SPECIFIC SYNTHETIC OLIGONUCLOTIDES FOR THE DETECTION OF RICKETTSIA RICKETTSII GENETIC MATERIAL AND THEIR DETECTION METHOD

MX431908BActive Publication Date: 2026-02-25UNIV AUTONOMA DE QUERETARO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2022003615
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Filing Date
2022-03-24
Publication Date
2026-02-25
Estimated Expiration
2042-03-24

AI Technical Summary

Technical Problem

Current diagnostic methods for Rickettsia rickettsii are non-specific, leading to nonspecific results and delayed diagnosis, which contributes to the high lethality of Rocky Mountain Spotted Fever (RMSF).

Method used

Design of specific synthetic oligonucleotides that recognize and amplify the DNA or mRNA sequences unique to Rickettsia rickettsii using PCR and LAMP techniques, enabling rapid and specific detection.

Benefits of technology

The method achieves 100% specificity and sensitivity between 75-95% for detecting Rickettsia rickettsii, potentially reducing the lethality of RMSF by enabling early and accurate diagnosis.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention consists of the unique design of oligonucleotides that specifically hybridize to a Rickettsia rickettsii sequence. The hybridization or binding of these oligonucleotides to the Rickettsia rickettsii sequence is useful for performing specific amplification using standard techniques such as Polymerase Chain Reaction (PCR) or hairpin-based isothermal amplification (LAMP) and their real-time variants, which are used as diagnostic or detection methods for microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

