (n ~ 2 technical replicates) is indicated. Figure 8: .Detection and quantification of cells positive for. HbF by flow cytometry at 7' (open black bars), 14 (open light gray bars), or 21. (open dark gray bars) days after erythroid differentiation following electroporation of HSPC with RNP containing sgRNA. of the indicated addressing domain. The percentage of HbF+ cells - paw - control cultures not treated with sgRNA at each time point was subtracted. The mean (bar) of two independent cell donors is shown, along with the value for each donor (circle - first .donor, triangle ~ second donor). Figure 9. Visualization of PCR products from the indicated reaction: P1, P2 or P3, as described in the Examples, of cells after electroporation with RNP containing sgRNA of the indicated targeting domain or cells of control not treated with sgRNA. The expected -products are the following. Pl: 7.7 kb for wild / small indel allele or 4.9.kb inversion allele, 2.8 kb for 4.9 kb allele detected. P2: 3.8 kb for wild / small indel allele, no product for 4.9 kb deletion or 4.9 kb de-inversion allele. P3: 1..8: kb for 4.9 kb inversion allele, no product for wild / small indel allele or 4.9 kb deletion allele. L ~ .Reference DNA ladder. * - DNA from this band was isolated and subjected to next generation sequencing. Figure 10: Schematic indicating the genomic location of the primer and probe binding sites for the digital cat PCR assay to authenticate the 4.9 kb deletions. The primers (5.2 kb Forward and 5.2 kb Reverse) and the probe (EAM probe) bind to an intergenic site downstream of HBG2 and upstream of HBG1. The probe has a second binding site upstream of HBG2, but that region is not bound by the primers. The areas in which the targeting domains are located in the HBGI and HBG2 promoters are indicated. If the intervening sequence in the two targeting domain regions is removed, the primer / probe binding site between HBGI and HBG2 would be lost. Figure 11; Classification scheme for HSPC subpopulations for the cell sample after electroporation. with R-NP containing sgRNA of the GCR-0067 targeting domain. Dot plots of cell fluorescence after immunostaining targeted to the indicated cell surface marker are shown. The following populations were classified as illustrated: P5 ~ CMP (CD34+CD45RA-CD38e), P9 -MPP (CD34+CD45RA"CD38~CD90-CD49f-), PIO - ST-HSC (CD34-hCD45RA-CD38-CD90 -CD49f+), Pll = LT-HSC (CD34+CD45RA-CD38-CD90+CD49I+) Total CD34+ cells also sorted (not shown). Figure 12: Percent editing of sorted HSPC subpopulations after electroporation with RNPs containing sgRNA of the GCR-0067 targeting domain. HBGI indel and HBG2 indel indicate the percentage of small insertions and deletions identified by next-generation screening of PCR amplicons at or near the targeting domain of the HBGI or HBG2 promoter region, respectively-(note that alleles with the 4.9 kb deletion or inversion described above are not amplified). The HBG1-HBG2 deletion indicates the percentage of alleles with the 4.9 kb deletion, as determined! by the PCR assay. with digital drops described in the Examples. The total edit is an approximation calculated by the percentage of HBG1-HBG2 deletion added to the percentage of no HBG 1-HBG2 deletion moments multiplied by the percentage of HBG2 indel. Figure 13: The. Figure I3A shows the sum of all indels observed at the HBGI locus in the indicated cell type after introduction of sgRNA comprising the targeting domain of GCR-0067. The indels are arranged with the most frequently observed indels at the top of each bar. It is not quantified. in this assay the fraction of cells comprising the large 4.9 kb deletion between the EIBG1 and HBG2 loci. The number within the bar of each of the most prevalent indels indicates the number of nucleotide differences from the genomic sequence. wild-type (- indicates deletion; + indicates insertion). Figure 13B shows the sum of all indels observed at the HBG2 locus in the indicated cell type after introduction of sgRNA comprising the targeting domain of GCR-0067. The indels are arranged with the most frequently observed indels at the top of each bar. The fraction of cells comprising grao is not quantified in this assay. 4.9 kb deletion between the HBG 1 and HBG2 loci. The number within the bar of each of the most prevalent indels indicates the number of nucleotide differences from the wild-type genomic sequence (~ indicates deletion and indicates insertion). CMP = CD34+CD45RA-CD3.8+ cells; MP.P = CD34-rCD45RA-CD38-CD90-CD49f cells; S'T-HSC = CD34vCD45RA~CD38~CD90-CD49f-t cells; and LT-IISC - CD34+C'D45RA-CD38-CD90+CD49f+ cells. Figure 14: Percentage of colonies corresponding to the indicated subtype, CFU-GEMM (dark gray bars), CEU-G / M / GM (medium gray bars) or BFU-E / CFU-E (light gray bars). ), after electroporation with RNPs containing sgRNA del. indicated domain targeting or control cultures not treated with sgRNA. The mean + / - standard deviation is indicated (n == .2 independent donors). Figure 15: Proliferative folds of total normalized cells (TNC), CD34 positive cells (CD34+), and CD34 and CD90 double positive cells (CD34+CD90+), as indicated, in a medium comprising compound 4, after electroporation with RNPs containing sgRNA of the GCR-0067 targeting domain or control cultures not treated with sgRNA. The mean + / - standard deviation (n :::: 2 independent donors) is indicated. The mean (bar) of three independent cell donors is illustrated, along with the value for each donor (square -donor .A, triangle -donor B, circle -donor C). Differences between edited and control cultures were not significant (ns) by unpaired i-test (GraphPad Prism). Figure 16: Representative gating of cell populations by flow cytometry. Illustrated are dot plots of cellular fluorescence after immunostaining directed at the indicated cell surface markers, or isotype control (isotype). The gates indicated by the bold boxes were used to quantify the percentage of the indicated population and were set to exclude isotype control-labeled cells. Only viable cells previously separated are shown as 'DAPI negative and within the cell forward scatter and side scatter gates and are derived from donor C electroporated with Cas9 alone. Figure 17: Percentage of cells with the indicated cell surface phenotype, as assessed by flow cytometry, after electroporation with RNPs containing sgRNA of the targeting domain. GCR-0067 (black bars) or control cultures not treated with sgRNA (grey bars). Cells were expanded 2 days after electroporation of RNP in medium comprising Compound 4, and evaluated by flow cytometry as described in Figure 16. Meanla + standard deviation (n - 3 independent donors) is indicated. ·. There were no significant differences between edited and unedited cells for a given population by unpaired t-test (GraphPad Prism). Figure 18A. Quantification. CE-M.S of Globin subunits in control-edited IdSCs derived from a patient with sickle cell disease (SCD1) edited with Cas9 and without sgRNA. After differentiation of the cells into the erythroid lineage, the cells showed a normal level of α-globin, no normal β-globin due to sickle cell homozygosis, a high level of β-globin subunit facifbrme, and a low level of g - fetal globin. Figure 18B. CE-MS quantification of globin subunits in genome-edited HSPCs derived from sickle cell patients (SCDl). After editing of HSCs, patient-derived erythroid cells in the sample demonstrated 40% upregulation of fetal g-globin and simultaneous 50% downregulation of Ia. sickle subunit of b-globma. Figure .19, Schematic protocol for gene-edited cell engraftment study. Transplantation of gene-edited HSCs with Cas9 and sgRNA comprising the targeting domain of CROO!.128 (sgl 12-8-). Five hundred thousand. Human CD34+ cells were subjected to either gRNA or sgl 128 control editing, followed by injection into 2 Gy-irradiated NOD.Cg-PrkdcscidI12rgtmlWjí / SzJ (NSG) recipients. Mice were bled at 4, 8, 12, 16 weeks and bone marrow cells were harvested at 16 weeks post-transplantation. Figure 20. Bone marrow reconstitution at 16 weeks post-transplantation using the experimental protocol illustrated in Figure 19. Figure 21. Reconstitution of myeloid lymphoid, B-, and T cells in peripheral blood and bone marrow at multiple time points using the experimental protocol illustrated in Figure 19. N ~ 5 / group, data shows from .min to max, 4 independent experiments-. Figure 22. Schematic diagram of the transplantation study to evaluate the stem cell function of edited HSCs coft sgRNAs.of the gamma globin promoter region (sg-G0008, &g-G0051f sg-GOOlO, sg-G0048, sg-G0067) in comparison with the gRNA of the erythroid-specific enhancer region of the BCLHA gene (sg-G1128; also called sgl 128). Cells were left in culture 24 hours after electroporation. Culture conditions both before and after electroporation were StemSpan SFEM+IL6, SCF, TPO. Flt3L; Compound 750nM 4. Figure 23: Human engraftment and lineage analysis over 20 weeks in NSG mice. Figure 23A) Peripheral blood chimerism for 18 weeks; Figure 23B) Lineage distribution in peripheral blood at 18 weeks. Bone marrow analysis: Figure 23C.) Bone marrow analysis of human cells at week 9; Figure 23D) Human CD45+ engraftment and human cell lineage distribution in bone marrow at week 9; Figure 23E) Human CD45+ bone marrow engraftment at week 20 post-engraftment; Figure 23F) Lineage distribution of cells grafted in the bone marrow at week 20. Figure 24A. Grafting efficiency of HSCs edited with sgRNAs with homology to the gammaglobin promoter region (sg-G0008, sg-GÜ05l, sg-GOOlO, sg--G0048, sg-GOO'67) compared to sgRNA from the enhancer region BCL.l 1A gene-specific erythroid (sgl 128). Engraftment of human cells into NSG mice at 8 weeks post-transplantation is shown. N ::: 10 / group, 3 independent experiments. The chart shows grouped data. Figure 24B. .Grafting efficiency of HSCs edited with sgRNAs with homology to the gamma globin promoter region (sg-GüOOS, sg-G0051., sg-GOOlO, sg~G9048, sg-G0067) compared to enhanced region sgRNAs. erythroid specific to the BCL.llA gene (sgl 128). Engraftment of human cells into NSG mice at 20 weeks post-transplantation is shown. N - 10 / group, 3 independent experiments. The graph shows pooled data. Figure 25. Reconstitution of multiple lineages of NSG mice transplanted with CD34-:-sdítádas cells with genes. N = 10 / group, data from a representative experiment. Figure 26. High editing efficiency maintained before and after transplantation. "Pte-Xpt" editing efficiency and pattern of individual sgRNA indels in human CD34+ cells as measured by NGS at editing but before transplantation. "8 weeks after Xpt"; editing and patterning efficiency of ludeles in human CD34+ cells 8 weeks after bone marrow transplantation in mice, measured by NGS. "20 weeks after Xpt": editing efficiency and infidel pattern in human CD34r cells 20 weeks after bone marrow transplantation. mice, measured by NGS, Electroporation was performed in triplicate per group, data from a representative experiment. As herein referred to in this Figure, "indel" refers to the sum of all deles less than 200 nt; "large deletion" refers to the sequence deletion between the predicted HBGI and HBG2 binding sites for each gRNA. Figure 27. NGS analysis of GD34+ cells post-editing with RNPs. The specific regions targeting the sgRNA. are indicated on the axis. x. Figure 27A: NGS analysis of CD34+ cells at day .2 post-electroporation of RNPs. Figure 27B: NGS analysis of whole bone marrow from NSG mice transplanted with edited bone marrow CD34+- cells (27B) 9 weeks after transplantation. Figure 27C: Whole-bone marrow NGS analysis of NSG mice transplanted with edited bone marrow CD34+ cells at week 20 post-transplantation. Insertion indels are indicated in black, deletion indels (excluding large deletions that comprise a cleavage of the region between the HBG1 and HBG2 binding target sequences for each of the gRNAs sg-GSl, sg- G48 and sg~G67) are indicated in. Gray. Total % editing is represented by the height of the bars, N = 10, data are presented as mean+SEM from an independent experiment. Figure 28. Long-term, gene-edited, grafted human HSCs were able to produce a higher level of HbF upon differentiation of erythroid cells. Fifty thousand human CD34+ cells were sorted from the bone marrow of transplanted NSG mice aged 8 or 20 weeks. Sorted cells were seeded in erythroid differentiation medium for 14-21 days. Mature red blood cells in culture were analyzed for HbF expression and to enumerate the number of HbF+ cells by flow optometry. Control represents Cas9-edited CD34+ cells without gRNA* and transplanted into NSG mice in the same manner as the gene-edited control group. N - 10 / group, 3 independent experiments·. Figure 29. Off-target activity for HBGI and / or HBG2 guide RNAs was assessed using an oligo dsDNA insertion method in HE9-293 cells overexpressing Cas9. Sites within the target (open circle) and potential sites outside the target (closed circles) detected are indicated; the "y" axis indicates the detection frequency. All the gRNAs were tested in dgRNA format with the targeting domain indicated by the identifier CRxxxxxx. Figure 30. Off-target activity of HBG1 and / or -HBG2 guide RNAs was assessed using an oligo dsDNA insertion method into HE9-293 cells overexpressing Cas9. Sites within the target (open circle) and potential sites outside the target (closed circles) detected are indicated; e] "y" axis indicates the detection frequency. The gRNAs were tested in dgRNA format with the targeting domain indicated by the identifier CRxxxxx, or in sgRNA format with the targeting domain indicated by the identifier Gxxxxxx. Figure 31.4. CD34+ cell count of cells derived from peripheral blood mobilized from healthy individuals after gene editing. Cells were thawed on day 0, cultured for .3 days before. electroporation on day 3. Enumeration of the number of CD34+ cells by ISHAGE for 10 days post-electroporation. Two independent experiments were performed in duplicate. Total! N=5. Graphs show data from 1 experiment with mean+SEM. Figure 31B. Expansion of CD34+ cells from peripheral blood-derived cells mobilized from healthy individuals following gene-editing. Cells were thawed on day 0, cultured for 3 days before electroporation. on day 3. Expansion of total mononuclear cells on days 3, 7 and 10 after editing. Two independent experiments were performed in duplicate. Total N ~ 5. Graphs show data from 1 experiment with . mean+SEM. Figure 31C. Viability of CD34+ cells from peripheral blood-derived cells mobilized from healthy individuals after gene editing. Cells were thawed on day 0, cultured for 3 days before electroporation on day 3. Viability of mononuclear cells at same time points post-editing. Two independent experiments were performed in duplicate. Total N = 5. Graphs show data from experiment I with mean+SEM. Figure 32A. Editing efficiency of sgl 128 and sg0067 in mobilized CD34+ cells from the peripheral blood of healthy individuals. The percentage of INDELs captured by NGS after editing using sgl 128 (targeting the ESH BCL11A +58 region) and sg0067 (targeting the EIbG-1 and HbG-2 gene cluster) is shown. This plot also indicates the full-editing efficiency for sg l 128 since this sgRNA only generated small INDELs. More than five independent experiments were performed in duplicate or triplicate, n - 2-3 / experiment. Figure 32B. Editing efficiency of sgl 128 and sg0067 in CD34+ cells mobilized from the peripheral blood of healthy individuals. A. Percentage of INDELs captured by NGS after -editing using sg0067 (targeting HbG-.l and HbG-2 gene cluster). The total editing efficiency and the editing pattern of sg0067 are shown. The sgOOó'Z editing pattern consists of a large 5 kb deletion (indicated by black bars) and smaller INDELs (indicated by gray bars). More than five independent experiments were performed in duplicate or triplicate, n = 2-3 / experiment. Figure 33. Fold change of g-globin transcript in erythroid cells from patient samples following CRISPR deletion of BCL11A or indel formation / deletions in the HBG1 / 2 region. CD34+ cells derived from mobilized peripheral blood from healthy donors were CRISPR edited and differentiated into the erythroid lineage in vitro as described in the above procedures. On day 11 of erythroid differentiation, cells were harvested from culture and subjected to qPCR to measure g-globin and b-globin transcripts, normalizing to . GAPDH, The experiment was performed independently twice, each in duplicate, n = 2-3 / experiment. Data shows mean+SEM of pooled donors from one study. Figure 34. Enumeration of HbF+ cells from healthy individuals after gene editing. CD34+ cells derived from mobilized peripheral blood from healthy donors were CRISPR-edited and differentiated into the erythroid lineage in vitro as described in the procedures above. On day 10, of erythroid differentiation, cells are stained with anti-HbF-FITC antibody to enumerate HbF+ cells by flow cytometry. The experiment was performed independently twice, each in duplicate, n - 2-3 / experiment. The data shows the mean -t-SD of one study. Figure 35A. Expansion and viability of peripheral blood-derived CD34+ cells from individuals with fakiform cell disease after gene editing. Cells were cultured for 6-10 days before electroporation. DO refers to the day of electroporation. The absolute count of CD34+ cells by IS.HAGE for 10 days after electroporation is shown. N - 4, data shows mean+SEM. Four independent experiments were performed in duplicate. The bars are, from left to right at each time point, control (mock), sgl 1.28, sg0067. Figure 35B. Expansion and viability of peripheral blood-derived CD34+ cells from individuals with sickle cell disease following gene editing. Cells were cultured for 6-10 days prior to electroporation, OD refers to the day of electroporation. The percentage of CD34+ cells is shown by ISHAGE for 10 days after electroporation. N - 4,: data shows mean+SEM. Four independent experiments were performed in duplicate. The bars are, from left to right at each time point, control (mock), sgl. 12S, sg0067. Figure 35C. Expansion and viability of peripheral blood-derived CD34+ cells from individuals with fakiform cell disease following gene editing. Cells were cultured for 6-10 days prior to electroporation, OD refers to the day of electroporation. The expansion of total monenuclear cells at days 3, 7 and 10 after editing is shown. N ~ 4, data shows mean+SEM. Four independent experiments were performed in duplicate. The bars are, from left to right at each time point, control (mock), sgl .128, sg0067. Figure. 35D. Expansion and viability of peripheral blood-derived CD34+ cells from individuals with sickle cell disease after gene editing. Cells were cultured for 6-10 days prior to electroporation. DO refers to the day of electroporation. The viability of monenuclear cells is shown in. on days 3,7 and 10 after the edition. N=4, data shows mean+SEM. Four independent experiments were performed. The bars are, from left to right in each. panto in time, control (mock), sgl128, sg0067. Figure 36. Efficiency of editing sg l 128 and s-gO-067 on. CD34+ cells from samples of patients with sickle cell disease. The editing pattern of sg0067 is denoted by a large deletion (grey) and a sum of small indels (black). The data shows the mean+SEM of four independent editing experiments performed in duplicate' with CD34+ cells from four different sickle cell disease patients (SCD1-4). Figure 37. In vitro multilineage differentiation capacity of HSPCs measured by colony-forming unit assay. BFÍJ-E - burst forming unit, erythroid; CFIJ-GM = colony forming unit, granulocytes, monocytes; CFU-GEMM - colony-forming unit, granulocytes, erythroids, monocytes, megakaryocytes. The graph shows three independent experiments of CD34+ cells from three different sickle cell disease (SCD1-3) patients. The experiments were performed in triplicate. Data represent mean+SEM. Figure 38. Transcriptional fold change of g-globin in erythroid cells from patient samples following CRISPR knockdown of BCL11A or indel formation / deletions in the g-globin gene cluster. CD34+ cells derived from 3 patients with fakiform cell disease (SCD1-3) were CRISPR-edited and differentiated into the erythroid lineage in vitro -as described in the Examples. On day 11 of erythroid differentiation, cells were harvested from culture and subjected to qPCR to measure g-globin and b-globin transcripts, normalizing to . The GAPDEL experiment was performed in duplicate. The data shows the mean SEM of the pooled donors. Figure 39. Enumeration of HbF* cells in samples from patients with Alzheimer's disease. sickle cell after gene editing. CD34+ cells derived from 3 sickle cell disease patients (SCD1-3) were CRISPR-edited and differentiated into the erythroid lineage in vitro as described in the Examples. On days 11, 14 and 21 of erythroid differentiation, cells were stained with anti-HbF-FlTC antibody to enumerate HbF+ cells by flow cytometry. The experiment was performed in duplicate. Data shows mean+SEM. At day 11 the results of SCD1-3 are shown; in. on day 14 the results of SCD-1 and SCD-2 are shown; on day 21 the results of SCD-2 and SCD-3 are shown. Figure 40. Measurement of fetal hemoglobin expression in samples from gene-edited sickle-cell disease patients by flow cytometry. CD34+ cells derived from 3 sickle cell disease patients (SCD1-3) were CRISPR edited and differentiated into the erythroid lineage in vitro as described in the Examples. On days 11, 14 and 21 of erythroid differentiation, cells were stained with. anti-MbF-FITC antibody to measure the intensity of HbF expression in each cell by flow cytometry. The experiment was performed in duplicate. Data show, mean t-SEM. ΜΕΓ ~ intensity, medium fluorescent. On day 11 the results of SCD1 -3 are shown; at day 14 the results of SCD-1 and SCD-2 are shown; On day 21 the results of SCD-2 and SCD-3 are shown. Figure 4.1. Enumeration of the number of sickle cells versus normal cells for CRISPR editing of patient samples. CD34-1- cells derived from 3 patients with sickle cell disease (SCD1-3.) were CRISPR-edited and differentiated into the erythroid lineage in vitro as described in previous procedures. On day 21 of erythroid differentiation, cells were subjected to a % hypoxia chamber for 4 days, fixed and followed by flow cytometry of single cell imaging. Figure 41A (left panel) shows the change in the number of sickle cells in gene-edited patient samples, as enumerated by single cell imaging. Figure 41B (right panel) shows the change in the number of normal cells after gene editing in patient samples, as enumerated by single cell imaging. Three independent experiments were performed, with each experiment in duplicate. Forty thousand single cell images were enumerated from each patient. The graph shows the mean+SEM of the pooled data. DEFINITIONS The terms "CRISPR system", "Cas system" or "CRISPR / Cas system" refer to a set of molecules comprising an RNA-guided .nuclease or other effector molecule and a gRNA molecule that together are necessary and sufficient to directing and effecting nucleic acid modifications at a target sequence by the RNA-guided nuclease or other effector molecule. In one embodiment, a CRISPR system. comprises a gRNA and a Cas protein, eg, a Cas9 protein. Such systems comprising a Cas9 molecule or a modified Cas9 molecule are referred to herein as "C.as9 systems" or "CRISPR / Cas9 systems". In one example, the gRNA molecule and the Cas molecule can be complexed, to form a ribonucleus protein (RNP) complex. The terms "guide RNA", "guide RNA molecule", "gRNA molecule", or "gRNA" are used interchangeably and refer to a set of nucleic acid molecules that promote the specific targeting of an RNA-guided nuclease or other effector molecule (typically in a complex with the gRN A molecule) to a target sequence. In some embodiments, said targeting is accomplished by hybridization of a portion of the gRNA to DNA (eg, through the gRNA targeting domain), and by binding of a portion of the. gRNA molecule to RNA-guided nuclease or other effector molecule (eg, via at least the gRNA bring). In certain embodiments, a gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as "single guide RNA" or "gRNA sg" and the like. In other embodiments, a gRNA molecule consists of a single contiguous polynucleotide molecule. plurality, generally two, polynucleotide molecules, which are capable of association, asnally through hybridization, referred to herein as "dual guide RNA" or "dgRNA", and the like. gRNA molecules are described in more detail below, but generally include a targeting domain and a bring domain. In certain embodiments, the targeting and bringing domains are arranged in a single ιιή polynucleotide. In other 'embodiments, the addressing domain and the . bring are arranged in separate polynucleotides. The term "targeting domain" as used in connection with a gRNA, is that portion of the gRNA molecule that recognizes, eg, is complementary to, a target sequence, eg, a target sequence, within the nucleic acid of the target sequence. a cell, for example, within a gene. The term ''crRNA'', as used in connection with a gRNA molecule, is a portion of the gRNA molecule that comprises a targeting domain and a region that interacts with a carrier to form a spike region. , of flag. The term "target sequence" refers to a nucleic acid sequence complementary, eg, completely complementary, to a gRNA targeting domain. In certain embodiments, the target sequence is arranged in genomic DNA. In. one embodiment, the target sequence is adjacent to (either on the same strand or on the complementary strand of DNA) a protospacer-adjacent motif (PAM) sequence recognized by a protein having nuclease or other effector activity, for example, a PAM sequence recognized by Cas9. In certain embodiments, the target sequence is a target sequence within a gene or locus that affects the. expression of a -globin gene, for example, affecting the expression of beta globin or fetal hemoglobin (HbF). In certain embodiments, the target sequence is a target sequence within a non-optional HPFH region, eg, it is within a promoter region of HBG1 and / or HBG2. The term "flagpole" as used herein in relation to a gRNA molecule, refers to the portion of the gRNA where the crRNA and the crRNA bind to, or hybridize with, each other. The term "bring" as used herein in relation to a gRNA molecule, refers to the portion of the gRNA that binds to a nuclease or other effector molecule. In certain embodiments, the bring comprises a nucleic acid sequence that specifically binds to Cas9. In certain embodiments, the flag comprises a nucleic acid sequence that forms part of the flagpole. The terms "Cas9" or "Cas9 molecule" refer to an enzyme of the Type II bacterial CRISPR / Cas system responsible for DNA cleavage. Cas9 also includes wild-type protein, as well as functional and non-functional mutants thereof. In certain embodiments, Cas9 is Cas9 from S. pyogenes. The term "complementary", as used in relation to nucleic acid, refers to base pairing, A with T or U, and G with C. The term complementary refers to nucleic acid molecules that are completely complementary, i.e. that is, they form the A to T or U pairs and the G to C pairs throughout the reference sequence, as well as the. molecules that are at least 80%, 85%, 90%, 95%>, 99% complementary. "Template nucleic acid," as used in connection with homology-directed repair or homologous recombination, refers to the nucleic acid that will be inserted into the modification site by the donor sequence of the CRISPR system for repair (insert ) of the gene at the cut site. An "indel", -as used herein, refers to a nucleic acid comprising one or more nucleotide insertions, one or more nucleotide deletions, or a combination of nucleotide insertions and deletions, in. relative to a reference nucleic acid, resulting after being exposed to a composition comprising a gRNA molecule, eg, a. CRISPR system. Indels can be determined by sequencing nucleic acid after exposure to a composition comprising a gRNA molecule, for example, by NGS. With respect to the site of an indel, an indel is said to be "at or near" the site of an indel. a reference site (eg, a site complementary to a targeting domain of an mRNA molecule) if it comprises at least one insertion, or deletion within about 10.9, 8, 7. 6, 5.4, 3 ,2, or 1 nucleotide of the reference site, or overlaps with part or all of said reference site (eg, comprises at least one insertion or deletion overlap with, or within 10, 9, 8, 7, 6, 5.4, 3,.2, or 1 nucleotide of n-site complementary to the targeting-domain of a gRNA molecule, eg, a gRNA molecule described herein). In certain embodiments, the indel is a -large deletion, eg, comprising greater than about 1 kb, greater than about 2 kb, greater than about 3 kb, greater than about 4 kb, greater than about 5 kb, more than about 6 kb or more than about 10 kb of nucleic acid,. In certain embodiments, the 5' end, the 3' end, or both the 5' and 3' ends of the large deletion are disposed at or near a target sequence of a gRNA molecule described herein. In certain embodiments, the large deletion comprises approximately 4.9 kb of DNA disposed between a daily sequence of a gRNA molecule, eg, described herein, disposed within the HBGl promoter region, and a target sequence of a gRNA molecule. .gRNA molecule, for example, described in. the present one, disposed within the promoter region of HBG2-. An "indel pattern" as used herein refers to a set of indels that result upon exposure to a composition comprising a gRNA molecule. In one embodiment, the indel pattern comprises the first three indels, by frequency of occurrence. In one embodiment, the ludel pattern comprises the first five indels, by frequency of occurrence. In one embodiment, the indel pattern comprises those indels that are present at a frequency greater than about 1% relative to all. sequencing reads. In one embodiment, the indel pattern comprises those indels that are present at a frequency greater than about 5% relative to all sequencing reads. In one embodiment, the indel pattern comprises indels that are present at a frequency greater than about 10% relative to the total number of indel sequencing reads (i.e., those reads that are not composed of the sequence unmodified reference nucleic acid). In one embodiment, the indel pattern includes any 3 of the first five most frequent indels observed. The -pattern of indels can be determined, for example, by the methods described in. this document, for example, by sequencing cells from a population of cells that were exposed to the gRNA molecule. An "unwanted indel" as used herein refers to an indel at or near a site other than the target sequence, of the targeting domain of the gRN A molecule. Such sites may comprise, for example, 1 , 2, 3, 4, 5 or more mismatched nucleotides with respect to the gRNA targeting domain sequence. In certain exemplary embodiments, such sites are detected using targeted sequencing of predicted off-target sites in situ, or by an insertion method known in the art. With respect to the gRNAs described herein, examples of off-target indels are indels formed in sequences outside of the HBGI and / or I1BG2 promoter regions. In certain exemplary embodiments, the off-target indel is formed in a gene sequence, eg, within a gene coding sequence. The article "one" and its variants refer to one or more than one (ie at least one) of the grammatical object of the article. As an example, "an element" means an .o-element. more than one item. The term "approximately" when referring to a measurable value, such as quantity, time duration, and the like, is intended to cover variations of ±20%, or in some cases ±10%, or in some cases ±5%, or in some cases ± 1%, or in some cases ± 0.1% of the specified value, to the extent that such variations are appropriate to practice the methods herein. The term "antigen" or "Ag" refers to a molecule that elicits an immune response. This immune response may involve the production of antibodies or the activation of specific immunologically competent cells, or both. It will be understood by one of skill in the art that any chromofel, including virtually all proteins or peptides, can serve as an antigen. Furthermore, the antigens can be derived from recombinant or genomic DNA. One skilled in the art will understand that any DNA, which comprises a nucleotide sequence or partial nucleotide sequence that encodes a protein that elicits an immune response, therefore encodes an "antigen" according to the present. