Cyclic peptide lipids for nanoparticle formulations

Abstract

The present disclosure describes cyclic peptide-lipid conjugates, compositions, nanoparticles (such as lipid nanoparticles), and / or lipid nanoparticle compositions and methods of their use.

Description

CYCLIC PEPTIDE LIPIDS FOR NANOPARTICLE FORMULATIONSCROSS REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to and the benefit of U.S. Provisional Application No. 63 / 521,391, filed June 16, 2023, the contents of which are herein incorporated by reference in its entirety.SEQUENCE LISTING

[0002] This application includes and incorporates by reference in its entirety a Sequence Listing XML in the required .xml format. The Sequence Listing XML file that has been electronically filed contains the information of the nucleotide and / or amino acid sequences disclosed in the patent application using the symbols and format in accordance with the requirements of 37 C.F.R. §§1.832 through 1.834.

[0003] The Sequence Listing XML filed herewith serves as the electronic copy required by§l.834(b)(1).

[0004] The Sequence Listing XML is identified as follows: “272059-545532_Sequence- listing.xmr (13 kilobytes in size), which was created on June 13. 2024.FIELD OF THE INVENTION

[0005] The present disclosure describes compounds, compositions, lipid nanoparticles, and methods for delivering constructs and polynucleotides.SUMMARY

[0006] An aspect of the present disclosure provides a cyclic peptide-lipid conjugate comprising: a cyclic peptide comprising 4 to 30 amino acid residues. wherein 1, 2, or 3 amino acid residues comprise a positive charge; and at least one lipid component conjugated to the cyclic peptide, wherein the at least one lipid component is connected to at least one amino acid residue side chain. wherein each lipid component comprises a lipid linker and a lipid chain, wherein the lipid linker comprises a biodegradable group and the lipid chain comprises a branched or unbranched, substituted or unsubstituted, cyclic or acyclic aliphatic group.

[0007] Another aspect of the disclosure provides a compound of Formula I or Formula II:wherein each a is independently 0-15; each b is independently' 0-15; each R1is independently an amino acid side chain, or isomers or derivatives thereof; each L is independently a serine-, cysteine-, aspartic acid- or glutamic acid-side chain; each R2is independently a branched or unbranched, substituted or unsubstituted Ci- C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ester-containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ether-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide- containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted sulfanyl-, ester- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; or a branched or unbranched, substituted or unsubstituted carbamoyl-containing C1-C20 alkyl. C2-C20 alkenyl, or C2-C20 alkynyl, orwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach e is independently 0-10; each f is independently 0 or 1 ; each g is independently 0 or 1 ; each h is independently 0 or 1 ; and each R3is independently H, a branched or unbranched, substituted or unsubstituted C1-C20 alkyd, a branched or unbranched, substituted or unsubstituted C2- C20 alkenyl, or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; provided that the compound of Formula I or Formula II comprises at least one and no more than three atoms with a positive charge, wherein the one to three positive charges are present in R1and / or R2.

[0008] In some embodiments, the compound of Formula I is a compound of Formulas I-A-l to I-A-4:

[0009] In some embodiments, the compound of Formula II is a compound of Formulas 11-A-l to II-A-4:

[0010] In some embodiments, the compound of Formula I is a compound of Formulas I-B-l to I-B-4:

[0011] In some embodiments, the compound of Formula II is a compound of Formulas II-B-l to II-B-4:

[0012] In some embodiments, the compound of Formula I is a compound of Formulas I-C-lo I-C-4:

[0013] In some embodiments, the compound of Formula II is a compound of Formulas II-C-1 to II-C-4:

[0014] Another aspect of the present disclosure provides a lipid nanoparticle (LNP) composition comprising: a cyclic peptide-lipid conjugate or a compound of Formula I or Formula II described herein.

[0015] Another aspect of the present disclosure provides a lipid nanoparticle (LNP) composition comprising: a cyclic peptide-lipid conjugate or a compound of Formula I or Formula II described herein; and at least one of: a cationic lipid; a phospholipid; a PEG-containing lipid; or a sterol.

[0016] Another aspect of the present disclosure provides a pharmaceutical composition comprising the LNP composition described herein.

[0017] Another aspect of the present disclosure provides a method for delivering polynucleotides into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic peptide-lipid conjugate a compound of Formula I or Formula II described herein; and (2) one or more polynucleotides.

[0018] Another aspect of the present disclosure provides a method for delivering a prime editing system into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic peptide-lipid conjugate a compound of Formula I or Formula II described herein; and (2) one or more components of a prime editing system.

[0019] Other aspects, embodiments, and features will be apparent from the following description and the claims.INCORPORATION BY REFERENCE

[0020] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The novel features of the methods and compositions provided herein are set forth with particularity in the appended claims. A better understanding of the features and advantages of the methods and compositions provided herein will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the methods and compositions provided herein are utilized, and the accompanying drawings of which:

[0022] FIG. 1 shows editing % for RNA cargo delivered with LNPs containing the cyclic peptides disclosed herein.DETAILED DESCRIPTION

[0023] Provided herein are cyclic peptide-lipid conjugates and compounds of Formula I and II. Compositions, lipid nanoparticles, and pharmaceutical compositions provided herein cancomprise the conjugates or compounds descnbed herein. Methods for delivering said compositions and lipid nanoparticles are also provided herein.

[0024] The following description and examples illustrate embodiments of the present disclosure in detail. It is to be understood that this disclosure is not limited to the particular embodiments described herein and as such can vary. Those of skill in the art will recognize that there are numerous variations and modifications of this disclosure, which are encompassed within its scope. Although various features of the present disclosure can be described in the context of a single embodiment, the features can also be provided separately or in any suitable combination. Conversely, although the present disclosure can be described herein in the context of separate embodiments for clarity, the present disclosure can also be implemented in a single embodiment.

[0025] As used herein, the following definitions shall apply unless otherwise indicated.

[0026] I. DEFINITIONS

[0027] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms “a”, "‘an” and ‘'the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms “including’", “includes”, “having”, “has”, “with”, or variants thereof are used herein, they mean “comprising”.

[0028] Unless otherwise specified, the words “comprising”, “comprise”, “comprises”, “having”, “have”, “has”, “including”, “includes”, “include”, “containing”, “contains” and “contain” are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0029] Reference to “some embodiments”, “an embodiment”, “one embodiment”, or “other embodiments” means that a particular feature or characteristic described in connection with the embodiments is included in at least one or more embodiments, but not necessarily all embodiments, of the present disclosure.

[0030] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about"’ can mean within 1 standard deviation, per the practice in the art.Alternatively, "‘about” can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5 -fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims,unless otherwise stated, the term “about” meaning within an acceptable error range for the particular value should be assumed.

[0031] The term “between” means the range of numbers including the first and the last number in a range.

[0032] The term “substantially” as used herein may refer to a value approaching 100% of a given value. In some embodiments, the term may refer to an amount that may be at least about 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 99.99% of a total amount. In some embodiments, the term may refer to an amount that may be about 100% of a total amount.

[0033] For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version. Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemi stry are described in "Organic Chemistry," Thomas Sorrell. University Science Books. Sausalito: 1999, and "March's Advanced Organic Chemistry." 5th Ed.. Ed.: Smith. M.B. and March, J., John Wiley and Sons, New York: 2001, the entire contents of which are hereby incorporated by reference.

[0034] As described herein, compounds of the disclosure optionally may be substituted with one or more substituents, such as are illustrated generally above, or as exemplified by particular classes, subclasses, and species of the disclosure.

[0035] As used herein, “aliphatic” or “aliphatic group” refers to a saturated or unsaturated group having the fundamental properties of an aliphatic compound, consisting solely of carbon atoms and hydrogen atoms, and which is attached to the rest of the molecules by a single bond. An aliphatic group includes straight or branched alkyl, alkenyl, alkynyl, cycloalkyl and cycloalkenyl groups, as defined hereinafter. In some embodiments, the aliphatic group is unsubstituted. In some embodiments, the aliphatic group is substituted.

[0036] The cyclic peptides described herein contain “amino acid residues,” which refer to any naturally occurring amino acid, any unnatural amino acid, any amino acid derivative, or any amino acid mimic known in the art. A “naturally occurring amino acid” refers to Gly, Ala, Ser, Thr, VaL Leu, He, Phe, Tyr, Trp, His, Glu, Asp, Gin, Asn, Cys, Met, Lys, Arg, or Pro. Examples of “unnatural amino acids” include, but are not limited to, 0-amino acids, y-amino acids, L-amino acids, D-amino acids, N-substituted amino acids, a, a-disubstituted amino acids, amino acids having side chains that are different from those of natural amino acids, and hydroxy carboxylic acids. Amino acid residues present in the cyclic peptide may have any conformation. In some embodiments, an “amino acid residue” constituiting the cyclic peptide conjugates or compounds described herein may be referred to as an “amino acid.”

[0037] As used herein, “amino acid side chains.” refer to a side chain present in any naturally occurring amino acid, any unnatural amino acid, any amino acid derivative, or any amino acid mimic known in the art. In some embodiments, the amino acid side chain contains a functional group (e.g., -COOH, -NH2, -SH. or -OH). In some embodiments, the amino acid side chain is modified so that it contains a functional group. In some embodiments, the functional group can be used in a chemical reaction for covalent conjugation to a lipid component. In some embodiments, the covalent conjugation proceeds with a direct conjugation of the amino acid side chain functional group to the lipid component. In some embodiments, the conjugation of the amino acid side chain to the lipid component is in the presence of a linker (e.g., a lipid linker).

[0038] As used herein, an "alkyl" group refers to a saturated aliphatic hydrocarbon group containing 1-15 (e.g., carbon atoms. An alkyd group can be straight or branched. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, n-heptyl, n-octyl. n-nonyl, n-decyl. n-dodecanyl. n-tridecanyl. n-tetradecanyl, n-pentadecanyl, or 2-ethylhexyl.

[0039] In some embodiments, an alkyl group can be substituted (i.e., optionally substituted) with one or more substituents independently selected from halo, phospho, cycloaliphatic [e.g., cycloalkyl or cycloalkenyl], heterocycloaliphatic [e.g., heterocycloalkyl or heterocycloalkenyl], aryl, heteroaryl, alkoxy, aroyl, heteroaroyl, acyl [e.g., (aliphatic)carbonyl, (cycloaliphatic)carbonyl, or (heterocycloaliphatic)carbonyl], nitro, cyano, amido [e.g., (cycloalk lalkyljcarbonylamino, arylcarbonylamino, aralkylcarbonylamino, (heterocycloalkyl)carbonylamino, (heterocycloalkylalkyl)carbonylamino. heteroarylcarbonyl amino, heteroaralkylcarbonylamino alkylaminocarbonyl, cycloalkylaminocarbonyl, heterocycloalky laminocarbonyl, arylaminocarbonyl, or heteroarylaminocarbonyl], amino [e.g., aliphaticamino, cycloaliphaticamino, or heterocycloaliphaticamino], sulfonyl [e.g., aliphatic-SCh-], sulfinyl, sulfanyl, sulfoxy, urea, thiourea, sulfamoyl, sulfamide, oxo, carboxy, carbamoyl, cycloaliphaticoxy, heterocycloaliphaticoxy, aryloxy, heteroaryloxy, aralkyloxy, heteroarylalkoxy, alkoxycarbonyl, alkylcarbonyloxy, or hydroxy.

[0040] In other embodiments, an alkyl group can be substituted with one or more substituents independently selected from carboxy (such as HOOC-alkyl, alkoxycarbonyl, and alkylcarbonyloxy), cyano, hydroxy, alkoxy, acyl, aralkyl, aryl, heteroaryl, sulfonylaminoalkyl (such as alkyl-SCh-amino), amino, amido, cycloaliphatic, or halo.

[0041] In some embodiments, an alkyl group can be substituted with one or moresubstituents independently selected from halo, oxo, hydroxy, cyano, halo, alkoxy (e.g.. Ci-6 alkoxy), -C(O)-Ci-6 alkoxy and -C(O)-Ci-6 alkyl. In other embodiments, an alkyl group can be substituted with one or more substituents independently selected from halo, alkoxy, and hydroxy.

[0042] In some embodiments, an alkyl group can be substituted with -OH (“hydroxysubstituted alkyl”).

[0043] As used herein, an "alkenyl" group refers to an aliphatic hydrocarbon group that contains 2-20 carbon atoms and at least one double bond. Like an alkyl group, an alkenyl group can be straight or branched. Examples of an alkenyl group include, but are not limited to ethenyl, propenyl, butenyl, pentenyl, hexenyl, and heptenyl.

[0044] In some embodiments, an alkenyl group can be substituted (i.e., optionally substituted) with one or more substituents independently selected from halo, phospho, cycloaliphatic [e.g., cycloalkyl or cycloalkenyl], heterocycloaliphatic [e.g., heterocycloalkyl or heterocycloalkenyl], aryl, heteroaryl, alkoxy, aroyl, heteroaroyl, acyl [e.g.. (aliphatic)carbonyl, (cycloaliphatic)carbonyl, or (heterocycloaliphatic)carbonyl], nitro, cyano, amido [e.g., (cycloalkylalkyl)carbonylamino, arylcarbonylamino, aralkylcarbonylamino. (heterocycloalkyl)carbonylamino, (heterocycloalkylalkyl)carbonylamino. heteroarylcarbonylamino, heteroaralkylcarbonylamino alkylaminocarbonyl, cycloalkylaminocarbonyl, heterocycloalkylaminocarbonyl, aryl aminocarbonyl, or heteroarylaminocarbonyl], amino [e.g., aliphaticamino, cycloaliphaticamino, heterocycloaliphaticamino, or aliphaticsulfonylamino], sulfonyl [e.g., alkyl-SCh-, cycloaliphatic-SO2-, or aryl-SCh-]. sulfinyl, sulfanyl, sulfoxy. urea, thiourea, sulfamoyl, sulfamide, oxo, carboxy, carbamoyl, cycloahphaticoxy. heterocycloaliphaticoxy. aryloxy, heteroaryloxy, aralkyloxy, heteroaralkoxy, alkoxycarbonyl, alkylcarbonyloxy, or hydroxy.

[0045] In other embodiments, an alkenyl group can be substituted with one or more substituents independently selected from cyano, alkoxy, acyl, hydroxy, aryl, aralkyl, alkoxyaryl, sulfonylamino (such as alkyl-SCh-amino), amino, amido, cycloaliphatic, or halo.

[0046] In some embodiments, an alkenyl group can be substituted with one or more substituents as set forth herein for alkyl groups.

[0047] In some embodiments, an alkenyl group can be substituted with -OH (“hydroxysubstituted alkenyl”).