SPECIFIC SYNTHETIC OLIGONUCLEOTIDES FOR THE DETECTION OF RICKETTSIA RICKETTSII GENETIC MATERIAL AND ITS DETECTION METHOD. IVIA / a / ZUZZ / UUÓD I o DESCRIPTION TECHNICAL FIELD OF THE INVENTION The present invention relates to the field of biotechnology, specifically to molecular diagnostics for the detection of infectious diseases. Specifically, the present invention relates to methods for early detection of the bacterium Rickettsia rickettsii, the causative agent of Rocky Mountain Spotted Fever (RMSF), also known as Rickettsia rickettsii Spotted Fever (RSFF). OBJECTIVES OF THE INVENTION The first objective of the present invention is to provide the design of specific synthetic igonuc I e ó ti two that serve as primers for the detection of deoxyribonucleic acid (DNA) of the bacterium Rickettsia rickettsii, by means of the hairpin-based isothermal amplification technique (LAMP) and its variants, as well as by means of the polymerase chain reaction technique (PCR) and its variants. The second objective of the present invention is to provide a method for the specific diagnosis of Rickettsia rickettsii in patients with symptoms of Rocky Mountain Spotted Fever (RMSF). BACKGROUND Rickettsia rickettsii (RR) is a pathogenic bacterium for humans and animals, transmitted through tick bites. This bacterium causes Rocky Mountain Spotted Fever (RMSF), also known as Rickettsia rickettsii Spotted Fever (RMSF). The life cycle of the tick that transmits Rickettsia rickettsii involves two hosts, both vertebrate and invertebrate. The tick larvae transmit Rickettsia rickettsii when they feed on the hosts, at which point the RMSF infection begins. RHF has caused the death of approximately 63% of children and adults who contract the disease. According to the Special Epidemiological Surveillance System for Rickettsiosis (2019), RHF is considered one of the most lethal diseases, generally associated with delayed diagnosis and treatment due to two main causes: a) the lack of effective vaccines and b) the lack of rapid and specific diagnostic methods. The biological characteristics of Rickettsia rickettsii and its high lethality rate have led to its being considered a potent bioterrorist agent in other countries, according to Azad and Radulovi c (2003) in “Pathogenic rickettsiae as bioterrorism agents”. Ann NY Acad Sci. Faced with this problem, health authorities have made Rickettsia rickettsii a priority for immediate public health attention. As a result of this emergency, and as established in Article 4 of the Political Constitution of the United Mexican States, which states that every person has the right to health protection, the Specific Action Program for the prevention and control of Rickettsiosis was proposed in the National Development Plan. This program promotes immediate attention to cases of FMMR, as well as promoting prevention and control actions to help reduce the presence of this disease, as indicated in the 2013 Sectoral Health Program. Current diagnostic methods are nonspecific for the Rickettsia rickettsii species, leading to nonspecific results. Molecular methods are based on oligonucleotides that hybridize within the Rickettsia genus because these oligonucleotides are designed using homologous sequences across Rickettsia species. One of the diagnostic methods used to detect the genus Rickettsiia is the polymerase chain reaction (PCR), specifically for the detection of the ompA and glta genes. This technique involves generating hundreds of copies of the genes used as a template. It consists of three steps performed at different temperatures (92°C, 55°C, and 72°C), with the amplification reaction lasting from 1 hour 30 minutes to 2 hours. The reaction mixture requires the following reagents: Taq polymerase, buffer, deoxynucleoside triphosphates (dNTPs), MgCh, oligonucleotides (sense (F3) and antisense (B3)), nuclease-free water, and template DNA. This method detects the entire Rickettsia family and is therefore not specific to the species Rickettsia rickettsii. PCR detection of Rickettsia rickettsii is carried out using specific oligonucleotides to amplify a gene that encodes a 17 kDa protein, according to Tzianabos et al. (1989) in “Detection of Rickettsia rickettsii DNA in clinical specimens by using Chain Reaction Technology”. Journal of Clinical Microbiology. 27(12):2866-2868, where it is stated that this gene is found in all Rickettsiia species, and therefore is not specific to Rickettsia rickettsii. Similarly, La Scola & Raoult (1997) in “Laboratory diagnosis of rickettsioses: current approaches to diagnosis of disease and new rickettsial diseases”. J Clin Microbiol. 