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full-length nucleotide sequence of a gene. It is evident that the present invention includes, among others, the use of partial nucleotide sequences from more than one gene and that these nucleotide sequences are arranged in various combinations to encode the polypeptides that elicit the desired immune response. Furthermore, one skilled in the art will understand that an antigen need not be encoded by a "gene" in. absolute. It is apparent that an antigen may be synthesized or derived from a biological sample, or could be a macromolecule as well as a polypeptide. Such a biological sample may include, but is not limited to, a tissue sample, a cell, or a fluid with other biological components. The term "autologous" refers to any material derived from the same individual into which it will later be reintroduced. The term "allogeneic" refers to any material derived from a different animal of the same species as the individual to which the material is introduced. Two or more individuals are said to be alqogenic to each other when the genes at one or more loci are not identical. In some respects, allogeneic material from individuals of the same species may be genetically different enough to interact antigenically. The term "xenogeneic" refers to a graft derived from an animal of a different species. "Derived from" hereby denotes a relationship between a first and a second molecule. It generally refers to the structural similarity between the first molecule and a second molecule and does not connote or include a process, or source limitation, in a first molecule that is derived from a second molecule. The term "coding" refers to the inherent property of specific nucleotide sequences in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as templates for the synthesis of other polymers and macromolecules in biological processes that have a defined sequence of nucleotides (eg, rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the resulting biological properties thereof. Thus, a gene, cDNA, or RNA encodes a protein if transcription and translation of the mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the. coding strand, whose nucleotide sequence is identical to the mRNA sequence and is usually given in sequence listings, like the non-coding strand, used as a template for transcription of a gene or cDNA, may be referred to as protein coding or .other product of that gene or cDNA. Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or an RNA" may also include byes insofar as the nucleotide sequence encoding the protein in some version may contain one or more intons. The terms "effective amount" or "therapeutically effective amount" are used, interchangeably herein, and refer to an amount of a compound, formulation, material or composition, herein effective to achieve a particular biological result. The term "endogenous" refers to any material of or -produced within an organism, cell, tissue or system. The term "exogenous" refers to any material introduced into or produced outside of an organism, cell, tissue, or system. The term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter. The term "fransfereucia vector" refers to a composition of matter that comprises an isolated nucleic acid and can be used to transfer the isolated nucleic acid into a cell. Numerous vectors are known in the art including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term "transfer vector" includes a plasmid or a. autonomously replicating virus. The term should also be interpreted as further including non-plasmid and non-viral compounds that facilitate the transfer of nucleic acid into cells, such as, for example, a polymer compound, liposome, and the like. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lenti viral vectors, and the like. The term "expression vector" refers to a vector comprising a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. Dn expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, including cosmids, plasmids (eg, naked or contained in liposomes) and viruses (eg, lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating the recombinant polynucleotide. The term "homologous" or "identity" refers to the subunit sequence identity between two polymeric molecules, for example, between two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or between two molecules of polypeptides, When a subunit position in the two molecules is occupied by the same monomeric subunit; for example, if a position in each of the two DNA molecules is occupied by adenine, then they are homologous or identical at that position. The homology between two sequences is a direct function of the number of coincident or homologous positions; for example, if half (eg, five positions in a ten-subunit-long polymer) of the positions in two sequences are homologous, the two sequences are 50% homologous; if 90% of the positions (eg 9 out of 10) are coincident or homologous, the two sequences are 90% homologous. The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated", but the same nucleic acid or peptide partially or completely separated from existing materials in its natural state is "isolated". An isolated nucleic acid or protein may exist in. substantially purified form^ or may exist in a. non-native environment such as, for example, a host cell. The term "operably linked" or "transcriptional control" refers to the functional link between a regulatory sequence and a heterologous nucleic acid sequence that results in expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed into a functional relationship with the second •nucleic acid sequence-. For example, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences may be contiguous with each other and, for example, where it is necessary to join two protein coding regions, they are in the same reading frame. The term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (s.c.), intravenous (i.v.), intramuscular (i.m.) or intrastemal, intratümóra injection techniques. or infusion. The term "-nucleic acid" or "polynucleotide" refers to deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) and their polymers. single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids that contain known analogs of natural nucleotides that have binding properties similar to those of the reference nucleic acid and are metabolized in a similar manner to natural nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants (eg, degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the expressly indicated sequence. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed base residues and / or deoxynosinaf Batzer et al., Nucleic Acid Res. 19: 5081 (1.99.1); Ohtsuka et al.,-J. Biol. Chem. 260: 2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994)). The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to a compound composed of amino acid residues covalently linked together by peptide bonds. A protein or peptide must contain at least two amino acids, and is not limited to the maximum number of amino acids that can comprise the sequence of a protein or peptide Polypeptides include any peptide or protein comprising two or more amino acids linked together by peptide bonds, As used herein, the term refers to both chains short chains, which are also commonly referred to in the art as peptides, oligopeptides, and oligomers, for example, and longer chains, which are generally referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example -biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, among others. A polypeptide includes a natural peptide, a recombinant peptide, or a combination thereof. The term "promoter" refers to a DNA sequence recognized by the cell's synthetic machinery, or introduced synthetic machinery, necessary to initiate the specific transcription of a polynucleotide sequence. The term "promoter / regulatory sequence" refers to a nucleic acid sequence that is required for the expression of a gene product operably linked to the promoter-follower sequence. In some cases, this sequence may be the core promoter sequence and in other cases, this sequence may also include an enhancer sequence and other regulatory elements that are required for expression of the gene product. The promoter / regulatory sequence may be, for example, one that expresses the gene product in a tissue-specific manner. The term "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions. of 1st cell. The term "inducible" promoter refers to a nucleotide sequence that, when operatively nested with a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell substantially only when a corresponding inducer is produced. to the promoter is present in the cell. The term "tissue-specific" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoded or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a tissue-type cell coi-responsive to the promoter. In accordance with the present gn-relationship to a messenger RNA (mRNA), a 5' cap (also called a RNA cap, a 7-methylguanosine RNA cap, or an m7G N.RNA cap) is a modified guanine nucleotide that has been added to the "-front" or 5' end of a messenger RNA encanoles shortly after the start of transcription. The 5'-cap consists of a terminal group that is attached to the first transcribed nucleotide. Their presence is critical for recognition by the ri'bosomay and protection against RNases. Capping is coupled to transcription and occurs co-transcriptionally, so that each influences the other. Shortly after the start of transcription, the 5' end of the mRNA being synthesized is bound by a cap synthesis complex associated with RNA polymerase. This enzyme complex catalyzes the chemical reactions that are required for the. formation of the mRNA cap. The synthesis proceeds as a multi-step biochemical reaction. The rest of the cap can be modified to modulate the functionality of the. mRNA such as its-stability or translation efficiency. As used herein, "in. vitro transcribed RNA" refers to RNA, preferably mRNA, that has been synthesized in vitro. Generally, in vitro transcribed RNA is generated from an in vitro transcription vector. The in vitro transcription vector comprises a template that is used to generate the in vitro transcribed RNA. According to the present invention, a "poly(A)" is a series of adenosines linked by polyadenylation to mRNA. In the preferred embodiment of a construct for transient expression, the polyA is between 50 and 5000 (SEQ ID NO: 190), preferably more than 64, even more than 100, and even more than 300 or 400. Poly(A) sequences can be chemically or enzymatically modified to modulate mRNA functionality, such as localization, stability, or translational efficiency. As used herein, "polyadenylation" refers to the eovalent linkage of a polyadenyl moiety, or its modified variant, to a messenger RNA' molecule. In eukaryotic organisms, most messenger RNA (mRNA) molecules are polyadenylated at the 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often several hundred) added to the pro-mRNA by the action of an enzyme, polyadenium polymerase. In higher eukaryotes, the poly(A) tail attaches to transcripts that contain a specific sequence, the polyadenylation signal. The poly(A) tail and the protein attached to it help protect the mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, mRNA export from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after transcription of DNA to RNA, but it can also occur later in the cytoplasm. After transcription is complete, the mRNA strand is cleaved through the action of an .endonuclease complex associated with RNA polymerase. The cleavage site is generally characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA has been cleaved, adenosine residues are added to the free T-terminus. the cleavage site. As used herein, "transient" refers to the expression of an unintegrated transgon over a period of hours, days, or weeks, where the time period of expression is less than the time period for expression of the gene. yes it is, integrated into the genome or contained within a stable plasmid replicon in the host cell. As used herein, the terms "treat", "treatment" and "treating" refer to the reduction or amelioration of the progression, severity and / or duration of a disorder, for example, a hemoglobinopathy or the amelioration of one or more symptoms (preferably* one or more discernible symptoms) of a disorder, eg, a hemoglobinopathy, resulting from the administration of one or more therapies (eg, one or more therapeutic agents such as a gRNA molecule, CRISPR system, or cell modified of the invention). In certain specific embodiments, the terms "treating", "treating" and "treating" refer to the improvement of at least one measurable physical parameter of a hemoglobinopathy disorder, not discernible by the patient. In other embodiments, the terms "treating", "treating", and "treating" refer to inhibiting the progression of a disorder, either physically, for example, by stabilizing a discernible symptom, physiologically by, for example, For example, the stabilization of a physical parameter, or both. In other embodiments, the terms "treating", "treatment" and "treating" refer to the reduction or stabilization of a symptom of a hemoglobinopathy, eg, sickle cell disease or beta thalassemia. The term "signal transduction pathway" refers to the biochemical relationship between a variety of signal transduction molecules that play a role in the transmission of a signal from one portion of a cell to another portion of a cell. The phrase "cell surface receptor" includes molecules and complexes of molecules capable of receiving a signal and transmitting it across the membrane of a cell. The term "subject" is intended to include living organisms in which an immune response can be elicited (eg, mammals, humans). The term, a "substantially purified" cell refers to a cell that is essentially free of other cell types. A substantially purified cell also refers to a cell that has been separated from other cell types with which it is normally associated in its natural state. In some instances, a substantially purified cell population refers to a homogeneous cell population. In other cases, this term simply refers to cells that have been separated from the cells with which they are naturally associated in their natural state. In some aspects, the cells are grown in vitro. In other aspects, the cells are not cultured in vitro. The term "therapeutic" as used herein means a treatment. A therapeutic effect is obtained by reduction, suppression, remission or eradication of a disease state. The term "prophylaxis" as used herein means the prevention or protective treatment of a disease or disease state. The term "transfected" or "transformed" or "transduced" refers to a process by which exogenous nucleic acid and / or protein. are transferred or introduced into the host cell. A "transfected" or "transformed" or "transduced" cell is one that has been transfected, transformed, or transduced with exogenous nucleic acid and / or protein. The cell includes the primary subject cell and its progeny. The term "specifically binds" refers to a molecule that recognizes and binds with a binding partner (eg, a protein or nucleic acid) present on one. sample, but the molecule neither recognizes nor binds substantially to other molecules in the sample. The term "bioequivalent" refers to an amount of an agent other than the reference compound required to produce an effect equivalent to the effect produced by the reference dose or the reference amount of the reference compound. "Refractory" as used herein refers to a disease, for example, a hemogiobinopathy, that is unresponsive to treatment. In certain embodiments, a refractory hemogiobinopathy may be resistant to prior treatment. or at the start of treatment. In other embodiments, refractory hemogiobinopathy may become resistant during a treatment. A refractory hemogiobinopathy is also called resistant hemogiobinopathy. "Relapse" as used herein refers to the return of a disease, (for haemogiobinopathy) or the signs and symptoms of a disease such as haemogiobinopathy after a period of improvement, for example, after previous treatment with a therapy, for example haemogiobinopathy therapy. Ranges: Throughout this specification, various aspects of the invention may be presented in a range format. It should be understood that description in range format is for convenience and brevity only and should not be construed as an inflexible limitation on the scope of the invention. Consequently, the description of a range should be considered to have specifically revealed all possible subranges, as well as the individual numerical values ​​within that range. For example, the description of a range as I to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, :2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, for example , 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range like 95-99% identity includes something with 95%, 96%, 97%, 98%, or 99% identity. % and includes subranges such as 96-99%, -96-9.8%, 96-9-7%, 97-99%, 97-98% and 98-99% identity. This applies regardless of the width of the range. The term "BCL1.1a" refers to lymphoma / B-cell leukemia 11A, a sequence-specific DNA-binding protein from the proximal region of the core promoter of RNA polymerase II, and the gene encoding said protein. , With. all peepers and exons. This gene encodes a C2H2-type zinc finger protein. BCL1IA has been found to play a role! in the suppression of fetal hemoglobin production. BCLlla is also known as CLL / B-Cell Lymphoma llA (Zinc Finger Protein), CTIP1, EVI9, Ecotropic Virus Integration Site Homologous Protein 9, COUP-TF Interacting Protein 1, Zinc Finger Protein 856 , KIAA1809, BCL-1 IA, ZNF-856, EVI-9, and B-Cell CLL / Linfbma 11 A. The term encompasses all isotherms and splice variants of BLC1 la. The human gene encoding BCLlla maps to chromosomal location 2pl 6.1 (by Enserabí). Human and murine nucleic acid and amino acid sequences can be found in a public database, GenBank said. UniProt and SwiSs-Prót,, and the genomic sequence of human BCL1 can be found at. G'enBank in NC ,000002.12. The BCL1 la gene refers to this genomic location, including all introns and exons. There are multiple known isotypes of BCL1 la. The mRNA sequence encoding human BCL1 la isoform 1 can be found in NM_022893. The peptide sequence of human BCL1 isoform 1 is: 10 20 30 4050 MSRRKQGKPQ HLSKREFSPE PLEAILTDDE PDHGPLGAPE GDHDLLTCGQ 60 7 0 8 0 .90100 CQMNPPLGDI LIFIEHKRKQ CNGSLCLERA VDKPPSPSPT EMKKASNPVE 110 120 130 140150 VGIQVTPEDD DCLSTSSRGI CPKQEHIADK Ll.HWRGLSSP RSAHGALIPT 160 170 180 190200 PGMSAEYAPQ GICKDEPSSY TCTTCKQPFT SAWFLLQHAQ NTHGLRIYLE 210 220 230 240250 S-EHSPLTPR VG1PSGLGAE CPSQPPLHG1 HIADWPFNL LRIPGSVSRE 260 270 280 290300 ASGLAEGRFP PTPPLFSPPP RHHLDPHRIE RLGAEEMALA THHPSAFDRV 310 320 330 340350 LRLNPMAMEP PAMDFSRRLR ELAGNTSSPP LSPGR.PSPMQ RLLQPFQPGS 360 370 380 390400 KPPFLATPPPL PPLQSAPPPS QPPVKSKSCE FCGKTFKFQS NLWHRRSHT 410 420 430 440450 GEKPYKCNLC DHACTQASKL KR.HMKTHMHK. SSPMTVKSDD GLSTASSPEP 460 4.70 480 4 9050 0 GTSDLVGSAS SALKSWAKF KSENPPNLIP ENGDEEEEED DEEEEEEEEE 510 520 530 540550 EEEELTESER VDYGFGLSLS AARHHENSSR GAWGVGDES RALPDVMQGM 560 570 580 590600 VtSSMQHFSE .AFHQVLGEKH: KRGHLAEAEG HRDTCDESV AGESDRIDDG 610 620 630 640650 TVNGRGCSPG ESASGGLSKK LLLLGSPSSLS PFSKRIKLEK EFDLPPAAMP 660 670 680 690700 NTENVYSQWL AGYAASRQLK DPFLSFGÚSR QSPFASSSEH SSENGSLRFS 710 720 730 740750 TPPGELDGGI SGRSGTGSGG STPHISGPGP GRPSSKEGRR SDTCEYCGKV 760 770 780 790800 FKNCSNLTVH RRSHTGERPY KCELCNYACA QSSKLTRHMK T.HGQVGKDVY 810 82 0 83 0 KCEICKMPFS VYSTLEKHMK KWHSDRVLNN DIKTE Seq ID No.: 245 (Identifier Q9HI65-1; and NM J322893.3: and accession ADL14508.1). The sequences of other isoforms of the BCLlla protein are provided in: Iscform2: Q9H165-2 isoform 3; Q9H165-3 Isoform 4: Q9H165-4 Isoform 5: Q9H165-5 Isoform 6: Q9H165 -6 According to the present, a human BCL1 protein also encompasses proteins that are at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%,.84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99%, or 100% sequence identity to the BCL11 a 1-6 isoform, wherein such proteins still have at least one of the functions of BCL 11a. The term "globin locus" as used herein refers to the region of human chromosome 11 that comprises genes for embryonic genes (ε). fetal (G (γ) and A (γ)), ​​adult globin genes (γ and β), locus-control regions, and sites of hypersensitivity to DNase I. The term "complementary", as used in relation to nucleic acid, refers to base pairing, A with T or 11, and G with C. The term complementary refers to nucleic acid molecules that are completely complementary, i.e. that is, they form A to T or U pairs and G to C pairs throughout the reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary. The term "nondeletional HPFH" refers to a mutation that does not comprise an insertion or deletion of one or more nucleotides, resulting in. 1st hereditary persistence of fetal hemoglobin, and is characterized by an increase in: fetal hemoglobin in adult red blood cells. In certain exemplary embodiments, nondeletional HPFH is a mutation described in Nathan and Oski's Hematology and Oncology of Infancy and Childhood, 8th Ed., 2015. Orkin SH, Fisher DE, Look T, Lux SE, Ginsburg D, Nathan DG, Eda., Elsevier Saunders, the entire contents of which are incorporated herein by reference, eg, the non-optional HPFH mutations described in Table 21-5. The term "non-deletional HPFH region" refers to a genomic site that comprises or is close to a non-deletional HPFH. In certain exemplary embodiments, the non-deletional region of HPFH is the nucleic acid sequence of the promoter region HBGl (Chrl 1: 5,249,833 to Chrl 1: 5,250,237, hg38; - chain), the nucleic acid sequence of the region HBG2 promoter (Chrl 1:5,254,738 to Chrl 1:5,255,164, hg38:-chain), or combinations thereof. In certain exemplary embodiments, the nondeletional HPFH region includes one or more of the nondeletional HPFHs described in Nathan and Oski's Hematology and Oncology of Infancy and Childhood, 8th Ed. 201S, Orkin SH, Fisher DE, Look T, Lux SE, Ginsburg D, Nathan DG, Eds, Elsevier Saunders (eg, according to Table 21-5). In certain exemplary embodiments, the HPFH region is non-deletional. .¡a nucleic acid sequence in chrl 1: 5,250,09'4-5,250,237. - chain, hg.38; or the nucleic acid sequence in chrll: 5,2.55,022-5,255,164, - chain, hg38; o The nucleic acid sequence in chrl 1: 5,249,833-5,249,927, - chain, hg38; or the nucleic acid sequence in chrll; 5,254,738-5,254,85.1, - chain, hg38; or the nucleic acid sequence in chrll: 5,250,139-5,250,237, - chain, bg38; or combinations thereof. ''Boosted? "BCL1 la" herein refers to the nucleic acid sequence that affects, eg, potency, expression, or function of BCL1 la. See, eg, Bsuer et al., Setene®, yol. 342, 2013, pp. 253-257- The enhancer of BCL1a may be, for example, operative only in certain cell types, for example, cells of the erythroid lineage An example of an enhancer of BCL1a is the nucleic acid sequence between the .exon 2 and exon 3 of the BCL1 ia gene (for example, the nucleic acid at positions +55: Chr2: 60497676-6049894.1; +58: Chr2; 60494251-60495546; +62: Chr.2: 60490409-60491734 as reported in hg38.) In one embodiment, the BCL1 enhancer is the +62 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL1a gene. In one embodiment, the BCL1 enhancer la is the +58 region of the nucleic acid sequence between exon 2 and exon 3 of the BCL1a gene.In one embodiment, the enhancer of B CL1la is the +55 region of the nucleic acid sequence between exon 2 and exon 3 of the BCLlla gene. The terms "hematopoietic stem and progenitor cells" or "HSPC" are used interchangeably, and refer to a population of cells comprising both hematopoietic stem cells ("HSC") and hematopoietic progenitor cells ("HPC"). Such cells are characterized, for example, as CD34+. In certain exemplary embodiments, HSPCs are isolated from bone marrow. In. In other exemplary embodiments, HSPCs are isolated from peripheral blood. In other exemplary embodiments, HSPCs are isolated from umbilical cord blood. In one embodiment, HSPCs are characterized as CD34+ / CD38VCD90+ / CD45RA-. In certain embodiments, HSPCs are characterized as CD34+ / CD90+ / CD49f+ cells. In certain embodiments, the HSPCs are characterized as CD34+ cells. In certain embodiments, HSPCs are characterized as CD34+ / CD90+ cells. In certain embodiments, HSPCs are characterized as CD34+ / CD90+ / CD45RA- cells. "Stem cell expander" as used herein refers to a compound that causes cells, eg, HSPC, HSC and / or HPC to proliferate, eg increase in number, at a faster rate relative to, with the same cell types in the absence of said agent. In one exemplary aspect, the stem cell expander is an inhibitor of the aryl hydrocarbon receptor pathway. Additional examples of stem cell expanders are provided below. In certain embodiments, proliferation, eg, increase in number, is achieved ex vivo. The term "graft" refers to the incorporation of a cell or tissue, eg, a population of HSPCs, into the body of a recipient, eg, a mammalian or human subject. In one example, grafting includes - the growth, expansion and / or differentiation of the grafted cells in the recipient. In one example, engraftment of HSPCs includes the differentiation and growth of said HSPCs into erythroid cells within the body of the recipient. The term "hematopoietic progenitor cells" (HPC), as used herein, refers to primitive hematopoietic cells that have a limited capacity for self-availation and the potential for multilineage differentiation (eg, myeloid, lymphoid), mono differentiation lineage (eg, myeloid or lymphoid) or restricted differentiation of cell type (eg, erythroid progenitor) depending on location within the hematopoietic hierarchy (Doulatov et al., CelLStem Cell 2012). "Hematopoietic stem cells" (HSC), as used herein, refer to immature blood cells having ai. ability to self-renew and differentiate into more mature blood cells comprising granulocytes (eg, promthelocytes, neutrophils, eosinophils, basophiles), erythrocytes (eg, reticulocytes, erythrocytes), thrombocytes (eg, megakaryoblasts, platelet-producing megakaryocytos, platelets) and monocytes (eg, monocytes, macrophages). HSCs are variously described as stem cells throughout the specification. It is known in the art that such cells may or may not include CD34+ cells. CD34+ cells are immature cells that express the cell-surface marker CD34. CD34+ cells are believed to include a subpopulation of cells with the stem cell properties defined above. It is well known in the art that HSCs are multipotent cells that can give rise to primitive progenitor cells (eg, multipotent progenitors) and / or progenitors committed to specific hematopoietic lineages (eg, lymphoid progenitors). Stem cells committed to specific hematopoietic lineages may be of the T cell lineage, B cell lineage, dendritic cell lineage, Langerhans cell lineage, and / or lymphoid tissue-specific macrophage cell lineage. In addition, HSCs are also referred to as long-term HSCs (LT-HSCs) and short-term HSCs (ST-HSCs). ST-HSCs are more active and more proliferative than LT-HSCs. However, LT-HSCs have unlimited self-renewal (i.e., they survive, throughout adulthood), while ST-HSCs have limited self-renewal (i.e., they survive only for a limited period of time). Any of these HSCs can be used in any of the methods described herein. Optionally, ST-HSCs are useful because they are highly proliferative and thus rapidly increase the number of HSCs and their progeny. Hematopoietic stem cells are optionally obtained from blood products. A blood product includes a product obtained from the body or an organ thereof. body containing cells of hematopoietic origin. Such sources include unfractionated bone marrow, umbilical cord, peripheral blood (eg, mobilized peripheral blood, eg, mobilized with a mobilizing agent such as G-CSE or Plerixafor®-(AMD3100), or a combination of G-CSF and Plerixafor® (AMD31O0)), liver, thymus, lymph and spleen. All of the crude or unfractionated blood products mentioned above can be enriched for cells having characteristics of hematopoietic stem cells in ways known to those of skill in the art. In one embodiment, HSCs are characterized as CD34HCD38- / CD90+ / CD45RA-. In certain embodiments, HSCs are characterized as CD34+ / CD90+ / CD49f+ cells. In certain embodiments, HSCs are characterized: as CD34+ cells. In certain embodiments, Jas HSCs are characterized as CD34+ / C.D90+ cells. In certain embodiments, HSCs are characterized as CD34+ / CD90+ / CD45RA- cells. "Expansion" or "Expand1' in the context of cells refers to an increase in the number of a characteristic cell type, or cell types, from an initial population of cells, which may or may not be identical. The initial cells used for the expansion may not be the same as the cells generated from the expansion."Cell population" refers to mammalian, preferably human, sukary cells isolated from biological sources, eg, blood or tissue products and derived from more than one cell "Enriched" when used in the context of cell population refers to a population of cells selected based on the presence, of one or more markers, eg, C.D34+. The term "CD34+ cells" refers to cells that express the CD34 marker on their surface. CD34+ cells can be detected and counted using, for example, flow cytometry and fluorescently labeled anti-CD34 antibodies. "Enriched for CD34+ cells" means that a population of cells has been selected based on the presence of the CD34 marker. Consequently, the percentage of CD34+ cells in the cell population after the selection method is greater than the percentage of CD34+ cells in the initial cell population before selecting the passage based on CD34 markers. For example, CD34+ cells may represent at least 50%, 60%, 70%, 80%, or at least 90% of the cells in a population of cells enriched for CD34+ cells. The terms "F cell" and "F-cell" refer to cells, usually erythrocytes (eg, red blood cells) that contain and / or produce (eg, express) fetal hemoglobin. For example, an F cell is a cell that contains or produces abnormal levels of fetal hemoglobin. For example, an F cell is a cell that contains or produces at least 5 picograms of fetal hemoglobin. In another example, an F cell is a cell that contains or produces at least 6 picograms of fetal hemoglobin. In another example, an F cell is a cell that contains or produces at least 7 picograms of fetal hemoglobin. In another example, an F cell is a cell that contains or produces at least 8-picograms of fetal hemoglobin. In another example, an F cell is a cell that contains or produces at least 9 picograms of fetal hemoglobin. In another example, an F cell is a cell that contains or produces at least 10 picograms of fetal hemoglobin. Fetal hemoglobin levels can be measured using an assay described in. the. present or by another method known in the art, eg, flow cytometry using an anti-fetal hemoglobin detection reagent, high performance liquid chromatography, mass spectrometry, or enzyme-linked immunosorbent assay. Unless otherwise indicated, all genome or chromosome coordinates agree with hg38. DETAILED DESCRIPTION 'The gRNA molecules, compositions and methods described herein relate to genome editing in eukaryotic cells using the CRISPR / Cas9 system. In particular, the gRNA molecules, compositions, and methods described herein relate to the regulation of globin levels and are useful, for example, in the regulation of globin gene and protein expression and production. The gRNA molecules, compositions, and methods may be useful in the treatment of hemoglobinopathies. I. gRNA Molecules A gRNA molecule however, can have several domains, as described in more detail below, a gRNA molecule typically comprises at least one crRNA domain (comprising a targeting domain) and a bring. The gRNA molecules of the invention, used as a component of a CRISPR system, are useful for modifying (eg, modifying the sequence) DNA at or near a target site. Such modifications include deletions and / or insertions that result in, for example, reduced or deleted expression of a. functional product of the gene that comprises the target site. These uses and additional uses are described in greater detail below. In one embodiment, a unimolecular RNA, or sgRNA, preferably comprises, from 5' to 3': a crRNA (containing a targeting domain complementary to a target sequence and a region that forms part of a flagpole (ie. i.e., a crRNA flagpole region)); A loop; and a bring (containing a domain complementary to the crRNA flagstaff region, and a domain that additionally binds a nuclease or other effector molecule, eg, a Cas molecule, eg, a Cas.9 molecule), and can take the following format (from 5' to 3'): [addressing domain] - [crRNA flagpole region] - [optional first flagpole extension] - [loop] - [optional first fetch extension ] - [bring flagpole region] - [bring nuclease binding domain). In certain embodiments, the nuclease binding domain of traverse binds to a Cas protein, eg, a Cas9 protein. In one embodiment, abmolecular, or dgRNA comprises two polynucleotides; and the first, preferably from 5' to 3': a crRNA (containing a targeting domain complementary to a target sequence and dye, a region that forms part of a flagpole; and the second, preferably from 5' to 3': a bring (containing a domain complementary to the flagpole region of crRNA, and a domain that additionally binds a nuclease or other effector molecule, eg, a Cas molecule, eg, Casó molecule), and may adopt the following format (from 5' to 3'): Polynucleotide 1 .