[0048] As used herein, a "cycloalkyl" group refers to a saturated carbocyclic mono- or bicyclic (fused or bridged) ring of 3-10 (e.g., 5-10) carbon atoms. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, adamantyl,norbomyl, cubyl, octahydro-indenyl, decahydro-naphthyl, bi cyclo|3.2.1] octyl, bicyclo[2.2.2]octyl, bicyclo[3.3. l]nonyl, bicyclo[3.3.2.]decyl, bicyclo[2.2.2] octyl, adamantyl, or ((aminocarbonyl)cycloalkyl)cycloalkyl.

[0100] A "cycloalkenyl" group, as used herein, refers to a non-aromatic carbocyclic ring of 3-10 (e.g., 4-8) carbon atoms having one or more double bonds. Examples of cycloalkenyl groups include cyclopentenyl, 1,4-cyclohexa-di-enyl, cycloheptenyl, cyclooctenyl, hexahydro-indenyl, octahydro-naphthyl, cyclohexenyl, bicyclo[2.2.2]octenyl, or bicyclo[3.3. l]nonenyl.

[0101] In some embodiments, a cycloalkyl or cycloalkenyl group can be substituted (i. e.. optionally substituted) with one or more substituents independently selected from phospho, aliphatic [e.g., alkyd, alkenyl, or alkynyl], cycloaliphatic, (cycloaliphatic) aliphatic, heterocycloaliphatic, (heterocycloaliphatic) aliphatic, aryl, heteroar l, alkoxy, (cycloaliphatic)oxy, (heterocycloaliphatic)oxy, aryloxy. heteroaryloxy, (araliphatic)oxy, (heteroaraliphatic)oxy. aroyl, heteroaroyl, amino, amido [e.g., (aliphatic)carbonylamino. (cycloaliphatic)carbonylamino, ((cycloaliphatic)aliphatic)carbonylamino, (aryl)carbonylamino, (araliphatic)carbonylamino, (heterocycloaliphatic)carbonylamino, ((heterocycloaliphatic)aliphatic)carbonylamino, (heteroaryl (carbonyl amino. or (heteroaraliphatic)carbonylamino], nitro, carboxy [e.g., HOOC-, alkoxy carbonyl, or alkylcarbonyloxy], acyl [e.g., (cycloaliphatic)carbonyl, ((cycloaliphatic) aliphatic)carbonyl, (araliphatic)carbonyl, (heterocycloaliphatic)carbonyl, ((heterocycloaliphatic)aliphatic)carbonyl, or (heteroaraliphatic)carbonyl], cyano, halo, hydroxy, mercapto, sulfonyl [e.g., alkyl-SCh- and aryl-SCh-], sulfinyl [e.g.. alkyl-S(O)-]. sulfanyl [e.g., alkyl-S-], sulfoxy. urea, thiourea, sulfamoyl, sulfamide, oxo. or carbamoyl.

[0102] In some embodiments, a cycloalkyl or cycloalkenyl group can be substituted with one or more substituents as set forth herein for aryl groups and / or aralkyl groups.

[0049] As used herein, a "heterocycloalkyl" group refers to a 3-10 membered mono- or bicyclic (fused or bridged) (e.g., 5- to 10-membered mono- or bicyclic) saturated ring structure, in which one or more of the ring atoms is a heteroatom (e.g., N, O, S, or combinations thereol). Examples of a heterocycloalkyl group include piperidyl, piperazyl, tetrahydropyranyl, tetrahydrofuryl, 1,4-dioxolanyl, 1,4-dithianyl, 1,3-dioxolanyl, oxazolidyl, isoxazolidyl, morpholinyl, thiomorpholyl, octahydrobenzofuryl, octahydrochromenyl, octahydrothiochromenyl, octahydroindolyl, octahydropyrindinyl. decahydroquinolinyl, octahydrobenzo[6]thiopheneyl, 2-oxa-bicyclo[2.2.2]octyl, l-aza-bicyclo[2.2.2]octyl, 3-aza- bicyclo[3.2.1]octyl, and 2,6-dioxa-tricyclo[3.3.1.03-7]nonyl. A monocyclic heterocycloalkylgroup can be fused with a phenyl moiety to form structures, such as tetrahydroisoquinoline, that would be categorized as heteroaryls.

[0050] A "heterocycloalkenyl" group, as used herein, refers to a mono- or bicyclic (e.g., 5- to 10-membered mono- or bicyclic) non-aromatic ring structure having one or more double bonds, and wherein one or more of the ring atoms is a heteroatom (e.g.. N, O, or S). Monocyclic and bicyclic heterocycloaliphatics are numbered according to standard chemical nomenclature.

[0051] In some embodiments, a heterocycloalky l or heterocycloalkenyl group has 1-3 heteroatoms independently selected from N. O, or S.

[0052] In some embodiments, a heterocycloalkyl or heterocycloalkenyl group can be substituted (i.e., optionally substituted) with one or more substituents independently selected from phospho, aliphatic [e.g., alky l, alkenyl, or alkynyl], cycloaliphatic, (cycloaliphatic)aliphatic. heterocycloaliphatic, (heterocycloaliphatic)aliphatic, aryl, heteroaryl, alkoxy, (cycloaliphatic)oxy, (heterocycloaliphatic)oxy, aryloxy. heteroaryloxy. (araliphatic)oxy, (heteroaraliphatic)oxy, aroyl, heteroaroyl, amino, amido [e.g., (aliphatic)carbonylamino, (cycloaliphatic)carbonylamino, ((cycloaliphatic) aliphatic)carbonylamino. (aryl)carbonylamino, (araliphatic)carbonylamino, (heterocycloaliphatic)carbonylamino, ((heterocycloaliphatic) aliphatic)carbonylamino, (heteroaryl)carbonyl amino, or (heteroaraliphatic)carbonylamino], nitro, carboxy [e.g., HOOC-, alkoxycarbonyl, or alkylcarbonyloxy], acyl [e.g., (cycloaliphatic)carbonyl, ((cycloaliphatic) aliphatic)carbonyl, (araliphatic)carbonyl, (heterocycloaliphatic)carbonyl, ((heterocycloaliphatic)aliphatic)carbonyl, or (heteroaraliphatic)carbonyl], nitro, cyano, halo, hydroxy, mercapto, sulfonyl [e.g., alkylsulfonyl or arylsulfonyl], sulfinyl [e.g.. alkylsulfinyl], sulfanyl [e.g., alkylsulfanyl], sulfoxy, urea, thiourea, sulfamoyl, sulfamide, oxo, or carbamoyl.

[0053] In some embodiments, a heterocycloalkyl or heterocycloalkenyl group can be substituted with one or more substituents as set forth herein for aryl groups, aralkyl groups, cycloalkyl groups, and / or cycloalkenyl groups.

[0054] A "heteroaryl" group, as used herein, refers to a monocyclic, bicyclic, or tricyclic ring system having 4 to 15 ring atoms wherein one or more of the ring atoms is a heteroatom (e.g., N, O, S, or combinations thereof) and in which the monocyclic ring system is aromatic or at least one of the rings in the bicyclic or tricyclic ring systems is aromatic. A heteroaryl group includes a benzofused ring system having 2 to 3 rings. For example, a benzofused group includes benzo fused with one or two 4 to 8 membered heterocycloaliphatic moieties(e.g.. indolizyL indolyl, isoindolyl, 3H-indolyl, indolinyL benzo[ / >]furyl, benzo [i>] thiopheneyl, quinolinyl, or isoquinolinyl). Some examples of heteroaryl are azetidinyl, pyridyl, 1H- indazolyl, furyl, pyrrolyl, thienyl, thiazolyl, oxazolyl, imidazolyl, tetrazolyl, benzofuryl, isoquinolinyl, benzthiazolyl, xanthene, thioxanthene, phenothiazine, dihydroindole, benzo[ 1,3] di oxole. benzo[b]furyl, benzo[b]thiophenyl, indazolyl. benzimidazolyl, benzthiazolyl, puryl, cinnolyl, quinolyl, quinazolyl,cinnolyl, phthalazyl, quinazolyl, quinoxalyl, isoquinolyl, 4H-quinolizyl, benzo-l,2,5-thiadiazolyl, or 1,8-naphthyridyl.

[0055] Without limitation, monocyclic heteroaryls include furyl, thiophene-yl, 2H-pyrrolyl, pyrrolyl, oxazolyl, thazolyl, imidazolyl, pyrazolyl, isoxazolyl, isothiazolyl, 1,3,4-thiadiazolyl, 2H-pyranyl, 4-H-pranyl, pyridyl, pyridazyl, pyrimidyl, pyrazolyl, pyrazyl, or 1,3,5-triazyl. Monocyclic heteroaryls are numbered according to standard chemical nomenclature.

[0056] Without limitation, bicyclic heteroaryls include indolizyl, indolyl, isoindolyl, 3H-indolyl, indolinyl, benzo[6]furyl, benzo[6]thiophenyl, quinolinyl, isoquinolinyl, indolizyl, isoindolyl, indolyl. benzo[6]furyl, bexo[6]thiophenyl. indazolyl, benzimidazyl. benzthiazolyl, purinyl, 4H-quinolizyl, quinolyl, isoquinolyl, cinnolyl, phthalazyl, quinazolyl, quinoxalyl, 1,8-naphthyridyl, or pteridyl. Bicyclic heteroaryls are numbered according to standard chemical nomenclature.

[0057] In some embodiments, a heteroaryl group has 1-3 heteroatoms independently selected from N, O, or S.

[0058] In some embodiments, a heteroaryl group can be substituted (i.e., optionally substituted) with one or more substituents such as aliphatic [e.g., alkyl, alkenyl, or alkynyl]; cycloaliphatic; (cycloaliphatic)aliphatic; heterocycloaliphatic; (heterocycloaliphatic)aliphatic; aryl; heteroaryl; alkoxy; (cycloahphatic)oxy; (heterocycloaliphatic)oxy; aryloxy; heteroaryloxy; (araliphatic)oxy; (heteroaraliphatic)oxy; aroyl; heteroaroyl; amino; oxo (on a non-aromatic carbocyclic or heterocyclic ring of a bicyclic or tricyclic heteroaryl ); carboxy; amido; acyl [ e.g., aliphaticcarbonyl; (cycloaliphatic)carbonyl;((cycloaliphatic)aliphatic)carbonyl; (araliphatic)carbonyl; (heterocycloaliphatic)carbonyl; ((heterocycloaliphatic)aliphatic)carbonyl; or (heteroaraliphatic)carbonyl] ; sulfonyl [e.g., aliphaticsulfonyl or aminosulfonyl]; sulfinyl [e.g., aliphaticsulfinyl] ; sulfanyl [e.g., aliphaticsulfanyl] ; nitro; cyano; halo; hydroxy; mercapto; sulfoxy; urea; thiourea; sulfamoyl; sulfamide; or carbamoyl. Alternatively, a heteroaryl can be unsubstituted.

[0059] In other embodiments, a heteroaryl group can be substituted with one or more substituents independently selected from halo [e.g., mono- and di-halo]; carboxy [e.g., alkoxy carbonyl] ; cyano; amino [e.g., (alkylsulfonyl)amino and (dialky l)amino]; amido [e.g.,aminocarbonyl, (alkylcarbonyl)amino. (((alkyl)amino)alkyl)aminocarbonyl, ((heteroaryl)amino)carbonyL (heterocycloaliphatic)carbonyl, and (alkylcarbonyl)amino] ; cyanoalkyl; alkoxy; sulfamoyl [e.g., aminosulfonyl]; sulfonyl [e.g., alkydsulfonyl]; hydroxyalkyl; alkoxyalkyl; hydroxy; (carboxy)alkyl; ((dialkyl)amino)alkyl; heterocycloaliphatic; cycloaliphatic; nitroalkyl; ((alkylsulfonyl)amino)alkyl; (alkylsulfonyl)alkyl; cyanoalkyl; acyl [e.g., alkylcarbonyl]; alkyl; or haloalkyl [e.g., trihaloalky 1] .

[0060] In some embodiments, a heteroaryl group can be substituted with one or more substituents as set forth herein for aryl groups, aralkyl groups, cycloalkyl groups, cycloalkenyl groups, heterocycloalkyl groups, and / or heterocycloalkenyl groups.

[0103] As used herein, a "carbonyl" refers to -C(O)-.

[0104] “Cyclic'’ or “cyclized” refers to a molecule comprising a sequence of amino acid residues (functionalized or not functionalized) or analogues thereof without free amino and carboxy termini. In some embodiments, a cyclized peptide comprises a linkage between all amino acids in the peptide via amide (peptide) bonds, but other chemical linkers are also possible. In some embodiments, an LN subunit and an Lc subunit can be fused via a peptide bond, thus forming a cyclic peptide. In some embodiments, a cyclic peptide may comprise amino acid residues, which refer to any naturally occurring amino acid, any amino acid derivative, or any amino acid mimic known in the art. A “naturally occurring amino acid” refers to Gly, Ala, Ser, Thr, Vai, Leu, He, Phe, Tyr, Trp, His, Glu, Asp, Gin, Asn, Cys, Met, Lys, Arg, or Pro. Examples of “unnatural amino acids” include, but are not limited to, P- amino acids, y-amino acids, L-amino acids, D-amino acids, N-substituted amino acids, a, a- disubstituted amino acids, amino acids having side chains that are different from those of natural amino acids, and hydroxy carboxylic acids. Amino acid residues present in the cyclic peptide may have any conformation. In some embodiments, an “amino acid residue” constituiting the cyclic peptide conjugates or compounds described herein may be referred to as an “amino acid.” In some embidiments. a cyclic peptide may comprise a combination of naturally occurring amino acid, any amino acid derivative, or any amino acid mimic known in the art. For example, in some embodiments, the cyclic peptide may comprise a mixture of L- and D-amino acids. In some embodiments, a cyclic peptide may comprise N-methylated amino acids. In some aspects, a cyclic peptide may comprise p-amino acids.

[0105] As used herein, the term "hydroxyl" or "hydroxy" refers to an -OH moiety.

[0106] As used herein, an "oxo" refers to =0.