35(1 1 ):271 5-27, has reported the PCR technique for the amplification of the ompA and glta genes, which are found in the genus Rickettsia; however, to determine the species nucleic acid sequencing is needed. Additionally, the loop-mediated isothermal amplification (LAMP) technique has been developed for the detection of the genus Rickettsiia, using a gene that, according to the statements of Noden et al. (2018) in “Development of a loop-mediated isothermal amplification (LAMP) assay for rapid screening of ticks and fleas for spotted fever group rickettsia”. PLoS One. 1 3(2):e01 92331 and Hanoaka et al. (2017) in “Development of a Novel Loop-Mediated Isothermal Amplification (LAMP) Assay for the Detection of Rickettsia spp”. Jpn J Infect Dis. 24;70(1 ): 1 1 9-1 23, encodes a 17 kDa protein; however, it is not specific for the detection of Rickettsia rickettsii, since this gene is found in the genus Rickettsia. As Notomi et al. (2000) point out in “Loop-mediated isothermal amplification of DNA”. Nucleic Acids Res. 28(12):E63, this technique is based on the isothermal amplification of thousands of copies of the target gene. Additionally, some patent documents addressing Rickettsia detection, such as MX3 56005B, describe a kit and method for the detection, identification, and differential diagnosis of Dengue virus, West Nile virus, Rickettsia spp., and Leptospira spp. by real-time PCR using oligonucleotide mixtures. In this technology, detection is not specific, as its advantage lies precisely in the detection and identification of all four of the aforementioned infectious agents, which are capable of causing disease with febrile symptoms. Furthermore, patent document CN1 02251 039A describes a kit and method for detecting anaplasmosis and rickettsiosis, based on hairpin-based isothermal amplification (LAMP) by detecting the omp gene. The kit is applicable to the clinical detection of spotted fever and granulocytic anaplasmosis, especially in rural areas where medical resources are limited; however, it is not specific to the species Rickettsia rickettsii. The different technologies applied to rickettsiosis disease were also considered from the point of view of its care, as in the patent document WO 2 OO 8 / OO 7 9 3 5, which describes a method for obtaining a drug to treat infectious diseases such as those caused by Rickettsia spp that focuses on the reproduction of the bacteria, and it would not be possible to derive a diagnostic method from this type of technology. Another technology focused on immunogenic compositions and vaccines using Rickettsia rickettsii is described in document WO201 9 / 027670. These vaccines address infections caused by tick-borne pathogens, including Rickettsia rickettsii, Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia ruminantium, Anaplasma marginale, and Anaplasma phagocytophilum. The immunogenic composition comprises inactivated cells, either individually or in combination. While this technology is specific to each of these species, it focuses on enhancing the immune response rather than on timely diagnosis. In addition, several patent documents related to Rickettsiosis disease were reviewed, such as RU2630672, US201 4228455, KR201 001 1 2678 and CN1 01 545009; however, all of them refer to the genus Rickettsia spp, without addressing the species Rickettsia rickettsii. Other patent documents cover specific species, such as document RU201 1 1 2521 2 which focuses on the Rickettsia species IVIA / a / ZUZZ / UUÓD I or Slovak, WO9942479 which focuses on Rickettsia helvética, RU22071 68 which addresses Astrakhan Rickettsiosis or documents CN1 01 21 921 4 and CN1 61 6968 which deal with Rickettsia river oyster. Therefore, based on the review of the state of the art, it can be concluded that there is currently no specific method for the detection of Rickettsia rickettsii by LAMP and PCR techniques, as well as variants of these techniques. TECHNICAL PROBLEM TO BE SOLVED Based on the above, technologies already exist that apply to the proposed development; however, these technologies do not consider the design of synthetic oligonucleotides specific to the Rickettsia rickettsii species, so the detection tests, as well as the diagnosis, are not specific to this species. IVIA / a / ZUZZ / UUÓD I o BRIEF DESCRIPTION OF THE INVENTION Unlike what is described in the prior art, the present invention consists of the design of specific synthetic oligonucleotides for detecting the bacterium Rickettsia rickettsii. These oligonucleotides specifically recognize a sequence of deoxyribonucleic acid (DNA) or ribonucleic acid, also called messenger ribonucleic acid (mRNA), through the synthesis of complementary DNA (cDNA), both derived from the bacterium Rickettsia rickettsii. Based on this design of specific synthetic oligonucleotides and their identification, an early detection method for the bacterium Rickettsia rickettsii was developed, which will reduce the lethality of Rocky Mountain Spotted Fever (RMSF). BRIEF DESCRIPTION OF THE FIGURES > tu r\ c NN CC to σ -ju The attached figures are explained as follows: Figure 1. Sample of each of the specific synthetic oligonucleotide sequences and their nomenclature. Figure 2. Sample of the specific synthetic oligonucleotide sequences of the present invention and the nucleotide sequence of the gene with unknown function of Rickettsia rickettsii where they hybridize. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the design of specific synthetic oligonucleotides for the detection, identification, and quantification of the genetic material of the bacterium Rickettsia rickettsii. To further clarify the description of the present invention, the most important concepts for the design of specific synthetic oligonucleotides are presented below: The definition of specific synthetic oligonucleotides states that they are fragments that recognize sequences of deoxyribonucleic acid (DNA) or ribonucleic acid, also called messenger ribonucleic acid (mRNA), both derived from the bacterium Rickettsia rickettsii. These specific synthetic oligonucleotides serve as templates or primers for the gene sequence present in the form of DNA or mRNA in the form of cDNA. These oligonucleotides are used in a mixture that, through standard Polymerase Chain Reaction (PCR) techniques or hairpin-based isothermal amplification (LAMP), in any of its known variants, produces amplification of the gene region corresponding to Rickettsia rickettsii. • The term “amplification” refers to the generation of hundreds of copies of deoxyribonucleic acid from a template of a specific DNA fragment; using polymerase chain reaction (PCR) techniques or hairpin-based isothermal amplification (LAMP), both in any of their known variants. The term “QLAMP” refers to the combination of the LAMP technique with a real-time detection method for DNA amplification. QLAMP is a more sensitive technique for detecting amplified DNA or cDNA due to the use of a fluorophore, or fluorescent marker. This technique requires real-time equipment that detects the fluorescence signal, eliminating the need for visual analysis of the results on an agarose gel. The term “fluorophore” refers to a molecule that absorbs light energy at a specific wavelength and emits it at another wavelength; it is at this latter wavelength that the light signal detected by equipment is observed. This signal is known as relative fluorescence (RFU). • The term “reaction mixture” or “reaction premix” refers to the combination of chemical substances that carry out the amplification of the target fragment by means of PCR, LAMP and their real-time variants. The term “target gene” or “template” refers to the fragment of DNA or cDNA that will be amplified using PCR, qPCR, and LAMP-qLAMP techniques. The target sequence refers to a 408 base pair (bp) fragment located in the genome of the bacterium Rickettsia rickettsii at locus AF042063, which is found in genetic sequence databases used for this purpose, such as GenBank, among others. • The term “intercalating agent” refers to a molecule that has the ability to form bonds with the deoxyribonucleic acid of DNA, which can be visualized using ultraviolet (UV) light. With these considerations, a first phase of the present invention consists of the design of a set of specific synthetic oligonucleotides which, in a second phase of the present invention, were identified as functioning as primers in the presence of the target gene. Subsequently, and once the design of specific synthetic oligonucleotides for the amplification of a nucleotide sequence of Rickettsia rickettsii has been obtained, the third phase is developed, which allows this unique design and its identification protocol to be used in diagnostic or detection methods of the microorganism of interest. .Design of synthetic oligonucleotides specific for Rickettsia rickettsii. The following process was carried out to design the specific synthetic oligonucleotides: 1.1. Bioinformatic analysis of the genome of Rickettsia rickettsii, Iowa strain and Sheila Smith strain, was performed in the genetic sequence databases used for these purposes, for example, GenBank, where the complete genomes of the reference strains for Rickettsia rickettsii are reported. 1.2. The template gene or template sequence was selected, using a template of a nucleic acid sequence belonging to a IVIA / a / ZUZZ / UUÓD I or gene with unknown function within the Rickettsia rickettsii genome. The search found a nucleotide sequence that corresponds to a gene with unknown function, since there is no report demonstrating its function. 