(crRNA): [targeting domain] - [crRNA flagpole region] - [optional first flagpole extension] - [optional second flagpole extension] Polynucleotide 2 (bring): [bring optional first extension] - [bring flagpole region] - [bring nuclease binding domain] In certain forms of. embodiment, the anion domain a. Tran nuclease binds to a Cas protein, for example, a Cas9 protein. In some aspects, the routing domain comprises or is composed of a routing domain sequence described in. hereby, for example, an addressing domain described in Table 1, or a. targeting domain comprising or composed of 17, 18, 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1. In some aspects, the flagstaff, eg, the crRNA flagstaff region, comprises, 5' to 3 GUÜÜÜAGAGCUA (SEQ ID NO: 182). In some aspects, the flagstaff, eg, the crRNA flagstaff region, comprises, 5' to 3 GUUÜAAGÁGCUA (SEQ ID NO: 183). In some aspects the loop comprises, from 5' to 3': G.AAA (SEQ ID NO: 186). In some aspects the bring comprises, from 5' to 3': ÜAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAÁAGUGGCACCGAGUCGGUGC (SEQ ID NO: 187) and is preferably used in a gRN.A molecule comprising SEQ ID NO: 182. In some aspects the bring comprises, from 5' to 3': ÜAGCAAGUUUAAAGAAGGCUAGÜCCGÚÜAÚCAACEUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID No.: .188) and is preferably used in a gRNA molecule comprising SEQ ID No. 183. In some aspects, the gRN A may further comprise, at the 3' end, additional nucleic acids U. For example the gRNA may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional U nucleic acids (SEQ ID NO: 249) at the 3' end. In one embodiment, the gRNA comprises 4 additional U nucleic acids at the 3' end. In the case of dgRNA, one or more of the dgRNA polynucleotides (eg, the polynucleotide comprising the targeting domain and the polynucleotide comprising the traverse) may comprise, at the 3\U end, additional nucleic acids. For example, in the case of dgRNA, one or more of the dgRNA polynucleotides (eg, the polynucleotide comprising the targeting domain and the polynucleotide comprising the bring) may comprise 1, 2, 3, 4, 5 , 6, 7, 8, 9, or 10 additional U nucleic acids (SEQ ID NO: 249) at the 3' end In one embodiment, in the case of dgRNA, one or more of the dgRNA polynucleotides ( for example, the polynucleotide-comprising the targeting domain and the polynucleotide-comprising the bring) comprises an additional 4 U nucleic acids at the 3' end. In one embodiment of a dgRNA, only the polynucleotide comprising the bring-in comprises the additional U nucleic acid(s), eg, 4 U nucleic acids. In one embodiment of a dgRNA, only the polynucleotide comprising the domain targeting comprises the additional nucleic acid(s) U. In one embodiment of a dgRNA, both the polynucleotide comprising the targeting domain and the polynucleotide comprising the traverse comprise additional U nucleic acids, for example, 4 U nucleic acids. In some aspects, the gRNA may further comprise, at the 3'-end, additional A nucleic acids. For example, gRNA may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional A nucleic acids (Id, Seq. No.: 250) at the 37-end. of embodiment, the gRNA comprises 4 additional nucleic acids A at the 3' end. In the case of dgRNA, one or more of the dgRNA polynucleotides (eg, the polynucleotide comprising the targeting domain and the polynucleotide comprising the traverse) may comprise, at the end, 3 additional A nucleic acids. For example, in the case of dgRNA, one or more of the dgRNA polynucleotides (eg, the polynucleotide comprising the targeting domain and the polynucleotide comprising the bring) may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional A nucleic acids (SEQ ID NO: 250) at the 3' end. In one embodiment, in the case of dgRNA, one or more of the dgRNA polynucleotides (eg, the polynucleotide comprising the targeting domain and the polynucleotide-comprising the traverse) comprises 4 additional A nucleic acids at the end 3'. In one embodiment of a dgRNA, only the polynucleotide comprising the bring comprises the additional A nucleic acid(s), for example, 4 A nucleic acids. In one embodiment of a dgRNA, only the polynucleotide comprising the domain of targeting comprises the additional nucleic acid(s) A. In one embodiment of a dgRNA, both the polynucleotide comprising the targeting domain and the polynucleotide comprising the traverse comprise additional IJ nucleic acids, for example, 4 A nucleic acids. In certain embodiments, one or more of the polynucleotides of the gRNA molecule may comprise a 5'-end cap. In one embodiment, a unimolecular RNA, or sgRNA, preferably comprising 5' to 3': a crRNA (containing a targeting domain complementary to a target sequence; a crRNA flagpole region; the first flagpole extension a flagpole; a loop; a first pull extension (containing a domain complementary to at least a portion of the first flagpole extension); and a bring (containing a domain complementary to the flagpole region of crRNA, and a domain that additionally binds to a Cas9 molecule.) In some aspects, the targeting domain comprises a targeting domain sequence described herein, for example, a targeting domain described in Table 1, or a targeting domain. domain comprising or composed of 17, 18, 1.9, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table 1, for example the 3' 17. jg> 19, or 20 (preferably 20) consecutive nucleotides of a targeting domain sequence described in Table i. In aspects comprising the first flagpole extension and / or a first fetch extension, the flagpole, loop, and fetch sequences may be as described. In general, it is possible to use the first flagpole extension and the first bring extension, as long as they are complementary. In certain embodiments, the first flagpole extension and the first bring extension are composed of 3, 4, 5, 6, 7, 8, 9, 10 or more complementary nucleotides. In some aspects, the first flagpole extension comprises, from 5' to 3': UGCUG (Seo Id. No. : 184). In. In some respects, the first flagpole extension is made up of Sec. Id. No.: 184. In some respects, the first extension to bring comprises, from 5* to 3' ' CACrCA (Seq. Id. No.: 189). In some respects, the first extension to be brought in consists of Seq ID No.: 189. In. In one embodiment, a dgRNA comprises two nucleic acid molecules. In some aspects, the dgRNA comprises a first nucleic acid containing, preferably from 5' to 3': an a-complementary targeting domain. a target sequence; a flagstaff region of crRNA; optionally to the first flagpole extension; and, optionally, a second flagpole extension, and a second nucleic acid (which may be referred to herein as bring), and comprises at least one domain that binds a Cas molecule, eg, a Cas9 molecule) comprising-preferably from 5' to 3': optionally a -first extension bring; and a bring (containing a domain complementary to the crRNA flagstaff region, and a domain that additionally binds a Cas molecule, eg, Cas9). The second nucleic acid may additionally comprise, at the 3' end (eg, 3' on bringing) further U nucleic acids. For example, the bring may comprise 1,2, 3, 4, 5,6, 7, 8, 9, or .10 additional U nucleic acids (SEQ ID NO: 249) at the 37-end (eg, 3' al. bring). The second nucleic acid may additionally or alternatively comprise, at the 3' end (eg, 3' by bringing) additional A nucleic acids. For example, the bring can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additional A nucleic acids (Seq. ID No.: 250) at the 3' end (eg, 3' when bringing). In some aspects, the targeting domain comprises a targeting domain sequence described herein, for example, a targeting domain described in Table 1, or a targeting domain comprising or composed of 17, 18, 19, -or 20 (preferably 20) consecutive nucleotides of a domain-targeting sequence described in Table 1. In aspects comprising a dgRNA, the crRNA flagpole region, optional first flagpole extension, optional first bring extension, and bring sequences may be as described. In some aspects, the optional second flagpole extension comprises, from 5' to 3': UUUUG (SEQ ID NO: 185). In certain embodiments, the 1, 2, ?>, 4, or 5 nucleotides 3', the I, 2,3,4, or 5 nucleotides 5', or the 1,2, 3,4, or 5 nucleotides 3' and 5' of the gRNA molecule (and in the case of a dgRNA molecule, the polynucleotide comprising the targeting domain and / or the polynucleotide comprising the traverse) are modified nucleic acids, as described in an more fully in section .XIII, below. The domains are briefly discussed below: 1) Addressing Domain: Guidance on Selecting Address Domains can be found, for example, in Fu Yei al. NAT 8IOTECHNOL 2014 (doi: 10.1038 / nbt.2808) and Sternberg SH el al. NATURE 2014 (doi: 10.1038 / natUrel3011). The targeting domain - comprises a nucleotide sequence - that is complementary, eg, at least 80,85,90,95, or 99% complementary, eg, fully complementary, to the. target sequence in the target nucleic acid. The targeting domain is part of an RNA molecule and will therefore comprise the base uracil (U), while the DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, it is believed that the complementarity of the targeting domain with the target sequence contributes to the specificity of the interaction of the gRNA molecule / Cas9 molecule complex with a target nucleic acid. It is understood that in a targeting domain and target sequence pair, the uracil bases in the targeting domain will pair with the adenine bases in the target sequence. In one embodiment, the addressing domain is from 5 to 50, eg 10 to 40, eg 10 to 30, eg 15 to 30, eg 15 a. 25 nucleotides long. In one embodiment, the targeting domain is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length. In one embodiment, the targeting domain is 16 nucleotides long. In one embodiment, the targeting domain is 17 nucleotides long. In one embodiment, the targeting domain is 18 nucleotides long. In one embodiment, the targeting domain is 19 nucleotides long. In one embodiment, the targeting domain is 20 nucleotides in length. In certain embodiments, the 16, 17, 18, 19, or 20 nucleotides mentioned comprise the 16, 17, 18, 19, or 20 nucleotides 5' of a targeting domain described in Table 1. In certain embodiments embodiment, the named 16, 17, 18, 19, or 20 nucleotides comprise the 1, 6, 17, 18, 19, or 20 nucleotides 3' of a targeting domain described in Table 1. Without wishing to be bound by theory, it is believed that the 8, 9, 10, 11 or 12 nucleic acids of the targeting domain arranged at the 3' end of the targeting domain are important for target sequence targeting and thus , may be called the "core" region of the addressing domain. In one embodiment, the core domain is fully complementary to the target sequence. The strand of the target nucleic acid to which the targeting domain is complementary is referred to herein as the target sequence. In some aspects, the target sequence is arranged on a chromosome, for example, it is targeted within a gene. In some aspects, the target sequence is arranged within an exon of a gene. In some aspects the target sequence is disposed within an intron of a gene. In some aspects, the target sequence comprises, or is proximal (eg, within 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, or 1000 nucleic acids) to a binding site of a target sequence. regulatory element, eg, a promoter or transcription factor binding site, of a gene of interest. Some or all of the nucleotides in the domain may have a modification, eg, the modification found in Section ΧΙΠ herein. 2) .crRNA Flagpole Region: The flagpole contains portions of the crRNA and fetch. The crRNA flagstaff region is complementary to a portion of the traverse, and in one embodiment, has sufficient complementarity with a portion of the traverse to form a duplex region under per io .minus some physiological conditions, e.g., physiological conditions normal. In one embodiment, the crRNA flagstaff region is 5 to 30 nucleotides in length. In one embodiment, the crRNA flag region is 5 to 25 nucleotides in length. The crRNA flagstaff region may share homology with, or be derived from, a natural portion of the. sequence of repetitions of mine. bacterial CRISPR matrix. In one embodiment, it has at least 58% homology to a crRNA flagpole region disclosed herein,--eg, a crRNA flagpole region of S. pyogenes, or S. thermophilus. In one embodiment, the flagpole, eg, crRNA flagpole region, comprises SEQ ID NO: 182. In one embodiment, the flagpole, eg, la. crRNA flagstaff region, comprises a sequence that has at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, or 99% homology to that of Sec. No.: 182. In one embodiment, the flagstaff, eg, the crRNA flagstaff region, comprises at least 5, 6, 7, 8, 9, 10, or 11 nucleotides of the ID. Seq. No.: 182. In one embodiment, the flagstaff, eg, the crRNA flagstaff region, comprises Seq. ID No.: 183. In one embodiment, the flagstaff of flag comprises a sequence that has at least 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% homology with that of Sec. No.: 183. In a way of embodiment, the flagpole, eg, the crRNA flagpole region, comprises at least 5, 6, 7, 8, 9, 10, or 11 nucleotides of the id. of Sec. No.: 183. Some or all of the nucleotides in the domain may have a modification, eg, the modification described in Section XIII herein. 3) First Flagpole Extension When using a bring comprising a first bring extension, the crRNA may comprise the first flagpole extension. In general, the first flagpole extension or the first bring extension may be used, to the extent that they are complementary. In certain embodiments, the first flagpole extension and the first bring extension are composed of 3, 4, 5, 6, 7, 8, 9, 10 or more complementary nucleotides. The first flagpole extension may comprise nucleotides that are complementary, eg, 80%, 85%, 90%, 9S%, or 99%, eg, fully complementary, with the nucleotides of the first extension bringing. In some aspects, the nucleotides of the first flagpole extension that hybridize with. the complementary nucleotides of the first extension bring are contiguous. In some aspects, the nucleotides of the first flagpole extension that hybridize with the complementary nucleotides of the first bring extension are discontinuous, for example, they comprise two or more hybridization regions separated by the nucleotides that do not pair with the nucleotides. nucleotides of the first extension bring. In some aspects, the first, flagpole extension comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, I I, 12, 13, 14, 15, 16, 17. 18 , 19,20 or more nucleotides. In some aspects, the first flagpole extension comprises, from 5' to 3': UGCUG (Seq. ID No.: 184). In some respects, the first flagpole extension is made up of Sec. Id. No.: 1-84. In some aspects the first flagpole extension comprises nucleic acid having at least 80%, 85%, 90%, 95% or 99% homology to SEQ ID NO: 184. Some or all of the nucleotides in the first extension may have a modification, for example, a modification found in Section XIII hereof. 3) Loop A loop serves to join the flagstaff region of crRNA. (ts optionally- the first flagpole extension, if present) with the bring (or optionally the first bring extension, if present) of an sgRNA, The loop can bind the flagpole region of crRNA and bring covalently or non-covalently. In one embodiment, the bond is covalently. In one embodiment, the loop covalently couples the flagpole region of crRNA and bring. In one embodiment, the loop covalently couples the first flagpole extension and the first fetch extension. In one embodiment, the loop is, or comprises, a covalent bond interposed between the flagpole region of crRNA A and the tra domain that hybridizes with the flagpole region of crRNA. Typically, the loop comprises one or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In dgRNA molecules, the two molecules can associate by virtue of hybridization between at least a portion of the crRNA (for example, the crRNA flagpole region) and at least a portion of the bring (for example, the crRNA domain). of the bring that is complementary to the crRNA flagstaff region). A wide variety of loops are suitable for use in sgRNAs. Loops may be composed of a covalent bond, or as short as one or a few nucleotides, eg, 1, 2, 3, 4, or 5 nucleotides in length. In one embodiment, a loop is 2, 3,4,5, 6, 7, 8,9,10, 15,20, or 25 or more nucleotides in length. In one embodiment, a loop is 2 to 50, 2 to 40, 2 to 30, 2 to 20, 2 to 10, or 2 to 5 nucleotides in length. In one embodiment, a loop shares homology -with, or is derived from., a natural sequence. In one embodiment, the loop has at least 50% homology to a. loop disclosed herein. In one embodiment, the loop comprises SEQ ID NO: 18-6. Some or all of the nucleotides in the domain may have a modification, eg, the modification described in Section XIII herein. 4) Second Flagpole Extension. In one embodiment, a dgRNA may comprise an additional sequence, 3' to the crRNA flagpole region or, if present, the first flagpole extension, referred to herein as the second flagpole extension. In. In one embodiment, the second flagpole extension is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, or 2-4 nucleotides in length. In. In one embodiment, the second flagpole extension is 2, 3, 4, 5, 6, Ί, 8, 9, or .10 or more nucleotides in length. In one embodiment, the second flagpole extension comprises the. Sec. ID No.: 185. 5) Bring: Trar is the nucleic acid sequence required for nuclease binding, eg, Cas9. Without wishing to be bound by theory, it is believed that each Cas9 species is associated with a particular bring sequence. .TRAN sequences are used in both sgR-NA and dgRNA systems. In one embodiment, the bring comprises a sequence of, or derived from, an £pyogenes bring. In some aspects, the bring has a portion that hybridizes with the flagpole portion of the crRNA, eg, it has sufficient complementarity with the 1st flagpole region of the crRNA to form one. duplex region under at least some physiological conditions (in some instances, referred to herein as the fetch-flagpole region or fetch domain complementary to the crRNA flagpole region), In certain embodiments, the duplex domain bring that hybridizes with the crRNA flagpole region comprises at least 5, 6, 7, 8, 9, 10, II, 12, 13, 14, .15,16,17,18, 19, or 20 nucleotides that hybridize with the complementary nucleotides of the flagpole region of crRNA. In some respects, nucleotides bring about hybridizing with nucleotides. complementary to the crRNA flagstaff region are contiguous. In some respects, the tra nucleotides that hybridize to the complementary nucleotides of the crRNA flagstaff region are discontinuous, for example, they comprise two or more hybridization regions separated by the nucleotides that do not pair with the nucleotides of the crRNA region. de-crRNA flagpole. In some aspects, the portion of the crRNA that hybridizes with the flagstaff region comprises 5! to 3': UAGCAAGÜUAAAA (Id. of.S.ec. No.: 191). In some aspects, the portion of the tram that hybridizes with the crRNA flagstaff region comprises, from 5' to 3': UAGCAAGUL'IJAAA (SEQ ID NO: 192). In certain embodiments, the sequence that hybridizes to the crRNA flagstaff region is disposed in the 5'-trapper to the trait sequence that further binds a nuclease, eg, a Cas molecule, eg, a Cas9 molecule. The bring further comprises a domain that further binds a nuclease, eg, a. Cas molecule, for example, a Cas9 molecule. Without wishing to be bound by theory, it is believed that Cas.9 from different species bind to different bringing sequences. In some aspects, the bring comprises a sequence that binds to a S. pyogenes Cas9 molecule. In some aspects, the bring comprises a sequence that binds to a Ca.s9 molecule disclosed herein. In some aspects, the domain that further binds a Cas9 molecule comprises, from 5' to 3': UAÁGGCUAGUCCGUUAUCAACUEGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 193). In some aspects the domain that further binds to a Cas9 molecule comprises, from 5" to 3': UAAGGCÜAGUCCGUGAUCAACUGGAAAAAGUGGCACCGAGUCGGUGCLJUUU (Seq. ID No.: 194). In some embodiments, the fetch comprises Seq ID No.: 187. In some embodiments, the fetch comprises Seq ID No.: 188. Some or all of the nucleotides in the list may, for example, have a modification found in Section Χ1Π of the. Present. In certain embodiments, the gRNA (eg, the sgRNA or the trand and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprise an inverted basic residue at the S\ terminus. 3' end or both 5' and 3' ends of the gRNA. In certain embodiments, the gRNA (eg, the sgRNA or the trand and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprise one or more phosphorothioate linkages between residues in the 5' end of the polynucleotide, for example, a phosphorothioate bond between the first two 5' residues, between each of the first three 5' residues, between each of the first four 5' residues, or between each of the first five 5' residues. In certain embodiments, the gRNA-or gRNA component may alternatively or additionally comprise one or more phosphorothioate linkages between residues at the 3' end of the polynucleotide, for example, a phosphorothioate linkage between the first two 3'-residues, between each of the first three 3'-residues, between each of the first four 3'-residues, or between each of the first five 3'-residues. In one embodiment, the gRNA (eg, the sgRNA or the trand and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprises a phosphorothioate bond between each of the first four 5' residues (eg, comprises, eg, is composed of, three phosphorothioate linkages at the 5'(s) end), and one phosphorothioate linkage between each of the first four residues.3' (eg, comprises, eg, is composed of, three phosphorothioate linkages at the 3'(s) end). In one embodiment, any of the phosphorothioate modifications described above are combined with an inverted abasic residue at the .5' end, the 3' end, or both the 5' and 3' ends of the polynucleotide. In such embodiments, the inverted abasic nucleotide may be linked to the 5' and / or 3' nucleotide by a phosphate bond or a phosphorothioate bond. In certain embodiments, the gRNA (eg, the SgRNA or the trand and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprises one or more nucleotides that include a 2' modification. O-methyl. In certain embodiments, each of the first l. 2, 3, or more of the 5' residues comprise a 2' O-methyl modification. In certain embodiments, the first 1, 2, 3, or more of the 3' residues each comprise a 2' O-methyl modification. In certain embodiments, the 4th-a~terminal, 3rd-a-terminal, and 2nd-a-terminus 3' residues comprise a 2' O-methyl modification. In certain embodiments, each of the first 1, 2, 3 or more of the 5' residues comprises a 2' O-methyl modification, and each of the first 1, 2, 3 or more of the 3 residues ' comprise a 2' O-methyl modification. In one embodiment, each of the first 3 of the 5' residues comprises a 2' O-methyl modification, and each of the first 3 of the 3' residues comprises a 2' Ο-methyl modification. In certain embodiments, the first 3 of the 5' residues each comprise a 2' O-methyl modification, and the 4th-a-termmaL, 3rd-a-tenninal, and 2nd-a-terminal 3' residues comprise a 2' O-methyl modification. In certain embodiments, any of the 2' O-methyl modifications, eg, as described, may be combined with one or more phosphorothioate modifications, eg, as described, and / or one or more inverted basic modification, for example,-according to the described. In one embodiment, the gRNA (eg, the sgRNA or the tra and / or crRNA of, a dgRNA), eg, the gRNA or gRNA components described above, comprises, eg, is composed of , a phosphorothioate bond between each of the first four residues 55 (for example, comprising, for example, se.consists of three phosphorothioate linkages at the 5' end of the polynucleotide(s)), one phosphorothioate linkage between each of the first four 3' residues (eg, comprises, eg, comprises three phosphorothioate linkages at the 5' end ' of the polymcleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, and a 2'.0-methyl modification at. each of the first three residues 37 In one embodiment, the gRNA (eg, the .sgRNA or the tra and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprises, eg, is composed of, a phosphorothioate bond between each of the first four 5' residues (eg, comprises, eg, is composed of three phosphorothioate bonds at the S* terminus of the polyn nucleotide(s)), a phosphorothioate between each of the first four 3' residues (eg, comprises, eg, is composed of three phosphorothioate linkages at the 5' end of the polyinuckotide(s)), a 2' O-methyl modification at each of the first three 5' residues, and a .2' O-methyl modification at each of the 4th-to-tcrminal, 3rd-to-termma.l, and 2nd-to-terminal residues 37. In one embodiment, the gRNA (eg, the sgRNA or the trand and / or crRNA of a dgRNA), eg, the gRNA or gRNA components described above, comprises, eg, is composed of, a link phosphorothioate between each of the first four 5' residues (eg, comprises, eg, is composed of three phosphorothioate linkages at the 5' end of the polynucleotide(s)), one phosphorothioate linkage between each of the first four residues 3 ' (eg, comprises, eg, is composed of three phosphorothioate linkages at the 5' end of the polynucleotide(s)), a 2' O-methyl modification at each of the first three 5' residues, a 2' modification O-methyl at each of the first three residues 37 and an additional inverted abasic residue at each of the 5' and 37 ends In one embodiment, gRNA (eg, sgRNA A or the tra and / or crRNA of a dgRNA), eg, gRNA or gRNA components. described above, comprises, for example, is composed of, a phosphorothioate bond between each of the first four 5' residues (for example, comprises, for example, is composed of three phosphorothioate bonds at the 5' end of the polymyceotide(s) ), a phosphorothioate bond between each of the first four 3' residues (eg, comprises, eg, is composed of three phosphorothioate bonds at the 5' end of the polynucleotide(s)). a 2' O-methyl modification. in each of the first three residues 57 and one modification. 2' O-methyl at each of the 4th-a-terminal, 3rd-a-terminal and 2nd-a-terminal residues 37 and an additional inverted abasic residue at each of the 5' and 3 ends 7 In one embodiment, the gRNA is a dgRNA and comprises, for example, is composed of: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNNGLTUUUAGCUAU*mG*mC*mU (SEQ ID NO: 251), where m indicates a base with 2'O-methyl modification, * indicates a phosphorothioate bond, and Ns indicate targeting domain residues, eg, as described, (optionally with an inverted abasic residue at the 5' terminus and / or 3j: and bring: AACAGCAUAGCAAGUÜAAÁAUAAGGCÜAGUCCGUUAUCAACÜÜG.AAAAGUGGCACCGAGUCG GUGCUUUUOUU (Seq. Id. No.: 224) (optionally with an inverted abasic residue at the 5' and / or 3' terminus). a dgRNA and comprises, for example, is composed of: crRNA: mN*mNW*NNWN.NNNNNNNWNNNGÜUWAGAG.CUAU*mG*mC*ffiü (SEQ ID No.: 251), where m indicates a base with 2' modification O-methyl, * indicates a phosphorothioate bond, and Ns indicate targeting domain residues, eg, as described, (optionally with an ab residue). inverted assic at the 5' and / or 3' terminus); and fetch: mA*mA*ftiC*AGCADAGCAAGU.ÜAAAAUAAGGCUAGUCCGUUAVCAACUUGAAAAAGÜGGCACCG AGUCGGUGGUUUU*mU*mU*mU (Seq ID No: 246), where m indicates a modified base. 2'0-methyl, * indicates a phosphorothioate bond, and N's indicate targeting domain residues, eg, as described, (optionally with an inverted abasic residue at the 5' and / or 3 terminus). In one embodiment, the gRNA is a dgRNA A and comprises, for example, is composed of: crRNA: mN*mN*mN*NNNNNNNNNNNNNNNWG.UIJUU'AGA.GCUAÜGCUGUU*mü*mU*mG (Seq. ID No. .: 25'2), where m indicates a 2'0-methyl modified base, * indicates a phosphorothioate bond, and Ns indicate targeting domain residues, eg, as described, (optionally with an abasic residue inverted at the 5' and / or 3' terminus); and bring: AACAGCAUAGCAAGUUAÁAAUAAGGCUAGUCCGUÜAUCAACUUGAAAAAGUGGCACCGAGÜ'CG GUGCUUUUUUU (SEQ ID NO: 224) (optionally with an inverted abasic residue at the 5' and / or 3' terminus). In one embodiment, the gRNA is a dgRNA and comprises, for example, is composed of: crRNA: nfN*mN*mN*NNNNNNNNNNNNNNNNNGUljIJlJAGAGC'UAlJGCUGLnj*mU*mU*niG (SEQ ID NO: 252) , where m indicates a base with 2O-methyl modification, * indicates a phosphorothioate bond, and Ns indicate targeting domain residues, eg, as described, (optionally with an inverted abasic residue at the 5' terminus and / or 3'); and bring: mA*HiA*mC*AGCAUAGCAAGUUAAAAUAAGGCüAGUCCGÜUAUCAACUUGAÁAAAGGGGAACCG ÁGUCGGUGCbTJUU*raU*mü*mU (Seq ID No: 246), where m indicates one. base with 2'0-methlyl modification, and * indicates a phosphorothioate bond (optionally with an inverted abasic residue at the 5' and / or 3' terminus). In one embodiment, the gRNA is :a dgRNA and comprises, for example, is composed of: crRNA: NNNWNNNNNNNNNNNNNNNGUUU.b'AGAGCl¡AÜQ:CU:GUUUUG (Seq. ID No.: 253), where the N indicate the residues of the addressing domain, eg, as described. (optionally with an inverted abasic residue at the 5* and / or 3' terminus); and fetch: mA*mA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGlRJAUCAACUUGAAAAAGUGGCACCG AGUCGGUGCUIJUU*mlI*mU*mU (Seq ID No: 246), where m indicates one. base with 2'0-metllo modification, and * indicates a. phosphorothioate bond (optionally with an inverted abasic residue at the 5' and / or 3' terminus) In one embodiment, the . gRNA is an sgRNA and comprises, for example, is composed of; NNNNNNNNNNNNNNNNNNGUlIÜÜAGAGCUÁGAAAOAGCAAGÜbAAAAbAAGGCUAGUCCGU UAUCAACXnjGAAA.AAGUGGCACCGAGIjCGGUGCUUUU (Seq ID No.: 254), where m indicates a base with 2'O-methyl modification, * indicates a phosphorothioate bond, and Ns indicate targeting domain residues, for example, as per as described, (optionally with an inverted abasic residue at the 5' and / or 3' terminus). In. one embodiment, the gRNA is an sgRNA-and comprises, for example, is composed of: mN*mN*mN*NNNNNNNNNNNNNNNNUUUUAGCUAGAAAUAGCAAGUUAAAAUAAGGCüA GUCCGUÜAUCAACUUGAAAAAGUGGC'ACCGAGUCGGUGCU*mÜ*m.U*mU (Seq. Id. No.: 255), where m indicates one. base with 2O-methyl modification, -* indicates a phosphorothioate bond, and Ns indicate targeting domain residues, eg, as described, (optionally with an inverted abasic residue at the 5' and / or 3' terminus). '). In one embodiment, the gRNA is an sgRNA and comprises, for example, is composed of: mN*mN*mN*NNWNNNNNNNNNNNNNGUUL!UAGAGCÜAGAAAUAGCAAGüUAAAA(JAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGÜGCmU*mU*mU*U (SEQ ID NO: 256) , where m indicates a base with a 2'O-methyl modification, * indicates a phosphorothioate bond, and N indicates the targeting domain residues, eg, as described, (optionally with an inverted abasic residue in the $' terminus). and / or 3'). 6) First extension of Bring When the gRNA comprises the first extension of flagpole, the fetch may comprise a first fetch extension. The first flagpole extension may comprise nucleotides that are complementary, eg, 80%, 85%, 90%, 95%, or 99%, eg, fully complementary, to the nucleotides of the first flagpole extension. In some aspects, the nucleotides of the first tract that hybridize with the complementary nucleotides of the first flagpole tract are contiguous. In some aspects, the nucleotides of the first tract that hybridize with the complementary nucleotides of the first flagpole stretch are discontinuous, eg, they comprise two or more hybridizing regions separated by nucleotides that do not pair with the nucleotides of the first flagpole stretch. In some aspects, the first extension bring comprises at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 1.5, 16, 17, 18, 19, 20 or more nucleotides. In some aspects, the first bring extension comprises SEQ ID NO: 189. In some aspects the first bring extension comprises nucleic acid having at least 80%, 85%, .90%, 95%, or 99% of homology. with Id., of Sec. No.,: 1.89. Some or all of the nucleotides in the first extension may have a modification, eg, a .focused-on modification. Section ΧΠ1 hereof. In some embodiments, the sgRNA may comprise, 5' to 3-', disposed 3' to the targeting domain: a) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUÁGUCCGUUAUCAACUUGAAAAAGUGGC ACCGAGUCGGUGC (Seq. ID No.: 1.95); b) GUUUAAGAGCUAGAAAUAGCAAGUUUAAAUAAGGCUAGUCCGUU.AUCAACUUGAAAAAGUGGC ACCGAGUCGGUGC (Id. de Sec. Nro.; 196);c) GUUUUAGAGCUAUGCUGGAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGC (Id. de Sec. Nro.: 197);d) GUUUAAGAGCUAUGCUGGAAACAGCAüAGCAAGUUUAAA.UAAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGC (Id. de Sec. Nro.: 198 ); e) any of a) to d), above, further comprising, at the 3' end, at least 1,.2, 3, 4, 5, 6' or 7 uracil nucleotides (U), for example, 1,2, 3, 4. 