[0107] As used herein, the term "substituted," whether preceded by the term "optionally" or not, refers generally to the replacement of hydrogen atoms in a given structure with the radical of a specified substituent. Specific substituents are described above in the definitions and below in the description of compounds and examples thereof. Unless otherwise indicated, an optionally substituted group can have a substituent at each substitutable position of the group, and when more than one position in any given structure can be substituted with more than one substituent selected from a specified group, the substituent can be either the same or different at every position. As one of ordinary skill in the art will recognize, combinations of substituents envisioned by this disclosure are those combinations that result in the formation of stable or chemically feasible compounds. In some embodiments, a "substituted" group (e.g., alkyl or alkylene) has at least one hydrogen atom replaced by a bond to a non-hydrogen atoms such as, but not limited to: a halogen atom such as F, CI, Br, and I; oxo groups (=0); hydroxyl groups (-OH); alkoxy groups (-ORX, where Rxis C1-C12 alkyl or cycloalkyl); carboxyl groups (-OC(=O)Ryor -C(=O)ORy, where Ryis H. C1-C12 alkyl or cycloalkyl); amine groups (- NRxRy, where Rxand Ryare each independently H, C1-C12 alkyl or cycloalkyl); Ci-C 12 alkyl groups; and cycloalkyl groups. In some embodiments the substituent is a C1-C12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group. In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amine group.

[0108] Unless otherwise stated, structures depicted herein also are meant to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure; for example, the R and S configurations for each asymmetric center, (Z) and (E) double bond isomers, and (Z) and (E) conformational isomers. Therefore, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the disclosure. Unless otherwise stated, all tautomeric forms of the compounds of the disclosure are within the scope of the disclosure. Additionally, unless otherwise stated, structures depicted herein also are meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of hydrogen by deuterium or tritium, or the replacement of a carbon by a1?C- or14C-enriched carbon are within the scope of this disclosure. Such compounds areuseful, for example, as analytical tools or probes in biological assays, or as therapeutic agents.

[0109] Compounds disclosed herein may be "isomerically pure" compounds. As used herein, the term "isomerically pure" refers to an isomeric form of a compound that is substantially free from other isomeric forms of the compound (e.g.. substantially free from other stereoisomers (e.g., enantiomers, diastereomers, geometric (or conformational) isomers, etc.), constitutional isomers, isotopomers, etc.). For example, an ‘'isomerically pure” compound having at least one asymmetric center of a particular configuration (i.e., R or S configuration) is substantially free from other isomeric forms of the compound having a different configuration at the at least one asymmetric center. An “isomerically pure” compound comprises more than 75% by weight, more than 80% by weight, more than 85% by weight, more than 90% by w eight, more than 91% by w eight, more than 92% by w eight, more than 93% by weight, more than 94% by weight, more than 95% by weight, more than 96% by weight, more than 97% by weight, more than 98% by weight, more than 98.5% by weight, more than 99% by weight, more than 99.2% by weight, more than 99.5% by weight, more than 99.6% by w eight, more than 99.7% by w eight, more than 99.8% by w eight, or more than 99.9% by weight, of a single isomer of the compound based on the total weight of all isomers of the compound that are present.

[0110] Chemical structures and nomenclature are derived from ChemDraw, version 18.0.0.231, Cambndge, MA.[OHl] It also will be appreciated that certain of the compounds of the present disclosure can exist in free form for treatment, or where appropriate, as a pharmaceutically acceptable derivative (e.g., a salt) thereof. According to the present disclosure, a pharmaceutically acceptable derivative includes, but is not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of such esters, or any other adduct or derivative that upon administration to a patient in need is capable of providing, directly or indirectly, a compound as otherwise described herein, or a metabolite or residue thereof.

[0112] As used herein, the term "pharmaceutically acceptable" means approved or approvable by a regulatory' agency of the Federal or a state government or the corresponding agency in countries other than the United States, or that is listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeia for use in animals, and more particularly, in humans.

[0113] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of a compound of the disclosure that is pharmaceutically acceptable and that possesses the desiredpharmacological activity of the parent compound. In particular, such salts are non-toxic may be inorganic or organic acid addition salts and base addition salts. Specifically, such salts include: (1) acid addition salts, formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like; or formed with organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl) benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethane- disulfonic acid, 2-hy dr oxy ethanesulfonic acid, benzenesulfonic acid, 4- chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2.2.2]-oct-2-ene-l-carboxylic acid, glucoheptonic acid, 3 -phenylpropionic acid, trimethylacetic acid, tertiary' butylacetic acid, laury l sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid, and the like; or (2) salts formed when an acidic proton present in the parent compound either is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion; or coordinates with an organic base such as ethanolamine, diethanolamine, triethanolamine, N-methylglucamine and the like. Salts further include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the compound contains a basic functionality, salts of non-toxic organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate and the like. The term "pharmaceutically acceptable cation" refers to an acceptable cationic counter-ion of an acidic functional group. Such cations are exemplified by sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium cations, and the like. See, e.g., Berge, et al., J. Pharm. Sci. (1977) 66(1): 1-79.

[0114] The term “lipid” refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are generally characterized by being poorly soluble in water, but soluble in many organic solvents.

[0115] A “lipid nanoparticle” may refer to particles having at least one dimension in the nanometers range (e.g., 1-1,000 nm) and include the compounds described herein. In some embodiments, lipid nanoparticles (LNPs) can be included in compositions that are used to deliver at least one polynucleotide and / or construct according to this disclosure. In some embodiments, the lipid nanoparticles of the disclosure comprise at least one polynucleotide and / or one or more components of a prime editing system. In some embodiments, the lipid nanoparticles can include one or more additional lipid components. In some embodiments,the at least one polynucleotide and / or construct may be encapsulated in the lipid portion of the lipid nanoparticle or an aqueous space enveloped by some or all of the lipid portion of the lipid nanoparticle.

[0116] In some embodiments, the lipid nanoparticles can have a mean diameter of from about 30 nm to about 200 nm, from about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm. from about 70 nm to about 80 nm. from about 40 nm to about 200 nm, from about 50 nm to about 200 nm, from about 100 nm to about 200 nm, from about 120 nm to about 200 nm, from about 150 nm to about 200 nm, or about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm. 130 nm, 135 nm, 140 nm, 145 nm, 150 nm, 155 nm, 160 nm, 165 nm, 170 nm, 175 nm, 180 nm, 185 nm. 190 nm, 195 nm. or 200 nm.

[0117] As used herein, “cationic lipids” (also referred to as an ionizable lipid) refer to lipids that are positively charged at the head group or lipids that are positively charged at acidic pH and neutral at physiological pH. Cationic lipids typically contain three domains: a hydrophilic headgroup. a hydrophobic domain, and a linker. Cationic lipids are an amphiphilic entity with the head group having hydrophilicity and lipid tails possessing hydrophobicity.

[0118] As used herein, a “cell” can generally refer to a biological cell. A cell can be the basic structural, functional and / or biological unit of a living organism. A cell can originate from any organism having one or more cells. Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant, an animal cell, a cell from an invertebrate animal (e.g. fruit fly, cnidarian, echinoderm, nematode, etc.), a cell from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal), a cell from a mammal (e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.), et cetera. Sometimes a cell may not originate from a natural organism (e.g., a cell can be synthetically made, sometimes termed an artificial cell).

[0119] In some embodiments, the cell is a human cell. A cell may be of or derived from different tissues, organs, and / or cell types. In some embodiments, the cell is a primary cell. In some embodiments, the term primary cell means a cell isolated from an organism, e.g.. a mammal, which is grown in tissue culture (i.e., in vitro) for the first time before subdivision and transfer to a subculture. In some non-limiting examples, mammalian primary cells can bemodified through introduction of one or more polynucleotides, polypeptides, and / or prime editing compositions (e.g., through transfection, transduction, electroporation and the like) and further passaged. In some embodiments, a cell is not isolated from an organism but forms part of a tissue or organ of an organism, e.g., a mammal. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a human stem cell.

[0120] The term “construct” refers to refers to a polynucleotide or a portion of a polynucleotide, comprising one or more nucleic acid sequences encoding one or more transcriptional products and / or proteins. A construct may be a recombinant nucleic acid molecule or a part thereof. In some embodiments, the one or more nucleic acid sequences of a construct are operably linked to one or more regulatory sequences, for example, transcriptional initiation regulator}' sequences. In some embodiments, a construct is a vector, a plasmid, or a portion thereof. In some embodiments, a construct comprises DNA. In some embodiments, a construct comprises RNA. In some embodiments, a construct is double stranded. In some embodiments, a construct is single stranded. In some embodiments, a construct comprises an expression cassette. An expression cassette means a polynucleotide comprising a nucleic acid sequence that encodes one or more transcriptional products and is operably linked to at least one transcriptional regulatory sequence, e.g., a promoter.

[0121] The term “polynucleotide” or “nucleic acid molecule” can be any polymeric form of nucleotides, including DNA, RNA, a hybridization thereof, or RNA-DNA chimeric molecules. For example, a polynucleotide can be a cDNA, genomic DNA, mRNA, tRNA, rRNA, microRNA, antisense DNA or RNA, plasmid DNA, microRNA inhibitors, mRNA- interfering complementary RNA (micRNA), multivalent RNA, etc. In some embodiments, a polynucleotide is double stranded, e.g., a double-stranded DNA in a gene. In some embodiments, a polynucleotide is single-stranded or substantially single-stranded, e.g., single-stranded DNA or an mRNA. In some embodiments, a polynucleotide is a cell-free nucleic acid molecule. In some embodiments, a polynucleotide circulates in blood. In some embodiments, a polynucleotide is a cellular nucleic acid molecule. In some embodiments, a polynucleotide is a cellular nucleic acid molecule in a cell circulating in blood.

[0122] Polynucleotides can have any three-dimensional structure. The following are nonlimiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), an exon, an intron, intergenic DNA (including, without limitation, heterochromatic DNA). messenger RNA (mRNA), transfer RNA (tRNA). ribosomal RNA (rRNA), a ribozyme, cDNA, a recombinant polynucleotide, a branched polynucleotide, a plasmid, a vector, isolated DNA, isolated RNA, sgRNA, guide RNA, anucleic acid probe, a primer, an snRNA. a long non-coding RNA. a snoRNA, a siRNA, a miRNA, a tRNA-derived small RNA (tsRNA), an antisense RNA, an shRNA, or a small rDNA-derived RNA (srRNA).

[0123] In some embodiments, a polynucleotide comprises deoxyribonucleotides, ribonucleotides or analogs thereof. In some embodiments, a polynucleotide comprises modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.

[0124] In some embodiments, a polynucleotide is composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); thymine (T); and uracil (U) for thymine when the polynucleotide is RNA. In some embodiments, the polynucleotide may comprise one or more other nucleotide bases, such as inosine (I), which is read by the translation machinery as guanine (G).

[0125] In some embodiments, a polynucleotide may be modified. As used herein, the terms “modified’' or “modification” refers to chemical modification with respect to the A, C, G, T and U nucleotides. In some embodiments, modifications may be on the nucleoside base and / or sugar portion of the nucleosides that comprise the polynucleotide. In some embodiments, the modification may be on the intemucleoside linkage (e.g., phosphate backbone). In some embodiments, multiple modifications are included in the modified nucleic acid molecule. In some embodiments, a single modification is included in the modified nucleic acid molecule.

[0126] The terms “protein,” “peptide,” and “polypeptide” can be used interchangeably to refer to a polymer of two or more amino acids joined by covalent bonds (e.g, an amide bond) that can adopt a three-dimensional conformation. In some embodiments, a protein, peptide, or polypeptide comprises at least 4 amino acids, at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, 15 amino acids, 20 amino acids, 30 amino acids or 50 amino acids joined by covalent bonds (e.g, amide bonds). In some embodiments, a protein, peptide, or polypeptide comprises at least two amide bonds. In some embodiments, a protein, peptide, or polypeptide comprises multiple amide bonds. In some embodiments, a protein, peptide, or polypeptide comprises an enzyme, enzyme precursor proteins, regulatory protein, structural protein, receptor, nucleic acid binding protein, a biomarker, a member of a specific binding pair (e.g., a ligand oraptamer), or an antibody. In some embodiments, a protein may be a full-length protein (e.g.. a fully processed protein having certain biological function). In some embodiments, a protein may be a variant or a fragment of a full-length protein. A variant of a protein or enzy me, for example a variant reverse transcriptase, comprises a polypeptide having an amino acid sequence that is about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 96% identical, about 97% identical, about 98% identical, about 99% identical, about 99.5% identical, or about 99.9% identical to the amino acid sequence of a reference protein.

[0127] In some embodiments, a protein comprises one or more protein domains or subdomains. As used herein, the term "polypeptide domain”, '‘protein domain”, or '‘domain” when used in the context of a protein or polypeptide, refers to a polypeptide chain that has one or more biological functions, e.g., a catalytic function, a protein-protein binding function, or a protein-DNA function. In some embodiments, a protein comprises multiple protein domains. In some embodiments, a protein comprises multiple protein domains that are naturally occurring. In some embodiments, a protein comprises multiple protein domains from different naturally occurring proteins. A protein that comprises amino acid sequences from different origins or naturally occurring proteins may be referred to as a fusion, or chimeric protein.

[0128] In some embodiments, a protein, peptide, or polypeptide includes naturally occurring amino acids (e.g., one of the twenty amino acids commonly found in peptides synthesized in nature). In some embodiments, a protein , peptide, or polypeptide includes non-naturally occurring amino acids (e.g., amino acids which is not one of the twenty amino acids commonly found in peptides synthesized in nature, including synthetic amino acids, amino acid analogs, and amino acid mimetics). In some embodiments, a protein , peptide, or polypeptide is modified.

[0129] In some embodiments, a protein comprises an isolated polypeptide. The term “isolated” means free or removed to varying degrees from components which normally accompany it as found in the natural state or environment. For example, a peptide or polypeptide naturally present in a living animal is not isolated, and the same peptide or polypeptide partially or completely separated from the coexisting materials of its natural state is isolated.

[0130] In some embodiments, a protein is present within a cell, a tissue, an organ, or a virus particle. In some embodiments, a protein is present within a cell or a part of a cell (e.g., a bacteria cell, a plant cell, or an animal cell). In some embodiments, the cell is in a tissue, in asubject, or in a cell culture. In some embodiments, the cell is a microorganism (e.g, a bacterium, fungus, protozoan, or virus). In some embodiments, a protein is present in a mixture of analytes (e.g. , a lysate). In some embodiments, the protein is present in a lysate from a plurality of cells or from a lysate of a single cell.

[0131] The term "encode’' as it is applied to polynucleotides refers to a polynucleotide which is said to “encode” another polynucleotide, a polypeptide, or an amino acid if, in its native state or when manipulated by methods well known to those skilled in the art, it can be used as a polynucleotide synthesis template, e.g., transcribed into an RNA, reverse transcribed into a DNA or cDNA, and / or translated to produce an amino acid, or a polypeptide or fragment thereof. In some embodiments, a polynucleotide comprising three contiguous nucleotides form a codon that encodes a specific amino acid. In some embodiments, a polynucleotide comprises one or more codons that encode a polypeptide. In some embodiments, a polynucleotide comprising one or more codons comprises a mutation in a codon compared to a wild-type reference polynucleotide. In some embodiments, the mutation in the codon encodes an amino acid substitution in a polypeptide encoded by the polynucleotide as compared to a wild-type reference polypeptide.