1.3. The sequence analysis was performed using a multiple sequence alignment program, such as the BLAST family of programs. Once this nucleotide sequence was obtained from the reference strains mentioned above, a more exhaustive search was performed on all the genomes of the different Rickettsia rickettsii isolates reported to date in the genetic sequence databases, using the multiple sequence alignment program. 1.4. Multiple alignment of the nucleotide sequences of the different strains of Rickettsia rickettsii was carried out using a bioinformatics tool, within which a multiple alignment program of nucleotide sequences called MUSCLE or CLUSTAL can be used, in order to find conserved and identical regions among all the nucleotide sequences of each isolate analyzed. 1.5. Once the conserved nucleotide sequences were obtained among the different isolates of Rickettsia rickettsii reported in the genome bank, the sequences were selected and the oligonucleotide design was carried out using standard parameters. 1.6. The analysis of the physicochemical parameters of the sequences was carried out, for which some computer program that allows the calculation of the characteristics present in the oligonucleotides can be used, as in this case, the Oligo IDT analyzer program. 1.7. The synthesis of the specific synthetic oligonucleotides was carried out, using a template of an acid sequence IVIA / a / ZUZZ / UUÓD I od is oxiribonuc I eicos, which encodes a protein with unknown function in Rickettsia rickettsii. Based on this procedure, the set of specific synthetic nucleotides obtained consists of F3 (SEQ. ID. NO. 1), F2 5 (SEQ.ID.NO.2), F1 (SEQ. ID. NO. 0.3), B3 (SEQ.ID.NO.4), B2 (SEQ.ID.NO.5), B1 (SEQ. ID. NO.6), LOOPB (SEQ. ID. NO. 7), LOOPF (SEQ.ID.NO.8), whose complete sequences are described in Table 1. Additionally, when B1-B2 is joined, BIP (SEQ.ID.NO.9) is presented, and when F1-F2 is joined, FIP (SEQ.ID.NO. 10) is presented. Table 1. Nucleotide sequences SEQ ID NO. 0 li go Nucleotide sequence 5-3' No. of PB 1 F3 GGCTTTAATTGTAGCGGGGGAATGAATAGA 30 2 F2 CTATAGATGCTAGTGCAGAAATAGCAACAACTC 33 3 F 1 CGCTGTGGATTAAAGGAGAAGGTCAAG 27 4 B3 GCATGCCAATTAAAGGAGAAGGTCAAG 28 4 B3 GCATGCCAATTAAAGCTGCATCAGCTAA 28 GCCAGCAGCATTGGATTG2 6 B1 GGCAAGTGTTGTCAATTACCCTTTTCCTTTTTCC 33 7 LOOPB CCTTTACCTCTCTGATTCTCACTTTGTGGGC 31 8 LOOPF CGGCTATGCTCCAGCTCACCAT 22 9 FIP CGCTGTGGATTAAAGGAGAAGGTCAAGTTTT CTATAGAGTAGTAGTAGCATTAGCATCA04 BIP GGCAAGTGTTGTCAATTACCCTTTTCCTTTCCtttt GGCCAGACTTTGCCGATTTCAAGG 61 The nucleotide set was evaluated using different parameters 15 as shown in Table 2 . IVIA / a / ZUZZ / UUÓD I o Table 2. Nucleotide Set Characterization Results SEQ ID NO. 01 igo Tm Pb Delta g Secondary structures Specificity 1 F3 57 27 -0.18 -6.05 1 0 0 % 2 F2 58.5 33 -2.15 -7.65 1 0 0 % 3 F1 59.2 27 0.12 -4.85 1 0 0 % 4 B3 60.1 28 -3.15 -11.66 1 0 0 % 5 B2 60.7 24 -0.59 -9.28 1 0 0 % 6 B1 61.4 33 -0.35 -5.36 1 0 0 % 7 LOOPB 61.7 3 1 -0.37 -3.53 1 0 0 % 8 LOOPF 61.6 22 -1.18 -6.34 1 0 0 % The mixture of specific synthetic oligonucleotides (OSE Mixture) for use in the diagnostic method may consist of either of the following two mixtures: Mix OSE 1: F3, B3, FIP, BIP, LoopB and LoopF ​​and their combinations. OSE 2 Mixture: F3, B3, FIP, BIP and their combinations. 2.Protocol for the identification of genetic material for Rickettsia rickettsii. For the detection of the genetic material of Rickettsia rickettsii, the polymerase chain reaction (PCR) techniques and its variant known as real-time polymerase chain reaction (qPCR) are considered; as well as the hairpin-based isothermal amplification (LAMP) technique and its variant known as real-time hairpin-based isothermal amplification (qLAMP). The protocol for identifying genetic material for Rickettsia rickettsii consists of the following steps: 2.1. Obtaining the clinical sample: It is performed by venipuncture, tissue sampling, or biopsy in patients suspected of having Rickettsia rickettsii. A tick sample can also be obtained. In all cases, DNA extraction must be performed using a known technique for this purpose. 2.2. Preparation of the reaction mixture, depending on the technique to be used. 2.2.1. PCR reaction for the detection of Rickettsia rickettsii. 2.2.1.1. Clean the work area with a sanitizing solution. 2.2.1.2. Place the following materials in the work area: a) boxes of sterile tips b) PCR tubes (600 pL) c) 1.5 m L tubes d) rack e) fine-point indelible marker. 2.2.1.3. Place the tubes containing the DNA samples to be analyzed in an icebox and defrost. 2.2.1.4. Place the reagent tubes and defrost. 2.2.1.5. Once the samples are thawed, shake for 5 seconds. 