5, 6, or 7 nucleotides of uracil (U); f) any of a) to d), above, further comprising, at the 3' end, at least -1, 2, 3 , 4, 5, 6, or 7 nucleotides of -adenine (A), eg, 1, 2.3, 4, 5.6, or 7 nucleotides of adenine (A); or g) any of a) to f), above, further comprising, at the 5' end (eg, at the 5' terminus, eg, 5' to the targeting domain), at least 1, 2, 3, 4 , 5, 6, or 7 adenine nucleotides (A), eg, 1, 2, .3, 4, 5, 6, or 7 adenine nucleotides (A). In certain embodiments, any of a) to g) above is attached directly to the targeting domain. In one embodiment, an sgRNA of the invention comprises, for example, is composed of, from 5' to 3': (address domain]- GUUUUAGAGCUAGAAAUAGCAAGUUAAAAU.AA.GGCUAGUC.CGUUAUCAACUUGAAÁAAGUGGC ACCGAGUCGGUGCUUUU (Seq. ID No. :, 23.1). In one embodiment, an sgRNA of the invention comprises, for example, is composed of, from .5' to 3': [targeting domain]- .GUUUAAGAGCUAUGCUGGAAA.CAGCA.UAGCAAGUUUA.AAAAAGGCUAGUCCGUUAUCAACUUG AAAÁAGUGGCACCGAGUCGGUGCUUUU (Seq. ID No. .: 227). In. In some embodiments, the dgRNA may comprise: A crRNA comprising, from 5' to 32 preferably directly 3' to. addressing domain: a) GUUUUAGAGCUA (Seq Id No.: 182); b) GÜUUAAGAGCUA (Seq Id No.; 183); c) GUUUUAGAGCUAUGCUG (Seq Id No.: 199);d ) GUUUAAGAGCÜAUGCUG (Sec. ID No.: 200); e) GUUUÜAGAGCUAUGCUGUUUUG (Sec. ID No.: 201); f) GUUUAAGAGCUAUGCUGUUUUG (Sec. ID No.; 202); og) GUUUUAGAGCUAUGCU (Sec. ID No.: 226): and «n bring that includes, from 5' to 3': a) UAGCAAGUUAAAAUAAGGCUAG.UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC(Sec. ID No.: 187); b) UAGCAAGUUUAAAUAAGGCÜAGUCCGUUAUCAACGCUUGAAAAAGÜGUGGCACC Id. dé Sec. Nro.: 188);c) cagcauagcaaquuaaaauaaggcüaguccgüüaucaacuugaaaaagüggcaccgágucggu GC (Id. de Sec, Nro. : 203);d) cagcauagcaaguuuaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggu GC (Id. de Séc. Nro.: 204);e) aacagcauagcaaguuaaaauaaggcuagüccguijaucaacuugaaaaaguggcaccgagucg GUGCUUIJUUI.IU ( Seq ID No.: 224); t) aacagcauagcaagüuuaauaaggcuaguccguüaucaacuugaaaaagüggcaccgagucg GUGCUUUUUUU (Sec. ID No.: 225); g) aacagcauagcaaguuaaaauaaggcuaguccguuaucaacijugaaaaaguggcaccgagucg GUGC (Seq. ID No.: 232) h) GUUÜAAGAGCUAUGCUGGAAACAGCAUAGCAAGLJUUAAAGAAGGCUA.GUCCGUIJAUCAACUUG AAAAAGiJGGCACCGAGUCGGUGCUUUU (Seq. Id. No.: 22?); i) agcauágcaaguuaaaauaaggcuaguccguuaucaacuugaáaaaguggcaccgagijcggug CÜIjIJ (Id. de Sec. Nro.: 228);j) güUggaaccauucaaaacagcauagcaaguuaaaauaaggcuaggccguuaucaacuugaaaa AGUGGCACCGAGüCGGUGCIJUU (Id. de Sec. Nro.: 229);k) .cualquiera de a) a j), precedentes, comprendiendo además, en el extremo 37 at least 1, 2, 3, 4, .5, 6, or 7 uracil (U) nucleotides, for example, 1, 2, 3.4, 5, 6, or 7 uracil (U) nucleotides; ) any. from a) to j), above, further comprising, at the 3\ end at least i, 2, 3, 4, 5, 6 or 7 adenine nucleotides (A), for example, 1,2, 3 , 4, 5, 6, or 7 adenine nucleotides (A); or m) any of-a) to th), above, further comprising, at the 5-terminus (for example, at the 5-terminus), chicken minus 1, 2, 3, 4, 5, 6 or 7 adenine nucleotides (A ), for example, 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides (A) In one embodiment, the sequence of k) above comprises the sequence 3' UUÜUÜO, eg, if a U6 promoter is used for transcription. In one embodiment, the sequence of k) above comprises the sequence 3' UUUU, eg, if a Η1 promoter is used for transcription. In one embodiment, the sequence of k),. above, comprises varying numbers of Us 3' depending on, for example, the termination signal of the pol-IU promoter used. In one embodiment, the sequence of k), above, comprises the 3' variable sequence derived from. DNA template if a T7 promoter is used. In one embodiment, the sequence of k) above comprises the 3' variable sequence derived from the DNA template, eg, if in vitro transcription is used to generate the RNA molecule. In one embodiment, the sequence of k) above comprises the 3' variable sequence derived from the DNA template, eg, if a pol-II promoter is used to drive transcription. In one embodiment, the crRNA comprises, for example, is composed of, a targeting domain and, disposed 3' to the targeting domain (eg, disposed directly 3' to the targeting domain), a sequence comprising, for example example, is made up of, Seq ID No.: 201, and bringing comprises, for example, is made up of aacagcauagcáaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucg GUGCDUUDÜUU (Sec ID No.: 224). In one embodiment, the crRNA comprises, for example, is composed of, a targeting domain and, disposed 3' to the targeting domain (eg, disposed directly 3' to the targeting domain), a sequence comprising, for example, it is made up of, Sec.Id.Nrc,.: 202, and the bring comprises, for example, is made up of, AACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGGUAUCAAC-UUGAAÁAAGUGGCACCGAGUCG GÜGCUUUUUUU (Sec. Id. No.: 225). In one embodiment, the crRNA comprises, for example, is composed of, a targeting domain and, disposed 3' to the targeting domain (eg, disposed directly 3' to the targeting domain), a sequence comprising, for example example, is made up of, GUUUUAGA-GCUAUG.CU (Sec. ID, No.: 226), and bringing comprises. for example, it is composed of, GUUUAAGAGCUÁUGCUGGAA ACA. GCAU AGC AAGUUUA AAUÁAGGCUAGUCCGUUAUCAACUUG AAAAAGUGGCACCGAGUCGGUGCUUUU (Seq. ID No.: 227). In one embodiment, the crRNA comprises, eg, is composed of, an and-targeting domain, disposed 3' to the --targeting domain (eg, disposed directly 3' if-targeting domain), a sequence comprising, for example, it is composed of, GUUUUAGAGCUAIJGCÜ (Seq. Id. No.: 226), and ei to bring comprises, for example, is composed of, AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG Cl ld' (Seq. Id. No.: 228). In one embodiment, the crRNA comprises, for example, is composed of, an and-targeting domain, disposed 3' to the targeting domain (for example, disposed directly 3' to the targeting domain), a sequence comprising, for example example, .is composed of, GUUUUAGAGCUAUGCUGUUUUG (Sec ID No.: 201), and .traer comprises, for example, is composed of, GUUGGAA.CCAUUCAÁAÁCAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAA AGUGGCÁC-CGAGUCGGUGCUTJU (Sec ID No.: 229) . Π. gRNA Targeting Domains Targeting Non-Deletional HPFH Regions Targeting domains targeting non-deletional HPFH regions, for gRNA molecules of the present invention, and for use in the various aspects of the present invention, for example, in altering the expression of gRNAs, are provided in the table below. globin genes, for example, a hemoglobin gene or a beta hemoglobin gene. Table 1: gRNA targeting domains targeting non-deletional HPFH regions. The IDs of Sec. refer to the targeting domain of the gRNA sequence. Table 2 below shows the addressing domains that. when included in a gRNA molecule, < result in at least a 17% increase in fetal hemoglobin (for example, in erythroid cells differentiated from modified HSPCs) at 7 days according to the methods described in the Examples. . gRNA molecules that comprise any of these targeting domains are collectively called Tier 2 gRNA molecules. Table 2 - Targeting Domains for Tier 2 gRNA Molecules Table 3a and Table 3b, below, show the targeting domains that, when included in a gRNA molecule, result in the greatest increase in fetal hemoglobin (eg, in erythroid-differentiated cells). Modified HSP.Cs) at 7 days according to the methods described in the Examples. gRNA molecules. comprising these targeting domains are collectively referred to as Tier 1 gRNA molecules (eg, Tirr la or Tier Ib). Tabie 3a- Targeting domains for gRNA molecules Tier la Table 3b. - Targeting domains for Tier Ib gRNA molecules ΠΙ. Methods for designing gRNAs Methods for designing gRNA are described herein, including methods for selecting, designing, and validating target sequences. Examples of addressing domains are also provided in this document. The targeting domains described herein can be incorporated into the gRNAs described herein. Methods for selection and validation of target sequences as well as analysis of unwanted sequences are described, for example, in, Mali el ai., 2013 SCIENCE 339(6121): 823-826; Hsu et al, 2013 NAT BIOTECHNOL, 31(9):827-32; Fu et. al, 2014 NAT BIOTECHNOL, doi: 10.1038 / nbt,2808. PubMed PM ID: 24463574; Heigwer et al, 2014 NAT METHODS TI (2): 122-3. doi: 10.1038 / nmeth.2812. PubMed PMID: 24481216: Bae el al, 2014 BIOINFORMATICS PubMed PMID: 24463181; Xiao A el al, 2014 BIOINFORMATICS PubMed PMID: 24389662. For example, you can use a software tool to optimize it. choice of gRNA within the user tm target sequence, eg, to minimize total Riera activity of the target throughout the genome. The Riera activity of the target may be other than cleavage. For each possible choice: from gRN A, for example, using Cas9 from S. pyogenes, the tool can identify all sequences, outside of the . target (for example, preceding PAMS NAM or NGG) throughout the genome containing up to a certain number (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) of base pairs not comeident.es. The cleavage efficiency at each target Riera sequence can be predicted, for example, using an experimentally derived weighting scheme. Each putative gRNA is classified according to its expected total off-target cleavage; the highest ranked gRNAs represent those likely to have the most on-target cleavage and the least off-target cleavage. Other features, e.g. automated reagent design for CRISPR construct, primer design for on-target Surveyor assay, and primer design for high-throughput detection and quantification of off-target cleavage via next-generation sequencing , can also be included in the tool. Candidate gRNA molecules can be evaluated by methods known in the art or as described. While software algorithms can be used to generate an initial list of potential gRNA molecules, cleavage efficiency and specificity will not necessarily reflect predicted values, and gRNA molecules may generally require detection in specific cell lines. eg, primary human cell lines, eg, human HSPCs, eg, human CD34-V cells, to determine, for example, cleavage efficiency, indel formation, cleavage specificity, and change in phenotype wanted. These properties can be analyzed using the methods described in this document. In certain aspects of the invention, a gRNA comprising the targeting domain of 'GCR-OOOl (Seq. Id. No.: 1, unmodified sequence underlined for confirmation), for example, one of the described gRNA molecules below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la presente: sgRNAGCRWQl#!: AGUCCUGGOAUCClJCUALlGAGUUUUAGÁGCUAGAAAlJÁGCAAGUUAAAAUAAGGCUAGUCCGU UAUCAACULGAAAAAGUGGCÁCCGAGUCGGUGCIAJliU (Id. de Sec. Nro.: 74) sgRNA GCR4to01..#2: mA^mG^mlJ^CCÜGGU AUCCUCUAUGAGUUUU AG AGC UAGAA A L A G C A AGUU AA A AU AAGGC U AG GCCGüUAÜCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mü*mü*mU (Seq. ID No.: 75) sgRNA GCR-0001 43: MA*m.G*mÜ*CClJG.GUAUCCUCUAUGAGlíUUUAGA.GCUAGAÁAUAGCAAGUr]AAA AI IA 4GGCUÁG UCCGUUAUCAACUCUGGACC*mUGCACCUG.ÁAAAUGGUCUG* (Seq. Id. No.: 76) dgRNAGCOQOl #k crRNA: AGUCCUGGIIÁUCCUCUAUGAGUUUUAGAGCUAUGCUGUUUEG (Seq. Id. No.: 77) bring: AACÁ.GCAUAGCAAGUUAAAAUAAGGCUAGUCCG.UUAUCAA.CUUGAAAAAGUGGCACCGAGUCG GUGCUUUUUUÜ (Seq. Id. No.: dg2RNAG4CR) -0()()l.A2: crRNA: mAlmGlmU!.CCUGGjjAUCmUAUGAGUUUOAGAGCUAUGCUGUU»mU*mU*mG (Seq Id No.: 78) fetch: niA*mA*mC*AG.CAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACOÜGAAAAAGUGGCACCG A(rtlCGGUGCUUUU*mU* mU*mü (Seq. ID No.: 73) ^RNAGCR-OOOI··^: crRNA: mAjJfoG / forUÍCCU^^ (Id. of Sec. No.: 78) bring: AACáGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUÁUCAACUIjGAAAAÁGUGGCACCGAGUCG GUGCUUUUUUU (Sec. ID No.: 224). In each of the gRNA molecules described above, a **" dendta.un. phosphorothioate bond between adjacent nucleotides, and ςίηίΝ" (where N ~ A, G. C or U) denotes a nucleotide with 2'0Me modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0006 (Seq. ID: 6, unmodified sequence underlined below), for example, one of the gRNA molecules described below , it is useful in CRISPR systems, methods, cells and other aspects and embodiments of the invention, even in aspects involving more than one gRNA molecule; por ejemplo, descripta en la presénte: sgRNA GCRcOiWil.: AAAAACUGGAAUGACUGAAUGUUUUAGAGCUAGAAAUAGCAAGUUAAA.AUAAGGCUAGUCCGU ü AUCAACUUGAAAAAGGGGCACCGAGUCGGUGCUUGU (Id. de Seo. Nro,: 79) sgRNA GCR-0006 #2: niAfinANnAÍAACTJGGAAIJíMCWAAUGUUlJUAGAGCUAGAAAUAGCAAGUUAAAAIJAAGClClIA GUCCGUUAUCAAClJUGAAAAAGUGGCACCGAGUCGGUGCU*mü*mU*mU (Id. de Sec. Nro .: 80) sg^AGCRfoOMÉN. aAífflA!siA^CÜGGáAUGACUGÁAUGüÜinjAGAGCUAGAAAUAGCAAGUUA.AAAVAAGGCÜA GUCCGUUAÜCAACUUGAAAAÁGUGGCACCGAGÜCGGÜGCmUNnUNnU*U (Seq ID No.: 81) dgRNA.GCR-0006-# I; crRNA.: AAAAACUGGAAUGACUGAAUGUUUGÁGAGCGAUGCÜGUUUUG (Id. dé Sec. Nro.: 82) traer: AACAGCAUAGCAAGUGAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUGG GUGCUUUUUÜIJ (Id. de Sec. Nro.: 224) dgRNAjjCRAOOÓfS: crRNA: mA*mA*mA*AACUGGAAUGACVGAAUGUWUAGAG€UAUGCUGGU*mU*.mU*mG (Seq ID No.: 83) bring: mA*mA*mC*AGCAUAGCAAGUUAAAAOAAGGCUAGUCCGUÜ.AUCAACÜUGAAAAAGU'GGCACCG AGUCGGUGCUUUU*mU*mU*mU (Seq ID No: 73) dgRNAGCM00§Í3: crRNA: mA ^mAfinA^AACUGGAAUGACUGAAUGUUUUAGCUAUGCUGUU^mWmU^mG (Sec ID #: 8.3) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGüGGCACCGAGUCG GÜGCÜUUUUUU (Sec ID #: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N = A, G, C, or U) denotes a 2'OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0008 (SEQ ID NO: 8, unmodified sequence underlined below), for example, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la presente: sgENAGCOOOMk GGAGAAGGAAAGUAGCUAAAGUUUUAGAGC.UAGAAAUAGCAAGUI.JAAAAIJAAGGCI.IA.GIJCCG1.] UALJCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Id. de Sec. Nro.: 84) sgRNAGCR-T008#2: mG*mGi|!mA*GAAGGAAACUAGCUAAAGUUUUAGAGCUÁGAAA.UAGCAAGUUAAAAlJAAGGCIJA GUCCGUUAUCAACUUGAAAAAGGGGCACCGAGUCGGUGCU* mU*mG*mU (SEQ ID NO: 85) sgRNAGCOOOOfo mgi | ímg*ma.*gaaggaaacuagc.gaaagauuagcgaagaaaag.caaguuaaaaaaaggcna guccuuaucuugaaaaaaaaaggcccgugucguggcmu*mü*mu*u (id. De Sec. Nro.: 86) DGRNA GCR-0008 #1. ) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU.CAACUÚGAÁAÁAGUGGCACCGAGUCG GUGCUGUUUUU (Seq Id No: 224) <UKNAGCRfo0002: crRNA: mG*mGNnA*GAAGGAAACUAGC(JAAAGÚUGUA(}AGCUAGGCUGÜUNnU*mUiÍ!mG (Seq Id No:; mA8ia8) bring *mC*AGCAUAGCAAGinJAAAAÜAAGGCÜAGUCCGUÜAUCAACUUGAAAAAGUGGCACCG AGUCGGUGCUUÜU wmU*mü*mU (Seq. ID No.: 73) dgRNÁ.GCR-000843: crRNA: mG*mG*mA»GAAGGAAACUAGCUAAAGUUUUAGAGCUAÜGCUGUU*i«U*mU' (Sec. No.: 88) bring: .aacagcauagcaagüuaaaavaaggcuaguccguuaucaacuugaaaaaguggcaccgagücg GUGCUUUUUUtI (Sec. ID No.: 224). In each of the gRNA molecules described above, A w*" denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N ~ A, G, C or U) denotes tm nucleotide with 2OMe modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein; In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-009 (SEQ ID NO: 9, unmodified sequence underlined below), for example, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells and other aspects and embodiments of the invention, even in aspects that involve more than one -gRNA molecule; for example, described herein: sgRNA GCR-0009 #1: GUUUCCUUCUCCC AUC AUÁGGUUU UAGAGCUAGA A AIIAGC A A GIJT J AÁ Α.ΑΊΤ A A GGCI ? A GT TC AGI 1 UAUCAACUUGAAAAAGÜGGCACCGAGUCGGUGCUUUÜ (Id. de Sec. Nro.: 89) sgRNA GCR-0009 tí2-mGfoiUGnUUJCCUUCUCCCAUCAUAGGmJUIJAGAGCUAGAAAUAGCAAGUUAAÁÁIJAAGGCUAfi UCCGUÜAÜCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*niU*mU (Id, de Sec. Nro.: 90) sgRNA GCR-0009 Ó3: .mG *mU*mU*UCCUÜCUCCCAUCAUAGGUUUÜAGAGCUAGAAAUAGCAAGUUAAAAUAA.GGCUAG UCCGUUAGC.AACUUGAAAAAGUGGCACCGAGCCGGUGCmU*mü;i:mC*U (Seq.ID No.: 91) dgRNA GCR-0009 #1: crRNA: GUUÜCCUUCGCCCAUCAUAGGUUUGAGCUAIGUdro.UU (Seq.Number: 92) bring: AACAGCAUAGCAAGUUAAAAUAAGGCÜAGUCCGUUAUCAACIJUGAAAAAGUGGCACCGAGUCG GüGCUUUUUUU (Sec ID No.: 224) dgRNA GCR-0009 #2: crRNA: mG*mU*mU'*UCCUUCUCCCA.UCAÜAGGUUUÜAGAGCUAUGCUGUU*inU*mU*mG (Sec ID No. : 93) bring: mA*tnA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCG AGUCGGUGCUüüU*mU*mU í,'mU (Seq. ID No.: 73) dgRNA GCR-0009 #3: crRNA: mG^U^mU^UCCUUCÚCCCAUCAUAGGUUUUAGCUAUGCÜ ^mU^mG (Sec ID No: 93) bring: aacagcaijagcaagüuaaaauaaggcuaguccguuagcaacuügaaaaaguggcaccgagucg GUGCUUUUUUU (Id. of Sec. No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N = A, G, C or ti) denotes a 2'OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complexes with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0010 (SEQ ID NO: 10, unmodified sequence underlined below), eg, one of the gRN molecules A. described below, is useful in CRISPR systems, methods, cells and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; eg, described herein; sgRNA GCR-00 i Q #1: GGGAGAAGGAAACUAGCUAAGUUUUAGAGCUÁ.GAAAUAGCAAGUUAAAAUAA.GGCUAGUCCGIT UAUCAACUUGAAAAAGUGGCACCGAGUCGGÜGCUUUU (Id. de Sec. Nro.: 94) sgRNA GCR-0010 #2: mG*mG'»mG'*AGAAGGAAACUAGCUAAGUUUUAGAGCUAGAAAÜAGCAAGUÜAAAAUAAGGCUA GUCCGUÜAUCAACUUGAAAAAGÜGGCACCGAGUCGGUGCU*mU*mü*mU ( Seq ID #: 95) sgRNA GCR-0010 #3: mG*mG*mG*AGAAGGAAACUAGCUAAGUUUUAGAGCUA.GAAAUAGCAAGlJUAAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmU*mll*mU*U (Seq ID #: 96) dgRNA GCR-0010 ál : crRNA: GGGAGAAGGAAACUAGCUAAGUÜUIjAGAGCUAUGCUGUUUUG (Id. de Sec. Nro,: 97) traer: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAU.CAACUUGAAAAAGÜGGCACCGAGUCG GUGCUÜUUÜUU (Id. de Sec. Nro.: 224) dgRNA GCR-0010 #2: crRNA: niG*mG*mG*AGAAGGAAACUAGCUAAGU'llUUAGAGCEAUGCUGUU *mU*m.U*mG (Seq ID No.: 98) bring: mA*mA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUÜGAAAAAGUGGCACCG AGUCG.GUGCUUÜU*mU*mU*mU (Seq ID No: 73) dgRNA GCR-0010 #3: crRNA: mG*mG*mG,|tÁGAAGGAAACUAG.CUÁAGUUUUAGAGCOAUGClJGUl'J'*mU*inU*mG (Seq. ID Nr o.: 98) bring: AACAGCAUAG.CAAGÜÜAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUUWU (Id. desire. No.: 224). In each of the molecules of. gRNAs described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N - A, G, C or U) denotes a nucleotide with 2'QMe modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, are complexed with. a Cas9 molecule, for example, as described, to form a complex of r'.bonucleoproteins (RNP). Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention: eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0011 (Seq. ID No.: I I. unmodified sequence underlined below), eg, a. of the gRNA molecules described below, is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule. por ejemplo, descripta en la presente·: sgRNA GCR-001 I #1: CACÚGGAGCUAGAGACAAGAGÜUUUAGAGCUAGAAAUAGCAAGUUAAAAUAáGGCUAGUCCGU UAUCAA.CUUGAAAAÁGUGGCACCGAGUCGGUGCUUUU (Id. de Sec, Nro.: 99) sgRNA GCR-0011 #2: mC*mA*mC^UGGÁGCUAGÁGACÁAGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGU.UAU. CAACUUGAAAAAGUGGCACCGAGUCG6UGCU*inU*mU*inU (Seq ID No.: 100) sgRNA GCR-0011 #3: mC"!mA*mC*UG.GAGCUAGAGACAAGAGUUUÜAGAGCUAGAAAUAGCAAGUUA.AAAUAAGGCUAG.UCCGUUAUCAACUUGAAAAAGÜGGCACCGAGUCGGUGCUcU*mU*mU Seq. .#: lili) dgRNA GCR-0011 #1: crRNA:. GCR-0011 #2: crRNA: mC*.mA'»mC*UGGAGCUAGAGACAAGAGUUUUAGAGCUAÜGCUGÚU*mU*mU*mG (Seq ID No.: 103) bring: mA*mA*mC*ÁGCAÜAGCAAGUUAAAAUAAGGC.UAGUCCGUUAUCAACUUGAAAAAGIJGGC.ACCG AGUCGGUGCUUÜlJ *mU*mlI (SEQ ID NO: 73) dgRNA GCR-0011 #3: crRNA: mCGnANmCTJGGAGCUAGAGACAAGAGUUU UAGAGCUAUGCUGUU'WfomUN-nG (Id, de Sec, No.: 103) bring: aacagcauagcaagcuaaa.au aaggcuaguccguuaucaacuugaaaaaguggcaccgagucg GUGCUUUUUUU (Id, de Sec. No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "inN" (where N - A, G, C or U) denotes a 2'OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0012 (SEQ ID NO: 1:2, unmodified sequence underlined below), eg, one of the gRNA molecules described below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la presente: sgRNA GCR-0012 41: agagacaagaagguaaaaaaguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccgu UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCÜQUU (Id. de Sec. Nro.; 104) sgRNA GCR-0012-#2: mA*mG%}A*GACAAGAAGGÜAAAAAAGULWAGAGCUAGAAAUAGCAÁGUJAAAAüAAGGC(JA GUCCGUUAUCAACUüGAAAAAGlJGGCACCGAGUCGGUGCU*mÜ*mlPmU (Seq ID No.; 105) sgRNA GCR-0012 43: mA*mG:*mA*GACAAGAAGGUAAAAAAAGUUUUA.GAGCUAGAAA-UAGC.AAGUUAAAAGAAGGCUA GUCCGÜUAüCAACUUGAAAAAGUGGCACCGAGUCGGUGCmU*inU*mGW (Seq ID No: Γ06) dgRNA GCR- 0012 #1: crRNA: AGAGáCAAGAAGGUAAAAAAGUUUGAGAGCIIAUGCUGCUUUG (Id. de Sec. Nro.: 107) traer; .AACAGCAÜAGCAAGUUAAAAÜAAGGCUAGUCCGUVAGCAACUGGAAAAAGUGGCÁCCGÁGUCG GUGCUUUUUUU (Id. de Sec. Nro;: 224) dgRNA GCR-0012 42: crRNA: mA*m.G*mA*GACAAGAAGGUAAAAAAGUUlIUAGAGCUAUGCO' Gl)U*inU*mU*inG (Seq ID #: 108) bring: mA*TnA*mC*AGCAÜAGCAAGUUAAAÁUAAGGCUAGUCCGUVAUCAACUUGAAAAAGUGGCACCG AGUCGGUGCUUUU-*m:U*mU*mU (Seq ID #: 73) dgRNA GC-R-OO12 #3: crRNA: mA*mG*mA*GACAAGAA.GGUAAAAAAfíUUUUAGA GCÜAUGCUGGUWJ*mU*mG (Id. No.: IOS) bring: AACAGCAUAGCAAGUüAAAAUAAGGCÜAGUCCGUUAGCAACULJGAAAAAGGGGCACCGAGUCG GUGCUÜWUUU (Sec. ID No.: 224). In each of the gRN A molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "inN" (where N = A, G, C, or U) denotes a 2'0Me-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a deribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described in. the present. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0028 (SEQ ID NO: 28, unmodified sequence underlined below), for example, one of the gRNA molecules described below. below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; for example, described herein: sgRNAfíCR-OOÚgJl. GGCUAGGGAUGAAGAAUAAAGUUUUAGAGCUAGAAAUA.GCAAGU.UAAAAUAAGGCUAGUCCGU UÁUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Seq. ID No.: 109) SgRNA GCR-0028 #2: mG^mG^mC^UAGGGAUGAAGAAUAAAGUCUUÁGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUA GUCCGÜUAUCAACUUGAAAAAGUGGCACCGAGUCGGU.GCU*m(J*mU*ni.U (Id. de Sec. Nro.: 110) mG*mG*'mC*UAGGGAUGAAGAAUAAAGULTJUAGAGCÜAGAAAUAGCAAGUÜAAAAUAAGGCUA GÜCCGUUAUCAACinJGAAAAAG.UGGCACCGAGUCGGUGCmü* mU*mU*U (Seq ID No.: Η i) dgRNA GCR-0028 #1: crRNA: GGCUAGGGAUGAAGAAUAAAGUUUUAGAGCUAGGCÜGUUUUG (Seq ID No. 112) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUÜAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUGÜUUUU (Seq ID No. : 224) dgRNA GCR-0028 #2: crRNA;mGfinG*mCHJAGGGAUGAAGAAUAAAGUUUUAGAGCUAUGCUGüU*mU*mU*mG (Seq ID No.: 113) bring: TnA*mA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGÜUAGCAACUÜGAAAAAGUGGCACCG AGUCGGUGCUUUU*m.U*mU*mlI (Seq. Id. No.: 73) dgRNA GCR-0028 #3: crRNA: mG*mG*mC*UAGGGAUGAAGAAUAAAGUUUUAGAGCUAÜGCUGUU*mU*mU (id. of Sec, No.: 113) bring: aacagcauagcaaguüaaaaüaaggcüaguccguuaucaacuugaaaaaguggcaccgagucg GUGCUUL'UIJUU (Sec. ID No.; 224). In each of the gRNA molecules described above, an s'*" denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N ;:= A, G, C, or U) denotes a nucleotide with 2' modification. OMe, In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribonucleoprotein complex ( RNP) Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0034 (SEQ ID NO: 34, unmodified sequence underlined below), for example, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells and other aspects and embodiments of the invention, even in aspects involving more than one gRNA molecule: for example, described herein: SgRNA GCR-00344I: AAAAAUUGGAAUGACUGAAUGUUUUAGAGCUAGAAAUAGCAAGUIEWNAUAAGGCUAGIJCCGU ÜAUCAACUÜGAAAAAGUGGCACCGAGUCGGUGCUUDU (Id. de Sec. Nro.: 114) sMNAGCRtoO3442: mA*mA*mA*AAUUGGAAÜGACUGAÁÜGVUXJÜAGAGCUAGAAAUAGCAÁGUÜAAAAUAAGGCUA GÜCCGÜUAUCAACÜUGAAAAÁGUGGCACCGAGUCGGUGCU*mU*mU*mU (Id. de Sec. Nro.: 115) sgRNA GCR-0034 43 : mANnANnA*AAUUGGAAlJGACUGAAUGUljUUAGCUAGAAAUAGCÁAGUUAAAAÍJAAGGCUA GUCCGUUAÜCAACUUGAAAAAGÜGGCACCGAGUCGGUGCm.Ü*mU*mU*Ü (Seq ID No: 116) dgRNA GCR-0034 41; crRNA: AAAAAUUGGAAUGACUGAAUGUUUIJAGAGCUAUGCUGUUUUG (Sec ID No.: 117) bring: aacagcauagcaaguuaaaauaaggcuaguccguuáucaacüugaaaaaguggcaccgagucg GUGCUUIIUUUIJ (Sec ID No.: 224) dgRNA GCR-0034 42:. crRNA: mA*mA*mA*AAmJGGAAUGACVGAAUGIJGGUAGAGCUAUGCÜGUU*mU*mV*mG (Id. Seq. No.: 118) bring: mA*mA«mC*AGCAUAGCAAGUÜAAAAüAAGGCUAGGCCGIJUAUCAACUÚGAAAA.AGUGGCACCG AGUCGGUGCUÜUU*mU*mU*mU (Seq. ID No.: 73) dgRNA GCR-0034 43: crRNA: mA^mA^mA^ AAUUGGAAUGACUGAAUGUUUlJAGAGCUAUGCUGUU»mTNroHAuG (Seq. ID No.: 118) bring; aagagcauagcaagugaaaauaaggcuagijccguuaucaaouugaaaaaggggcaccgagucg GUGCUUUUUUU (Sec. ID No.: 224). In each of the gRNA molecules described above, a'**" denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N ~ A, G, C, or U) denotes a nucleotide with 2'OMe modification, In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. they are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0045 (SEQ ID NO: 45, unmodified sequence underlined below), eg, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la presénte: sgRNA GCR-0045 # 1: .UG'GUCAAGUUUGCCUUGUCAGUUUUAGAGCÜAGAAAUAGCAAGÜUAAAAUAAGGCUÁGUCCGU NAUCAACUUGAAAAAGIJGGCACCGAGUCGGUGCUUUU (Id. de Seo. Nro.: 119) sgRNÁGCR;foO45.#2: mU»mG*mG*UCAAGUUUGCCUUGÜCAGUUUUAGAGCUAGAAAUAGCAAGUUÁAAAUAAGGCUAG UCCGUUAUCAACLFÜGAAAAAGÜGGCAGCGAGUCGGÜGCU*mU*raU *.mU (Seq ID #: 120) sgRNA GCR-0045 #3: mU*mG*mG*UCAAG.UUUG.CCUUGUCAGUUUUAGAGCUAGAAAUÁGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGÜGGCACCGAGüCGGÜGCmU*mU*mV*U (Seq ID #: 121) dgRNAGCR-0045AI: crRNA: UGGÜCAAGUUUGCCUUGUCAGGUUUAGAGCUAUGCUGUUUUG (Seq. ID No.: 122) bring: AACAGCAUAGCAÁ.GUUAAAAUAAGGCIJAGUCCGUGAÜCAACIJ4.JGAAAAAGUGGCACCGAGUCG GUGCUUUUUUC (Seq. ID No.: 224)* dgRNA5 GCR:20*0gRNAGCR4-mRNA* 0gRNA5 GCR:20*0gRNA5 GCR:20*0gRNAGCR4-mRNA5 mG*UCAAGUUUGCCUUGÜCAGUGUUAGAGCGAUGCUGUU*'mU*mU*mG (Seq ID No.: 123) bring: mA*mA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCXOUUAUCAACUUGAAÁAAGUGGCACCG AGUCGGUGCUUUU*mU*mlRmü (Seq ID No: 73) dgRNA5 GCR-004 GCR-004 #3i crRNA: foU*mG.!mG*UCAAGUUUGC.CUUGUCAGUUU-UAGAGCU AÜGCUGUU*mU*mU»mG (Id. No.: 123) bring: AACAGCAUAGCAAGGUAAAAUAAGGCUAGUCCGUUAUCAACÜUGAAAAAAGUGGCACCGAGUCG GUGCUUUUUUU (Sec. ID No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N = A, G, C, or U) denotes a 2OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule. for example, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GC.R-0046 (SEQ ID NO: 46, unmodified sequence underlined below), eg, one of the gRNA molecules described below, is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en ia presente: sgRNA GCR-0046 #1: GGGAGAAGAAAACÜAGCUAAGUUUUAGAGCUAGAAAÜAGCAAGUÜAAAAÜAAGGCUAGUCCGU UAUCAACUUGAAAAAGIIGGCACCGAGUCGGÜGCIJUUU (Id. de Sec. Nro.: 124) sgRNA GCR-0046 #2: mG*mG*mG*AGAAGAAAACUAGCUAAGUUUUAGAGCUAGAAÁUAGCAAGUUAAAAUAAGGCUA GUCCGU.UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*mU*.mU *mU (SEQ ID NO: 125) sgRNAGCR.-0046J3; mG*mG*mG*AGAAGAAAACUAGCUAUUUUAGAGCÜAGAAAUAGCAAGlJUAAAAÜAAGGCÜA G.UCCGUUAUCAACUUGAAAAAGUGGCAC-CGAGUCGGUGCinU*mU*mU*Ü (Seq ID No.: 126) dgRNA GCR-0(M6..#l: crRNA: GGGÁGAAGAUGAAUGAAUGCUUAUUU de No.: 127) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACWGAAAAAGUGGCÁCCGAGUCG GÜGCUUIJUÜUU (Seq. ID No.: 224) dgRNA GCR-0046 Ú2: crRNA.ffiG^mG*mO»AGAAGAAAACUAGCUAAGUUUUAGCUAlÍde iClCTJCrUn; : 128) bring: mA*mA*m.C*AGCAUAGC.AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUGGAAAAAGUGGCACCG AGUCGGUGClIUlJU*mU*mU*mU (Seq ID No.: 73) dgRNA GCR-0046 #3 : crRNA: niG*mG*mGMGAAGAAAACUAGCUAAGUlJUUAGUAGmIAUJGCTUUGn* *mG (Sec ID No.: 1.28) bring: AACAGCAUAGCAAGUUAAAAGAAGGqUAGUCCGüUAUCAACinjGAAAAAGUGGCACCGAGLiCG GÜGCUGUUUUU (Sec ID No: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and GnN" (where N = A, G, C, or U) denotes a .2OMe-modified nucleotide. In certain embodiments , any of the gRNA molecules described herein, for example, described above, complex with a Casi? molecule, for example, as described, to form a ribonucleoprotein (RNP) complex Such RNPs are particularly useful in methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA. comprising the targeting domain of GCR-0047 (SEQ ID NO: 47, unmodified sequence underlined below), for example, one of the gRNA molecules described below, is useful in CRISPR systems, methods , cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la présente: sgRNA GCR-0047 41: GGCAAGGCUGGCCAACCCAtJGUUUUAGAGCUÁGAAAIJAGCAAGinJAAAAUAAGGCtJA.Gl.ICCGtJ UAÜCAACÜGGAAAAAGUGGCACCGAGUCGGUGCUUGU(Id. de Sec. Nro.: 129) sgRNA GCR-0047 #2: T.nG*mG*mC*AAGGCUGGCCAACCCAUGUUUUAGAGCUAGAAAUAGCAÁGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGÜGGCACCGAGÜCGGUGCÜ*mU *mU*mU (Seq ID No.: 130) sgRNA GCR-0047 #3: mG*mG*mC*AAGGCUGG€C.AA'CCCAlJGUUGUAGAGCÜAGAAÁUAGCAAGUÜAAAAUAAGGCUAG UCCGOUAGCAACUUGAAAAAGUGGCACCGAGUCGGGGCmU*mU*niU*U (Seq ID No. : 131) dgRNA.GCR-Q047 # 1: crRNA: GGCAAGGCUGGCCAACCCAUGUUGUAGAGCUAUGCUGUUUUG (Seq ID No.; 132) bring: AACAGCAUAGCAAG(JUAAAA:UAAGGCIJ.AGUCCGÜUAI)CAACUUGAAAAAGUGGCACCGAGIJCG GUGCUUUUÜUÜ (Seq ID No. 224): dRNA Seq No.224 GCR-0047 #2: crRNA: mG>smGjimC*A.AGGCU'GGCCAACCCAUGÜUUGAGAGCUAlKiCUG{JlRm(J !!;mlj*mG (Seq ID No.: 133) bring: mA*inA*raC*AGCAUAGCAAGUÜAAAAUAAGGCUAGUCCGUUAUGAACUUGAAAAAGUGGCUUGCÜUUGCÜUGC *mU*mU (Seq Id No: 73) dgRNA GCR-0047 #3;crRNA: mG*mG*mC*AAGGCUGG.CC AAC.CCAUGUUUUAGAGCUACrGCÜGUU*niU*mU*inG (Id. of Sec. No.: 133) bring: .. AACAGCAUAGCAAOUUAAAAUAAGGCÜAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GÜGCUÜUUUUU (Id, of Sec. No.: 224). In each of the gRNA molecules described above, a ***" denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where NA, G, C, or U) denotes a 2'OMe-modified nucleotide. embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex.Such RNPs are particularly useful. in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0048 (SEQ ID NO: 48, unmodified sequence underlined below), eg, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; por ejemplo, descripta en la presente: sgRNA GCR-0048 #1: ACGGCUGACAAAAGAAGUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGU UAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Id. de Sec. Nro.: 134) sgRNA GCR-0048 42: mA*.mC*mG*GCUGACAAAAGAAGUCCGUUUUAGAQCUAGAAAUAGCAAGUUAAAAUAAGGCUAG GCCGGUAÜCAACUGGAAAAAGGGGCACCGAGUCGGLOCÜ*mU*mU*mU ( Seq Id No.: 135) sgRNA GCR-0048 #3: mA*mC*mG*GCNGACAAAAGAAGÜCCGUUUUAGCUAGAAAUAGCAAGUOAAAAÜAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGLICGGUGCmG*.mU*.mU*U (Seq Id No: 136) dgRNA # GCR1-0048 : crRNA: ACGGCUGACAAAAGAAGUCCGUUUUAGAGCUáI ¡GCl IGIΤΓΠΠIG (Seq. ID No.: 137) bring: AACAGCAUA.GCAAQÜUAAAAUAAGGCIJAGUCCGUUAUCAACUEGAAAAA.GUGGCACCGAGUCG GUGCUUUUUUü (Seq. Id No.: 224) dgRNA GCR-Q048: #2 mA*CRNA*: mA*CRNA: GCR-Q048 mG*GCLOACAAAAGAAGUCCGUUUÜAGAGCUAUGCUGÜlJ*mlT*mH*mG (Seq ID #: 138) ti* 3C1" mA*mA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGÜCCGUUAUCAACUUGAAAAAGGGGCACCG AGUCGGUGCUUUU*mU*mü*mü (Seq ID #: 73) RNAg 73 GCR-0048 #3: crRNA:.mA*mC*mG*GCUGACAAAAGAAGUCCGlJUUUAGA GCUAUGEUGTJÜ*mU*mU*mG (Id. No.: 138) bring: AACAGCAUAGCAAGUÜAAAAGAAGGeüAGUCCGUUAüCAACUGGÁAAAAGUGGCACCGAGUCG GUGCUUUUUUU (Sec. ID No.: 224). In each of the gRNA molecules described above, a "*" denotes a phosphorothioate bond between adjacent nucleotides, and "mN"' (where N ::: A, G, C, or U) denotes a modified nucleotide. 2'OMe. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described in. the present. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0050 (SEQ ID NO: SO, unmodified sequence underlined below), for example, one of the gRNA molecules described below , is useful in CRISPR systems, methods, cells, and so on. Aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; for example, described herein: sgRNA GCR-0050 #.l: CCUGGCIJAAACUCCACCCAUGUUIjUAGAGCUAGAAAUAGCAAGEUAAAAUAAGGCUAGUCCGU UAUCAACUÜGAAAAAGUGGCÁCCGAGUCGGUGCUUÜU(Id. de Sec. Nro.: 139) sgRNA GCR-0050 #2': mC*mC*mU*GGCUAAACUCCÁCCCAUGUUUUAGAGCUAGAAAUAGCAAGÜUAAAÁÜAAGGCUAG UCCGUÜAÜCAA.CUUGAAAAAGUGGCACCGAGUCGGUGCU*mU ií:mU*mÜ (id. de Sec. Nro.: 140) sgRNA GCR-0050'#3: m£*mC*mü*GGCUAAACUCCACCC AUGUUÜUAGAGCUAGAAALAGCA AGI Π JÁ A A Al IÁ AGG.CUAG I.lCCiJIJOAUC A7'VGUljC}AAAAAGUCKjCACCGAGÜCGGLíGCmIJ*mLT*mI.PU (Seq. ID No.: 141) dgRNA GCR-0050 41: crRNA: CCGGGCUAAACUCCACCCAUGUUUUAGAGGIJAIiGCUGUUUUG (Id. de Sec. Nro.: 142) traer: AACAGCAüAGCAAGLílJAAAAUAAGGCUAGUCCGinJAlJCAACUUGAAAAAGÚGGCACCGAGUCG GÜGCUUUUUUU (Id. de Sec. Nró.: 224) dgRNA GCR-0050 42: crRNA: mC*n3C]|imÜ* GGCUAAACUCCACCCAUGUUUUAGAGCUAUGCUGUlJ*mtJ*rnlI*mG (Seq. Id. No.: 143) bring: ínA*TnA*mC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAÁAGUGGCACCG AGÜCGGUGCUÜUU*mU'*mU*mU (Seq. Id. No.: 0g5RNA GCR- 0g5RNA- 73) 43: crRNA: mC^mCNriU^GGCUAAAClJCCACCCAUGUGUUAGAGCUAljGCUGUU^mlPml.fomG (Id . of Sec. No.: 143) bring: AACAGCAUAGCAAGUUAAAAGAAGGCUAGUCCGUUAÜCAACOUGAAAAAGÜGGGACCGAGÜCG GUGCUUUUUUU (Sec. Id. No.: 224). In each of the gRNA molecules described above, a. denotes a phosphorothioate bond between adjacent nucleotides, and W (where N = A, G, C, or U) denotes a nucleotide with 2OMe modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-005 i (Seq. ID No.: SI, unmodified sequence underlined below), for example, one of the gRNA molecules described below then, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one g.RNA molecule; por ejemplo, descripta en la présente: sgRNA GCR-0051 41: GGAGAAGAAAACUAGCUAAAGGUIJUAGAGCUA.GAAAUAGC,4AGUUAAAAUAAGGCUAGUCCGG GAUCAACÜÜGAAAAAGGGGCACCGAGGCGGüGCUUUÜ (Id. de Sec. Nro.: 144) sgRNA GCR-0051 42: mGWfo mAHIAAGAAAACUAGCU AAAGUíJUUÁGAGCUAGAAAI i AG(1 A AGI Π JAÁ AA 1 ' IAÁ GGGí 1A CtÜCCGljUAljCA.AC,UL.'GA.AAAAGbGGCACCC}AGlJCGGlJGCU*mU*mE*mU (Seq. ID No.: 145) sgRNA GCR-005 i #3: mG*mG»nitA*GAAGAAAACUAGCLiAAAGUUUUAGAGCUAGAAAUAGCAAGUT.J .AAAAl.JA.AfiGCTN\ GLCCGGGAUCAACOUGAAAAAGUGGCACCGAGUCGGUGCiftU*m.U*mU*U (Id. de Sec, Nro.: 146) dgRNA GCR-0051J1; crRNA: GGAGAAGAAAACUAGCUAAAGUUUUAGAGCUAUGClIGIIIJIΠIG (Id. de Sec, Nro.: 147) traer: AACAGCAGAGCAAGÜUAAAAUAAGGCUAGGCCGÜUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUUUUU (Id Seq ID #: 224) dgRNA GCR-0051 #2: crRNA;¡nG*mG!mA*GAAGAAAAGÜAGCmAAGGÜÜUAGAGCUAUGCUGüU*mU*mU*mG (Seq ID #: 148) bring: mA*mÁ*tnC *AGCÁÜAGdAAGUUAAAAUAAGG.CUÁGUCCGUUAUCAACÜUGAAAAAAGUGGCACCG AGbCGGUGCUGUU*mü*mU*mU (Seq. ID No.: 73) dgRNA GCR-0051 #3: crRNA: mGNn(PmAíGAAGAAAACUAGCUAAAGlJUI.JUAGAGClJAIJGClJGUU;i:mU*mU*mG (Id. No.: 148) bring: AACAGCAUAGCAAGUÜAAAAUAAGGCUAGUCCGGUAUCAACUGGAAAAAGUGGCACCGAGGCG GVGCUUUÜÜIJE (Sec. ID No.; 224), In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N-A, G, C, or U) denotes a 2'0Me-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Casó molecule, eg, as described, to form a ribonoejeoprotein (RNP) complex. Such RNPs are found to be particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0053 (SEQ ID NO: 53, unmodified sequence underlined below), eg, one of the gRNA molecules described below , it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of AI. invention, even in aspects that involve more than one gRNA molecule: for example, described in the. presente: sgRNA GCR-0053 #1: CUUGUCAAGGaJAUÜGGUCAGljWUAGAGCUAGAAAGAGCAAG(JÜAAAAUAAGGCUAGUCCGü UÁUCAACUUGÁAAAAGUGGCACCGÁGUCGGUGCUUUIJ (Id- deSec. Nro.: 149) sgRNA GCR-0053 #2: mC*mÜ*mU*GüCAAGGCUAUUGGUCAGUUUUAGAG€UAGAAAUAGCAAGl.niAAAAlJAAGfiCUACT OCCG:UOAOC-AACULJGAAAAAGlJGGCACCGAGUCGGGGCU*mU*mU *mU (Seq ID No.: 150) SgRNA GCR-0053 #3:.mC*tnU*mU*GUCAAGGCUA'OUGGUCAGUUU.UAGAGCUAGAAAUA.GCAAGUUAAAAUAAGGCIJAG UCCGUUAUCAACüUGAAAAAAGUGGCACCGAGUCGGUGCmU*mU*mü*U (Seq ID No: 151) dgRNA GCR-0053 #1: crRNA; No.: 224) dgRNA GCR-0053 #2: crRNA: mCÍteü*mU*GUCAAGGC(JAinjGGUCAGLlUlJUAGAGCUAL!GCUGUL ;*mIJ*rnU*mG (Seq. ID No.: 153) bring: óiA*njA*mC*AGCAUAGCAAGUGAAAAUAAGGCUAGUCCGUüAUGGCAACUUGAAAAAGCA .CCG AGUCGGUGCUVUU*mU*mU*mÜ (SEQ ID NO: 73) dgRNA GCR-0053 #3: crRNA: mC*mUNnU*GlJCAAGGCUAWGGUCAGUUUUAGAG CUAUGCUGUU*mU*mU*mG (Id. No.: 153) bring: AACAGCAUAGCAAGUUAAAAÜAAGGCÜAGUCCGCUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUUUUUUÜ (Sec. ID No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "niN" (where N = A, G, C, or U) denotes a modified nucleotide, 2'OMe. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas? molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. . Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0054 (SEQ ID NO: 54, unmodified sequence underlined below), eg, one of the gRNA molecules. described below, it is useful in CRISPR systems, methods, cells and other aspects and embodiments of the invention, even in aspects involving more than one gRNA molecule; for example, described herein: sgRNAGCg-OOMli.;. AGHC.CUGGü / VUCÜUCÜAUGGGUUUUAGAGCUAGÁAAUAGC.AAGUÜAAAAüAAG.GCIJÁGUC.CGIT i UAUCAACUUGAAáAAGUGGCACCGAGGCGGUGCUUUU (Sec. ID No.: 154) SgRNAGCR^0Q5472: mA!mQ*mlJ*CCGGGUAVCUU-CGAUGGGUUUUAGAGCÜAGAAAUAGCAAGUÜAAAAIJAAGGCUAG UCCGGUAUCAACUÜGAAAAAGUGGCACCGAGUCGGUGCU*niU*mü^n)U (Id.de Sec, Nro.: 155) sgRNA GCR-0054 43: ' mA*mGfinU*CCUGGUAUCWCUÁUGGGI.RRJUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGClJAG UCCGÜÜAUCAACUÜGAAAAÁGUGGCACCGAGÜCGGUGCmU*mU *mU*U (Seq ID No.; 156) dgENAGCR-0054#l; crRNA: AGIJCCUGGUAUCUUCUAUGGGUIJUUAGAGCUAUGCIJGUUUÜG (Sec. ID No.: 157) bring: AACAGCAIMGCAáGUUAAAAÜAAGGCUAGGCCGUUAGCAACUUGAAAAAGUGGCACCGAGIJCG GUGCUUUÜUUU (Seq. Id. No.: 224) dgRNA GCR-0054 42: crRNA: mA^nG*mU*CCÜGG.UAUCUUCUÁ.UGGGUUUUAGAGCUAUGCUGUU*mU»mU*fnG (Seq. Id. No. 15): bring: mA*mA*mC*AGCAVAGCAAGUUAAAAUAAGGCÜAGÜCCGUÜÁUCAACUUGAAAAAGUGGCAC.CG AGÚCGGUGCUVUU*mU*niU*mU (Seq ID No.: 73) dgKNAGCRrQ2S4#3: crRNA: mA»mG*mU*'C.CUGGUAUCUGCüAGGGGUUÜÜAGGUAGCUA.CUUGGUUU.] |'inU*mG (Seq ID No: 158) bring: AACAGCAUAGCAAGUVAAAAUAAGGCUAGGCC'GUÜAUC-AACUUGAAAAAGIÍGGCACCGAGUCG GUGCUUUUUUU (Seq ID No: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides i, and "mN" (where N - A, G, C or U) denotes a .nucleotide with 2'0Me modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, is complexed with a Cas9 molecule, eg, as described, to form a ribomicleoprotein (RNP) complex. RNP tags are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0058 (SEQ ID NO: 58, unmodified sequence underlined below), for example, one of the gRNA molecules described below. below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; for example, described herein: sgRNA GCR-OO58 41; GÜCCUGGÜAUCUUCUAÜGGUGUUUUAGAGCUAGAAAUAGCAAGÜUAAAÁI JAAGGCl TAGl 1CCGIΓ UAUCAACÜUGAAAAAGUGGCACCGAGUCGGÜGCUUUU (Id. de Sec. Nro.: 159) sgRNA GCR-0058 42: mG*mU*mC*CUGG.UAUC.UUCUAUGGUGUUUUAGAGCL!AGAAAÜAGCAAGUUAAA.AUAAGGaJAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGÜGCU*mU*mU*mU(Id. de Sec. Nro.: 160) sgRNA GCR-0058 43: .mG*mU*mC*CUGGUAUCUUCUAUGGUGUUUlJAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAG UCCGUUAÜCAACUUGAAAAAGUGGCACCG.AGUCGGUG.CmU*mü*mU*U (Id. de Sec. Nro.: 161) dgRNA GCR-0058 41: crRNA: GüCCUGGUAUCUUCUAUGGUGUUUUAGAGCUAUGCUGUUUUG (Seq ID No.: 162) bring: aacagcauagcaaguuaaáauaággcüaguccguüaücaácuugaaaaaguggcaccgagucg GÜGCUUUUUUÜ (Seq Id No.: 224) dgRN A GCR-0058 42: crRNA: mG*mU*m€*CUGGUAUCUUCUA.UGGUGUAUUUÜAG| mU*mG (Seq ID #: 163) bring: mA*mA*mC*AGCAlJAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGÜGGCACCG ÁGUCGGUGC.UUÜU*inU*mU*mU (Seq ID #: 73) dgRNA GCR-0058 43: crRNA ; mG*mU*mC*CUGGUAUCUUCUAUGGIjGULTlTUAGAGCUAlJGCUGlRJWJ*mU*mG (Sec ID #: 163) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCG GUGCIJUUUÜW (Sec ID #: 224). In. In each of the gRNA molecules described above, a "♦" denotes a phosphorothioate bond between adjacent nucleotides, and "mN" (where N ~ A, G, C, or U) denotes a 2'OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a molecule. It fused, for example, as described, to form a ribonucleoprotein (RNP) complex. Such RNPs are particularly useful in the methods, cells, and other aspects and embodiments of the invention, eg, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0062 (SEQ ID NO: 62, unmodified sequence underlined below), eg, one of the gRNA molecules described below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; for example, describe. herein: sgRNA GCR-0062 #l·. CUÜGACCAAUAGCCUUGACAGUUUÜAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGU ÜAUCAACUUGAAAAAGUGGCACCGAGUCGGIJGCUUUU (Id. de Sec. Nro.: 164) sgRNA GCR-0062 #2: mC*m.U*mU'*GACCAAUAGCCUUGACAGUUUUAGAGCUAGAAAUAGCAAGinJAAAAGAAGGCU.ÁG UCCGUUAUCAACUUG.AAAAAGUGGCACCGAGUCGGUGCU*mU*mU*m1J (Id. de Sec. Nro.: 165) SgBNAGCR-0062Í3: mCNnU*mU*GACCAAUAGCCl.njGACAGUGUUAGAGCUAGAAAlJAGCAAGUUAAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGüCGGÜGCmU*mU*mÜ*U (Id. de Sec. Nro.; 166) dgRNA.GCR-0062 #1: crRNA: CUUGACCAAUAGCCUUGACAGUÜUUAGAGCUAUGCUGUUUUG (Id. de Sec. Nro.: 167 ) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUÁUCAACUUGAAAAAGUGGCACCGAGUCG GUGCUÜUUI.JÜÜ (Seq ID #: 224) dgRNA GCR-0062 #2: crRNA: mCN-nUNnU*GACCAAUAGCCUUGACAGUUUUAGCUAUGCUGUU*mU*mU*mG (Seq ID #: 16) bring: 16 : ffiA*mAG-nCUGCAÜAGCAAGGlJAAAAUAAGGCUAGUCCGGCAUCAAClJUGAAAAAAGUGGCACCG AGUOGGLJGCUUUUhnlNmU^mU (Seq. ID No.: 73) dgRNAGCR~0Q62#.3y crRNA: mC^mlNmU^GACCAAUAGCCUUGAGAGLJUUUAGAGCUAUGCUGUUG^mlNmlJ bring:1C.6 No.8 de:^c.6dro.8 AACAGC-A UAGCAAGUUAAAAUAAGGCGAGUCCGUUAÜCAACUUGAAAAAGüGGCACCGAGUCG GUGCUUUUUUU (Id. of Sec. No.: 224). In each of the gRNA molecules described above, a. denotes a phosphorothioate- bond between adjacent nucleotides, and '"níN" (where N = A, G, C or U) denotes a nucleotide with 2'OMe modification. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such KN Ps are particularly useful in the methods, cells, and other aspects and embodiments of. the invention, for example, described herein; In certain aspects of the invention, a gRNA comprising the targeting domain of -GCR-00'63 (Seq. Id. No.: 63, unmodified sequence underlined below), for example, one of the molecules of gRNA described below, is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; For example, described in. Ia present: sgRMGCRA)063 41; CAAGGCUAWGGUCAAGGCAGUUUUAGAGCUAGAAAUAGC.AAGUÜAAAAUAAGGCUAGUCCGU UAUCAA.CÜUGAAAAAGUGGCACCGAGUCGGUGCGÜUG (Id, de Sec. Nro.: 1.69) sgRNA.G€R-0Q6g#2: m€*mA^A*GGCUAUUGGUCAAGGCAGUUUUAGAGCUAGAAAUAGCAÁGUÜAAAAÜAAGGCGAG UCCGUÜAUCAACUUGAAAAAGVGGCÁCCGAGUCGGUQCU*mU*mU*mU (Id,, de Sec. Nro ..: 170) sgRNAGCQ06343: mC*mA*mA*GGCUAUUGGUCAAGGCAGUUUUAGAGCGAGAAAUAGCAAGUUAAAAUAAGGCUAG· UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCmü«mIJ*mU*IJ (Id. de Sec. Nro.: 171) dgRNAGCM63Jl: crRNA: CAAGGCUAUUGGUCAAGGCAGUUUUAGAGCUAGGCUGÜÜUUG (Id. de Sec. Nro.: 172) traer : AACAGCAUAGCAAGUüAAAAUAAGGCaAGUCCGUÜAUC.AACUUGAAAAAGIJGGCACCGAGUCG. GÜGCUUUÜULIU (Seq Id No.: 224) dgRNA .GCRfoO6312: crRNA: mC*mA*mA*GGCUAUUGGÜCAAGGCAGUlOJAGAGCGAGGCUGUUNuUNnU*mG (Seq Id No.: 173) bring: mA*mA*mC*AGCAÜAGGCCAUCAAGU-GUAAAAGACUUAUACCAUACC AGL TCGGUGCUUUU*mü*mÜ*mU (Id, de Sec. Nro.: 73) dgRNA GCR-0063 43: crRNA: mCfinANnAN9GCUAUUGGÜCAAGGCAGtJUUUAGAGCUAUGCUGUmnlJNnU*mG (Id. de Sec, Nro.: 173) traer: AACAGCAüAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACIjGGAAAAAGUGGCACCGAGUCG GUGCUUUUUUIJ (Id.. de Sec. No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and '•'mN" (where N = A, G, C, or U) denotes a nucleotide with -2OMe modification. embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex.Such RNPs are particularly useful. in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. In certain aspects of the invention, a gRNA comprising the targeting domain of GCR-0067 (SEQ ID NO: 67, unmodified sequence - underlined below), eg, one of the gRNA molecules described below, it is useful in CRISPR systems, methods, cells, and other aspects and embodiments of the invention, including aspects involving more than one gRNA molecule; for example, described herein: SgRNAGCR-0067 #i: ACUGAAUCGGAÁCAAGGCAAGUUÜUAGAGCUAGAAAUAGCAAGÜUAAAAUAAGGCUAGUCCGU UAGCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Id. de Sec. Nro.: 174) sgRNAGCR-006742: mA*nrC*mU*GAAUCGGAACAAGGCAAGUUUUAGAGCUAGAAAUAG€AAGüUAAAÁUAAGGCUAG UCCGUUAUCAACUUGAAAAAGLIGGCACCGAGUCGGUGCU*mU*mU*mU (Id. de Sec. Nro.: 175) sgRNA GCR-0067.4-3: mA*mC*mU*GAAUCGGAACAA.GGCAAGUUUUAGAGCUAGAAAUAG.CAAGUUAAAAUAAGGCUAG UCC.GUUÁUCAACUU'GAAAAAGUGGCACCGAGUCGGÜGCmU*inU*mU*U (Id. de Sec. Nro,: 176) dgRNA GCR-0067 41: crRNA: ACUGAAUCGGAACAAGGCAAGUUUUAGAGCUAUGCUGLJGÜUG ( Seq. ID No.: 177) bring: aacagcaüagcaaguüaaaauaaggcuaguccguiiaucaacuugaaaaaguggcaccgagucg GUGCÜIJUGUUÜ- (Sec. ID No.: 224) dgRNA.GC.RPjl67ú2;. crRNA: mA*mCGuG*GAAUCGGAACAAGGCAAGUEUUAGCUAGGCUGLHJWJ*mU*mG (Seq Id No.: 178) bring: mA*mAEnC*AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAGCAACUüGAAAAAGGGGCACCG AGUCGGUGCUUUU*mU*mG*mU (Seq Id No: dgRNA GCR- 73) 0067 43: crRNA: mA*mC*mÜ-*GAAUCGGAACAAGGCAAGUUUIlAGAGCUAUGCVGUU*mU*rriU*mG (Seq ID No.: 178) bring: AACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUÜAUCAACUUGAAAAAGUGGCACCGAGIJCG GÜGCUUUUUUG (Seq ID No.: 224). In each of the gRNA molecules described above, a denotes a phosphorothioate bond between adjacent nucleotides, and "jnN" (where N = A, G, G or U) denotes a 2'OMe-modified nucleotide. In certain embodiments, any of the gRNA molecules described herein, eg, described above, complex with a Cas9 molecule, eg, as described, to form a ribonucleoprotein (RNP) complex. Such RN Ps are particularly useful in the methods, cells, and other aspects and embodiments of the invention, for example, described herein. IV. Cas molecules Cas molecules? In preferred embodiments, the Cas molecule is a Cas? molecule. Is it possible to use Cas molecules? of different species in the methods and compositions described herein. Although the molecule Cas? from S. pyogenes is used in most of the disclosure, Cas9 molecules of, derived from, or based on Cas? of other species listed herein may also be used. In other words, other Cas9 molecules, eg, Cas9 molecules from S, ther.mophilus, Staphylococcus aureus, and / or Neisseria meningitidis, can be used in the systems, methods, and compositions described herein. Other Cas9 species include: Acidovorax avenae, Actipobacillus pieuropneumoniae, Actinobaeillus succinogenes, Actinobacillus sais, Actinomyces sp., Eycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp, Blastopirellula. marina, Bradyrhiz obium sp., Brevibacillus latemsporus, Campylobacter coli, Cainpylobaeter jejuni, Campylobacter iad. Candidatos Puniceispiríllum, Clostridin cellulolyticum, Clostridium perfríngens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebactérium matruchofii, Dinoroseobacter sliibae, Eubactermm dolichum, gamma proteobactertúm, Gluconacetobacler díazotrophicus, Haemoph'ílus parainfluenzae, Haemophilus sputorom, Helicobacter canadensis, Helicobacter cinaedi, .Helicobacter mustelae, Ilyobacler polytropus , Kingellá kingae, Lactobacilíus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylósinus trichosporium, Mobiluncus- rnulieris, Neisseria baciíliformis, Neisseria cinerea, Neisseria flavéscens, Neisseria lactamica. Neisseria sp., Neisseria wadsworthii, Nitrosomonas sp., Parvibaculum lávamentivorans, Pasteurella muítocída, Phascoírctobaeterium succinatutens, Ralstoma syzygii, Rhod.opseudomo.nas palustris, Rhodovulum sp., Símonsiella mueiieri, Sphíngomonas sp., Sporolactobacillus sp. ., Subdoligranuhmi sp,, TislréUa mobilis, Treponem.a sp., or Verm.ine.phrobacter eisemaé. A Cas? molecule, as used herein, refers to a molecule that can interact with a gRNA molecule (eg, the sequence of a domain of a bring) and, in concert with the gRNA molecule, locate (eg, targeting or addressing) a site comprising a target sequence and a PAM sequence. In one embodiment, the Cas9 molecule is capable of cleaving a target nucleic acid molecule, which may be referred to herein as active Cas9 molecule. In one embodiment, an active Cas9 molecule comprises one. or more of the following activities: a-nickase activity, ie, the ability to cleave a single strand, eg, the non-complementary strand or the complementary strand, of a nucleic acid molecule; a double-stranded nuclease activity, ie, the ability to cleave both strands of a double-stranded nucleic acid and create a double-stranded break, which in one embodiment is the presence of two nickase activities; an endonuclease activity; an exonuclease activity; and a helicase activity, ie, the ability to unwind the helical structure of a double-stranded nucleic acid. In one embodiment, an enzymatically active Cas9 molecule cleaves both strands of DNA and results in a double-strand break. In one embodiment, a Cas9 molecule cleaves only one strand, eg, the strand to which the gRNA hybridizes, or the strand complementary to the strand to which the gRNA hybridizes. In one embodiment, an active Cas9 molecule comprises cleavage activity associated with an HNH-like domain. In one embodiment, an active Cas9 molecule comprises cleavage activity associated with an N-terminal UV-c-like domain. In a. embodiment, an active Cas9 molecule comprises cleavage activity associated with an HNH-like domain and cleavage activity associated with an N-terminal UV-c-like domain. In one embodiment, an active Cas9 molecule comprises an active or cleavage-competent, HNH-like domain and an inactive or cleavage-incompetent, N-terminal RuvC-like domain. In one embodiment, an active Cas9 molecule comprises an inactive, or cleavage-incompetent, HNH-like domain and an active, or cleavage-competent, N-terminal RuvC-like domain. In one embodiment, the ability of an active Cas9 molecule to interact with and cleave a target nucleic acid is dependent on the PAM sequence. A PAM sequence is a target nucleic acid sequence itself. In one embodiment, cleavage of the target nucleic acid occurs upstream of the PAM sequence. Active Cas9 molecules from different bacterial species can recognize different sequence motifs (eg, PAM sequences). In one embodiment, an active Cas9 molecule from S. 'pyogenes recognizes e! motif of the NGG sequence and directs cleavage of a target nucleic acid sequence 1 to 10, eg, 3 to 5, base pairs upstream of that sequence. See for example. Mali el al, SCIENCE 2013; 3 39(6121): 82'3-826. In one embodiment, an active Cas9 molecule from S. thermophilus recognizes the NGGNG and NNAG AAVV (,W-A or T) sequence motif and directs cleavage of a target nucleic acid core sequence 1 to 1.0, eg, 3 to 5, base pairs upstream of these sequences. See, eg, Horvath et al., SCIENCE 2010; 327(5962): 167-170, and Déveau eral, J BACTERIOL 2008; 190(4): 1390- 14QÓ. In one embodiment, an active S. mülans Casó molecule recognizes the NGG or NAAR (R-A or G) sequence motif and directs cleavage of a target nucleic acid core sequence 1 to 10, eg, 3 5 base pairs upstream of this sequence. See, eg, Deveau et al., J BACTERIOL 2008; 190(4): 1390-1400- In one embodiment, a molecule. Active Cas9 from S. aureus recognizes the NNGRR sequence motif (R = A or G) and directs cleavage of the target nucleic acid sequence 1 to 10, eg, 3 to 5, base pairs upstream of that sequence. See, for example, Ran F, et al., NATURE, vol. 520, 201.5, ρρ, 186-191. In one embodiment, an active N. meningitidis Cas9 molecule recognizes the NNNNGATT sequence motif and directs cleavage of the target nucleic acid sequence 1 to '1.0, for example. 3 to 5., base pairs upstream of that sequence. See, for example, Hou et al, PNAS EARLY EDITION 2013, 1-6. The ability of a Cas9- molecule to recognize a PAM sequence can be determined, for example, using a. test.de teansíórmación described in. Jinek et al, SCIENCE 2012, 337:816. Some Cas9- molecules have the ability to interact with a gRNA molecule, and in conjunction with the gRNA molecule. they address (eg, target or localize) to a central target domain, but are unable to cleave the target nucleic acid, or unable to cleave at efficient rates. Cas9 molecules that do not have or do not have substantial cleavage activity may be referred to in the. present inactive Cas9 (enzymatically inactive Cas9), dead Cas9 or a dCas molecule. For example, an inactive Cas9 molecule may lack cleavage activity or have substantially less, eg, less than 20, 10, 5, 1, or 0.1% of the cleavage activity of a "reference" Cas9 molecule as measured by assay described herein.Examples of natural Cas9 molecules are described in Cbylinski et al, RNA Biology 2013;1():5, 727-737.Such Cas9 molecules include Cas9 molecules from typhus bacterial family of duster 1, bacterial family of duster 1, duster 2. bacterial family of cluster 3. bacterial family of cluster 3, family, bacterial of cluster 5, bacterial family of cluster 6, bacterial family of cluster 7, bacterial family of cluster 8, bacterial family of cluster 9, bacterial family of cluster duster 10, bacterial family, of duster 1.1, bacterial family of duster 12, bacterial family, of cluster 13, bacterial family of cluster 14, bacterial family of cluster 15. bacterial family of duster 16, bacte family riana of duster 17, bacterial family of cluster 18, bacterial family of cluster 19, bacterial family of cluster 20, bacterial family of. cluster 21, bacterial family of cluster 22, bacterial family of duster 23, bacterial family of duster 24, bacterial family of duster 2.5, bacterial family of cluster 26, bacterial family of duster 27, bacterial family of cluster 28, bacterial family of duster 29 , bacterial family of duster 30, bacterial family of cluster 31, bacterial family of duster 32, bacterial family of cluster 33, bacterial family of duster 34, bacterial family of cluster 35, bacterial family of duster 36, bacterial family of cluster 3 7, cluster 38 bacterial family, duster 39 bacterial family, duster 40 bacterial family, duster 41 bacterial family, cluster 42 bacterial family, duster 43 bacterial family, cluster 44 bacterial family, duster 45 bacterial family, bacterial family from cluster 46, duster bacterial family 47, duster bacterial family 48, duster bacterial family 49, bacterial family, from cluster 50, bacterial family of cluster 51, bacterial family of cluster 52, bacterial family of duster 53, .bacterial family of duster 54, bacterial family of cluster 55, bacterial family of cluster 56, bacterial family of cluster 57, bacterial family of cluster 58, bacterial family of duster .5'9, bacterial family of cluster 60, bacterial family of duster 61, bacterial family of duster 62, bacterial family of cluster 63, bacterial family of duster 64, bacterial family of cluster 65, bacterial family of duster 66, bacterial family of duster 67, bacterial family, of duster 68, bacterial family of cluster 69, bacterial family of cluster 70, bacterial family of cluster 71, bacterial fairilia of cluster 72, bacterial family of cluster 73, bacterial family of cluster 74, bacterial family of cluster 75, bacterial family of cluster 76, bacterial family of. cluster 77, or cluster 78 bacterial family. Examples of natural Casó molecules include a Casó molecule from the bacterial cluster 1 family. Examples include a Casó molecule from: S. pyogenes (eg, strain SF370, MGAS .10270, MGAS 10750, M.GAS2096, MGA.S315 , MGASbOOS, MGAS6180, MGAS9429, NZ13 i and SSI-1), S. thermopbilus (eg strain LMD-9), S. pseudoporcinus (eg strain SPIN 20026), S. mutans (eg strain UA 159, ΝΝ2Θ25Χ S. macacae (eg strain NCTC1 1558), S. gallolylicus (eg strain UCN34, ATCC BAA-2069), S. equine-s (eg strain ATCC 9812, MGCS 124), S. dysdalaetiae ( strain GGS 124), S. bovts (eg strain ATCC 700338), S. eruginosas (eg strain F021 1'), S. agalactia* (eg strain NEM216, A909), Listeria mouocytogenes (for example, strain F6854), Listeria innocua (for example, L. innocua, strain Clip I 1262), EtUerococcus italicus (for example, strain DSM 15952), or Enterococcus faecium (for example, strain 1,231,408). examples of molec ulas Casó are a Casó molecule of Neísseria meningitidís (Hcm efal. PNAS Early Edition 2013, l -6) and a Casó molecule of S. aureus. In a. embodiment, a Casó molecule, eg, an active Casó molecule or an inactive Casó molecule, comprises an amino acid sequence: having 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology: differs by no more than .1%, 2%, 5%, 10%, .15%, 20%, 30%, or 40% of amino acid residues compared to; differs by at least 1,2, 5,10, or 20 amino acids but by no more than 100, 80, 70, 60, 50, 40, or 30 amino acids from; or is identical to; any Cas9 molecule sequence described herein or a natural Casó molecule sequence, eg, a Casó molecule of the species listed herein or described in Chylinski. et al., RNA Biology 2013, ÍO:5,'IZI-T,.l Hou et al. PNAS Early Edition 2013, 1-6. In one embodiment, a Casó molecule comprises an amino acid sequence that is 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%. or 99% homology; differs by no more than 1%, 2%, 5%, 10%, 15%, 20%, 30%, or 40% of the amino acid residues compared to; differs by at least 1, 2, 5, 10, or 20 amino acids but by no more than 100, 80, 70, 60, 50, 40, or 30 amino acids from; or is identical to; S. pyogenes Cas9: Met Asp Lys Lys Tyr Ser lie Gly Leu Asp lie Gly Thr Asn Ser Val 1 5 1015 Gly Trp Ala Val lie Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 2530 Lys Val Leu Gly Asn Thr Asp Arg Bis Ser lie Lys Lys ñán Lea lie 35 4045 Gly Ala Leu Leu Phe Asp .Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 5560 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asa Arg lie Cys 6 5 70 7580 Tyr Leu Gln Glu lie Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 85 9095 Phe Phe His Arg Leu Glu Glu Ser phe Leu Val Glu Glu Asp Lys Lys 100 105110 His Glu Arg His Pro He Phe Gly Asn lie Val Asp Glu Val. Wing Tyr 115 120125 His Glu Lys Tyr Pro Thr He Tyr His Leu Arg Lys Lys Leu Val Asp 130 135140 Ser Thr Asp Lys Ala Asp Leu Arg Leu lie Tyr Leu Ala Leu AlaHis 145 150 155160 Met lis Lys Phe Arg Gly His Phe Leu He Glu Gly Asp Leu AsnPro 165 17017S Asp Asn Ser Asp Val Asp Lys Leu Phe He Gln Leu Val Gln Thr Tyr 180 185190 Asn Gln Leu Phe Glu Glu Asn Pro He Asn Ala Ser Gly Val Asp Ala 195 200,205 Lys Ala He Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 21522 0 Leu He Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe GlyAsn. 225 23 0 23 52:40 Leu He Ala. Leu Se.r Leu Gly Leu Thr Pro Asn Phe Lys Ser AsnPhe 245 250255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265270 .Asp Asp Leu Asp Asn Leu Leu Ala Gln He Gly Asp Gln Tyr Ala Asp 275 280285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala lie Leu Leu Ser Asp 290 295300 He He Leu Arg Val Asn Thr Glu He Thr Lys Ala Pro Leu Ser AlaSer 305 310 315320 Met He Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu LeuLys 3 25 33 03.35 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu He Phe Phe 340 345350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr lie Asp Gly Gly Ala. Be 355 3 603 65 Gln Glu Glu. Phe Tyr Lys Phe lie Lys Pro lie Leu Glu Lys Met Asp 3 70 375380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu LeuArg 385 390 395400 Lys Gln Arg Thr Phe .Asp Asn Gly -Ser He Pro His Gln lie HisLeu 405 410415 Gly Glu Leu His Wing He lie Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425430 Leu Lys Asp Asn .Arg Glu Lys lie Glu Lys He Leu Thr Phe Arg i le 435 440445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Tro 450 455460 Met Thr Arg Lys Ser Glu Glu Thr lie Thr Pro Trp Asn Phe GluGlu 465 470 475480 Va.1 Val Asp Lys Gly Allah Ser Ala Gln Ser Phe lie Glu Arg MetThr 485 490495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 .505510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520525 Tyr Val Thr Glu. Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu. Gln 530 535540 Lys Lys Ala He Val Asp Leu Leu Phe Lys Thr Asn Arg Lys ValThr 545 550 555560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys He Glu Cys PheAsp 565 570575 Ser Val Glu He S.er Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585590 Thr Tyr His Asp Leu Leu Lys He He Lys Asp Lys Asp Phe Leu Asp 595 600605 Asn Glu Glu Asn Glu Asp lie. Leu Glu Asp He Val Leu Thr Leu Thr 610 615620 Leu Phe Glu Asp Arg Glu Met He Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg ArgTyr 645 650655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu He Asn Gly He Arg Asp 660 665670 Lys Gln Ser Gly Lys Thr He Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680685 Ala Asn Arg Asn Phe Met Gln Leu lie His Asp Asp Ser Leu Thr Phe 690 695700 Lys Glu Asp He Gln Lys Ala Gln Val Ser Gly Gln Gly Asp SerLeu 705 710 715720 His Glu His He Ala. Asn Leu Ala Gly Ser Pro Ala lié Lys LysGly '72 5 73 073 5 He He Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745750 Arg His Lys Pro Glu Asn lie Val He Glu Met Ala Arg Glu Asn Gln 755 760765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Mefc Lys Arg He 770 775780 Glu Glu Gly He Lys Glu Leu Gly Ser Gln He Leu Lys Glu HisPro 785 790 795800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr TyrLeu 805 810815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp He Asn Arg 820 825830 Leu Ser Asp Tyr Asp Val Asp His He Val Pro Gln Ser Phe Leu Lys 835 840845 A,sp Asp Ser lie Asp Asn Lys Val. Leu Thr Arg Ser Asp Lys Asn Arg 850 855860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys MetLys 8 6 5 8 7 0 3 7 5880 A8n Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu lie Thr Gln ArgLys 885 890895 Phe .Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905910 Lys Aía Gly Phe He Lys Arg Gln Leu. Val Glu Thr Arg Gln He Thr .915 92 0925 Lys ais Val Ala Gln He, Leu Asp Ser Arg Meb Asn Thr Lys Tyr Asp 930 93594 0 Glu Asn Asp Lys Leu He Arg Glu Val Lys Val He Thr Leu LysSer 945 950 955960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys ValArg 965 970975 Glu He Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985990 val Gly Thr Ala Leu lie Lys Lys lyr Pro Lys Leu Glu Ser Gln Phe 995 10001005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met He Ala Lys 1010 10151020 Ser Glu Gln Glu He Gly Lys Ala Thr Ala Lys Tyr Phe Phe TyrSer 1025 1030 10351040 Asn He Met Asn Phe Phe Lys Thr Glu lié Thr Leu Ala. Asn GlyGlu 1045 10501055 He He Arg Lys Arg Pro Leu He Glu Thr Asn Gly Glu Thr Gly Glu He 1060 10651070 Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys val Leu Ser 1075 10801085 Met Pro Gln Val. Asn He Val Lys Lys Thr Glu Val Gln Thr Gly Gly 1090 10951100 Phe Ser Lys Glu Ser He Leu Pro Lys Arg Asn Ser Asp Lys LeuHe 1105 1.110 11151120 Ala Arg' Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe AspSer 1125 11301135 Pro Thr Val Ala Tyr Ser val Leu Val Val Ala Lys val Glu Lys Gly 1140 11451150 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly He Thr He 1155 11601165 Met Glu Arg Ser Ser Phe Glu Lys Asn Pro He Asp Phe Leu Glu Ala 1170 11751180 Lys Giy Tyr Lys Glu Val Lys Lys Asp Leu He He Lys Leu ProLys H8 5 1190 1195 12 0 0 Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu AlaSer x205 12101215 Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr 1220 12251230 Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 12401245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His 1250 12551260 Tyr Leu Asp Glu He He Glu Gln He Ser Glu Phe Ser Lys ArgVal 1265 1270 12751280 He I Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr AsnLys 1285 12SO1295 His Arg Asp Lys Pro He Arg Glu Gln Ala Glu Asn He lie His Leu 1300 13051310 Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1315 13201325 Thr Thr He Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp 1330 13351340 Ala Thr Leu He His Gln Ser He Thr Gly Leu Tyr Glu Thr Arg He 1345 1350 13551360 Asp Leu Ser Gln Leu Gly Gly Asp 1365 (Id. Sec. No. 205) In certain embodiments, the Cas? is «na variant of Cas? from S. pyogenes SEQ ID NO: 205 that includes one or more positively charged amino acid mutations (eg, lysine, arginine, or histidine) that introduce an uncharged or nonpolar amino acid, eg, , alanine, in that position. In certain embodiments, the mutation is to one or more positively charged amino acids in the Cas? nt-groove. In certain embodiments, the Cas? is a variant of Cas9 of S, pyogenes of ia Id, of Seq. No.: 205 that includes a mutation at position 855 of Seq. Id. No.: 205, for example a mutation to an uncharged amino acid, for example, alanine, at position 855 of SEQ ID NO: 205. In certain embodiments, the Cas? has a mutation only at position 855 of SEQ ID NO: 205, en. relation to Seq.ID No.: 205, eg to an uncharged amino acid, eg alanine. In certain embodiments, the Cas? is it a variant of Cas? of S, pyogenes of Sec. Id. #: 205 that includes a mutation at position 810,: a mutation at position 1003, and / or an information at position 1060 of SEQ ID #: .2()5, for example a mutation to alaain at position 810, position 1003, and / or position 1060 of SEQ ID NO: 205. In certain embodiments, the Cas9 molecule has a mutation only at position 810, position 1003, and position 1060 of. Seq ID No.: 205, in relation to Seq ID No.: 205, for example, where each. mutation is to an uncharged amino acid, eg, afemin. In certain embodiments, the Cas9 molecule is a variant of Cas9 from S, pyogenes of SEQ ID NO: 205 that includes a mutation at position 848, a mutation at. position 1003. and / or one. mutation in position. 1060 of SEQ ID NO: 205, for example - a mutation to alan'ma at position 848, position 1003, and / or position 1060 of SEQ ID NO; 205. In certain embodiments, the Cas9 molecule has a mutation only at position 848, position 1003, and position 1060 of Seq. Id. No.: 205, relative to Seq. Id. No. .: 205, for example, where each mutation is to an uncharged amino acid, eg, alanine. In certain embodiments, the. Cas9 molecule is a Cas9 molecule as described in Siaymaker et al. Science Express available online from-el. December 1, 2015 in Science DOI: 10.1126 / science.aad5227. In certain embodiments, the Cas9 molecule is a variant of Cas9 from S, pyogenes from lald. Sec. No.: · 205 that includes one or more mutations. In certain embodiments, the Cas9 variant comprises a mutation at position 80 of Seq. Id. No.: 205, eg, includes a leucine at position 80 of Seq. Id. SEQ ID NO: 205 (ie, comprises, eg, is composed of, SEQ ID NO: 205 with a C80L mutation). In certain embodiments, the Cas9 variant comprises a mutation at position 574 of the. SEQ ID NO: 205, for example, includes a glutamic acid at position 574 of ia SEQ ID NO: 205 (i.e., comprises, for example, is composed of, SEQ ID No.: 205 with a C574E mutation). In certain embodiments, the Cas9 variant comprises a mutation at position 80 and a mutation at position 574 of SEQ ID NO: 205, eg, includes a leucine at position .80 of Id. SEQ ID NO: 205, and a glutamic acid at position 574 of SEQ ID NO; 205 (ie, comprises, eg, is composed of, SEQ ID NO: 205 with a C80L mutation and a CS74E mimic). Without wishing to be bound by theory, it is believed that such mutations improve the solution properties of the Cas9 molecule. In certain embodiments, the Cas9 molecule is a Cas9 variant of S, pyogenes of SEQ-ID No.: 205 that includes one or more mutations. In certain embodiments, the Casó variant comprises a mutation in. position 147 of ia SEQ ID NO: 205, for example, includes a tyrosine at position 147 of SEQ ID NO: 205 (i.e., comprises, for example, is composed of, the SEQ ID NO: 205 with a D147Y mutation). In certain embodiments, the Cas9 variant comprises one. mutation in the position 41 I of SEQ ID NO: 205, for example, includes a threonine at position 411 of SEQ ID NO: 205 (i.e., comprises, for example, is composed of, the SEQ ID NO: 205 with a P41 IT mutation). In certain embodiments, the Cas9 variant comprises a mutation at position 147 and a mutation at position 411 of SEQ ID NO: 205, eg, includes a tyrosine at position 147 of ld. No.: 205, and a threonine at position 411 of Seq. ID No.: 205 (i.e., comprises, e.g., is composed of, Seq. No.: 205 with a DI47Y mutation and a P41 IT mutation). Without wishing to be bound by theory, it is believed that such mutations improve the targeting efficiency of the Casó molecule, for example, in yeast. In certain embodiments, the Cas9 molecule is a variant of Casó de S, pyogenes of SEQ ID NO: 205 that includes one or more mutations. In certain embodiments, the variant of. Casó comprises a mutation at position 1135 of Seq. Id. No.: 205, for example, includes a glutamic acid at position 1135 of Seq. Id. No.: 205 (i.e., comprises, for example, example, is composed of, SEQ ID NO: 205 with a mutation of DI 135E), Syn. While wishing to be bound by theory, such mutations are believed to enhance the selectivity of the Casó molecule for the NGG PAM sequence versus the NAG PAM sequence. In certain embodiments, the Casó molecule is a Casó variant of S, pyogenes SEQ ID NO: 205 that includes one or more mutations that introduce an uncharged or nonpolar amino acid, eg, alanine. , in certain positions. In certain embodiments, the Casó molecule is a Casó variant of S, pyogenes of SEQ ID NO: 205 that includes a mutation at position 497, a mutation at position. 