[0132] II. LIPID NANOPARTICLES (LNPs)

[0133] The present disclosure provides lipid nanoparticle (LNP) compositions. In some embodiments, the LNP compositions comprise a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein. In some embodiments, the LNP compositions comprise a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein, and at least one of a cationic lipid, a phospholipid, a polyethylene glycol-lipid, and a sterol.

[0134] A. Compounds

[0135] The present disclosure provides lipid nanoparticle (LNP) compositions. In some embodiments, the LNP compositions comprise a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein.

[0136] One aspect of the present disclosure provides cyclic peptide-lipid conjugates comprising: a cyclic peptide comprising 4 to 30 amino acid residues. wherein 1, 2, or 3 amino acid residues comprise a positive charge; and at least one lipid component conjugated to the cyclic peptide,wherein the at least one lipid component is connected to at least one amino acid residue side chain, wherein each lipid component comprises a lipid linker and a lipid chain, wherein the lipid linker comprises a biodegradable group and the lipid chain comprises a branched or unbranched, substituted or unsubstituted, cyclic or acyclic aliphatic group.

[0137] In some embodiments, the cyclic peptide-lipid conjugate comprises 5-10 or 5-7 amino acid residues. In some embodiments, the cyclic peptide-lipid conjugate comprises 5, 6, 7, 8, 9, or 10 amino acid residues.

[0138] In some embodiments, the cyclic peptide-lipid conjugate comprises naturally occurring amino acid residues, non-naturally occurring amino acid residues, derivatives, or combinations thereof. In some embodiments, the cyclic peptide-lipid conjugate comprises naturally occurring amino acid residues. In some embodiments, the cyclic peptide-lipid conjugate comprises non-naturally occurring amino acid residues. In some embodiments, the cyclic peptide-lipid conjugate comprises a combnation of naturally occurring amino acid residues and non-naturally occurring amino acid residues.

[0139] In some embodiments, the amino acid residues that comprise a positive charge comprise arginine, lysine, histidine, or derivatives thereof. In some embodiments, the amino acid residue that comprises a positive charge comprise arginine or a derivative thereof. In some embodiments, the amino acid residue that comprises a positive charge comprise lysine or a derivative thereof. In some embodiments, the amino acid residue that comprises a positive charge comprise histidine or a derivative thereof.

[0140] In some embodiments, the at least one amino acid residue side chain that connects to the lipid component comprises a serine-, cysteine-, aspartic acid-, or glutamate-side chains, or derivatives thereof. In some embodiments, the at least one amino acid residue side chain that connects to the lipid component comprises a serine side chain or a derivative thereof. In some embodiments, the at least one amino acid residue side chain that connects to the lipid component comprises a cysteine side chain or a derivative thereof. In some embodiments, the at least one amino acid residue side chain that connects to the lipid component comprises an aspartic acid side chain or a derivative thereof. In some embodiments, the at least one amino acid residue side chain that connects to the lipid component comprises a glutamate side chain or a derivative thereof.

[0141] In some embodiments, the biodegradable group of the lipid linker comprises an ether, ester, thioether, thioester, disulfide, amide, or carbamate bond, or combinations thereof.In some embodiments, the biodegradable group of the lipid linker comprises an ether bond. In some embodiments, the biodegradable group of the lipid linker comprises an ester bond, in any direction (e.g., -C(O)O- or -OC(O)-). In some embodiments, the biodegradable group of the lipid linker comprises a thioether bond. In some embodiments, the biodegradable group of the lipid linker comprises a thioester bond, in any direction (e.g.. -C(O)S- or -SC(O)-). In some embodiments, the biodegradable group of the lipid linker comprises a disulfide bond. In some embodiments, the biodegradable group of the lipid linker comprises an amide bond, in any direction (e.g., -C(O)N- or -NC(O)-). In some embodiments, the biodegradable group of the lipid linker comprises a carbamate bond, in any direction (e.g., -OC(O)N- or - NC(O)O-).

[0142] In some embodiments, the lipid chain comprises a branched or unbranched, substituted or unsubstituted C1-C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2- C20 alkynyl. In some embodiments, the lipid chain comprises a branched or unbranched, substituted or unsubstituted C2-C20 alkyl. In some embodiments, the lipid chain comprises a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl. In some embodiments, the lipid chain comprises a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl. In some embodiments, at least one double bond in the C2-C20 alkenyl is in a cis configuration.

[0143] Another aspect of the present disclosure provides a compound of Formula I or Formula II:whereineach a is independently 0-15; each b is independently 0-15; each R1is independently an amino acid side chain, or isomers or derivatives thereof; each L is independently a serine-, cysteine-, aspartic acid- or glutamic acid-side chain; each R2is independently a branched or unbranched, substituted or unsubstituted Ci- C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ester-containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ether-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide- containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted sulfanyl-, ester- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alky nyl; or a branched or unbranched, substituted or unsubstituted carbamoyl-containing C1-C20 alkyl. C2-C20 alkenyl, or C2-C20 alkynyl, orwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-;each Z is independentlyeach e is independently 0-10; each f is independently 0 or 1 ; each g is independently 0 or 1 ; each h is independently 0 or 1 ; and each R3is independently H, a branched or unbranched, substituted or unsubstituted C 1-C20 alky l, a branched or unbranched, substituted or unsubstituted C2- C20 alkenyl, or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; provided that the compound of Formula I or Formula II comprises at least one and no more than three atoms with a positive charge, wherein the one to three positive charges are present in R1and / or R2.

[0144] In some embodiments, each a is independently 0-15 or 0, 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11. 12, 13, 14, or 15. In some embodiments, each a is independently 0. In some embodiments, each a is independently 1. In some embodiments, each a is independently 2. In some embodiments, each a is independently 3. In some embodiments, each a is independently 4. In some embodiments, each a is independently 5. In some embodiments, each a is independently 6. In some embodiments, each a is independently 7. In some embodiments, each a is independently 8. In some embodiments, each a is independently 9. In some embodiments, each a is independently 4. In some embodiments, each a is independently 10. In some embodiments, each a is independently 11. In some embodiments, each a is independently 12. In some embodiments, each a is independently 13. In some embodiments, each a is independently 14. In some embodiments, each a is independently 15.

[0145] In some embodiments, each b is independently 0-15 or 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. In some embodiments, each b is independently 0. In some embodiments, each b is independently 1. In some embodiments, each b is independently 2. In some embodiments, each b is independently 3. In some embodiments, each b is independently 4. In some embodiments, each b is independently 5. In some embodiments, each b is independently 6. In some embodiments, each b is independently 7. In some embodiments, each b is independently 8. In some embodiments, each b is independently 9. In some embodiments, each b is independently 4. In some embodiments, each b is independently 10. In some embodiments, each b is independently 11. In some embodiments, each b is independently 12. In some embodiments, each b is independently 13. In some embodiments, each b is independently 14. In some embodiments, each b is independently 15.

[0146] In some embodiments, each R1is independently an amino acid side chain, or isomers or derivatives thereof. In some embodiments, the amino acid side chain derives from naturally occurring amino acids, that is, one of the twenty amino acids commonly found in peptides synthesized in nature, and known by the one letter abbreviations A, R. N, C, D, Q, E, G. H, I, L. K, M, F, P. S, T. W, Y and V. In some embodiments, each R1is independently an alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, ty rosine, or valine side chain. In some embodiments, each R1is independently an alanine side chain. In some embodiments, each R1is independently an arginine side chain. In some embodiments, each R1is independently an asparagine side chain. In some embodiments, each R1is independently an aspartic acid side chain. In some embodiments, each R1is independently a cysteine side chain. In some embodiments, each R1is independently a glutamine side chain. In some embodiments, each R1is independently a glutamic acid side chain. In some embodiments, each R1is independently a glycine side chain. In some embodiments, each R1is independently a histidine side chain. In some embodiments, each R1is independently a isoleucine side chain. In some embodiments, each R1is independently a leucine side chain. In some embodiments, each R1is independently a lysine side chain. In some embodiments, each R1is independently a methionine side chain. In some embodiments, each R1is independently a phenylalanine side chain. In some embodiments, each R1is independently a proline side chain. In some embodiments, each R1is independently a serine side chain. In some embodiments, each R1is independently a threonine side chain. In some embodiments, each R1is independently a tryptophan side chain. In some embodiments, each R1is independently a tyrosine side chain. In some embodiments, each R1is independently a valine side chain.

[0147] In some embodiments, each R1is independently an amino acid side chain derived from non-naturally occurring amino acids (e.g, amino acids which is not one of the twenty amino acids commonly found in peptides synthesized in nature, including synthetic amino acids, amino acid analogs, and amino acid mimetics). In some embodiments, the amino acid side chain derives from isomers or derivatives of naturally occurring amino acids. In some embodiments, the amino acid side chain derives from isomers or derivatives of non-naturally occurring amino acids.

[0148] In some embodiments, each L is independently a serine-, cysteine-, aspartic acid- or glutamic acid-side chain. In some embodiments, each L is independently a serine side chain. In some embodiments, each L is independently a cysteine-side chain. In some embodiments,each L is independently an aspartic acid-side chain. In some embodiments, each L is independently a glutamic acid-side chain.

[0149] In some embodiments, each R2is independently a branched or unbranched, substituted or unsubstituted C1-C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ether-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-containing C1-C20 alkyl. C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted sulfanyl-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; or a branched or unbranched, substituted or unsubstituted carbamoyl-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl. In some embodiments, each R2is independently a branched or unbranched, substituted or unsubstituted C1-C20 alkyl. In some embodiments, each R2is independently a branched unsubstituted C1-C20 alkyl. In some embodiments, each R2is independently a branched substituted C1-C20 alkyl. In some embodiments, each R2is independently an unbranched, substituted C1-C20 alkyl. In some embodiments, each R2is independently an unbranched, unsubstituted C1-C20 alkyd. In some embodiments, each R2is independently a branched or unbranched, substituted or unsubstituted C1-C20 alkenyl. In some embodiments, each R2is independently a branched unsubstituted C1-C20 alkenyl. In some embodiments, each R2is independently a branched substituted C1-C20 alkenyl. In some embodiments, each R2is independently an unbranched, substituted C1-C20 alkenyl. In some embodiments, each R2is independently an unbranched, unsubstituted C1-C20 alkenyl.

[0150] In some embodiments, each R2is independentlywherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach e is independently 0-10; each f is independently 0 or 1; each g is independently 0 or 1 ; and each h is independently 0 or 1.

[0151] In some embodiments, each X is independently absent, -CH2-, -S-. or -C(O)-. In some embodiments, each X is independently absent. In some embodiments, each X is independently -CH2-. In some embodiments, each X is independently -S-. In some embodiments, each X is independently -C(O)-.

[0152] In some embodiments, each c is independently 0-10 or 0, 1, 2, 3, 4, 5, 6. 7, 8, 9, or 10. In some embodiments, each c is independently 0. In some embodiments, each c is independently 1. In some embodiments, each c is independently 2. In some embodiments, each c is independently 3. In some embodiments, each c is independently 4. In some embodiments, each c is independently 5. In some embodiments, each c is independently 6. In some embodiments, each c is independently 7. In some embodiments, each c is independently 8. In some embodiments, each c is independently 9. In some embodiments, each c is independently 4. In some embodiments, each c is independently 10.

[0153] In some embodiments, each Y is independently absent, -C(O)O- or -OC(O)-. In some embodiments, each Y is independently absent. In some embodiments, each Y is independently -C(O)O- In some embodiments, each Y is independently -OC(O)-.

[0154] In some embodiments, each Z is independently I or I . In someembodiments, each Z is independently I . In some embodiments, each Z is independently

[0155] In some embodiments, each e is independently 0-10 or 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, each e is independently 0. In some embodiments, each e is independently 1. In some embodiments, each e is independently 2. In some embodiments, each e is independently 3. In some embodiments, each e is independently 4. In some embodiments, each e is independently 5. In some embodiments, each e is independently 6. In some embodiments, each e is independently 7. In some embodiments, each e is independently 8. In some embodiments, each e is independently 9. In some embodiments, each e is independently 4. In some embodiments, each e is independently 10.

[0156] In some embodiments, each f is independently 0 or 1. In some embodiments, each f is independently 0. In some embodiments, each f is independently 1 .

[0157] In some embodiments, each g is independently 0 or 1. In some embodiments, each g is independently 0. In some embodiments, each g is independently 1.

[0158] In some embodiments, each h is independently 0 or 1. In some embodiments, each h is independently 0. In some embodiments, each h is independently 1.

[0159] In some embodiments, each R3is independently H, a branched or unbranched, substituted or unsubstituted C1-C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2- C20 alkynyl. In some embodiments, each R3is independently H. In some embodiments, each R3is independently a branched or unbranched, substituted or unsubstituted C1-C20 alkyd. In some embodiments, each R3is independently a branched unsubstituted C1-C20 alky l. In some embodiments, each R3is independently a branched substituted C1-C20 alkyl. In some embodiments, each R3is independently an unbranched, substituted C1-C20 alkyl. In some embodiments, each R3is independently an unbranched, unsubstituted C1-C20 alkyl. In some embodiments, each R3is independently a branched or unbranched, substituted or unsubstituted C 1-C20 alkenyl. In some embodiments, each R3is independently a branchedunsubstituted C1-C20 alkenyl. In some embodiments, each R3is independently a branched substituted C1-C20 alkenyl. In some embodiments, each R3is independently an unbranched, substituted C1-C20 alkenyl. In some embodiments, each R3is independently an unbranched, unsubstituted C1-C20 alkenyl. In some embodiments, each R3is independently a branched or unbranched, substituted or unsubstituted C1-C20 alkynyl. In some embodiments, each R3is independently a branched unsubstituted C1-C20 alkynyl. In some embodiments, each R3is independently a branched substituted C1-C20 alkynyl. In some embodiments, each R3is independently an unbranched, substituted C1-C20 alkynyl. In some embodiments, each R3is independently an unbranched, unsubstituted C1-C20 alkynyl.