2.2.1.6. Label the tubes that will be used for the reaction: a) One tube for each sample, labeled with the sample number, b) One negative control tube. c) A positive control tube. 2.2.1.7. Add the PCR reaction reagents to sterile 600 pL tubes in the amounts and order indicated in Table 3 for PCR with any Master mix and in Table 4 for PCR with any reagent: dNTPs, MgCh, 1x buffer, genomic DNA, Taq polymerase and nuclease-free water. Mixtures can be made at different volumes, using the proportions indicated in Tables 3 and 4. IVIA / a / ZUZZ / UUOOl o Table 3. Reagents required for the PCR reaction when using Master mix. Order Reagent Negative Control Problem Sample Positive Control 1 Oligonucleotide F3 (10 pM) 1 pL 1 pL 1 pL 2 Oligonucleotide B3 (10 pM) 1 pL 1 pL 1 pL 3 Master mix 12.5 pL 12.5 pL 12.5 pL 4 DNA positive control (0.03-90 ng) 0 pL 0 pL 1 pL 5 DNA sample (0.03-90 ng) 0 pL 1 pL 0 pL 6 Molecular biology grade H2O 10.5 pL 9.5 pL 9.5 pL Final volume 25 pL 25 pL 25 pL Table 4. Reagents needed for the PCR reaction, when using any Taq polymerase. Order Reagent Negative Control Sample Positive Control 1 Oligonucleotide F3 (10 pM) 1 pL 1 pL 1 pL 2 Oligonucleotide B3 (10 pM) 1 pL 1 pL 1 pL 3 Buffer 1 x 2.5 pL 2.5 pL 2.5 pL 4 dNTPs 0.2 pM 0.2 pM 0.2 pM 5 Mg C12 1.5 pM 1.5 pM 1.5 pM 6 Taq polymerase (1 U) 1 pL 1 pL 1 pL 7 Positive control DNA (0.03-90 ng) 0 pL 0 pL 1 pL 8 Sample DNA (0.03-90 ng) 0 pL 1 pL 0 pL 9 Molecular biology grade H2O 2.5 pL 2.5 pL 2.5 pL 2.5 pL 2 5 p L Final volume 25 pL 25 pL 25 pL 2.2.1.8. Close the 600 μ L tubes, and keep them on ice. 2.2.1.9. Centrifuge the reaction tubes for 10 seconds in a picocentrifuge. 2.2.1.1 0.1 Incubate the tubes following the program: 1 cycle of 94°C for 1 min, 34 cycles of 94°C for 1 min, followed by alignment at 63°C for 45 seconds and the extension step at 72°C for 45 seconds. The final extension step is one cycle at 72°C for 7 min. IVIA / a / ¿U¿¿ / UUÓD I o 2.2.2. LAMP reaction with oligonucleotides for the detection of Rickettsia rickettsii. 2.2.2.1. Follow steps 2.2.1.1 to 2.2.1.6 2.2.2.2. Add the LAMP reaction reagents to sterile 600 pL tubes in the amounts and order indicated in Table 5 for LAMP with any Master mix and in Table 6 for LAMP with any reagent: dNTPs, MgCh, 1x buffer, genomic DNA, Taq polymerase and nuclease-free water. Mixtures can be made at different volumes, using the proportions indicated in Tables 5 and 6. Table 5. Reagents required for the LAMP reaction when using Master mix. Order Reagent Negative Control Problem Sample Positive Control 1 Oligonucleotide F3 0.25 pL 0.25 pL 0.25 pL 2 Oligonucleotide B3 0.25 pL 0.25 pL 0.25 pL 3 Oligonucleotide FIP 0.5 pL 0.5 pL 0.5 pL 4 Oligonucleotide BIP 0.5 pL 0.5 pL 0.5 pL 5 Master mix 12.5 pL 12.5 pL 12.5 pL 6 DNA Sample 0 pL 1 pL 1 pL 7 Molecular Biology Grade H2O 1 1 pL 10 pL 10 pL Final Volume 25 pL 25 pL 25 pL ινΐΛ / a / zuzz / uuóo io Table 6. Reagents needed for the LAMP reaction, when using any Taq polymerase. Order Reagent Negative Control Problem Sample Positive Control 1 Oligonucleotide F3 0.25 pL 0.25 pL 0.25 pL 2 Oligonucleotide B3 0.25 pL 0.25 pL 0.25 pL 3 Oligonucleotide FIP 0.5 pL 0.5 pL 0.5 pL 4 Oligonucleotide BIP 0.5 pL 0.5 pL 0.5 pL 5 dNTPs 3.5 pL 3.5 pL 3.5 pL 6 Buffer 2.5 pL 2.5 pL 2.5 pL 7 MgS 0.4 1.5 pL 1.5 pL 1.5 pL 8 Bstpo I 1 pL 1 pL 1 pL 9 DNA Sample 0 pL 1 pL 1 pL 1 0 Molecular Biology Grade H2O 1.4 pL 13 pL 1 3 pL Final volume 25 pL 25 pL 25 pL 2.2.2.3. Follow steps 2.2.1.8 to 2.2.1.9 2.2.2.4. Incubate the reaction tubes at a temperature range of up to 65°C, using a thermocycler or water bath. 2.2.3. Reaction of the QLAMP variant with oligonucleotides for the detection of Rickettsia rickettsii. 2.2.3.1. Follow steps 2.2.1.1 to 2.2.1.6 2.2.3.2. Add the QLAMP reaction reagents to sterile 600 pL tubes, in the amounts and order indicated in Table 7. Mixtures can be made at different volumes, using the proportions indicated in Table 7. ΐνΐΛ / ϋ / ZUZZ / UUoO I o Table 7. Reagents required for the QLAMP reaction, when using any reagent from Master mix for QLAMP. Order Reagent Negative Control Sample Positive Control 1 Oligonucleotide F3 0.25 pL 0.25 pL 0.25 pL 2 Oligonucleotide B3 0.25 pL 0.25 pL 0.25 pL 3 Oligonucleotide FIP 0.5 pL 0.5 pL 0.5 pL 4 Oligonucleotide BIP 0.5 pL 0.5 pL 0.5 pL 5 Master mix 12.5 pL 12.5 pL 12.5 pL 6 Fluorescent dye (5 Ox) 1 pL 1 pL 1 pL 7 DNA sample 0 pL 1 pL 1 pL 8 Molecular biology grade H2O 1 1 pL 10 pL 10 pL Final volume 25 pL 25 pL 25 pL 2.2.3.3. Follow steps 2.2.1.8 to 2.2.1.9 2.2.3.4. Program the equipment to a temperature of 63°C for 25 cycles, each cycle per minute, add the Melt curve. The complete program lasts 55 min. 2.2.3.5. Save the results. 2.2.3.6. Export the results to Excel and analyze the RFU and the Ct value. 2.2.4. Visualization of results for the use of coloring agents for the LAMP technique and its variant QLAMP. 