661, a mutation at position 695 and / or a mutation at position 926 of SEQ ID NO: 205, for example a mutation to alanine at position 497, position 661, position 695 and / or position 926 of SEQ ID NO: 205. In certain embodiments, the Casó molecule has a mutation only at position 497, la. position 661, position 695, and position 926 of SEQ ID NO: 205, relative to SEQ ID NO: 205, for example, where each mutation is to an uncharged amino acid, for example, alanine. Without wishing to be bound by theory, it is believed that such mutations reduce cleavage by the Casó molecule at undesired sites. It will be understood that the mutations described aqtii for the molecule. Casó can be combined, and can be combined with, any of the fusions or other modifications described herein, and the Casó molecule tested in the assays described herein. Various types of Cas molecules can be used to practice the inventions described herein. In some embodiments, Cas molecules from Π-type Cas systems are used. In other embodiments, Cas molecules from other Cas systems are used. For example, type I or type III Cas molecules can be used. Examples of Cas molecules (and Cas systems) are described, for example, in Haft et al, PLoS COMPUTATIONAL BIOLOGY 2005, 1(6):eoO and Makarova et al, NATURÉ RÉVIEW MICROBIOLOGY 201 1, 9:467-477, documents which are fully incorporated herein by reference. In one embodiment, the Casó molecule comprises one or more of the following activities: a nickase activity; a double-stranded cleavage activity (eg, an endonuclease and / or exonuclease activity); an a-helical activity; or the ability, in conjunction with a gRNA molecule, to target tm target nucleic acid. Cas molecules? altered Naturally occurring Casó molecules possess a number of properties, including: nickase activity, nuclease activity. (eg, endonuclease and / or exonuclease activity): hellcase activity; the ability to associate fimeionaímenie with one. gRNA molecule: and the. ability to target (or locate) a site on a nucleic acid' (eg, PAM recognition and specificity). In one embodiment, a Casó molecule may include all or a subset of these properties. In typical embodiments, Cas9 molecules have the ability to interact with a gRNA molecule and, in concert with the gRNA molecule, localize to a site on a nucleic acid. Other activities, eg, FAM-specificity , cleavage activity or helicase activity may vary more widely in Cas9 molecules. Cas9 molecules with the desired properties can be obtained in a number of ways, for example by altering a parent element, eg natural Cas9 molecules to provide a Cas? molecule. altered having a desired property. For example, it is possible to introduce one or more mutations or differences relative to a parent Cas9 molecule. Such mutations and differences comprise; substitutions (eg, conservative substitutions or non-essential amino acid substitutions); inserts; or delec-ions. In one embodiment, a Cas? may comprise one or more mutations or differences, for example at least 1,2, 3,4, 5, 10, 15, 20,30,40 or 50 mutations but less than 200,100, or 80 mutations in relation to a molecule Cas? reference. In a. embodiment, a mutation or mutations do not have a: substantial effect on a Cas9 activity, eg, a Cas9 activity described herein. In one embodiment, one or more mutations have a substantial effect on a Cas9 activity, eg, a Cas9 activity described herein. In one embodiment, examples of activity comprise one or more of PAM specificity, cleavage activity, and helicase activity. One or more mutations may be present, for example, in: one or more RuvC-like domains, eg, a RuvC N~tennin1-like domain; an HNH-like domain; a region outside the RuvCs-like domain and the HNH-like domain. In some embodiments, one or more mutations are present in an N-terminal RuvC-like domain. In some embodiments, one or more mutations are present in an HNH-like domain. In some embodiments, the mutations are present in an N-terminal UV-c-like domain. and an HNH-like domain. Whether or not a particular sequence, for example a substitution, may or may not affect one or more activities, such as targeting activity, cleavage activity. etc., can be evaluated or predicted, for example, by evaluating whether the mutation is conservative or by the method described in Section III. In one embodiment, a. "non-essential" amino acid residue, as used in the context of a Cas9 molecule, is a residue that can be altered from the sequence of a Cas? wild type, e.g., a natural C-as9 molecule, e.g., an active Cas9 molecule, without abolishing or-more preferably, without substantially altering a Cas9 activity (e.g., cleavage activity), while the change an "essential" amino acid residue results in a substantial loss of activity (eg, cleavage activity). Cas9 molecules with impaired PAM recognition or no PAM recognition The Cas molecules? naturally-occurring can recognize specific PAM sequences, eg, the FA.M recognition sequences described above for §. pyogenes, S. thermophius, S. mutans, S. aureus, and N. memngitidis. In one embodiment, a Casó molecule has the same PAM specificities as a native Cas9 molecule. In: other embodiments, a Cas9 molecule has a PAM specificity not associated with a wild-type Cas9 molecule, or a PAM specificity not associated with the wild-type Casó molecule with which it has the closest sequence homology. For example, a natural .Casó molecule can be altered, - eg, to alter PAM recognition, eg, to alter the PAM sequence that the Casó molecule recognizes to decrease target sites and / or improve specificity; or remove a PAM acknowledgment requirement. In one embodiment, a Cas9 molecule can be altered, for example, to increase the length of the PAM recognition sequence and / or enhance Casó specificity to a high level of identity to decrease target sites and increase specificity. . In one embodiment, the length of the PAM recognition sequence is at least 4, 5, 6, 7, 8, 9, 10, or 15 amino acids in length. Casó molecules that recognize different PAM sequences and / or have reduced off-target activity can be generated using directed evolution. Examples of methods and systems that can be used for the directed evolution of Casó molecules are described, for example, in Esvelt et al, Nature 2011, 472(7344): 499-503, Candidate Casó molecules can be evaluated, for example, at through the methods described herein. Casó molecules without cleavage and with modified cleavage In one embodiment, a Casó molecule comprises a cleavage property that differs from naturally occurring Casó molecules, eg, differing from the naturally occurring Casó molecule having the closest homology. For example, a Casó molecule may differ from natural Casó molecules, eg, a Casó molecule from S. pyogenes, in the following way; its ability to modulate, eg, less or greater cleavage of a double-stranded break (endonulease and / or exonenulease activity), eg, compared to a naturally occurring Casó molecule (eg, a Cas9 molecule from S. pyogenes); its ability to modulate, e.g. less or more, cleavage of a single strand of a nucleic acid, e.g. a non-complementary strand of a nucleic acid molecule or a complementary strand of a nucleic acid molecule (nickase activity), eg, compared to a naturally occurring Casó molecule (eg, a Casó molecule from S. pyogenes); or the ability to cleave a nucleic acid molecule, eg, a double-stranded or single-stranded nucleic acid molecule, may be eliminated. Casó active molecules with modified cleavage In one embodiment, an active Casó molecule comprises one or more of the following activities: cleavage activity associated with an N-terminal UV-c-like domain; cleavage activity associated with an HNH-like domain; cleavage activity associated with an HN'H domain and cleavage activity associated with an N-terminal UV-c-like domain. In one embodiment, the Casó molecule is a Casó nickase, eg, it cuts only one strand of DNA. In one embodiment, the Casó nickase includes a mutation at position 10 and / or a mutation at position 840 of SEQ ID NO: 205. For example, it comprises a D10A and / or H840A mutation in the ld of Sec. No.: 205. Inactive Cas9 Molecules Without Cleavage In a. embodiment, the altered Cas9 molecule is an inactive Casó molecule that does not cleave a nucleic acid molecule (double-stranded or single-stranded nucleic acid molecules) or that cleaves a nucleic acid molecule with significantly less efficiency, e.g., less than 20.10, 5.1, or 0.1% of the ., cleavage activity of a reference Case molecule, eg, as measured by the assay described herein. The reference Casó molecule may be a naturally occurring unmodified Casó molecule, eg, a naturally occurring Casó molecule such as a Casó molecule from S. pyogenes, S. thermopbiius, :S. aureus or N. meningitidis. In one embodiment, the reference Casó molecule is the natural Casó molecule which has the closest sequence identity or homology. In one embodiment, the inactive Casó molecule lacks substantial cleavage activity associated with an N-terminal RuvC-like domain and cleavage activity associated with a tm HNH-like domain. In one embodiment, the Casó molecule is dCasÓ. Tsayet al. (2014), Nal. Biotecb. 32:569-577. A catalytically inactive Casó molecule can fuse with a transcriptional repressor. An inactive Casó fusion protein complexes with a gRNA and localizes to a DNA sequence specified by the -gRNA targeting domain, but, unlike an active Casó, it will not cleave the target DNA. Fusion of an effector domain, such as a transcriptional repression domain, into an inactive Case allows recruitment of the effector to any DNA site specified by the gRNA. Site-specific targeting of a Casó fusion protein to a promoter region of a gene can block or impair polymerase binding to the promoter region, for example, a Casó fusion with a transcription factor (eg, an activator of transcription), and / or a transcriptional enhancer binds to the nucleic acid to increase or inhibit transcriptional activation. Alternatively, site-specific targeting of a Caso- to a transcriptional repressor to a promoter region of a gene can be used to decrease transcriptional activation. Transcriptional repressors or transcriptional repressor domains that can be fused to an inactive Caso molecule may include the Kruppél associated domain (K.RAB or SKI)), the Mad m.SIN3 interaction domain (SID), or the ERE repressor domain. (ERDj. In another embodiment, an inactive Casó molecule can be fused with a protein that it modifies, chromatin. For example, an inactive Casó molecule can fuse with heterochromatin protein 1 (HP1), a histone Usin methyltransferase (eg, SUV39H1, SUV39H2, G9A, ESET / SETDB l, Pr-SET7 / 8, SUV4-2ΘΗ fiRIZl), a demediate lysine histone (e.g., LSDl / BHCi 10, SpLsdí / Sw, 1 / Safi 1Q, Su(var)3-3, JMJD2A / JHDM3A, JMTD2B, JMJD2C / GASC1, JMJD2D, Rpb I, JA.W 1 A / RBP2, JARl DÍB / PLU-I, JAR.1D IC / SMCX, JARID1 D / S-MCY, Lid, Jhr.2, Jmj2), a histone lysine deacetylase (eg, HDAC-l, HDAC2, HDAC3 , HDAC8, Rpd3, Hos I, Ciro, HDAC4, HDAC5, HD.AC7, HDÁCÓ, HdaL Cir3, SIRT I, SIR.T2, Sir2, Hst í,.Hst2, Hst3, Hst4, HDAC i 1 ) and a DNA methylase (DNMT1,DNM1'2a / DMNT3b, METI). Can a fusion protein of the chromatin-modifying molecule Cas? inactive to alter the state of chromatin to reduce the expression of a target gene. The heterologous sequence (eg, the transcriptional repressor domain) can be fused to the N- or C-terminus of the inactive Cas9 protein. In an alternative embodiment, the heterologous sequence (eg, the transcriptional repressor domain) can be fused to an internal portion (ie, a portion other than the N-terminus or C-terminus) of the Cas? protein. inactive. The ability of a Cas9 / gRNA molecule complex to bind to and cleave a target α-nucleic acid can be assessed, for example, by the methods described herein in Section ΠΪ. The activity of a Cas9 molecule, for example. Cas? active or inactive Cas.9, alone or in a complex with a gRNA molecule, can also be assessed by methods well known in the art, including gene expression assays and chromatin-based assays, for example, chromatin immunoprecipitation (ChiP) and in vivo chromatin assay (CiA). Other fusions of Cas9 molecules In certain embodiments, the Cas9 molecule, eg, a 6' pyogenes Cas9, may comprise relevant addition of one or more amino acid sequences that confer additional activity. In. some aspects, the molecule Cas? it may comprise one or more nuclear localization sequences (NLSs), such as at least 1,2, 3, 4, 5, 6, 7, 8, 9, 10, or more NLSs. In some embodiments, the Cas9 molecule comprises at least 1, 2, 3, 4, 5, 6, 7, B, 9, 10, or more NLSs at or near the amino terminus, at least 1. 2, 3,4,5,6,7,8,9,10, or more NLSs at or near the carboxy terminus, or a combination of these (for example one or more NLSs at the ami.no terminus and one or more NLSs at the term, carboxy). When more than one NLS is present, each may be selected independently of the others, such that a single NLS may be present in more than one copy and / or in combination with one or more other NI.S present in a or more copies. In some embodiments, an NLS is considered near the N- or C-terminus when the closest amino acid of the NLS is within about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50 or more amino acids along the polypeptide chain from the N- or C-terminus. Typically, an NLS is composed of one or more short sequences of positively charged .lysines or arginines displayed on the surface of the protein, but know of other types of NLS. Non-limiting examples of NLSs include an NLS sequence comprising or derived from: the NLS of the large T antigen of ! SV40 virus, having the amino acid sequence PKKKRKV (SEQ ID NO: 206); the lyuclecplasmin NLS (for example the bipartite nucleoplasmin NLS with the sequence KRPAATKKAGQAKKKK (SEQ ID NO: 207); the c-myc NLS having the amino acid sequence PAAKRVK.LD (SEQ ID NO. ; 208) or RQRRNELKR.SP (Seq ID No.: 209), and NLS hRNPAl M.9 having the sequence NQSSNFGPh4K.GGNFGGR.SSGPYGGGGQYFAKPRNQGGY (Seq ID No.: 210), the sequence RMRIZ. FKNKGKDTAELRRRRVEVSVELRKAKKDEQILK.R.RNV (Seq ID No.: 211) of domain 1B.B of alpha-importin, the sequences VSRK.RPRP (Seq ID No.: 212) and PPK.KA.RED (Id , Seq. No.: 213) of T myoma protein, the sequence PQPKKKPL (Seq. ID No.: 214) of human p53, the sequence SALIKKKKKKMAP (Seq. ID No.: 215) dec-abl IV from mouse, the sequences DRLRR (SEQ ID NO: 216) and PKQKKRK (SEQ ID NO: 217) of the influenza virus NS1, the sequence RKLKKKIKKL (SEQ ID NO: 217). ,No.: 218) of the hepatitis virus delta antigen: the sequence REKKKFLKRR (SEQ ID No.: 219) of the Mx protein mouse l; the sequence KRKGDEVDGVDEVAKKKSKK (SEQ ID NO: 220) from human poly(ADP-rjbose) polymerase; and the RKCLQAGMNLEARKTKK sequence (SEQ ID NO: 221) of steroid hormone glucocorticoid receptors (human). Other suitable NLS sequences are known in the art (eg, Sorokin. Biochemistry (Moscow) (2007) 72:13,1439-1457; Langa J Biol Chém. (2007) 282:8,5101-•5)· In one embodiment, the Casó molecule, eg, 8. pyogenes Cas9 molecule, comprises an SV4Q NLS sequence, eg, arranged N-terminally to the Casó molecule. In one embodiment, the Casó molecule, eg, Cas9 molecule from S. pyogenes,. it comprises an SV40 NLS sequence arranged N-terminally to the Casó molecule and an SV40 NLS sequence arranged C-terminally to the Casó molecule. In one embodiment, the Casó molecule, eg, S. pyogenes Cas9 molecule, comprises an SV40 NLS sequence arranged N-terminal to the molecule. married and one Nucleoplasmin NLS sequence arranged C-terminal to the Casó molecule. In any of the foregoing embodiments, the molecule may further comprise a tag, eg, a His tag, eg, a His(6) (SEQ ID NO: 247) or His(8) tag. ) (SEQ ID NO : 248), for example, in the N-term or the C-term, In some aspects, the Casó molecule may comprise one or more amino acid sequences that allow the Casó molecule to be specifically recognized, eg, a tag. In a. embodiment, the tag is a histidine tag, eg, a histidine tag comprising at least 3, 4, 5, 6, 7, 8.9, 10 or more histidine amino acids. In certain embodiments, the histidine tag is a Hiso (six histidine) tag (SEQ ID NO: 247). In other embodiments, the histidine tag is a His8 (eight histidine) tag (SEQ ID NO: 248). In certain embodiments, the histidine-tag may be separated from one or more parts of the Casó molecule by a linker. In certain embodiments, the linker' is GGS. An example of such a fusion is the Casó iProtl 06520 molecule. In some aspects, the Casó molecule may comprise one. or more amino acid sequences that are recognized by a protease (eg, comprise a protease cleavage site). In certain embodiments, the cleavage site is the tobacco etch virus (TEV) cleavage site, eg, comprising the sequence ENLYFQG (SEQ ID NO: 230). In some aspects the protease cleavage site, eg, the TEV cleavage site, is disposed between a tag, eg, a His tag, eg, an H.is6 tag (SEQ ID NO. : 247) or His8 (Seq. ID. No.: 248), and the rest of the Casó molecule. Without wishing to be bound by theory it is believed that such introduction will allow the use of the tag for, for example, purification of the Casó molecule, and subsequent cleavage such that the tag does not interfere with the function of the Casó molecule. In certain embodiments, the Casó molecule (eg, a Cas9 molecule as described) comprises an N-terminal NLS, and a C-terminal NLS (eg, comprises, N-terminal ά C- NLS-Cas9 -NLS), for example, where each NLS is a. NLS SV40 (PKKKRKV (Seq. ID No.: 206)). In certain embodiments, the Cas9 molecule (eg, a Cas9 molecule as described) comprises an N-terminal NLS, a C-terminal 'NLS, and a C-terminal His6 tag (SEQ ID NO / 247). (eg, comprising, N-terminal 3C-NLS-Cas9-NLS-tag.His), eg, wherein each NLS is a NLS SV40 (PKKK.RKV (SEQ ID NO: 206)). In certain embodiments, the Casó molecule (eg, a Cas9 molecule as described) comprises an N-terminal His tag (eg, Hisó tag (SEQ ID NO: 247)), an NLS N -terminal, and a C-terminal NLS (eg, comprising, N- to C-terminal His-tag~NI..S-Cas9-NLS), eg, wherein each NLS is a SV40 NLS (PKKK.RKV (Seq. ID No.: 206)). In certain embodiments, the Cas9 molecule (eg, a Casó molecule as described) comprises an N-terminal NLS and a C-terminal His tag (eg, Hisó tag (SEQ ID NO: 247) ) (eg, comprises N- to C-terminal His-Cas9-NLS tag), eg, wherein the NLS is an SV40 NLS (PKKKRKV (SEQ ID NO: 206)). In certain embodiments, the Cas9 molecule (eg, a Cas? molecule as described) comprises an N-terminal NLS and a C-terminal His tag (eg, Hiso tag (Seq. Id. No.: 247 )) (eg, comprising N- to C-terminal NLS-Cas9-His tag), eg, wherein the NLS is an SV40 NLS (PKKKRKV (SEQ ID NO: 2(16)). In certain embodiments, the Cas[alpha] molecule (eg, a Cas9 molecule as described) comprises an N-terminal His tag (eg, His8 tag (SEQ ID NO: 248)), a N-terminal cleavage (e.g., a tobacco etch virus (TEV) cleavage domain (e.g., comprises the sequence ENLYFQG (Seq. Id. No: 230))), an N-terminal NLS (e.g., an NLS :SV40; SEQ ID NO: 206), and a C-terminal NLS (for example, an NLS SV40; SEQ ID NO: 206) (for example, comprises of the N-terminal - a C-tag His-TEV-NLS-Cas9-NLS).In any of the embodiments p Cas9 has the sequence of SEQ ID NO: 205. Alternatively, in any of the aforementioned embodiments, Cas9 has the sequence of a Cas9 variant of SEQ ID NO: 205, for example, as described. In any of the foregoing embodiments, the Cas9 molecule comprises a linker between the His tag and another portion of the molecule, eg, a GGS linker. The amino acid sequences of examples of Cas? described above are provided below. The "i"Prot" identifiers match those in Figure 60. iProtl 05026 (also called iProtlOól54, iProtl 0633'1, iProtlO'6545, and PID426303, depending on the -protein preparation) (Seq. ID No. .: 233): MAPKKKRKVD KKYSIGLDIG TNSVGWAV1T DEYKVPSKKF KVLGNTDRHS IKKNLIGALL FDSGETAEAT RLKRTARRRY TRRKNRICYL QEIFSNEM.AK VDDSFFHRLE ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMI KFR.GHFLIEG DLNPDNSDVD KLFIQLVQTY NQLFEENPIN ASGVDAKAIL SARLSKS'RRL ENLIAQLPGE KKNGLFGNLI ALSLGLTPNF KSNFD.LAEDA KLQLSKDTYD DDLDNLLAQI GDQYADLFLA AKNLSDA1LL S.DILRVNTEI TKAPLSASMI KRYDEHHQDL TLLKALVRQQ LPEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKPILEK MDGTEELLVK LNREDLLRKQ RI'FDNGSIPH QIHLGELHAl LRRQEDFYPF LKDNREK1EK ILTFRIPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASAQSF1 ERMTNFDKNL PNEKVLPKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKAJVDLL FKTNRKVTVK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKIJK DKDFLDNÉÉN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLA.GSPA IKKG1LQTVK VVDELVKVMG RHKPENIVIE MARENQTTQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGR.DM YVDQELDINR LSDYDVDHIV PQSFLKDDSI DNKVLTRSDK NRGKSDNVPS EEVVKKMKNY WRQLLNAKLI TQRKFDNLTK. AERGGLSELD KAGFIKR.QLV ETRQITKHVA QILDSRMNTK YDENDKLIRE VKVITLKSKL VSDFRKDFQF YK.VREINNYH HAHDAYL.NAV VGTALIKKYP KLESEFVYGD YKVYDVRKMÍ AKSEQEIGKA TAKYFFYSN1 MNFFKTEITL ANGEIRKRPL ffi'INGETGEI VWDKGRDFAT VRKVí.SMPQV NIVKKTEVQT GGFSKESILP KRNSDKLIAR KKDWDPKKYG GFDSPTVAYS VLVVAKVEKG KSKKLKSVKE LLGITIMERS SFEKNPIDFL EAKGYKEVKK DUIKLPKYS LFELENGRKR MLASAGELQK GNELALPSKY VNFLYLASHY EKLKGSPEDN EQK.QLFVEQH K.HYLDEIIEQ ISEFS.KRVIL ADANLDKVLS AYÑKHRDKPI REQAENOHL FTLTNLGAPA- AFKYFDTT1D RKRYTSTKEV LDATLIHQSI TGEYEERIDL SQLGGDSRAD PKKKRKVHHH HHH iProtl065l8 (Seq ID No.: 234): MAPKKKRKVD KKYSIGEDIG TNSVGWAV1T DEYKVPSKKF KVI..GNTDRHS IKKNLIGALL EDSGETAEAT RI.RRTARR.RY TRRKNRILYL QE1FSNEMAK VDDSFFHRLE ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMI KFRGHFLIEG DLNPDNSDVD KLFIQLVQTY NQLFEENPTN. ASGVDAKAIL SARLSKSRRL ENLÍAQLPGE KKNGLFGNLI ALSLGLTPNF KSNFDIAEDA KLQI..SKDTYD DDLDNLLAQI GDQYADLFLA AKNLSDAILL SDILRVNTEI IKAPLSASMI KRYDEFLHQDL TLLKALVRQQ LPEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKPII.EK MDGTEELLVK LNREDLLRKQ RTFDNGSIPH QIHI.GELHAI LRRQEDFYPF LKDNREKIEK ILTFRJPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASAQSFI ERMIWDKNL PNEKVLPKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKK.ÁIVDLL FKTNRKVTVK QLKEDYFKKI EEFDSVEISG VEDRFNASLG TYHDLLKIIK DKDFLDNEEN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA IK.KG1LQTVK VVDELVKVMG RHKPENIVIE MARENQTTQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGRDM YVDQELDINR. LSDYDVDHIV PQSFLKDDSI DNKVLTRSDK NRGKSDNVPS EEVVKKMKNY WR.QLLNAKLI TQ.RKFDNLTK AERGGLSELD KAGFIKRQLV ETRQÍTKHVA QILDSRMNTK YDENDKL1RE VKVITLKSKL VSDFRKDFQF YKVREINNYH HAHDÁYLNAV VGTALIKKYP KEESEFVYGD YKVYDVRKMI AKSEQEIGKA TAKYFEYSNI MNFFKTEÍTL ANGEIRKKPL 1ETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP KRNSDKLIAR KKDWDPKKYG GFDSPTVAYS VLVVAKVEKG KSKKL.KSVKE LLG1TIMERS SFEKNPIDFL EAKGYKEVKK DLIIKLPKYS LFELENGRKR MLASAGELQK. 235 MGSSHHHHHH HHENLYFQGS MDKKYSIGLD 1GTNSVGWAV 1TDEYKVPSK KFKVLGNTDR HSIKKNLIGA LLFDSGETAE ATRLKRTARR RYTRRKNRIC YLQEIFSNEM AKVDDSFFHR LEESFLVEED KKHERHP1FG N1VDEVAYHE KYPTIYHL.RK KLVDSTDKA'D LRLIYLALAH MIKFRGHFLI EGDLNPDNSD VDKLFIQLVQ TYNQLFEENP INASGVDAKA ILSARLSKSR RLENLIAQLP GEKKNGLFGN UALSI..GLTP NFKSNFDLAE DAKLQLSKDT YDDDLDNLLA QIGDQYADLF LAAKNLSDA1 LLSDILRVNT EITKAPLSA8 MIKRYDEHHQ DLTLLKALVR QQLPEKYKEI FFDQSKNGYA GYIDGGASQE EFYKFIKPÍL EKMDGTEELl. VKLNREDLLR KQRTFDNGSI PHQIHLGELH AILRRQEDFY PFLKDNREKI EKiLTFRIPY YVGPLARGNS RFAWMTRKSE EIITPWNFEE WDKGASAQS FIERMTNFDK NI..PNEKVLPK HSLLYEYFTV YNELTKVKYV TEGMRKPAFL SGEQKKAIVD LLFKTNRK.VT VKQLKEDYFK KIEGFDSVEI SGVEDRFN'AS LGTYHDLLKÍ IKDKDFI.DNE ENEDILEDIV LTLTLFEDRE MIEERLKTYA HLFDDK.VMKQ LKRRRYTQWG RLSRKL1NGI RDKQSGKTIL DFLKSDGFAN RNFMQLIHDD SLTFKEDÍQK AQVSGQGDSL HEHIANLAGS PAIKKGILQT VKWDELVKV MGRHKPENrV ÍEMARENQTT QKGQKNSRER MKRIEEGIKE LGSQILKEHP VENTQLQNEK LYI..YYLQNGR DMYVDQELDI NRLSDYDVDH IVPQSFLKDD SIDNKVLTRS DKNRGKSDNV PSEEVVKKMK. NYWRQLLNAK L1TQRKFDNL TK.AERGGLSE LDKAGFIKRQ EVÉTRQlTKM VAQI.LDSRMN TK.YDENDKLI REVKVI'FLKS KLVSDFRKDF QFYK.VRE.INN YHHAHDAYLN AVVGTALIKK YPKLES.EFVY GDYKVYDVRK. MIAKSEQEIG KATAKYFFYS NÍMNFFKTEI TLANGEIRKR PLIETNGETG EIVWDKGRDF ATVRKVLSMP QVNIVKKTEV QTGGFSKESI LPKRNSDKLI ARKKDWDPKK YGGFDS.PTVA YSVLVVAKVE KGKSKKLKSV RE-LEGITIME RSSFEKNPID FLEAK.GYKEV K.KDLJÍKLPK. YSLFELENGR KRMLASAGEL QRGNELALPS .KYVNFLYLAS HYEKLKGSPE DNEQKQLFVE QFIKHYLDEII EQISEFSKRV ILADANLDKV LS-AYNKHRDK PlREQAENn HLFTLTNLGA PAAFKYFDTt IDRKRYTSTK EVLDATLIHQ SITGLYETRI DLSQI..GGDGG GSPKKKRKV IProtl 06520 Sec. MAHHHHHHGG SPKKKRKVDK KYSIGLDIGT NSVGWAVITD 'EYKVPSKKFK VLGNTDRHSI KKNL'IGALLF DSGETAEATR. LKRTARRRYT RRKNR1CYLQ EIFSNEMAKV DDSFFHRLEE SFLVEEDKKH ERHPIFGNIV DEVAYHEKYP TIYMKKLV DSTDKADLRL IYLALAHMIK FRGHFLIEGD LNPD'NSDVDK LFIQLVQTYN QLFEEN'PINA SGVDAKAILS ARLSKSRRLE NUAQLPGEK KNGLFGNLIA LSLGLTPNFK SNFDLAEDAK LQLSKDTYDD DL.DNLLAQIG DQYADLFLAA KNLSDAILLS- DILRVNTEIT KAPLSASMIK RYDEHHQDLT LLKALVR.QQL PEKYKEIFFD QSKNGYAGYI DGGASQEEFY KFIKPILEKM' DGTEELLVKL NREDLLRKQR TFDNGS1PHQIHLGELHAIL RRQEDFYPFL KDNREKIEKI LTFR1PYYVG PLARGNSFA WMTRKS.EETI TPWNFEEVVD RGASAQSFIE RMTNFDKNLP NEKVLPKHSL LYEYFTVYNE LTKVKYVTEG MRKPAFLSGE QKKAIVDLLF KTNRKVTVKQ LKEDYFKKIE CFDSVE1SGV EDRFNASLGT YHDLLKIIKD KDFLDNEENE DILEDIVLTL TLFEDREMIE ERLKTYAHLF DDKVMKQLKR RRYTGWGRLS RKLINGIRDK QSGKT1LDFL KSDGFANKNF MQLIHDDSLT FKEDÍQKAQV SGQGDSLHEH IANLAGSPAI KKGILQTVKV VDELVKVMGR .HKPENIVIEM ARENQTTQKG QKNSRERMKR IEEGIK.ELGS QILKEHPVEN TQLQNEKLYL YYLQNGRDMY VDQELDINRL SDYDVDHIVP QSFLK.DDS1P NKVI.TRSDKN RGKSDNVPSB EWKKMKNYW RQI.,LNAKI..IT QRKFDNLTKA ERGGLSELDK AGFIKRQLVE TRQITKHVAQ ILDSRMNTKY DENDKLÍREV kvitlksk.lv SDFRKDFQFY kvreinnyhh AHDAYLNAVV GTALIKKYPK LESEFVYGDY KVYDVRKMÍA KSEQEIGKAT AKYFFYSNIM NF.FKTEITLA NGEIRKRPLI ETNGETGEIV WDKGRDFATV RKVLSMPQVN IVKKTEVQTG GFSKESILPK RNSDKLIARK KDWDPKKYGG FDSPTVAYSV LVVAKVEKGK SKKLKSVKEL LG1TIMERSS FEKNPIDFLE ÁKGYKEVKKD L1IKLPKYSL FELENGRKRM LASAGELQKG NELALPSKYV NFLYLASHYE KLKGSPEDN.E QKQLFVEQHK. HYLDEIIEQI SEFSKRVILA DANLDKVLSA YNKHRDKPIR EQAENIIHLF TLTNLGAPAA FKYFDTTIDR KRYTSTKEVL DATLIHQSIT GLY.ETRIDLS QLGGDSRADP KKKRKV iProtl 06521 (Seq. Id. No.: 237): MAPKKKRKVD KKYSIGLDIG TNSVGWAVIT DEYKVPSKKF KVLGNFDRHS IKKNLIGALL FDSGETAEAT RLKRTARRRY TRRKNRICYL QEIFSNEMAK VDDSFFHRLE ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMl KFRGHFIJIEG DLNPDNSDVD KLFIQLVQTY NQLF.EENPIN ASGVDAKAIL SARLSKSRRL ENLIAQLPGE KKNGLFGNLI ALSLGLTPNF KSNFDLAEDA KLQLSKDTYD D.DLD.NLLAQI GDQYADLFLA AKNLSDAI.U, SDILRVNTEI. TKAPLSASMI KRYDEHHQDL TLLKALVRQQ LPEKYKE1FF DQSKNGYAGY IDGGASQEEF YKFIKPILEK MDGTEELLVK LNREDLLRKQ RIFDNGSIPH QIHLGELHAI I. / RRQEDFYPF LKDNREKÍEK ILTFRIPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASÁQSFÍ ERMTNFDKNL PNEKVI,PKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKATVDLL FKTNRKVTVK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKIIK DKDFLDNEEN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA IKKGILQTVK VVDELVKVMG RHKPENIVIE MARENQTTQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGRDM YVDQELDINR LSDYDVDHIV PQSFLKDDSI DNKVLTRSDK NRGKS.DNVPS EEVVKKMKNY WRQLLNAKLI TQRKFDNLTK. AERGGLSELD KAGFIKRQLV ETRQITKHVA QILDSRMNTK YDENDKLIRE VKVITLKSKL.· VSDFRK.DFQF YKVREINNYH HAHDAYLNAV VGTALIKKYP KLESEFVYGD YKVYDVRKMI AKSEQEIGKA TAKYFFYSNI MNFFKTEITL ANGEIRKRPL lETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP KRNSDK.LIAR KKDWDPKKYG GFDSPTVAYS VLVVAKVEKG KSKKLKSVKE LLG1TIMERS SFEKNPIDFL EAKGYKEVKK DIJTKLPKYS LFELENGRKR MLASAGELQK GNELALPSKY VNFLYLASHY EKLKGSPEDN EQKQLFVEQH KHYLDEIIEQ ISEFSKRVIL ADANLDKVLS AYNKHRDKPI REQAENI1HL FTLTNLGAPA AFKYFDTTID RKRYTSTKEV LDATLIHQSTTGLYETWL SQLGGDSRAD HHHHHH iProt106522 (Seq ID No: 238): MAHHHHHHGG SDKKYSIGLD IGTNSVGWAV ITDEYKVPSK KFKVLGNTDR HSIKKNLIGA LLFDSGETAE ATRLKR.TARR RYTRRKNRIC YLQEIFSNEM AKVDDSFFHR LEESFLVEED KKHERHP1FG NIVDEVAYHE KYPTIYHLRK KLVDSTDKAD LRLIYLALAH MIKFRGHFLI EGDI..NPDNSD VDKI.F1QLVQ TYNQLFÉENP INASGVDAKA R,SARLSKSR RLENLIAQLP GEKKNGLFGN LIALSLGLTP NFKSNFDLAE- DAKLQLSKDT YDDDDNLLLA Q1GDQYADI.E LAAKNLSDAI LLSDILRVNT ErTKAPLSAS MIKRYDEHHQ DLTLI.KALVR QQLPEKYKEI FFDQSKNGYA GYIDGGASQE EFYKFIKPIL EKMDGTEELL VKLNREDLLR KQRTFDNGSI PHQIHLGELH AILRRQEDFY PFLKDNREKI 'EKILTFRIPY YVGPLARGNS RFAWMTRKSE ETITPWNFEE VVDKGASAQS FIERMTNFDK NLPNEKVLPK HSLLYEYFTV YNELTKVKYV TEGMRKPAFI.. SGEQKKAIVD LLFKTNRKVT VKQLKEDYFK KIECFDSVEI SGVEDRFNAS LGTYHDLLKI IKDKDFLDNE ENEDILEDIV LTI..TI..FEDRE MIEERLKTYA HLFDDKVMKQ LKRRRYTGWG RLSRKLINGI RDKQSGKTIL DFLKSDGFAN RNFMQLIHDD SLTFKEDIQK AQVSGQGDSL HEHIANLAGS ¿AIKKGILQT VKVVDEIWKV MGRHKPENIV IEMARENQTT QKGQKNSRER MKRIEEGIKE LGSQILK.EHP VENTQLQNEK LYLYYLQNGR DMYVDQELD1 NRLSDYDVDH IVPQSFLKDD SIDNKVLTRS DKNRGKSDNV PSEEVVKKMK NYWRQL1..NAK IJTQRKFDNL TKAE.RGGLSE LDKAGFIKRQ LVETRQITKH VAQILDSRMN TKYDENDKLI REVKVHLKS KLVSDFRKDF QFYKVREINN YHI-IAFIDAYI..N AVVGTALIKK YPKLESEFVY GDYKVYDVRK MIAKSEQEIG KATAKYFFYS. NLMNFFKTEI TLANGEIRKR PLIETNGETG EIVWDKGRDF ATVRKVLSMP QVN.IVKKTEV QTGGFSKES1 LPKRNSDKLI ARKKDWDPKK YGGFDSPTVA YSVLVVAKVE KGKSKKLKSV KELLGFTIME RSSFEKNPID FLEAKGYKEV KKDLIIKI..PK YSLFELENGR KRMLASAGEL QKGNELALPS KYVNFLYLAS HYEKLKGSPE DNEQKQLFVE QHKHYLDEII EQISEFSKRV HADANLDKV LSAYNKHRDK PIREQAENII HLFTLTNLGA PAAFKYFDTT IDRKRYTSTK EVI..DATLIHQ SITGLYETRI DLSQLGGDSR ADPKKKRKV i.Prot 106658 (Seq. ID No.: 239): MGSSHHHHHH HHENLYFQGS MDKKYSIGLD IGTNSVGWAV FfDEYKVPSK KFKVLGNTDR HSÍKKNLIGA LLFDSGETAE ATRLKRTARR RYTRRKNRIC YLQEIFSNEM AKVDDSFFHR LEESFLVEED KKHERHPIFG NIVDEVAYHE KYPTIYHLRK KLVDSTDKAD LRLIYLALAH MIKFRGHFLI EGDLNPDNSD VDKLFIQLVQ TYNQLFEENP INASGVDAKA ILSARLSKSR RLENLIAQLP GEKKNGLFGN LIALSLGLTP NFKSNFDLAE DAKLQL'SKDT YDDDLDNLLA QIGDQYADLF LAAKNLSDAI LLSDILRVNT EITKAPLSAS M1KRYDEHHQ DLTLLKALVR QQLPEKYKEI FFDQSKNGYA GYIDGGASQE EFYKF1KPIL EKMDGTEELL VKLNREDLLR KQRTFDNGSI PHQIHLGELH AILRRQEDFY PFLKDNREKI EKILTFRIPY YVOPLARGNS RFAWMTRKSE ETITPWNFEE WDKGASÁQS FIERMTNFDK NLPNEKVLPK HSLLYEYFTV YNELTKVKYV T.EGMRKPAFL SGEQKKÁIVD LLFKTNRK.VT VKQLKEDYFK KIECFDSVEI SGVEDRF'NAS LGTYHDLLKI IKDKDFLDNE ENEDILEDIV LTLTLFEDRE MIEERLKTYA HLFDDKVMKQ LKRRRYTGWG RLSRKLINGI RDK.QSGKTIL DFLKSDGFAN RNFMQLIHDD SLTFKEDIQK AQVSGQGDSL HEHIANLAGS PAÍKKG1LQT VKVVDELVKV MGRHKPENIV IEMARENQTT QKGQKNSRER MKRIEEGIKE LGSQILKEHP VENTQLQNEK LYLYYLQNGR. DMYVDQELDI NRLSDYDVDH TVPQSF.LKDD SIDNKVLTRS DKNRGKSDNV PSEEWKKM.K NYWRQLLNAK LITQRKFDNL TKAERGGLSE LDKAGFIKRQ LVETRQITKH VAQILDSRMN TKYDENDKLI REVKVTTLKS KLVSDFRKDF QFYKVREINN YHHAHDAY1.N AVVGTAI.JKK YPKLESEFVY GDYKVYDVRK MIÁKSEQEIG KATAKYFFYS NIMNFFKTEI TLANGEIRKR PLÍETNGETG E1VWDKGRDF ATVRKVLSMP QVNIVKK.TEV QTGGFSKESI LPKRNSDKLI ARKKDWDPK.K YGGFDSPTVA YSVLVVAKVE KGKSKKLKSV KELLGITIME RSSFEKNPID FLEAKGYKEV KKDLIIKLPK YSLFELENGR KRMLASAGEL QKGNELALPS K'YVNFLYLAS HYEKLKGSPE DNEQK.QLFVE QHKHYLDEII EQISEFSKRV ÍLADANLDKV LSAYNKHRDK PIREQAENIIHLF TLTNLGA PAAFKYFDTT IDRKRYTSTK EVLDATLIHQ SITGLYETRI DLSQI..GGDGG GSPKKKRKV iProt106745 (Seo ID No.: 24(1): MAPKKKRKVD KK.YSIGLDIG TNSVGWAVIT DEYKVPSKKF KVLGNTDRHS IKKNLIGALL FDSGETAEAT rlkrtarrry trrknricyl qeifsnemak vddsffhrle ESFLVEEDKK HERHPIFGN! VDEVAYHEKY PTIYHI.RKKL VDSTDKADLR LlYLALAHMl KFRGHFLIEG DLNPDNSDVD KLFIQLVQTY NQI.FEENPIN ASGVDAKAIL SARLSKSRRL ENL1AQI.PGE KKNGLFGNLI ALSLGLTPNF KSNFDLAEDA KLQLSKDTYD DDLDNI..LAQI GDQYADLFLA AKNLSDAILL SDILRVNTEI. TKAPLSASMI KRYDEHHQDL TLLKALVRQQ ITEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKPILEK MDGTEELLVK LNREDLLRKQ RTFDNGSIPH QIHLGELHAI LRRQEDFYPF LKDNREKJEK 1LTFRIPYYV GPLARGNSRF AWM'TRKSEET ITPWNFEEVV DKGASAQSFI ERMTNFDKNL PNEKVLPKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKAIVDLL FKTNRKVTVK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKIIK DKDFLDNEEN EDILEDIVLT .LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL· SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA IKKGILQTVK VVDELVKVMG RHKPENIVIE MARENQTTQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGRDM YVDQELDINR LSDYDVDHIV PQSFLKDDSI DNAVLTRSDK NRGKSDNVPS EEVVKKMKNY WRQLLNAKLI TQRKFDNLTK. AERGGLSELD KAGFIKRQLV ETRQITKHVA QILDSRMNTK YDENDKLIRE VKVITLKSKL VSDFRKDFQF YKVREINNYH HAHDAYLNAV VGTALIKKYP KLESEFVYGD YKVYDVRKMI AKSEQEIGKA TAKYFFYSNI MNFFKTEITL ANGEIRKRPL lETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP KRNSDKLIAR KKDWDPKKYG GFDSPTVAYS VLWAKVEKG KSKKLKSVKE LLGITIMERS SFEKNPIDFL EAKGYKEVKK DLITKLPKYS LFELENGRKR. MLASAGELQK GNELALPSKY VNFLYLASRY EKLKGSPEDN EQKQLFVEQH KHYLDEIIEQ 1SEFSKRVIL ADANLDKVLS AYNKHRDKPI REQAENIIHL FTLTNLGAPA AFKYFDTTID RKRYTSTKEV LDATLIHQSI TGLYETRIDL SQLGGDSRAD PKKKRKVHHH ΗΗΉ íProt-10674.6 (Num. MAPKKKRKVD KKYSIGLDIG TNSVGWAVI.T DEYKVPSKKF KVLGNTDRHS IKKNLIGALL FDSGETAEAT RLKRTA.RRRY TRRKNRICYL QE1FSNEMAK VDDSFFIIRI.E ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMl KFRGHFLIEG DLNPDNSDVD KLFIQLVQTY NQLFEENPI.N ASGVDAKAIL SARLSKSRRL ENLIAQLPGE KKNGLFGNLI ALSLGLTPNF KSNFDLAEDA KLQLSKDTYD DDLDNLLAQI GDQYADLFLA AKNLSDAILL SDILRVNTEI TKAPL8 AS MI KRYDEHHQDL TLLKALVRQQ LPEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKP1LEK MDGTEELLVK LNREDLLRKQ RTFDNGSIPH QIHI.X3EI.MA1 LRRQEDFYPF LKDNR.EKIEK ILTFRIPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASAQSFI ERMTNFDKNL PNEKVLPKHS I,LYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKAIVDLL FKTNRKVTVK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKIIK DKDFLDNEEN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKLINGIRD KQSGKTILDF LKSDGFANRN FMQLIHDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA IKKGILQTVK VVDELVKVMG RHKPENIVIE MARENQI'TQK GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEALY LYYLQNGRDM YVDQELDINR LSDYDVDHIV PQSFLKDDSI DNKVLTRSDK NRGKSDNVPS EEVVKKMKNY WRQLLNAKLI TQRKFDNLTK AERGGLSELD KAGFIKRQLV ETRQITKHVA QILDSRMNTK YDENDKLIRE VKVITLK SKL VSDFRKDFQF YKVREINNYH HAHDAYLNAV VGTALIKKYP ALESEFVYGD YKVYDVRKMI AKSEQEIGKÁ TAKYFFYSNI MNF.FKTE1TL ANGE1RKAPL IETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP .KRN'SDKLÍAR KKDWDPKK.YG GFDSPTVAYS VLWAKVEKG KSKKLKSVKE LLGITIMERS SFEKNPIDFL EAKGYKEVKK DLIIKLPKYS LFELENGRKR MLASAGELQK GNELALPSKY VNFLYLASHY EKLKGSPEDN EQKQLFVEQH KHYLDEIIEQ ISEF.SKRVIL ADANLDKVLS AYNKHRDKPI REQAENIIHL FTLTNLGAPA AFKYFDTTID RKRYTSTKEV LDATLIHQSI TGLYETRIDL SQLGGDSRAD PKKKRKVFIHH ΗΙ-Π-Ι iProtl06747 (Seq.-ID No.: 242.): MAPKKKRKVD KKYSIGLDIG TNSVGWAVIT DEYKVPSKKF KVLGNTDRHS IKKNLIGALL FDSGETAEAT RLKRTARRRY TRRKNRICYL QEIFSNEMAK VDDSFFHRLE ESFLVEEDKK HERHPIFGNI VDEVAYHEKY PTIYHLRKKL VDSTDKADLR LIYLALAHMI KFRGHFLIEG DLNPDNSDVD KLFIQLVQTY NQLFEENPIN ASGVDAKAIL SARLSKSRRL ENL1AQLPGE KKNGLFGNLI ALSLGLTPNF KSNFDLAEDA KLQLSKDTYD DDLDNLLAQI GDQYADLFLA AKNLSDAILL SDILRVNTEI TKAPL.SASMI KRYDEHFIQDL TLLKALVRQQ LPEKYKEIFF DQSKNGYAGY IDGGASQEEF YKFIKPILEK. MDGTEELLVK I..NREDLLRKQ RTFDNGSIPH QlHLGELHAl LRRQEDFYPF LKDNREKIEK ILTFRIPYYV GPLARGNSRF AWMTRKSEET ITPWNFEEVV DKGASAQSFI ERMTNFDKNL PNEKVLPKHS LLYEYFTVYN ELTKVKYVTE GMRKPAFLSG EQKKAIVDLL FKTNRKVI'VK QLKEDYFKKI ECFDSVEISG VEDRFNASLG TYHDLLKHK DKDFLDNEEN EDILEDIVLT LTLFEDREMI EERLKTYAHL FDDKVMKQLK RRRYTGWGRL SRKI..1NGIRD KQSGKTILDF LKSDGFANRN FMQL1HDDSL TFKEDIQKAQ VSGQGDSLHE HIANLAGSPA tKKGILQTVK WDELVKVMG RHKPENIVIE MARENQTTQK. GQKNSRERMK RIEEGIKELG SQILKEHPVE NTQLQNEKLY LYYLQNGRDM YVDQELDINR LSDYDVDHIV PQSFLADDSI DNKVLTRSDK NRGKSDNVPS EEWKKMK.NY WRQLLNAKLÍ TQRKFDNLTK AERGGLSELD KAGFIKRQLV EI'RQITKHVA QILDSRMNTK YDENDKLIRE VKVITLKSKL VSDFRKDFQF YKVREINNYH HAHDAYLNAV VGTALIKKYP ALESEFVYGD YKVYDVRKMI AKSEQEIGKA TAKYFFYSNI MNFFKTEITL ANGEIRKAPL IETNGETGEI VWDKGRDFAT VRKVLSMPQV NIVKKTEVQT GGFSKESILP KRNSDKLIAR KKDWDPKKYG GFDSPTVAYS VLWAKVEKG KSKKLKSVKE LLGITIMÉRS SFEKNPIDFL EAKGYKEVKK DLIIKLPKYS· LFELENGRKR MLASAGELQK GNELALPSKY VNFI..YI..ASHY EKLKGSPEDN EQKQLFVEQH KHYLDEIIEQ ISEFSKRVIL ADANLDKVLS AYNKHRDKPI REQAENIIHL FTLTNLGAPA AFKYFDTTID RKRYTS'FKEV LDATLIHQSI TGLYETRIDL SQLGGDSRAD PKKKRKVHHH HHH iProtlO6S«4 (Seq. ID No.; 243): MAPKKKRKVD KKYSIGL...