[0160] In some embodiments, the compound of Formula I or Formula II comprises at least one and no more than three atoms with a positive charge, wherein the one to three positive charges are present in R1and / or R2. In some embodiments, the compound of Formula I or Formula II comprises one atom with a positive charge, wherein the one positive charge is present in R1or R2. In some embodiments, the compound of Formula I or Formula II comprises one atom with a positive charge, wherein the one positive charge is present in R1. In some embodiments, the compound of Formula I or Formula II comprises one atom with a positive charge, wherein the one positive charge is present in R2. In some embodiments, the compound of Formula I or Formula II comprises two atoms with a positive charge, wherein the two positive charges are present in R1and / or R2. In some embodiments, the compound of Formula I or Formula II comprises two atoms with a positive charge, wherein the two positive charges are present in R1. In some embodiments, the compound of Formula I or Formula II comprises two atoms with a positive charge, wherein the two positive charges are present in R2. In some embodiments, the compound of Formula 1 or Formula II comprises three atoms with a positive charge, wherein the three positive charges are present in R1and / or R2. In some embodiments, the compound of Formula I or Formula II comprises three atoms with a positive charge, wherein the three positive charges are present in R1. In some embodiments, the compound of Formula I or Formula II comprises three atoms with a positive charge, wherein the three positive charges are present in R2.

[0161] In some embodiments, the compound of Formula I is a compound of Formulas I-A-l to I-A-4:

[0162] In some embodiments, the compound of Formula II is a compound of Formulas 11-A-l to II-A-4:

[0163] In some embodiments, compound of Formula I is a compound of Formulas I-B-l toI-B-4:

[0164] In some embodiments, the compound of Formula II is a compound of Formulas II-B-l to II-B-4:

[0165] In some embodiments, the compound of Formula I is a compound of Formulas I-C-lo I-C-4:

[0166] In some embodiments, the compound of Formula II is a compound of Formulas II-C-1 to II-C-4:Formula II-C-3; or Formula II-C-4.

[0167] In some embodiments, in the compound of Formula I or Formula II. a is 0 and b is 1.

[0168] In some embodiments, in the compound of Formula I or Formula II. a is 1 and b is 1.

[0169] In some embodiments, in the compound of Formula I or Formula II, a is 1 and b is 2.

[0170] In some embodiments, in the compound of Formula I or Formula II, at least one R1is a lysine-side chain.

[0171] In some embodiments, in the compound of Formula I or Formula II. at least one R1is an arginine-side chain.

[0172] In some embodiments, in the compound of Formula I or Formula II, each L is a serine-side chain.

[0173] In particular embodiments, each X is -C(O)-; each c is independently 2; each Y isN independently absent; each Z is independently I ; and each e, f, g, and h is independently 0.

[0174] In particular embodiments, each X is -C(O)-; each c is independently 3; each Y isindependently -C(O)O-; each Z is independently I ; each e, f, g, and h is independently 0.

[0175] In particular embodiments, each X is -C(O)-; each c is independently 0; each Y isindependently absent; each Z is independently I ; and each e, f, g, and h is independently 0.

[0176] In some embodiments, in the compound of Formula I or Formula II. each L is a cysteine-side chain.

[0177] In particular embodiments, each X is -S-; each c is independently 3; each Y isindependently -C(O)O-; each Z is independently I ; and each e. f. g, and h is independently 0.

[0178] Another aspect of the disclosure provides a compound of Formula I-A-l :Formula I-A-l; wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof; eachwherein each X is independently absent, -CH2-, -S-, or -C(O)-;each c is independently 0-10; each Y is independently absent, -C(0)0-, or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C1-C20 alkyl.

[0179] In some embodiments, each R1is independently an amino acid side chain, or isomers or derivatives thereof as described above. In some embodiments, one or two R1is a lysine-side chain. In some embodiments, one or two R1is an arginine-side chain. In some embodiments, the remaining R1is a leucine-side chain.

[0180] In some embodiments, each X, c, Y, and Z are independently as described above.

[0181] In some embodiments, each X is -C(O)-; each c is independently 2; each Y isindependently absent; and each Z is independently I . In some embodiments, each X is -C(O)-; each c is independently 3; each Y is independently -C(O)O-; and each Z is independently CH . In some embodiments, each X is -C(O)-; each c is independently 0;each Y is independently absent; and each Z is independently I

[0182] In some embodiments, each R3is independently an unbranched, unsubstituted Ci- C20 alkyd.

[0183] Another aspect of the present disclosure provides a compound of Formula I-A-2:Formula I-A-2; wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof; eachwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C 1-C20 alky l.

[0184] In some embodiments, each R1is independently an amino acid side chain, or isomers or derivatives thereof as described above. In some embodiments, each R1is a lysine- side chain. In some embodiments, each R1is an arginine-side chain.

[0185] In some embodiments, each X, c, Y, and Z are independently as described above.

[0186] In some embodiments, each X is -S-; each c is independently 3; each Y isindependently -C(O)O-; and each Z is independently I

[0187] In some embodiments, each R3is independently an unbranched, unsubstituted Ci- C20 alkyl.

[0188] Another aspect of the present disclosure provides a compound selected from the group consisting of:

[0189] (ii) General Synthetic Shernes of Formula I and II

[0190] Compounds of Formula I or Formula II of the present disclosure can be synthesized according to the following general synthetic.

[0191] The scheme above shows a general synthetic scheme for preparing a cyclic peptidelipid conjugate or a compound of Formula 1 or Formula 11, as described herein. Briefly, a linear peptide can be synthesized using Fmoc chemistry. The linear peptide can then be cyclized using 1 -Hydroxy -7-azabenzotriazole (HO At) and l-Ethyl-3-(3- dimethylaminopropyl)carbodiimide (EDCI).

[0192] B. LNP Compositions

[0193] The present disclosure provides lipid nanoparticle (LNP) compositions.

[0194] Delivering payload to a specific tissue in the human body, such as liver, is a major challenge in novel lipid nanoparticle (LNP) development. Incorporation of biodegradable groups can enhance the gene editing level and reduce the potential toxicity of LNPs.

[0195] In some embodiments, the LNP compositions comprise a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein. In some embodiments, the LNP compositions comprise a cyclic peptidelipid conjugate or a compound of Formula I or Formula II described herein.

[0196] In some embodiments, a lipid nanoparticle (LNP) composition comprises:a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g.. a compound of Formula I or Formula II) described herein; and at least one of: a cationic lipid (also referred to as an ionizable lipid); a phospholipid (also referred to as a helper lipid); a PEG-containing lipid; or a sterol.

[0197] In some embodiments, a lipid nanoparticle (LNP) composition comprises: about 35 mol% to about 95 mol% of a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein; and at least one of:0 mol% to about 50 mol% of a cationic lipid (also referred to as an ionizable lipid);0 mol% to about 45 mol% of a phospholipid (also referred to as a helper lipid);0 mol% to about 3 mol% of a PEG-containing lipid; or0 mol% to about 50 mol% of a sterol.

[0198] (iii). Cationic Lipid

[0199] In some embodiments, a LNP composition comprises a cationic lipid (also referred to as an ionizable lipid). In some embodiments, a cationic lipid comprises an amino lipid. In some embodiments, a cationic lipid comprises one or more nitrogen atoms which are positively charged. In some embodiments, a cationic lipid includes, but is not limited to, N,N- dioleyl-N,N-dimethylammonium chloride ("DODAC"); N-(2,3- dioleyloxy)propyl-N,N-N- tri ethylammonium chloride ("DOTMA"); N,N-distearyl-N,N- dimethylammonium bromide ("DDAB"); N-(2,3-dioleoyloxy)propyl)-N,N,N- trimethylammonium chloride ("DOTAP"); 1.2-Dioleyloxy-3-trimethylaminopropane chloride salt ("DOTAP. Cl"); 30-(N-(N',N'- dimethylaminoethane)-carbamoyl)cholesterol ("DC -Choi"), N-(l-(2,3-dioleyloxy)propyl)-N- 2-(sperminecarboxamido)ethyl)-N,N-dimethylammonium trifluoracetate ("DOSPA"), dioctadecylamidoglycyl carboxy spermine ("DOGS"), 1,2-dileoyl- sn-3-phosphoethanolamine ("DOPE"), l,2-dioleoyl-3-dimethylammonium propane ("DODAP"), N, N-dimethyl-2,3- dioleyloxyjpropylamine ("DODMA"), N-(l, 2- dimyristyloxyprop-3-yl)-N,N-dimethyl-N- hydroxyethyl ammonium bromide ("DMRIE"), 3-(didodecylamino)-Nl,Nl,4-tridodecyl-l- piperazineethanamine (KL10), Nl-[2-(didodecylamino)ethyl]-Nl,N4,N4-tridodecyl-l,4- piperazinediethanamine (KL22). 14.25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), l,2-dihnoleyloxy-N,N-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4- dimethylaminomethyl-[ 1,3] -di oxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19- yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3] -di oxolane (DLin-KC2-DMA), 1.2-dioleyloxy-N,N-dimethylaminopropane (DODMA). 2-({8-[(33)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy] propan- 1 -amine (Octyl-CLinDMA), (2R)-2-({8-[(3P)-cholest-5-en-3- y loxy] octyl } oxy )-N,N-dimethyl-3- [(9Z, 12Z)-octadeca-9, 12-dien- 1 -y loxy ] propan- 1 -amine (Octyl-CLinDMA (2R))_ and (2S)-2-({8-[(33)-cholest-5-en-3-yloxy]octyl}oxy)-N.N- dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l -amine (Octyl-CLinDMA (2S)). Additionally, a number of commercial preparations of cationic lipids can be used, such as, e g., LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL), and LIPOFECTAMINE (comprising DOSPA and DOPE, available from GIBCO / BRL).

[0200] (iv). Phospholipids

[0201] In some embodiments, a LNP composition comprises a phospholipid (also referred to as a helper lipid). In some embodiments, a phospholipid includes, but is not limited to, phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and sphingomyelin. In some embodiments, a fatty acid moiety includes but is not limited to lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alphalinolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alky nes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond).

[0202] Other phospholipids include, but are not limited to, l,2-distearoyl-snglycero-3- phosphocholine (DSPC), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycerophosphocholine (DMPC), l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3- phosphocholine (DPPC). 1,2-diundecanoyl-sn-glycerophosphocholine (DUPC), 1-palmitoyl-2- oleoyl-sn-glycero-3-phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoy Lsn-glycero-3 - phosphocholine (OChemsPC), 1-hexadecyl snglycero-3-phosphocholine (Ci6 Lyso PC), 1,2- dilinolenoyl-sn- glycero-3 -phosphocholine, l,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphochohne, l,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine. 1.2-diarachidonoyl-sn-glycero-3-phosphoethanolamine. 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, l,2-dioleoyl-sn-glycero-3-phospho- rac- (1 -glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), l-stearoyl-2-oleoyl-phosphatidy ethanolamine (SOPE), l-stearoyl-2 oleoylphosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), or combinations thereof.

[0203] (v). Polyethylene glycol-lipid (PEG lipid)

[0204] In some embodiments, a LNP composition comprises a polyethylene glycol-lipid (PEG-lipids). In some embodiments, PEG lipids include PEG conjugated to saturated or unsaturated C6-C20 alkyl chains. In some embodiments, polyethylene glycol (PEG) lipids include PEG-modified lipids such as PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG- modified diacylglycerols, and PEG-modified dialkylglycerols. In some embodiments, polyethylene glycol lipids include DMG-PEG, DLPE-PEGs, DMPE-PEGS, DPPC-PEGS, and DSPE-PEGs. In some embodiments, the polyethylene glycol lipid’s name is followed by XXX, intended to signify the molecular weight of the polyethylene glycol moiety. For example, if the polyethylene glycol lipid is DMG-PEGXXX, the ‘‘XXX” representes the molegulcar weight, such as molecular weight of the polyethylene glycol moiety, e.g. DMG- PEG1000, DMG-PEG2000, DMG-PEG3000, or DMG-PEG5000.

[0205] (vi). Sterol

[0206] In some embodiments, a LNP composition comprises a sterol. Sterols are known in the art and typically refer to compounds having a perhydrocyclopentanophenanthrene ring system with one or more OH substituents. Examples of sterols include, but are not limited to, cholesterol, campesterol, ergosterol, sitosterol, and the like. In some embodiments, the sterol is cholesterol. In some embodiments, a cholesterol is modified. In some embodiments, a cholesterol is an oxidized cholesterol. In some embodiments, a cholesterol is esterified cholesterol. In some embodiments, the sterol is a cholesterol-based lipid such as PEGylated cholesterol, DC-Choi (N,N-dimethyl-N-ethylcarboxamidocholesterol), 1.4-bis(3-N- oleylamino-propyljpiperazine, or combinations thereof. Exemplary sterols include, but are not limited to, 25 -hydroxy cholesterol (25-OH), 20a-hydroxy cholesterol (20a-OH), 27-hydroxycholesterol, 6-keto-5a- hydroxycholesterol. 7-ketocholesterol, 7(3- hydroxycholesterol, 7 a-hydroxy cholesterol, 7P-25- dihydroxycholesterol, beta-sitosterol, stigmasterol, brassicasterol, campesterol, or combinations thereof.

[0207] (vii). Polynucleotides

[0208] In some embodiments, the LNP composition further comprises at least one polynucleotide.

[0209] The at least one polynucleotide present in the compositions described herein can be a DNA, cDNA, and RNA of all types. In some embodiments, the at least one polynucleotide is a double stranded DNA, single-stranded DNA, complexed DNA. encapsulated DNA, naked RNA, encapsulated RNA, messenger RNA (mRNA), tRNA, short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), antisense RNA (asRNA), or combinations thereof. The at least one polynucleotide can also be a DNA construct, such as expression vectors, expression vectors encoding a desired gene product, and the like. In some embodiments, the at least one polynucleotide is an mRNA. In some embodiments, the at least one polynucleotide is or encodes one or more components of a prime editing system.

[0210] (vii). Prime Editing System

[0211] In some embodiments, the LNP composition further comprises one or more components of a prime editing system.

[0212] The term "prime editing system” or “prime editing composition” refers to compositions involved in the methods of prime editing. A prime editing system may include a prime editor, e.g., a prime editor fusion protein, and one or more prime editing guide RNAs (PEgRNAs). A prime editing system may further comprise additional elements. For example, a prime editing system may comprise a prime editor, a PEgRNA. and a second strand nick guide RNA (ngRNA). Components of a prime editing system may be combined to form a complex for prime editing, or may be kept separately, e.g., for administration purposes. In some embodiments, a prime editing system may include one or more prime editors and one or more PEgRNAs. In some embodiments, a prime editing system may include (i) one or more polynucleotides encoding one or more prime editor polypeptides and (ii) one or more PEgRNAs, or one or more polynucleotides encoding one or more PEgRNAs.