2.2.4.1. Remove the tubes from the thermocycler or water bath. 2.2.4.2. Observe the coloration of the tubes, according to table 8. purple (or violet) to sky blue. IVIA / a / ZUZZ / UUÓD I o Table 8. Table of results for the use of coloring agents, for LAMP and its variant QLAMP. Dye Concentration pL Positive Negative Hydroxynaphthol Blue (HNB) 1 M 1 Blue Violet Phenol Red, included in the master mix 2X 12.5 Orange-yellow Red Dye or fluorescent dye 50 x 0.5 Fluorescence No fluorescence Grades: Those that show a noticeable change in color are considered positive. The fluorescent dye can be used in the qPCR variant, and is visualized and reported as RFU or fluorescence level. 2.2.5. Visualization of results by agarose gel electrophoresis, for the PCR and LAMP technique. 2.2.5.1. Prepare a 1% agarose gel with enough wells to load all the samples. 2.2.5.2. Place the gel inside the electrophoresis chamber and fill with TAE buffer up to the indicated marks. 2.2.5.3. Prepare the samples for loading the gel. a) Place a parafilm frame on the table. b) Place one 1 pL drop of DNA loading buffer for each LAMP reaction performed (taking into account the molecular size marker, controls and samples). c) Add 1 pL of intercalating agent, e.g., GeIRed 10X, to each drop of DNA loading buffer. d) Add 10 pL of sample from each sample in a separate drop. e) Add 1 pL of molecular size marker to the remaining drop. f) Load the gel with 2 pL of molecular size marker and 5 pL of the LAMP reaction product loading preparation. g) Run the electrophoresis at 50 V for 50 min. h) Visualize the gene on any transilluminator. i) Samples are considered positive if a sweep is observed in the lane (for the LAMP technique) and a -218 bp band is observed (for the PCR technique). j) In the negative control lane, no sweep should be observed. 3. Diagnostic method for the genetic material of Rickettsia rickettsii. The method for detecting the genetic material of Rickettsia rickettsii considers its performance using polymerase chain reaction (PCR) techniques and its variant known as real-time polymerase chain reaction (qPCR); as well as the hairpin-based isothermal amplification (LAMP) technique and its variant known as real-time hairpin-based isothermal amplification (qLAMP). The detection method for Rickettsia rickettsii consists of the following steps: 3.1.1. Obtaining the clinical sample: It is performed by venipuncture, tissue sampling, or biopsy in patients suspected of having Rickettsia rickettsii. A tick sample can also be obtained. In all cases, DNA extraction must be performed using a known technique for this purpose. 3.1.2. Preparation of the reaction mixture, depending on the technique to be used. For the PCR technique and its variants, follow the protocol indicated in point 2.2.1. For the LAMP technique, follow the protocol indicated in point 2.2.2. For the QLAMP technique, follow the protocol indicated in point 2.2.3. 3.1.3. Amplification: For amplification with the LAMP technique, using a temperature of 60-65°C, for a period of 30 to 60 min and an inactivation temperature of 80-83°C, for a period of 3-5 min. 3.1.4. V isua I ization of results For the LAMP and QLAMP technique using coloring agents, follow the protocol indicated in point 2.2.4. For the PCR and LAMP technique using agarose gel electrophoresis, follow the protocol indicated in point 2.2.5. IVIA / S / ZUZZ / UUÓD I o BEST WAY TO CARRY OUT THE INVENTION To illustrate the non-invasive method for detecting the genetic material of Rickettsia rickettsii, which shows 100% specificity and sensitivity between 75 and 95%, Table 8 presents the results of clinical samples obtained from a heterogeneous part of the population. Table 8. Diagnostic results for the detection of Rickettsia rickettsii genetic material # Sample Type Oligonucleotide Mixture Used Detection Method Result SE 1 Blood OES 1 & 2 Mixture Fluorescence Positive 75% 1 0 0 % 2 Biopsy OES 1 & 2 Mixture Fluorescence Positive 95% 1 0 0 % 3 Tick OES 1 & 2 Mixture Fluorescence Positive 1 0 0 % 1 0 0 % 4 Blood OES 1 & 2 Mixture Colorimetric (visual) Positive 75% 1 0 0 % 5 Biopsy OES 1 & 2 Mixture Colorimetric (visual) Positive 95% 1 0 0 % 6 Tick OES 1 & 2 Mixture Colorimetric (visual) Positive 1 0 0 % 1 0 0 % 7 Blood OES 1 & 2 Mixture Gel Positive 75% 1 0 0 % 8 Biopsy OES 1 & 2 Mixture Gel Positive 95% 1 0 0 % 9 Tick Mixture OES 1 and 2 Gel Positive 1 0 0 % 1 0 0 % Where: S = Sensitivity E = Specificity The invention has been sufficiently described to allow a person of average skill to reproduce it and obtain the results mentioned herein. However, any person skilled in the art to which this invention pertains may be able to make modifications not described herein; nevertheless, if the application of these modifications to the composition or manufacturing process of the invention requires the subject matter claimed in the following claims, such compositions or processes shall be considered within the scope of this invention.