Claims

1. A molecule of: gRNA comprising a carrier and crRNA, wherein the crRNA comprises a targeting domain that: a) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl1:5,250,094-5,250,237, - strand, hg38; b) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl1:5,255,022-5,255,164, - strand, hg38; c) is complementary to a target sequence of a non-delete 'HFPH' region (e.g., a human non-delete HPFH region); d) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl1:5,249.833 to Chrl 1:5,250,237, - chain, hg38;e) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl 1:5,254,738 to Chrl 1:5,255,164, - chain, hg38;f) is complementary to a target sequence within the genomic nucleic acid sequence at Chrl1; 5,249,833-5,249,927, - chain, h§38;g) is complementary to a target sequence within the genomic nucleic acid sequence in Chrl 1: 5,254,738-5,254,851, - chain, hg38;h) is complementary to a target sequence within the genomic nucleic acid sequence in Chrl 1:5,250,139-5,250,237, - chain, hg38; oi) their combinations.

2. A gRNA molecule according to Claim 1, wherein the targeting domain comprises, for example, any Seq. Id. No.: 1 to Seq. Id. No.: 72, or a fragment thereof.

3. A gRNA molecule according to Claim 2, wherein the targeting domain comprises, for example, any Seq. Id. No.: 67, Seq. Id. No.: 1, Seq. Id. No.: 6, Seq. Id. No.: 8, id. of Sec. No.: 9, Sec. Id. No.: 10, Sec. Id. No.: 11, Sec. Id. No.: 1.2, Sec. Id. No.: 28, Sec. Id. No.: 34, Sec. Id. No.; 45, Sec. Id. No.: 46, Sec. Id. No.: 47, Sec. Id. No.: 48, Sec. Id. No. 50, Sec. Id. No.: 51, Sec. Id. No.: 53, Sec. Id. No.: 54, Sec. Id. No.: 58, Sec. Id. No.: 62, Sec. Id. Sec. No.; 63, or a fragment thereof.4.A gRNA molecule according to Claim 2, wherein the targeting domain comprises, for example, any a) Sequence ID No.: 67, Sequence ID No.: 6, Sequence ID No.: 8, Sequence ID No.: 28, Sequence ID No.: 34, Sequence ID No.: 48, Sequence ID No.: 51, or a fragment thereof; or b) Sequence ID No.: 1, Sequence ID No.: 8, Sequence ID No.: 9, Sequence ID No.: 10, Sequence ID No.: 12, Sequence ID No.: 54, or a fragment thereof.

5. The gRNA molecule according to any of Claims 2-4, wherein the targeting domain comprises, for example, 17, 18, 19, or 20 consecutive nucleic acids from any of the listed targeting domain sequences.

6. The gRNA molecule according to Claim 5, wherein the 17, 18, 19, or 20 consecutive nucleic acids from any of the listed targeting domain sequences are the 17, 18, 19, or 20' consecutive nucleic acids arranged at the 3' end of the listed targeting domain sequence.

7. The gRNA molecule according to the. Claim 5, wherein the Γ7, '18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences are the .17,18, 19, or 20 consecutive nucleic acids arranged at the 5' end of the listed targeting domain sequence,8.The gRNA molecule according to Claim 5, wherein the 17, 18, 19, or 20 consecutive nucleic acids of any of the listed targeting domain sequences do not comprise the 5' or 3' nucleic acid of the listed targeting domain sequence.

9. The gRNA molecule according to any of Claims 2-8, wherein the targeting domain comprises the listed targeting domain sequence.

10. The gRNA molecule according to any of Claims 1-9, wherein the targeting domain comprises, for example, Seq. No.

67.

11. The gRNA molecule according to any of Claims 1-10, wherein the gRNA molecule is a double-stranded guide RNA molecule.

12. The gRNA molecule according to any of Claim 140, wherein the gRNA molecule is a simple guide RNA molecule,13.The gRNA molecule according to Claim 12, comprising: (a) Seq. No. 195; (b) Seq. No. 231; or (c) any of the above (a) or (b), further comprising at the 3-terminus 1, 2, 3, 4, 5, 6 or 7 uracil (U) nucleotides; wherein the sequence of any of (a) to (c) is optionally arranged immediately adjacent to the targeting domain.

14. A gRNA molecule according to Claim 1, comprising, for example, the sequence; (a) Seq. Id. No.: 174; (b) Seq. Id. No.: 175; or (c) Seq. Id. No.:

176.