[0213] The term “prime editing” refers to programmable editing of a target DNA using a prime editor complexed with a PEgRNA to incorporate an intended nucleotide edit into the target DNA through target-pnmed DNA synthesis. In prime editing, a target DNA may comprise a double stranded DNA molecule having two complementary strands. The prime editing process may search specific targets and edit the endogeneous sequence of a targetDNA, e.g.. a target gene. In some embodiments, the spacer sequence of a PEgRNA comprises complementarity to a target strand of the target gene, and can anneal with the target strand. The PEgRNA may form a complex with a prime editor, which may generate a nick in the target gene on the edit strand which is the complementary strand of the target strand. The prime editing complex may then use a free 3’ end formed at the nick site of the edit strand to initiate DNA synthesis, where a primer binding site (PBS) of the PEgRNA complexes with the free 3’ end, and a single stranded DNA is synthesized using an editing template of the PEgRNA as a template. The editing template may comprise one or more nucleotide edits compared to the endogenous target gene sequence. Accordingly, the newly-synthesized single stranded DNA also comprises the nucleotide edit(s) encoded by the editing template. Through removal of an endogenous sequence on the edit strand of the target gene and incorporation of the newly-snythesized single stranded DNA, the intended nucleotide edit(s) are incorporated into the target gene.

[0214] The term “prime editor (PE)” refers to the polypeptide or polypeptide components involved in prime editing. In various embodiments, a prime editor includes a polypeptide domain having DNA binding activity and a polypeptide domain having DNA polymerase activity. In some embodiments, the polypeptide domain having DNA binding activity is a polypeptide domain having programmable DNA binding activity. In some embodiments, the prime editor further comprises a polypeptide domain having nuclease activity'. In some embodiments, the polypeptide domain having DNA binding activity comprises a nuclease domain or nuclease activity. In some embodiments, the polypeptide domain having nuclease activity comprises a nickase, or a fully active nuclease. As used herein, the term “nickase” refers to a nuclease capable of cleaving only one strand of a double-stranded DNA target. In some embodiments, the prime editor comprises a polypeptide domain that is an inactive nuclease. In some embodiments, the polypeptide domain having programmable DNA binding activity comprises a nucleic acid guided DNA binding domain, for example, a CRISPR-Cas protein, for example, a Cas9 nickase, a Cpfl nickase, or another CRISPR-Cas nuclease. In some embodiments, the polypeptide domain having DNA polymerase activity comprises a template-dependent DNA polymerase, for example, a DNA-dependent DNA polymerase or an RNA-dependent DNA polymerase. In some embodiments, the DNA polymerase is a reverse transcriptase. In some embodiments, the prime editor comprises additional polypeptides or polypeptide domains involved in prime editing, for example, a polypeptide domain having 5’ endonuclease activity, e.g., a 5' endogenous DNA flap endonucleases (e.g., FEN1), for helping to drive the prime editing process towards the edited product formation.In some embodiments, the prime editor further comprises an RNA-protein recruitment polypeptide, for example, a MS2 coat protein.

[0215] In some embodiments, polypeptide domains of a prime editor may be fused or linked by a peptide linker to form a fusion protein. In other embodiments, a prime editor comprises one or more polypeptide domains provided in trans as separate proteins, which are capable of being associated to each other through non-peptide linkages or through aptamers or recruitment sequences. For example, a prime editor may comprise a DNA binding domain and a reverse transcriptase domain associated with each other by an RNA-protein recruitment aptamer, e.g., a MS2 aptamer, which may be linked to a PEgRNA. Prime editor polypeptide components may be encoded by one or more polynucleotides in whole or in part. In some embodiments, a single polynucleotide, construct, or vector encodes the prime editor fusion protein. In some embodiments, multiple polynucleotides, constructs, or vectors each encode a polypeptide domain or portion of a domain of a prime editor, or a portion of a prime editor fusion protein. For example, a prime editor may comprise an N-terminal portion fused to an intein-N and a C-terminal portion fused to an intein-C, each of which is individually encoded by a vector.

[0216] In some embodiments, a prime editor polypeptide is fused to one or more nuclear localization signals. In some embodiments, a prime editor polypeptide is fused to a polypeptide permeant domain to promote uptake by the cell. In some embodiments, the permeant domain is a peptide, a peptidomimetic, or a non-peptide carrier.

[0217] In some embodiments, a prime editor polypeptide is produced in vitro or by host cells. In some embodiments, a prime editor polypeptide is prepared by in vitro synthesis. Various commercial synthetic apparatuses can be used. In some embodiments, a prime editor polypeptide is isolated and purified in accordance with recombinant synthesis methods, for example, by expression in a host cell and the lysate purified using HPLC, exclusion chromatography, gel electrophoresis, affinity' chromatography, or other purification technique.

[0218] The term "prime editing guide RNA”, or “PEgRNA’’, refers to a guide polynucleotide that comprises one or more intended nucleotide edits for incorporation into the target double stranded DNA. In some embodiments, the PEgRNA associates with and directs a prime editor to incorporate the one or more intended nucleotide edits into the target gene via prime editing.

[0219] In some embodiments, a PEgRNA comprises a spacer that is complementary or substantially complementary' to a search target sequence on a target strand of the target gene.In some embodiments, the PEgRNA comprises a gRNA core that associates with a DNA binding domain, e.g., a CRISPR-Cas protein domain, of a prime editor. In some embodiments, a PEgRNA comprises an extension arm that comprises an editing template and a primer binding site (PBS). In some embodiments, the editing template comprises comprises one or more intended nucleotide edits to be incorporated in the target DNA by prime editing, in some embodiments, the editing template comprises substantial or partial complementarity’ to the editing target sequence except at the position of the intended nucleotide edits to be incorporated into the target gene. In some embodiments, the PBS comprises complementarity' or substantially complementarity to a free 3’ end on the edit strand of the target gene at a nick site generated by the prime editor.

[0220] In some embodiments, a PEgRNA consists of RNA. In some embodiments, a PEgRNA is a chimeric or hybrid PEgRNA that comprises an RNA portion (e.g., including the spacer and the gRNA core) and a DNA portion (e.g., the extension arm comprising the editing template that includes a strand of DNA).

[0221] In some embodiments, a PEgRNA comprises a single polynucleotide molecule that comprises a spacer, a gRNA core, and an extension arm. In some embodiments, a PEgRNA comprises multiple polynucleotide molecules, for example, two polynucleotide molecules.

[0222] In some embodiments, the prime editing system comprises a PEgRNA, a prime editor, and further comprises a second strand nick guide polynucleotide, e.g., a nick guide RNA (ngRNA). In some embodiments, a ngRNA comprises a spacer (referred to as a ngRNA spacer or ng spacer) and a gRNA core, wherein the ng spacer comprises a region of complementarity to the edit strand, and wherein the gRNA core can interact with a Cas, e.g., Cas9. of a prime editor. Without wishing to be bound by any particular theory, an ngRNA may bind to the edit strand and direct a Cas nickase to generate a nick on the non-edit strand (or target strand).

[0223] In some embodiments, a prime editing sy stem comprises a first prime editing guide RNA (PEgRNA), a second PEgRNA, and one or more prime editors (a dual prime editing system). In some embodiments, dual prime editing involves two different PEgRNAs each complexed with a prime editor. In some embodiments, the prime editor is the same for each of the PEgRNA-prime editor complexes. In some embodiments, the prime editor is different for each of the PEgRNA-prime editor complexes. In some embodiments, the first PEgRNA and the second PEgRNA each comprises a spacer, a gRNA core, and an extension arm comprising a PBS and an editing template. In some embodiments, each of the two PEgRNAs comprises a spacer comprising a region of complementarity’ to a distinct search targetsequence of the double stranded target DNA, wherein the two distinct search target sequences are on the two complementary strands of the double stranded target DNA. In some embodiments, the two PEgRNAs each can direct a prime editor to initiate the prime editing process on the two complementary strands of the double stranded target DNA. In some embodiments, the editing template of the first PEgRNA and the editing template of the second PEgRNA comprises a region of complementarity to each other. In some embodiments, the editing template of the first PEgRNA and the editing template of the second PEgRNA each comprises a region of complementarity to a distinct sequence of the double stranded target DNA.

[0224] In some embodiments, a prime editing system comprises (i) a prime editor or one or more polynucleotides encoding the prime editor, and (ii) a PEgRNA or one or more polynucleotides encoding the PEgRNA. In some embodiments, a prime editing system comprises (i) a prime editor or one or more polynucleotides encoding the prime editor, (ii) a PEgRNA or one or more polynucleotides encoding the PEgRNA. and (iii) a ngRNA or one or more polynucleotides the ngRNA. In some embodiments, a prime editing system is a dual prime editing system that comprises (i) a prime editor or one or more polynucleotides encoding the prime editor, (ii) a first PEgRNA or one or more polynucleotides encoding the PEgRNA, and (iii) a second PEgRNA or one or more polynucleotides encoding the second PEgRNA. In some embodiments, the one or more polynucleotides encoding the prime editor, the PEgRNA, the ngRNA, the first PEgRNA, and / or the second PEgRNA is a part of, or encoded by, an expression cassette, a construct, or a vector. In some embodiments, the vector is a non-viral vector. In some embodiments, the one or more polynucleotides is operably linked to a regulatory element, e.g., a transcriptional control element, such as a promoter. In some embodiments, the polynucleotide is operably linked to multiple control elements. Depending on the expression system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (e.g.. U6 promoter. Hl promoter). Prime editing system components may be encoded individually by separate polynucleotides, or two or more prime editing system components may be encoded by a single polynucleotide. In some embodiments, a prime editor polypeptide and one or more PEgRNA(s) or ngRNA are encoded by a single polynucleotide. In some embodiments, the polynucleotide encodes a prime editor fusion protein comprising a DNA binding domain and a DNA polymerase domain. In some embodiments, the polynucleotide encodes a DNA polymerase domain of a prime editor. In some embodiments, thepolynucleotide encodes a DNA binding domain of a prime editor. In some embodiments, the polynucleotide encodes a portion of a prime editor protein, for example, aN-terminal portion of a prime editor fusion protein connected to an intein-N. In some embodiments, the polynucleotide encodes a portion of a prime editor protein, for example, a C-terminal portion of a prime editor fusion protein connected to an intein-C. In some embodiments, the polynucleotide encodes a PEgRNA. In some embodiments, the polynucleotide encodes two or more components of a prime editing composition, for example, a prime editor fusion protein and a PEgRNA.

[0225] In some embodiments, a prime editing system comprises one or more polynucleotides that encode prime editor components and / or the first PEgRNA and / or the second PEgRNA. In some embodiments, a prime editing system comprises a polynucleotide encoding a fusion protein comprising a DNA binding domain and a DNA polymerase domain. In some embodiments, a prime editing system comprises (i) a polynucleotide encoding a fusion protein comprising a DNA binding domain and a DNA polymerase domain, (ii) a first PEgRNA or a polynucleotide encoding the first PEgRNA, and (iii) a second PEgRNA or a polynucleotide encoding the second PEgRNA. In some embodiments, a prime editing system comprises (i) a polynucleotide encoding a DNA binding domain of a prime editor, e.g., a Cas9 nickase, (ii) a polynucleotide encoding a DNA polymerase domain of a prime editor, e.g., a reverse transcriptase, (iii) a first PEgRNA or a polynucleotide encoding the first PEgRNA, and (iv) a second PEgRNA or a polynucleotide encoding the second PEgRNA.

[0226] (ix). Pharmaceutical compositions

[0227] Disclosed herein are pharmaceutical compositions comprising any of the compounds, compositions and / or nanoparticles described herein, and one or more pharmaceutically acceptable excipient.

[0228] The compounds and LNP compositions described herein can be formulated into pharmaceutical compositions that further comprise a pharmaceutically acceptable carrier, diluent, adjuvant or vehicle. In one embodiment, the present disclosure provides a pharmaceutical composition comprising a compound described herein, and a pharmaceutically acceptable carrier, diluent, adjuvant or vehicle. In one embodiment, the present disclosure provides a pharmaceutical composition comprising a LNP composition described herein, and a pharmaceutically acceptable earner, diluent, adjuvant or vehicle.

[0229] In some embodiments, a pharmaceutical composition comprises any of the compounds described herein, at least one polynucleotide, and one or more pharmaceuticallyacceptable excipients. In some embodiments, a pharmaceutical composition comprises any of the compounds described herein, one or more components of a prime editing system, and one or more pharmaceutically acceptable excipients. In some embodiments, a pharmaceutical composition comprises any of the compositions described herein and one or more pharmaceutically acceptable excipients. In some embodiments, a pharmaceutical composition comprises any of the lipid nanoparticles described herein and one or more pharmaceutically acceptable excipients.

[0230] The term ‘‘pharmaceutical composition”, as used herein, refers to a composition formulated for pharmaceutical use. In some embodiments, the pharmaceutical composition comprises additional agents, e.g., for specific delivery, increasing half-life, or other therapeutic compounds.

[0231] In some embodiments, a pharmaceutically-acceptable excipient comprises any vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the compound from one site (e.g., the delivery site) of the body, to another site (e.g., organ, tissue or portion of the body). A pharmaceutically acceptable carrier is “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to a tissue and / or subject (e.g., physiologically compatible, sterile, physiologic pH, etc.).

[0232] A pharmaceutically acceptable carrier may contain inert ingredients that do not unduly inhibit the biological activity of the compounds. The pharmaceutically acceptable carriers should be biocompatible, e.g., non-toxic, non-inflammatory, non-immunogenic or devoid of other undesired reactions or side-effects upon the administration to a subject. Standard pharmaceutical formulation techniques can be employed.

[0233] The pharmaceutically acceptable carrier, adjuvant, or vehicle, as used herein, includes any and all solvents, diluents, or other liquid vehicle, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired. Remington's Pharmaceutical Sciences, Sixteenth Edition, E. W. Martin (Mack Publishing Co., Easton, Pa., 1980) discloses various carriers used in formulating pharmaceutically acceptable compositions and known techniques for the preparation thereof. Except insofar as any conventional carrier medium is incompatible with the compounds described herein, such as by producing any undesirable biological effect or otherwise interacting in a deleterious manner with any other component(s) of the pharmaceutically acceptable composition, the useof such conventional earner medium is contemplated to be within the scope of this disclosure.

[0234] Some examples of materials that can sen e as pharmaceutically acceptable carriers include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as twin 80. phosphates, glycine, sorbic acid, or potassium sorbate), partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes (such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, or zinc salts), colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, polyacrylates, waxes, polyethylene- polyoxypropylene-block polymers, methylcellulose, hydroxypropyl methylcellulose, wool fat, sugars such as lactose, glucose and sucrose; starches such as com starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil; safflower oil; sesame oil; olive oil; com oil and soybean oil; glycols; such a propylene glycol or polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffering agents such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol, and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents. Preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator.