Claims

1. A mixture of specific synthetic oligonucleotides, referred to as Mixture OSE 1, for the detection of the genetic material of Rickettsia rickettsii characterized in that it has a first sequence consisting of SEQ.ID.NO.1, SEQ.ID.NO.4, SEQ.ID.NO.9, SEQ.ID.NO.10, SEQ.ID.N0.7, SEQ.ID.N0.8 and their combinations.

2. A mixture of specific synthetic oligonucleotides, referred to as Mixture OSE 2, for the detection of the genetic material of Rickettsia rickettsii characterized in that it has a second sequence consisting of SEQ.ID.NO.1, SEQ.ID.NO.4, SEQ.ID.NO.9, SEQ.ID.NO.10 and their combinations.

3. Protocol for the identification of genetic material for Rickettsia rickettsii according to what is described in claims 1 and 2 characterized in that it can employ the polymerase chain reaction (PCR) technique and its variants.

4. Protocol for the identification of genetic material for Rickettsia rickettsii according to what is described in claims 1 to 3 characterized in that it can employ the hairpin-based isothermal amplification technique (LAMP) and its variants.

5. A non-invasive method for detecting the genetic material of Rickettsia rickettsii, as described in claims 1 to 4, characterized in that it consists of four steps: obtaining the clinical sample, preparing the reaction mixture, amplification, and visualization of results. ANAL / ϋ / ZUZZ / UUoO I o 6. Non-invasive method for detecting the genetic material of Rickettsia rickettsii, as described in claim 5, characterized in that the clinical sample can be blood, biopsy, tissue or ticks.

7. A non-invasive method for detecting the genetic material of Rickettsia rickettsii, as described in claim 5, characterized in that the preparation of the reaction mixture can include both OSE Mixture 1 and OSE Mixture 2.

8. Non-invasive method for the detection of the genetic material of Rickettsia rickettsii, according to the description in claim 5, characterized in that the amplification is carried out using the enzyme Bst polymerase, in a period of time between 30 and 60 minutes.

9. A non-invasive method for detecting the genetic material of Rickettsia rickettsii, as described in claim 5, characterized in that the visualization of results can be carried out by using dye agents for the LAMP technique and its variant QLAMP.

10. Non-invasive method for the detection of the genetic material of Rickettsia rickettsii, according to the description in claim 5, characterized in that the visualization of results can be carried out by agarose gel electrophoresis for the PCR and LAMP technique.