15. A gRNA molecule according to Claim 1, comprising, for example, is composed of: (a) a crRNA comprising, for example, is composed of, Seq. No. 177, and a strand comprising, for example, is composed of, Seq. No. 224; (b) a crRNA comprising, for example, is composed of, Seq. No. 177, and a strand comprising, for example, is composed of, Seq. No. 73; (c) a crRNA comprising, for example, is composed of, Seq. No. 178, and a strand comprising, for example, is composed of, Seq. No. 224;or (d) a crRNA comprising, for example, is composed of, Seq. No. 178, and a tracer comprising, for example, is composed of, Seq. No.

73. '16. A gRNA molecule according to any of Claims 1-15, wherein (a) when a CRISPR system (for example, an RNP as described herein) comprising the gRNA molecule is introduced into a cell, an indel is formed in or near the target sequence complementary to the targeting domain of the gRNA molecule;and / or) when a CRISPR system (e.g., an RNP as described herein) comprising the gRNA molecule is introduced into a cell, a deletion is created comprising the sequence, e.g., substantially the entire sequence, between a sequence complementary to the gRNA targeting domain (e.g., at least 90% complementary to the gRNA targeting domain, e.g., totally complementary to the gRNA targeting domain) in the HBG1 promoter region and a sequence complementary to the gRNA targeting domain (e.g., at least 90% complementary to the gRNA targeting domain, e.g., totally complementary to the gRNA targeting domain) in the HBG2 promoter region; 17. The gRNA molecule according to Claim 16, wherein the indel does not comprise a nucleotide disposed between 5,250,092 and 5,249,833 - chain (hg38), optionally wherein the indel does not comprise a nucleotide of a non-deletional HPFH or transcription factor binding site.

18. A gRNA molecule according to any of Claims 1-17.Wherein, when a CRISPR system (e.g., an RNP as described herein) comprising the gRNA molecule is introduced into a cell population, an indel is formed in or near the target sequence complementary to the targeting domain of the gRNA molecule in at least approximately 15%, e.g., at least approximately 17%, e.g., at least approximately 20%, e.g., at least approximately 30%, e.g., at least approximately 40%, e.g., at least approximately 50%, e.g., at least approximately 55%, e.g., at least approximately 60%, e.g., at least approximately 70%, e.g., at least approximately 75%, of the cells in the population.

19. A gRNA molecule according to any one of Claims 1-18, wherein when a CRISPR system (e.g., an RNP as described herein) comprising the gRNA molecule is introduced into a cell (e.g., a cell population): (a) the expression of fetal hemoglobin increases in said cell or its progeny, e.g., its erythroid progeny, e.g., its red blood cell progeny, optionally wherein said expression of fetal hemoglobin increases by at least approximately 15%, e.g., at least approximately 17%, e.g., at least approximately 20%, e.g., at least approximately 25%, e.g., at least approximately 30%, e.g., at least approximately 35%, e.g., at least approximately 40%, relative to the level of fetal hemoglobin expression in a cell population into which the gRNA molecule is not introduced introduced or a population of its offspring, for example,(a) its erythroid progeny, for example, its red blood cell progeny; (b) said cell or cell population, or its progeny, for example, its erythroid progeny, for example, its red blood cell progeny, produces at least approximately 6 picograms (for example, at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms, or between approximately 9 and approximately 10 picograms) of fetal hemoglobin per cell; (c) no off-target indels are formed in said cell, for example, no unwanted indels are formed outside the HBG1 and / or HBG2 promoter regions, for example, as detectable by next-generation sequencing and / or a nucleotide insertion assay; and / or (d) no unwanted indel, e.g., no unwanted indel outside the HBG and / or HBG2 promoter regions,is detected in more than approximately 5%, for example, more than approximately 1%, for example, more than approximately 0.1%, for example, more than approximately 0.01%, of the cells in the cell population, for example, as detectable by next-generation sequencing and / or a nucleotide insertion assay.

20. The gRNA molecule according to any of Claims 16-19, wherein the cell is (or the cell population comprises) a mammalian, primate, or human cell, for example, a human cell, optionally wherein said cell is obtained from a patient suffering from a hemoglobinopathy, for example, sickle cell disease, or a thalassemia, for example, beta-thalassemia.

21. The gRNA molecule according to Claim 20, wherein the cell is (or the cell population comprises) an HSPC, optionally a CD34+ HSPC, optionally a CD34+CD9(H) HSPC.

22. The gRNA molecule according to any of Claims 16-21, wherein the cell is autologous or allogeneic with respect to a patient to whom said cell is to be administered.

23. A composition comprising: 1.one or more gRNA molecules (including a first gRNA molecule) according to any of Claims 1-22 and a Cas9 molecule; 2) one or more gRNA molecules (including a first gRNA molecule) according to any of Claims 1-22 and nucleic acid encoding a Cas9 molecule; 3) nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) according to any of Claims 1-22 and a Cas9 molecule; 4) nucleic acid encoding one or more gRNA molecules (including a first gRNA molecule) according to any of Claims 1-22 and nucleic acid encoding a Cas9 molecule; or 5) any of the above (1) to 4), and a nucleic acid template; or 6) any of the above (1) to 4), and nucleic acid comprising a sequence encoding a nucleic acid template.

24. A composition comprising a first gRNA molecule according to any of Claims 1-22, further comprising a Cas9 molecule, optionally wherein the Cas9 molecule is an active or inactive S. pyogenes Cas9, optionally wherein the Cas9 molecule comprises Seq. No. 205 or a sequence having at least 95%, 96%, 97%, 98%, or 99% sequence homology with the same.

25. The composition according to Claim 23-24, wherein the Cas9 molecule comprises, for example, comprising: (a) Seq. No. 233; (b) Seq. No. No.: 234:(c) Sec. Id. No.: 235;(d) Sec. Id. No.: 236;(e) Sec. Id. No.: 237; (í) Sec. ID No.: 238; (g) Sec Id No: 239;(h) Sec Id No: 240;(i) Sec Id No: 241;(j) Sec Id No: 242;(k) Sec Id No: 243; o(l) Sec. ID No.; 244.

26. The composition according to any of Claims 23-25, wherein the first gRNA molecule and the first Cas9 molecule are present in a ribonucleoprotein (RNP) complex.

27. The composition according to any of Claims 23-26, formulated in a medium suitable for electroporation.

28. The composition according to any of Claims 23-27, wherein each of said gRNA molecules is in an RNP with a Cas9 molecule described herein, and wherein each RNP is at a concentration of less than approximately 10 µM, for example, less than approximately 3 µM, for example, less than approximately 1 µM, for example, less than approximately 0.5 µM, for example, less than approximately 0.3 µM, for example, less than approximately 0.1 uM, optionally where the concentration of said RNP is approximately 2 uM or is approximately 1 uM, optionally where the composition further comprises a cell population, e.g., HSPCs.

29. A nucleic acid sequence encoding one or more gRNA molecules according to any of Claims 1-22.

30. A vector comprising the nucleic acid according to Claim 29, optionally wherein said vector is selected from the group comprising a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a herpes simplex virus (HSV) vector, a plasmid, a mini-RNA, a nanoplasmid, and an RNA vector.

31. A method for altering a cell (e.g., a cell population) (e.g., by altering the nucleic acid structure (e.g., sequence) in or near a target sequence within said cell, comprising contacting (e.g., introducing) said cell (e.g., the cell population) with: 1.one or more gRNA molecules according to any of Claims 1-22 and a Cas9 molecule; 2) one or more gRNA molecules according to any of Claims 1-22 and nucleic acid encoding a Cas9 molecule; 3) nucleic acid encoding one or more gRNA molecules according to any of Claims 1-22 and a Cas9 molecule; 4) nucleic acid encoding one or more gRNA molecules according to any of Claims 1-22 and nucleic acid encoding a Cas9 molecule; 5) any of the above (1) to 4) and a nucleic acid template; 6) any of the above (1) to 4) and nucleic acid comprising a sequence encoding a nucleic acid template; 7) the composition according to any of Claims 23-28; or 8) the vector according to Claim 30.

32. The method according to Claim 31, wherein the cell is an animal cell, for example, a mammalian, primate, or human cell, for example, a human cell; optionally wherein said cell is obtained from a patient suffering from a hemoglobinopathy, for example, sickle cell disease, or a thalassemia, for example, beta-thalassemia.

33. The method according to any of Claims 31-32, wherein the cell is an HSPC, optionally a CD34+ HSPC, optionally a CD34+CD90+ HSPC.

34. The method according to any of Claims 31-33, wherein the cell is arranged in a composition comprising a cell population that has been enriched for CD34+ cells.

35. The method according to any of Claims 31-34, wherein the cell (e.g., cell population) has been isolated from bone marrow, peripheral blood (e.g., mobilized peripheral blood) or umbilical cord blood.36.The method according to any of Claims 31-35, wherein the cell is autologous or allogeneic with respect to a patient to whom said cell is to be administered.

37. The method according to any of Claims 31-36, wherein: a) the alteration results in an indel in or near a genomic DNA sequence complementary to the targeting domain of the single or more gRNA molecules; and / or b) the alteration results in a deletion comprising a sequence, for example, substantially the entire sequence, between a sequence complementary to the targeting domain of the single or more gRNA molecules (for example, at least 90% complementary to the gRNA targeting domain, for example, totally complementary to the gRNA targeting domain) in the HBG1 promoter region and a sequence complementary to thetargeting domain of the single or more gRNA molecules (e.g., at least 90% complementary to the gRNA targeting domain, e.g., totally complementary to the gRNA targeting domain) in the promoter region of H.8G2, optionally where the deletion does not comprise a nucleotide disposed between 5,250,092 and 5,249,833, - chain (h.g38).

38. The method according to any one of Claims 31-37, wherein: (a) the method results in a cell population wherein at least approximately 15%, for example, at least approximately 17%, for example, at least approximately 20%, for example, at least approximately 30%, for example, at least approximately 40%, for example, at least approximately 50%, for example, at least approximately 55%, for example, at least approximately 60%, for example, at least approximately 70%, for example, at least approximately 75% of the population has been altered, for example, comprising an indel, optionally wherein the indel is selected from an indel listed in Table 2-7, optionally wherein the cells in the population do not comprise a deletion of a nucleotide disposed between 5,250,092 and 5,249,833, - chain (hg38);(b) the alteration results in a cell (e.g., the cell population) that is capable of differentiating into a differentiated cell of an erythroid lineage (e.g., a red blood cell), and wherein such differentiated cell exhibits a higher level of fetal hemoglobin, for example, in relation to an unaltered cell (e.g., the cell population); (c) the alteration results in a cell population that is capable of differentiating into a differentiated cell population, for example, a cell population of an erythroid lineage (e.g., a red blood cell population), and wherein such differentiated cell population has a higher percentage of F cells (e.g., at least approximately 15%, at least approximately 20%, at least approximately 25%, at least approximately 30%, or at least approximately 40% more F cells), for example, in relation to an unaltered cell population;and / or (d) the alteration results in a cell (for example, the cell population) that is capable of differentiating into a differentiated cell, for example, a cell of an erythroid lineage (for example, a red blood cell), and wherein said differentiated cell produces at least approximately 6 picograms (for example, at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms, or between approximately 9 and approximately 10 picograms) of fetal hemoglobin per cell.

39. A cell, altered by the method according to any one of Claims 31-38, or a cell that can be obtained by the method according to any one of Claims 31-38.

40. A cell, comprising an indel described in Table 7-2, optionally wherein the cell does not comprise a deletion of a nucleotide disposed between 5,250,092 and 5,249,833, - chain (hg38).

41. A cell, comprising a first gRNA molecule according to any of Claims 1-22, or a composition according to any of Claims 23-28, a nucleic acid according to Claim 29, or a vector according to Claim 30.

42. The cell according to any of Claims 39-41, wherein the cell is capable of differentiating into a differentiated cell, for example, a cell of an erythroid lineage (for example, a red blood cell), and wherein said differentiated cell exhibits an increased level of fetal hemoglobin, for example, relative to.a cell of the same type that has not been modified to comprise a gRNA molecule, optionally wherein the differentiated cell (e.g., a cell of an erythroid lineage, e.g., a red blood cell) produces at least approximately 6 picograms (e.g., at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms, or between approximately 9 and approximately 10 picograms) of fetal hemoglobin, e.g., in relation to a differentiated cell of the same type that has not been modified to comprise a gRNA molecule.

43. The cell according to any of Claims 39-42, which has been contacted with a stem cell expander.44.The cell according to Claim 43, wherein the stem cell expander is: a) (lr,4r)-bP-(2-benzyl-7-(2-methyl-2H-tetrazol-5-yl)-9H-pyrimido[4,5-b]indole-4-yl)cyelohexane-1,4-diamine; b) methyl 4-(3-piperidin-1-ylpropion)-9H-pyrimido[4,5-b]indo-7-carboxylate; c) 4-(2.-(2 <benzó[b]tiofen-3-il)-9-isopropil-9H-purin-6-Ílaniino)etíí)fenol;d) (S)-2-(6-(2-(lH-ind0L3-il)etilamino)-2-(5-fluorópiridm-3-d)-9H-purín-9-il)propan-l-ol· oe) sus combinaciones (por ejemplo, una combinación, de (lr,4r)-NJ-(2-bencil-7-(2-met.il-2H.-tetrazol-5-íl)-9H-piriinido[4,5-b]indol-4-il)ciclohexano-l,4-díámina y (S)-2-(6-(2-(iH-indoí-3-il)etilñmino)-2-(5~fíuoropiridin-3-il)-9H-purín-9-il)propan-Lol).

45. A cell, for example, a cell according to any of Claims 39-44, comprising: a) an indel in or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule according to any of Claims 1-22; and / or) a deletion comprising the sequence, for example, substantially the entire sequence, between a sequence complementary to the targeting domain of a gRNA molecule according to any of Claims 1-22 (for example, at least 90% complementary to the targeting domain of gRNA, for example, totally complementary to the targeting domain of gRNA) in the HBGI promoter region and a sequence complementary to the targeting domain of a gRNA molecule according to any of Claims 1-22 (for example, .at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG2 promoter region, optionally where the deletion does not comprise a nucleotide located between 5,250,092 and 5,249,833, - chain (hg38).

46. ​​The cell according to any of Claims 39-45, wherein the cell is an animal cell, for example, a mammalian, primate, or human cell, for example, a human cell; optionally wherein said cell is obtained from a patient suffering from a hemoglobinopathy, for example, sickle cell disease, or a thalassemia, for example, beta-thalassemia.

47. The cell according to any of Claims 39-46, wherein the cell is an HSPC, optionally an HSPC-CD34+, optionally a CD34+CD90+ HSPC.

48. The cell according to any of Claims 39-47, wherein the cell (for example, cell population) has been isolated from bone marrow, peripheral blood (for example, mobilized peripheral blood), or umbilical cord blood.

49. The cell in accordance with any of the Rei vindications 39-48,where the cell is autologous or allogeneic with respect to a patient to whom said cell will be administered.

50. A cell population comprising the cell according to any one of Claims 39-49, optionally where at least approximately 50%, for example, at least approximately 60%, for example, at least approximately 70%, for example, at least approximately 80%, for example, at least approximately 90% (for example, at least approximately 98%, at least approximately 96%, at least approximately 97%, at least approximately 98%, or at least approximately 99%) of the cells in the population are a cell according to any one of Claims 39-49.

51. The cell population according to Claim 50, wherein the cell population is capable of differentiating into a differentiated cell population, for example, a cell population of an erythroid lineage (for example,a population of red blood cells), and wherein said population of differentiated cells has a higher percentage of F cells (for example, at least approximately 15%, at least approximately 17%, at least approximately 20%, at least approximately 25%, at least approximately 30%, or at least approximately 40% more F cells) for example, relative to a population of unmodified cells of the same type; optionally wherein the F cells of the population of differentiated cells produce an average of at least approximately 6 picograms (for example, at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms,or between approximately 9 and approximately 10 picograms) of fetal hemoglobin per cell.

52. The cell population according to any of Claims 50-51, comprising:

1. at least 100 CD34+ cells / kg of body weight of the patient to whom the cells will be administered; 2. at least 200 CD34+ cells / kg of body weight of the patient to whom the cells will be administered; 3. at least 306 CD34+ cells / kg of body weight of the patient to whom the cells will be administered; 4. at least 406 CD34+ cells / kg of body weight of the patient to whom the cells will be administered; or 5. between 206 and 1006 CD34r cells / kg of body weight of the patient to whom the cells will be administered, 53. The cell population according to any of Claims 50-52, wherein at least approximately 40%, for example, at least approximately 50% (for example, at least approximately 60%, at least approximately 70%, at least approximately 80%, or at least approximately 90%) of the cells in the population are CD34+ cells, optionally wherein at least approximately 10%, for example, at least approximately 1.5%, for example, at least approximately 20%, for example, at least approximately 30% of the cells in the population are CD34+CD90+ cells.

54. The cell population according to any of Claims 50-53, wherein the cell population is derived from umbilical cord blood, peripheral blood (for example, mobilized peripheral blood), or bone marrow, for example, is derived from bone marrow. 55.The cell population according to any of Claims 50-54, wherein the cell population comprises, for example, mammalian cells, for example, human cells, optionally wherein the cell population is obtained from a patient suffering from a hemoglobinopathy, for example, sickle cell disease, or a thalassemia, for example, beta-thalassemia.

56. The cell population according to any of Claims 50-55, wherein the cell population is (i) autologous in relation to a patient to whom it is to be administered, or (ii) allogeneic in relation to a patient to whom it is to be administered.

57. The cell population (for example, CD34+ cells), for example, according to any of Claims 50-56, comprising a pattern of indels described in Table 7-2, optionally wherein the indels of the.The pattern of indices described in Table 7-2 are detectable in at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the cells in the population.

58. A composition comprising the cell or cell population according to any one of Claims 39-57, optionally comprising a pharmaceutically acceptable medium, for example, a pharmaceutically acceptable medium suitable for cryopreservation.

59. A method for treating a hemoglobinopathy, comprising administering to a patient a cell or cell population according to any one of Claims 39-57 or a composition according to Claim 58. 60.A method for increasing fetal hemoglobin expression in a mammal, comprising administering to a patient a cell or cell population according to any of Claims 39-57, or a composition according to Claim 58.

61. The method according to Claim 60, wherein ia.hemoglobinopathy is beta-thalassemia or sickle cell disease; 62. A method for preparing a cell (e.g., a cell population) comprising: (a) providing a cell (e.g., a cell population) (e.g., an HSPC (e.g., a population of HSPCs)); (b) culturing said cell (e.g., said cell population) ex vivo in a cell culture medium comprising a stem cell expander; and (c) introducing into said cell a first gRNA molecule according to any one of Claims 1-22, a nucleic acid molecule encoding a first gRNA molecule according to any one of Claims 1-22, a composition according to any one of Claims 23-28, a nucleic acid according to Claim 29, or a vector according to Claim 30.

63. The method according to Claim 62, wherein after said introduction of step (c), said cell (e.g., the cell population) is capable of differentiating into a differentiated cell (e.g., differentiated cell population), e.g., a cell of an erythroid lineage (e.g., a cell population of an erythroid lineage), e.g., a red blood cell (e.g., a red blood cell population), and wherein said differentiated cell (e.g., differentiated cell population) produces an increase in fetal hemoglobin, e.g., relative to the same cell that has not been subjected to step (c).

64. The method according to any of Claims 62-63, wherein the stem cell expander is: a) (lr,4r)-Nl-(2-beneyl-7-(2~metj.l-2H-tetrazol-5-yl)-9H-pyrimido[4,5-b]indol-4-il.)cic.lohexano-l,4-diariaina;b) metil 4-(3-piperidin-l-i-propilamino)-9H-pirimido[4,5-b]mdoI-7-carboxilato;c) 4-(2-(2-(benzGrb]tÍ0fen-3-i])-9-isopropyl-9H-purin-6"ilamino)etil)fenol;d) (S)-2-(6-(2-(lH"indoI"3-ii)etilamino)-2-(5-fluoropiridin-3-il)-9H-purin-9"il)propan-I-ol; oe) their combinations (por ejemplo, with a combination of (lr,4r)~N1-(2-bencil-7-(2-metil-2H-tetrazol-5-i)-9H~ pirimido[4,5~b]indol-4-il)ciclohexano-l,4-diamina y (S)-2-(6-(2-(lH-indol-3-il)etílamino)-2-(5-fluoropiridin~3-iT)-9H-purin-9-il)propan-l-ol).

65. The method according to any of Claims 62-64, wherein the cell culture medium comprises thrombopoietin (Tpo), FIt3 ligand (FIt-3L) and human stem cell factor (SCF), optionally wherein the cell culture medium further comprises human interleukin-6 (IL-6); optionally wherein the cell culture medium comprises thrombopoietin (Tpo), FIt3 ligand (FIt-3L), human stem cell factor (SCF), and optionally human IL-6, each at a concentration ranging from approximately 10 ng / ml to approximately 1000 ng / ml, optionally each at a concentration of approximately 50 ng / ml, e.g., a concentration of approximately 50 ng / ml. 66.The method according to any of Claims 62-65, wherein the cell culture medium comprises a stem cell expander at a concentration ranging from approximately 1 nM to approximately 1 mM, optionally at a concentration ranging from approximately 1 µM to approximately 100 nM, optionally at a concentration ranging from approximately 500 nM to approximately 750 µM, optionally at a concentration of approximately 500 nM, for example, at a concentration of approximately 500 µM, or at a concentration of approximately 750 nM, for example, at a concentration of approximately 750 nM.

67. The method according to any of Claims 62-66, wherein the cultivation of step (b) comprises a cultivation period prior to the introduction step (c), optionally wherein the cultivation period prior to the introduction step (c) is at least 12 hours, e.g., is a period of approximately between 1 day and approximately 12 days, e.g., is a period of approximately between 1 day and approximately 6 days, e.g., is a period of approximately between 1 day and approximately 3 days, e.g., is a period of approximately between 1 day and approximately 2 days, e.g., is a period of approximately between 2 days. 68.The method according to any of Claims 62-67, wherein the culture of step (b) comprises a culture period following the introduction of step (c), optionally wherein the culture period following the introduction of step (c) is at least 12 hours, for example, is a period of approximately 1 day to approximately 12 days, for example, is a period of approximately 1 day to approximately 6 days, for example, is a period of approximately 2 days to approximately 4 days, for example, is a period of approximately 2 days, or is a period of approximately 3 days, or is a period of approximately 4 days.

69. The method according to any of Claims 62-68, wherein the cell population is expanded ex vivo at least 3 times, for example, at least 4 times, for example, at least 5 times, for example, at least 10 times. 70.The method according to any of Claims 62-69, wherein the introduction of step (c) comprises electroporation.

71. The method according to any of Claims 62-70, wherein the cell (e.g., cell population) provided in step (a) is a human cell (e.g., a human cell population).

72. The method according to Claim 71, wherein the cell (e.g., cell population) provided in step (a) is isolated from bone marrow, peripheral blood (e.g., mobilized peripheral blood), or umbilical cord blood. 73.The method according to Claim 72, wherein (i) the cell (e.g., cell population) provided in step (a) is isolated from bone marrow, e.g., is isolated from the bone marrow of a patient suffering from a hemoglobinopathy, optionally wherein the hemoglobinopathy is sickle cell disease or a thalassemia, optionally wherein the thalassemia is beta thalassemia; or (ii) the cell (e.g., cell population) provided in step (a) is isolated from peripheral blood, e.g., is isolated from peripheral blood of a patient suffering from a hemoglobinopathy, optionally wherein the hemoglobinopathy is sickle cell disease or a thalassemia, optionally wherein the thalassemia is beta thalassemia; optionally where the peripheral blood is mobilized peripheral blood, optionally where the mobilized peripheral blood is mobilized using Plerixafor, G-CSF, or a combination thereof.

74. The method according to any of Claims 62-73, wherein the cell population provided in step (a) is enriched for CD34+ cells.

75. The method according to any of Claims 62-74, wherein, after the introduction of step (c), the cell (e.g., the cell population) is cryopreserved.

76. The method according to any of Claims 62-75, wherein, after the introduction of step (c), the cell (e.g., the cell population) comprises: a) an indel in or near a genomic DNA sequence complementary to the targeting domain of the first gRNA molecule; and / or a deletion comprising the sequence, e.g., substantially the entire sequence, between a sequence complementary to the targeting domain of the first gRNA molecule (e.g., at least ).90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG1 promoter region and a sequence complementary to the targeting domain of the first gRNA molecule (e.g., at least 90% complementary to the gRNA targeting domain, e.g., fully complementary to the gRNA targeting domain) in the HBG2 promoter region, optionally wherein the indel, e.g., deletion, does not comprise a nucleotide disposed between 5,250,092 and 5,249,833, chain (hg38).

77. The method according to any one of Claims 62-76, wherein: (a) after the introduction of step (c), at least approximately 40%, at least approximately 50%, at least approximately 60%, at least approximately 70%, at least approximately 80%, at least approximately 90%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, or at least approximately 99% of the cells in the cell population comprise an indel in or near a genomic DNA sequence complementary to the targeting domain of the first gRNA molecule, optionally wherein the indel is selected from an indel listed in Table 2-7, optionally wherein no cell in the population comprises a deletion of a nucleotide located between 5,250,092 and 5,249,833 of the strand (hg3 8);(b) after the introduction of step (c), the cell (e.g., the cell population) is capable of differentiating into a differentiated cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell exhibits a higher level of fetal hemoglobin, for example, in relation to an unaltered cell (e.g., the cell population); (c) after the introduction of step (c), the cell population is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (e.g., a red blood cell population), and wherein said population of differentiated cells has a higher percentage of F cells (e.g., at least approximately 15%, at least approximately 20%, at least approximately 25%, at least approximately 30%, or at least approximately 40% more F cells), for example, in relation to an unaltered cell population;(d) after the introduction of step (c), the cell (e.g., cell population) is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell (e.g., differentiated cell population) produces at least approximately 6 picograms (e.g., at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms, or between approximately 9 and approximately 10 picograms) of fetal hemoglobin per cell;(e) after the introduction of step (c) no off-target indels are formed in that cell, for example, no unwanted indels are formed outside the HBG1 and / or HBG2 promoter regions, for example, as detectable by next-generation sequencing and / or a nucleotide insertion assay; and / or (f) after the introduction of step (c), no unwanted indels, for example, no unwanted indels outside the HBG1 and / or HBG2 promoter regions, are detected in more than approximately 5%, for example, more than approximately 1%, for example, more than approximately 0.1%, for example, more than approximately 0.01%, of the cells in the cell population, for example, as detectable by next-generation sequencing and / or a nucleotide insertion assay.

78. A cell (for example, a cell population), which can be obtained by the method according to any of Claims 62-77.

79. A cell, for example, an altered cell, for example, a cell according to Claim 78, wherein: (a) at least approximately 40%, at least approximately 50%, at least approximately 60%, at least approximately 70%, at least approximately 80%, at least approximately 90%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, or at least approximately 99% of the cells in the cell population comprise an indel in or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule according to any one of Claims 1-22, optionally wherein the indel is selected from an indel listed in Table 2-7,optionally- wherein no cell in the population comprises a deletion of a nucleotide located between 5,250,092 and 5,249,833, -chain (hp.3 8); (b) the cell (e.g., the cell population) is capable of differentiating into a differentiated cell of an erythroid lineage (e.g., a red blood cell), and wherein said differentiated cell exhibits a higher level of hemoglobin, for example, fetal, relative to an unaltered cell (e.g., the cell population); (c) the cell population is capable of differentiating into a population of differentiated cells, for example, a population of cells of an erythroid lineage (e.g., a red blood cell population), and wherein said population of differentiated cells has a higher percentage of F cells (e.g., at least approximately 15%, at least approximately 20%, at least approximately 25%, at least approximately 30%, or at least approximately 40% more F cells), for example,in relation to an unaltered cell population; (d) the cell (e.g., cell population) is capable of differentiating into a differentiated cell, e.g., a cell of an erythroid lineage (e.g., a red blood cell), and wherein such differentiated cell (e.g., differentiated cell population) produces at least approximately 6 picograms (e.g., at least approximately 7 picograms, at least approximately 8 picograms, at least approximately 9 picograms, at least approximately 10 picograms, or between approximately 8 and approximately 9 picograms, or between approximately 9 and approximately -10 picograms) of fetal hemoglobin per cell; (e) no off-target indels are formed in such cell, e.g., no unwanted indels are formed outside the HBGI and / or HBG2 promoter regions, e.g.,as detectable by next-generation sequencing and / or a nucleotide insertion assay; (f) no unwanted indel, for example, no unwanted indel outside the HBGI and / or HBG2 promoter regions, is detected in more than approximately 5%, for example, more than approximately 1%, for example, more than approximately 0.1%, for example, more than approximately 0.01%, of the cells in the cell population, for example, as detectable by next-generation sequencing and / or a nucleotide insertion assay; and / or (g) said cell or its progeny is detectable in a patient to whom it is transplanted more than 16 weeks, more than 20 weeks, or more than 24 weeks post-transplant, optionally detected by the detection of an indel in or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule according to any one of Claims 1-22,optionally where the indel is selected from an indel listed in Table 2-7., 80. The cell according to any of Claims 78-79, wherein the cell is an animal cell, for example, a mammalian, primate or human cell, for example, a human cell; optionally wherein said cell is obtained from a patient suffering from a hemobiopathy, for example, sickle cell disease or a thalassemia, for example, beta-thalassemia, 81. The cell according to any of Claims 78-80, wherein the cell is an HSPC, optionally a CD34+ HSPC, optionally a CD34+CD90+ HSPC.

82. The cell according to any of Claims 78-81, wherein the cell (e.g., cell population) has been isolated from bone marrow, peripheral blood (e.g., mobilized peripheral blood), or umbilical cord blood.

83. The cell according to any of Claims 78-82, wherein the cell is autologous or allogeneic with respect to a patient to whom said cell is to be administered.

84. A method for treating a hemoglobinopathy, comprising administering to a human patient a composition comprising a cell or cell population according to any of Claims 39-57 or 78-83.

85. A method for increasing fetal hemoglobin expression in a human patient, comprising administering to said human patient a composition comprising a cell or cell population according to any of Claims 39-57 or 78-83.

86. The method according to Claim 84,wherein the hemoglobinopathy is beta-hemolytic anemia or sickle cell disease.

87. The method according to any of Claims 84-86, wherein a composition comprising at least approximately 26 cells according to any of Claims 39-57 or 78-83 per kilogram of the human patient's body weight, for example, at least approximately 200 CD34+ cells according to any of Claims 39-57 or 78-83 per kilogram of the human patient's body weight, is administered to the human patient.

88. The method according to any of Claims 84-87, wherein the cell or cell population, or its progeny, is detectable in the human patient more than 16 weeks, more than 20 weeks, or more than 24 weeks after administration,optionally detected by detecting an indel in or near a genomic DNA sequence complementary to the targeting domain of a gRNA molecule according to any of Claims 1-22, optionally wherein the indel is selected from an indel listed in Table 2-7; optionally wherein the detection level of the indel in a reference cell population (e.g., CD34+ cells) at more than 16 weeks, more than 20 weeks, or more than 24 weeks after administration is reduced by no more than 50%, no more than 40%, no more than 30%, no more than 20%, no more than 10%, no more than 5%, or no more than 1% relative to the detection level of the indel in the cell population immediately prior to administration.

89. A gRNA molecule according to any of Claims 1-22, a composition according to any of Claims 23-28 or 58, a nucleic acid according to Claim 29,A vector according to Claim 30, a cell or cell population according to any of Claims 39-57 or 78-83, for use as a medicament.

90. A gRNA molecule according to any of Claims 1-22, a composition according to any of Claims 23-28 or 58, a nucleic acid according to Claim 29, a vector according to Claim 30, a cell or cell population according to any of Claims 39-57 or 78-83, for use in the manufacture of a medicament.

91. A gRNA molecule according to any of Claims 1-22, a composition according to any of Claims 23-28 or 58, a nucleic acid according to Claim 29, a vector according to Claim 30, a cell or cell population according to any of Claims 39-57 or 78-83, for use in the treatment of a disease.

92. A gRNA molecule according to any of Claims 1-22, a composition according to any of Claims 23-28 or 58, a nucleic acid according to Claim 29, a vector according to Claim 30, a cell or cell population according to any of Claims 39-57 or 78-83, for use in the treatment of a disease, wherein the disease is a hemoglobinopathy, optionally wherein the hemoglobinopathy is a sickle cell disease or a thalassemia (e.g., beta-thalassemia).Abstract The present invention relates to genome editing systems, reagents and methods for the treatment of hemoglobinopathies.