[0235] Formulations of the pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory' methods include the step of bringing the active ingredient(s) into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, shaping and / or packaging the product into a desired single- or multi-dose unit. Pharmaceutical formulations can additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes any and all solvents, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, solid binders, lubricants and the like, as suited to the particular dosage form desired.

[0236] The pharmaceutical compositions described herein may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via animplanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intraocular, intrahepatic, intralesional and intracranial injection or infusion techniques.

[0237] The the pharmaceutical compositions described herein may be orally administered in any orally acceptable dosage form including, but not limited to. capsules, tablets, aqueous suspensions or solutions. In the case of tablets for oral use, carriers commonly used include lactose and com starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried cornstarch. When aqueous suspensions are required for oral use, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening, flavoring or coloring agents also may be added.

[0238] Alternatively, the pharmaceutical compositions described herein may be administered in the form of suppositories for rectal or vaginal administration. These can be prepared by mixing the agent with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature and therefore will melt in the rectum or vaginal cavity to release the drug. Such materials include cocoa butter, polyethylene glycol or a suppository' wax that is solid at ambient temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.

[0239] The pharmaceutical compositions described herein also may be administered topically, especially when the target of treatment includes areas or organs readily accessible by topical application, including diseases of the eye, skin, or lower intestinal tract. Suitable topical formulations are readily prepared for each of these areas or organs.

[0240] Topical application for the lower intestinal tract can be effected in a rectal suppository' formulation or in a suitable enema formulation. Topically-transdermal patches also may be used.

[0241] For topical applications, the pharmaceutical compositions described herein may be formulated in a suitable ointment containing the active component suspended or dissolved in one or more carriers. Carriers for topical administration of the compounds or LNP compositions described herein include, but are not limited to, mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyoxyethylene, polyoxypropylene compound, emulsifying wax and water. Alternatively, the pharmaceutical compositions described herein can be formulated in a suitable lotion or cream containing the active components suspended or dissolved in one or more pharmaceutically acceptable carriers. Suitable carriers include,but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60. cetyl esters wax. cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water.

[0242] For ophthalmic use, the pharmaceutical compositions described herein may be formulated, e.g., as micronized suspensions in isotonic, pH adjusted sterile saline or other aqueous solution, or. preferably, as solutions in isotonic, pH adjusted sterile saline or other aqueous solution, either with or without a preservative such as benzylalkonium chloride. Alternatively, for ophthalmic uses, the pharmaceutical compositions described herein may be formulated in an ointment such as petrolatum. The pharmaceutical compositions described herein also may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and / or other conventional solubilizing or dispersing agents.

[0243] Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art such as. for example, w ater or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, com, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, the oral compositions also can include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0244] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S.P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables.

[0245] The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0246] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form also may comprise buffering agents.

[0247] Solid compositions of a similar t pe also may be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. Solid dosage forms optionally may contain opacifying agents. These solid dosage forms also can be of a composition such that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. Solid compositions of a similar type also may be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polethylene glycols and the like.

[0248] The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well know n in the pharmaceutical formulating art. In such solid dosage forms the LNP composition may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms also may comprise, as is normal practice, additional substancesother than inert diluents, e.g., tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms also may comprise buffering agents. They may optionally contain opacifying agents and also can be of a composition such that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes.

[0249] (x). Delivery

[0250] Also disclosed herein are methods for delivering polynucleotides or prime editing system(s) into a target cell by utilizing the LNP compositions described herein.

[0251] In some embodiments, the LNP compositions described herein are used to deliver a prime editing system, a DNA plasmid encoding prime editor components, a DNA plasmid encoding a PEgRNA and optionally an ngRNA, a DNA plasmid encoding a PEgRNA pair, a DNA plasmid encoding a prime editor fusion protein, or one or more DNA plasmids encoding one or more of a prime editor fusion protein, a PEgRNA, an ngRNA, or a PEgRNA pair.

[0252] In some embodiments, the LNP compositions described herein are used to deliver an mRNA encoding prime editor components, an mRNA encoding prime editor fusion protein, a PEgRNA and optionally ngRNA, or a PEgRNA pair.

[0253] In some embodiments, the LNP compositions described herein are used to deliver a prime editor protein, a prime editor fusion protein, a PEgRNA and optionally ngRNA, or a PEgRNA pair.

[0254] In some embodiments, a method for delivering polynucleotides into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein; and (2) one or more polynucleotides.

[0255] In some embodiments, the polynucleotides are DNA or mRNA.

[0256] In some embodiments, a method for delivering a prime editing system into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic peptide-lipid conjugate or a cyclic peptide compound (e.g., a compound of Formula I or Formula II) described herein; and (2) one or more polynucleotides.

[0257] In some embodiments, the one or more components of a prime editing system comprises a construct encoding prime editor components. In some embodiments, the construct is a DNA plasmid encoding prime editor components.

[0258] In some embodiments, the one or more components of a prime editing system comprises a construct encoding a prime editing guide RNA (PEgRNA), and optionally a nick guide RNA (ngRNA). In some embodiments, the one or more components of a prime editing system comprises a construct encoding a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA. In some embodiments, the construct is a DNA plasmid encoding a prime editing guide RNA (PEgRNA). and optionally a nick guide RNA (ngRNA). In some embodiments, the construct is a DNA plasmid encoding a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA.

[0259] In some embodiments, the prime editor components comprise a prime editing guide RNA (PEgRNA), and optionally a nick guide RNA (ngRNA). In some embodiments, the prime editor components comprise a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA.

[0260] In some embodiments, the one or more components of a prime editing system comprises a construct encoding a prime editor fusion protein. In some embodiments, the construct is a DNA plasmid encoding a prime editor fusion protein.

[0261] In some embodiments, the one or more components of a prime editing system comprises one or more constructs encoding one or more of a prime editor fusion protein, PEgRNA, ngRNA, or a PEgRNA pair. In some embodiments, the one or more constructs are one or more DNA plasmids encoding one or more of a prime editor fusion protein, PEgRNA, ngRNA, or a PEgRNA pair.

[0262] In some embodiments, the one or more components of a prime editing system comprises an mRNA encoding prime editor components. In some embodiments, the one or more components of a prime editing system comprises an mRNA encoding a prime editor fusion protein.

[0263] In some embodiments, the prime editor components comprise a prime editing guide RNA (PEgRNA), and optionally a nick guide RNA (ngRNA). In some embodiments, the prime editor components comprise a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA.

[0264] In some embodiments, the one or more components of a prime editing system comprises a PEgRNA, and optionally an ngRNA. In some embodiments, the one or more components of a prime editing system comprises a PEgRNA pair. In some embodiments, theone or more components of a prime editing system comprises a prime editor protein, a prime editor fusion protein, a PEgRNA, a ngRNA, or a PEgRNA pair.

[0265] In some embodiments, the LNP composition is formulated to deliver at least one polynucleotide or one or more components of the prime editing system to target cells.

[0266] In some embodiments, wherein the target cells are or comprise liver cells, bone marrow cells, lung cells, eye cells, muscle cells, or cells in the central nervous system.

[0267] In some embodiments, the first and second lipid nanoparticles are the same. In some embodiments, the first and second lipid nanoparticles are different.

[0268] In some embodiments, the first and second lipid nanoparticles are introduced into the cell simultaneously. In some embodiments, the first and second lipid nanoparticles are introduced into the cell sequentially.

[0269] Delivery to the cells can be in vitro, via ex vivo administration, or via in vivo administration.

[0270] In some embodiments, the target cells are or comprise human cells, mammalian cells, liver cells (e.g., hepatocytes), bone marrow cells (e.g., bone marrow monocytes), lung cells, eye cells, muscle cells, or cells in the central nervous system.

[0271] III. EXAMPLES

[0272] Additional embodiments are disclosed in further detail in the following examples, which are not in any way intended to limit the scope of the claims.

[0273] The compounds provided herein can be prepared from readily available starting materials using the following general methods and procedures. It will be appreciated that where typical or preferred process conditions (i.e. , reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization.

[0274] Additionally, as will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. The choice of a suitable protecting group for a particular functional group as well as suitable conditions for protection and deprotection are well known in the art. For example, numerous protecting groups, and their introduction and removal, are described in T. W. Greene and P. G. M. Wuts, Protecting Groups in Organic Synthesis, Second Edition, Wiley,New York, 1991, and references cited therein.

[0275] Abbreviations:

[0276] CTC resin: 2-chlorotrytyl chloride resin; EDCI: l-(3-dimethylaminopropy)-3- ethylcarbodiimide; Fmoc: fluorenylmethoxycarbonyl; DIEA: N,N-diisopropylethylamine; DCM: dichloromethane; DMF: dimethylformamide; HOAt: l-Hydroxy-7-azabenzotriazole; DIC: N,N' -Diisopropylcarbodiimide; HFIP: Hexafluoroisopropanol; TFA: Trifluoroacetic acid; TIS: O-(l,l-dihydroxyethyl)-L-serine; MPA: 3-mercaptopropionic acid; Boc: tertbutyloxycarbonyl; CAN: acetonitrile.

[0277] EXAMPLE 1.

[0278] Compound 1 (Cyclic Peptide 1; CPI) was prepared as shown in the following scheme:

[0279] Preparation of Intermediate Cyc-Pl

[0280] Step 1 - Resin preparation: The CTC resin (5.0 mmol, 1.0 eq, Sub 1.0 mmol / g) and Fmoc-Lys(Boc)-OH (1.0 eq), DIEA (3.0 eq) in DCM (50.0 ml) was agitated with N2 for 2 hrs. Then 5.0 ml MeOH was added to the resin and was agitated with N2 for 30 mins. Then the mixture was fdtered to get the resin.

[0281] Step 2 - Deprotection: 20% piperidine in DMF (100.0 rnL) was added and agitated the resin with N2 for another 30 mins. The resin was washed with DMF (100.0 mL * 5) and filtered to get the resin.

[0282] Step 3 - Coupling: A solution of Fmoc-Ser(Trt)-OH (3.0 eq), HO At (3.0 eq) and DIC (3.0 eq) in DMF (50.0 mL) was added to the resin and agitated with N2 for 60 mins at 20 °C. The resin was then washed with DMF (100.0 mL * 5).

[0283] Steps 2 and 3 were repeated for the coupling of following amino acids: (3~5).

[0284] Peptide Cleavage. Cyclization and Purification:

[0285] The resin was washed with MeOH (50mL*3), and dried under vacuum. Then the peptide resin (9.5 g) was treated with the cleavage cocktail (20%HFlP / 80%DCM) 1 0ml for 15 mins twice.

[0286] The filtrate was collected and concentrated under reduced pressure to give a residue. The peptide was precipitated with cold isopropyl ether (500 mL) and centrifuged (2 min at 3000 rpm) and washed two times with isopropyl ether dry the peptide under vacuum 2 hours. The full protection linear peptide (Al) was obtained 4.75 g. The crude peptide confirmed by LCMS (Al, Rt=1.539 mm).

[0287] Cyclization: To a solution of crude all protection linear peptide (Al, 4.76 g) and HOAt (1.0 eq) in DCM (1600 mL) was added EDCI (1.0 eq) slowly. The mixture was stirred at 25 °C for 30 min. LCMS showed crude all protection linear peptide was consumed completely and a new peak (A2, Rt=1.832 min) appeared. The reaction mixture was concentrated under reduced pressure to give a residue (A2).

[0288] Cleavage: 50 ml of cleavage cocktail (92.5%TFA / 2.5%H2O / 2.5%TIS / 2.5%MPA) were added to the residue and stirred 25 °C for 30 min. The peptide was precipitated with cold methyl tert-butyl ether (500 mL) and centrifuged (2 min at 3000 rpm) and washed two times. The crude peptide was dried under vacuum for 2 hours to get 2.55 g crude (A3) which was confirmed by LCMS (A3, Rt=1.024 min).

[0289] Added Boc group: To a solution of crude A3 (2.55 g) and BOC2O (1.5 eq) in DMF (20 mL) was added DIEA(3.0 eq) slowly. The mixture was stirred at 25 °C for 30 min. LCMS showed one main (Rt=1.417 min) peak with desired m / z detected.

[0290] The crude peptide was purified by prep-HPLC (A: 0.075% TFA in H2O, B: ACN) to give the peptide Cyc-Pl (600 mg, 943.77 pmol. 18.88% yield, 98.9% purity. N / A) was obtained as a white solid which was confirmed by HPLC.

[0291] Preparation of Intermediate Cyc-PIA

[0292] A mixture of Cyc-Pl (400 mg, 629.18 pmol, 1 eq), prop-2-enoyl prop-2-enoate (238.04 mg, 1.89 mmol, 3 eq) and DIEA (325.27 mg, 2.52 mmol. 438.37 pL. 4 eq) in DMF (5 mL) was stirred at 26 °C for 30 min. LCMS showed one main peak (Rt=1.582 min) with desired m / z was detected.

[0293] The crude peptide was purified by prep-HPLC (A: 0.075% TFA in H2O, B: ACN) to give the peptide Cyc-PIA (250 mg, 339.28 pmol. 53.92% yield) and was obtained as a white solid.

[0294] Preparation of Compound 1 (Cyclic Peptide 1; CPI)

[0295] A mixture of Cyc-PIA (166 mg, 225.28 pmol, 1.00 eq) and N-decyldecan-1 -amine (167.59 mg, 563.21 pmol, 2.50eq) in dioxane (10.0 mL) was stirred at 75 °C for 24 h. A 39.09% peak (retention time = 3.298 min) with Boc protecting peptide mass was detected by LCMS. The reaction mixture was concentrated in vacuum and which was treated with FA (5.0 mL) for 1 h at 25 °C, no peptide with Boc protection was remained and a major peak (Rt= 2.825 min) with de-Boc peptide mass was detected by LCMS. The reaction mixture was concentrated directly to give a crude product, the crude product was purified by prep-HPLC (TFA condition, A: 0.075%TFA in H2O, B: ACN) to afford Compound 1 (Cyclic Peptide 1; CPI) (66.8 mg, 54.10 pmol, 22.92% yield, 98.77% purity, FA) as a white solid. The product was checked by LCMS (Rt = 1.787 min), the purity was confirmed by HPLC (Rt= 10.086 min, 98.77% purity).

[0296] EXAMPLES 2-4

[0297] Compounds 2-4 (Cyclic Peptides 2-4) were prepared using the same methodology as Compound 1 shown above.

[0298] EXAMPLE 5

[0299] Lipid Nanoparticles (LNPs) were prepared using the cyclic peptides described herein.

[0300] LNP preparation:

[0301] LNPs were prepared using various cyclic peptide lipids in a 2- to 5-component lipid system comprising a cyclic peptide and one or more components selected from the groupconsisting of an ionizable lipid, a helper lipid, a sterol, and a PEG-lipid. The mol % of ionizable lipid varies between 35-95%; the mol % of ionizable lipid varies between 0-50%; the mol % of helper lipid varies between 0-45%; the mol % of sterol varies between 0-50%; and the mol % of PEG-lipid varies between 0-3%. In assays for percent editing in cells, Cas9 or PE mRNA and guide RNAs (e.g. sgRNA, pegRNA or ngRNA) targeting a mouse sequence were formulated in LNPs, at either a 1 : 1 w / w ratio, 1:2 w / w ratio, or 4:3: 1 w / w ratio. In some embodiments, a functional mRNA and a reporter DNA were mixed at 10: 1 to 1: 10 w / w ratio. The lipid components were dissolved in 100% ethanol with the lipid component molar ratios described below. The guide RNA and mRNA were combined and dissolved in 50 mM acetate, pH 5.0, resulting in a concentration of total RNA cargo of approximately 0.1 mg / mL. The LNPs were formulated with an ionizable / RNA weight ratio of 20. The LNPs were formed by microfluidics mixing using a NanoAssemblr® Ignite™ from Precision Nanosystems, according to manufacturer’s protocol. A 3: 1 ratio of aqueous to organic solvent was maintained during mixing at differential flow rates. The LNPs were held for 30-60 min at 4°C before dialyzing them using a Slide-A-Lyzer™ Dialysis Cassette, 20K MWCO, for two hours at room temperature in IX PBS. LNPs were then concentrated using an Amicon Ultra Centrifugal filter tube (100K NMWL). The resulting LNPs passed through a 0.2 pm sterile filter and stored at 4°C.

[0302] LNP Composition analysis:

[0303] Dynamic Light Scattering (DLS) is used to characterize the size and polydispersity index (PDI) of an LNP. The PDI represents the particle size distribution (around the mean) in a population; a uniform population will have a PDI of zero. 2 pL of each sample were used to measure LNP size and PDI using the Unchained Labs Stunner instrument, without further dilution. A fluorescence-based assay (Ribogreen®, ThermoFisher Scientific) is used to determine total RNA concentration as well as free RNA. Encapsulation efficiency is calculated as (Total RNA-Free RNA) / Total RNA. LNP samples are diluted with IX TE buffer to determine free RNA or with IX TE containing 0.2% Triton-X 100 to determine total RNA. Standard curves are prepared by utilizing the starting RNA solution used to make the compositions and diluted in lx TE buffer + / - 0.2% Triton-X 100 buffer. Diluted RiboGreen® dye (according to the manufacturer's instructions) is added to each condition and incubate for 10-20 minutes at 37°C, in the absence of light. A SpectraMax i3x Microplate Reader was used to read the samples with excitation and emission wavelengths set to 488 and 525 nm, respectively. The total RNA and free RNA can be calculated from the appropriate standard curve.

[0304] LNP deliven / in vitro:

[0305] HEK293 cells were plated on a 96 well plate (Black / clear TC treated) when reaching 75% conflucence in a T75 flask. LNPs were incubated in 10% of desired serum at 10 ng / uL (payload concentration) diluted in PBS for 1 hour at 37°C. Standard incubation tube set up: 20pL fetal bovine serum (FBS) + 2000ng of LNP (based on encapsulated RNA concentration from the Ribogreen assay) brought up to 200pL with PBS. After pretreatment, LNPs were sterile filter using a 0.2pm syringe filter with a ImL syringe in a biosafety cabinet. To transfect cells, add the desired concentration directly to the well. For 96-well plate, plate cells with 100 pL media and add up to lOOpL of LNP. For dose response curves (DRC) start from top dose and serially dilute down in media. Pipette up and down gently to mix LNPs into well. After 72 hours, media was removed from plate and washed once with PBS. PBS was removed and quick extract (40pL / per well of a 96W plate) was added to cells. Cells were incubated for 5 minutes. Quick extract solution was transferred to a PCR plate or tubes to measure editing by Next-Generation Sequencing (NGS). gDNA was isolated according to MAI 50E-QuickExtract™ DNA Extraction Solution protocol (Thermocycler, 65°C for 6 minutes, followed by 98°C for 2 minutes). When finished DNA was stored at 4°C or proceed to PCR (PCR1) for NGS. The first PCR reaction on the gDNA used paired primers (Forward primer- ATGTGGGCTGCCTAGAAAGG (SEQ ID NO.: 1) and reverse primer- CCCAGCCAAACTTGTCAACC (SEQ ID NO.: 2) and adapters (ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNN (SEQ ID NO.: 3), TGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO.: 4)) in a 20 pL reaction with Q5 Hot Start High-Fidelity 2X Master Mix (NEB). This reaction was run on a thermocycler at 98°C for 30 seconds, then 98°C for 10 seconds. 63°C for 20 seconds. 72°C for 30 seconds for 30 cycles total, followed by last step of 72°C for 2 minutes. PCR1 reactions were stored at 4°C. Following the first PCR reaction, a second PCR reaction w as set up with barcoded primers, 1 pL of the first PCR reaction, and Q5 Hot Start High-Fidelity 2X Master Mix (NEB), which underwent 7 cycles of amplification. The second PCR reactions were pooled and run on a 2% agarose E-gel for DNA purification. The DNA samples were then run on the Miseq for sequencing. NGS results were analyzed using JupyterHub notebooks and CRISPResso to measure percent correction and percent of indels for each mutation in the Rhodopsin gene. The percent correction and percent indel values are determined based on the percentage of sequencing reads.

[0306] FIG. 1 shows the editing % in HEK293 cells at various dosages of an LNP comprising cyclic peptide 1 (CPI), a helper lipid (phospholipid), and a PEG lipid.

[0307] mRNA sequence:

[0308] AGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGAAACGGACAGCCGACGGAAGCGAGUUCGAGUCACCAAAGAAGAAGCGGAAAGUCGACAAGAAGUACAGCAUCGGCCUGGACAUCGGCACCAACUCUGUGGGCUGGGCCGUGAUCACCGACGAGUACAAGGUGCCCAGCAAGAAAUUCAAGGUGCUGGGCAACACCGACCGGCACAGCAUCAAGAAGAACCUGAUCGGAGCCCUGCUGUUCGACAGCGGCGAAACAGCCGAGGCCACCCGGCUGAAGAGAACCGCCAGAAGAAGAUACACCAGACGGAAGAACCGGAUCUGCUAUCUGCAAGAGAUCUUCAGCAACGAGAUGGCCAAGGUGGACGACAGCUUCUUCCACAGACUGGAAGAGUCCUUCCUGGUGGAAGAGGAUAAGAAGCACGAGCGGCACCCCAUCUUCGGCAACAUCGUGGACGAGGUGGCCUACCACGAGAAGUACCCCACCAUCUACCACCUGAGAAAGAAACUGGUGGACAGCACCGACAAGGCCGACCUGCGGCUGAUCUAUCUGGCCCUGGCCCACAUGAUCAAGUUCCGGGGCCACUUCCUGAUCGAGGGCGACCUGAACCCCGACAACAGCGACGUGGACAAGCUGUUCAUCCAGCUGGUGCAGACCUACAACCAGCUGUUCGAGGAAAACCCCAUCAACGCCAGCGGCGUGGACGCCAAGGCCAUCCUGUCUGCCAGACUGAGCAAGAGCAGACGGCUGGAAAAUCUGAUCGCCCAGCUGCCCGGCGAGAAGAAGAAUGGCCUGUUCGGAAACCUGAUUGCCCUGAGCCUGGGCCUGACCCCCAACUUCAAGAGCAACUUCGACCUGGCCGAGGAUGCCAAACUGCAGCUGAGCAAGGACACCUACGACGACGACCUGGACAACCUGCUGGCCCAGAUCGGCGACCAGUACGCCGACCUGUUUCUGGCCGCCAAGAACCUGUCCGACGCCAUCCUGCUGAGCGACAUCCUGAGAGUGAACACCGAGAUCACCAAGGCCCCCCUGAGCGCCUCUAUGAUCAAGAGAUACGACGAGCACCACCAGGACCUGACCCUGCUGAAAGCUCUCGUGCGGCAGCAGCUGCCUGAGAAGUACAAAGAGALUJUUCLIUCGACCAGAGCAAGAACGGCUACGCCGGCUACAUUGACGGCGGAGCCAGCCAGGAAGAGUUCUACAAGUUCAUCAAGCCCAUCCUGGAAAAGAUGGACGGCACCGAGGAACUGCUCGUGAAGCUGAACAGAGAGGACCUGCUGCGGAAGCAGCGGACCUUCGACAACGGCAGCAUCCCCCACCAGAUCCACCUGGGAGAGCUGCACGCCAUUCUGCGGCGGCAGGAAGAUUUUUACCCAUUCCUGAAGGACAACCGGGAAAAGAUCGAGAAGAUCCUGACCUUCCGCAUCCCCUACUACGUGGGCCCUCUGGCCAGGGGAAACAGCAGAUUCGCCUGGAUGACCAGAAAGAGCGAGGAAACCAUCACCCCCUGGAACUUCGAGGAAGUGGUGGACAAGGGCGCUUCCGCCCAGAGCUUCAUCGAGCGGAUGACCAACULJCGAUAAGAACCLJGCCCAACGAGAAGGUGCUGCCCAAGCACAGCCUGCUGUACGAGUACUUCACCGUGUAUAACGAGCUGACCAAAGUGAAAUACGUGACCGAGGGAAUGAGAAAGCCCGCCUUCCUGAGCGGCGAGCAGAAAAAGGCCAUCGUGGACCUGCUGUUCAAGACCAACCGGAAAGUGACCGUGAAGCAGCU GAAAGAGGACUACUUCAAGAAAAUCGAGUGCUUCGACUCCGUGGAAAUCUCC GGCGUGGAAGAUCGGUUCAACGCCUCCCUGGGCACAUACCACGAUCUGCUGAA AAUUAUCAAGGACAAGGACUUCCUGGACAAUGAGGAAAACGAGGACAUUCUG GAAGAUAUCGUGCUGACCCUGACACUGUUUGAGGACAGAGAGAUGAUCGAGG AACGGCUGAAAACCUAUGCCCACCUGUUCGACGACAAAGUGAUGAAGCAGCUG AAGCGGCGGAGAUACACCGGCUGGGGCAGGCUGAGCCGGAAGCUGAUCAACGG CAUCCGGGACAAGCAGUCCGGCAAGACAAUCCUGGAUUUCCUGAAGUCCGACG GCUUCGCCAACAGAAACUUCAUGCAGCUGAUCCACGACGACAGCCUGACCUUU AAAGAGGACAUCCAGAAAGCCCAGGUGUCCGGCCAGGGCGAUAGCCUGCACGA GCACAUUGCCAAUCUGGCCGGCAGCCCCGCCAUUAAGAAGGGCAUCCUGCAGA CAGUGAAGGUGGUGGACGAGCUCGUGAAAGUGAUGGGCCGGCACAAGCCCGA GAACAUCGUGAUCGAAAUGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGA AGAACAGCCGCGAGAGAAUGAAGCGGAUCGAAGAGGGCAUCAAAGAGCUGGG CAGCCAGAUCCUGAAAGAACACCCCGUGGAAAACACCCAGCUGCAGAACGAGA AGCUGUAC CUGU AC UAC CUGC AGA AUGGGC GGGAU AUGU AC GUGGAC C AGGA ACUGGACAUCAACCGGCUGUCCGACUACGAUGUGGACGCUAUCGUGCCUCAGA GCUUUCUGAAGGACGACUCCAUCGACAACAAGGUGCUGACCAGAAGCGACAAG AACCGGGGCAAGAGCGACAACGUGCCCUCCGAAGAGGUCGUGAAGAAGAUGA AGAACUACUGGCGGCAGCUGCUGAACGCCAAGCUGAUUACCCAGAGAAAGUUCGACAAUCUGACCAAGGCCGAGAGAGGCGGCCUGAGCGAACUGGAUAAGGCCGG CUUCAUCAAGAGACAGCUGGUGGAAACCCGGCAGAUCACAAAGCACGUGGCAC AGAUCCUGGACUCCCGGAUGAACACUAAGUACGACGAGAAUGACAAGCUGAUC CGGGAAGUGAAAGUGAUCACCCUGAAGUCCAAGCUGGUGUCCGAUUUCCGGA AGGAUUUCCAGUUUUACAAAGUGCGCGAGAUCAACAACUACCACCACGCCCAC GACGCCUACCUGAACGCCGUCGUGGGAACCGCCCUGAUCAAAAAGUACCCUAA GCUGGAAAGCGAGUUCGUGUACGGCGACUACAAGGUGUACGACGUGCGGAAG AUGAUCGCCAAGAGCGAGCAGGAAAUCGGCAAGGCUACCGCCAAGUACUUCUU CUACAGCAACAUCAUGAACUUUUUCAAGACCGAGAUUACCCUGGCCAACGGCG AGAUCCGGAAGCGGCCUCUGAUCGAGACAAACGGCGAAACCGGGGAGAUCGUG UGGGAUAAGGGCCGGGAUUUUGCCACCGUGCGGAAAGUGCUGAGCAUGCCCCA AGUGAAUAUCGUGAAAAAGACCGAGGUGCAGACAGGCGGCUUCAGCAAAGAG UCUAUCCUGCCCAAGAGGAACAGCGAUAAGCUGAUCGCCAGAAAGAAGGACUG GGACCCUAAGAAGUACGGCGGCUUCGACAGCCCCACCGUGGCCUAUUCUGUGCUGGUGGUGGCCAAAGUGGAAAAGGGCAAGUCCAAGAAACUGAAGAGUGUGAAAGAGCUGCUGGGGAUCACCAUCAUGGAAAGAAGCAGCUUCGAGAAGAAUCCCAUCGACUUUCUGGAAGCCAAGGGCUACAAAGAAGUGAAAAAGGACCUGAUCAUCAAGCUGCCUAAGUACUCCCUGUUCGAGCUGGAAAACGGCCGGAAGAGAAUGCUGGCCUCUGCCGGCGAACUGCAGAAGGGAAACGAACUGGCCCUGCCCUCCAAAUAUGUGAACUUCCUGUACCUGGCCAGCCACUAUGAGAAGCUGAAGGGCUCCCCCGAGGAUAAUGAGCAGAAACAGCUGUUUGUGGAACAGCACAAGCACUACCUGGACGAGAUCAUCGAGCAGAUCAGCGAGUUCUCCAAGAGAGUGAUCCUGGCCGACGCUAAUCUGGACAAAGUGCUGUCCGCCUACAACAAGCACCGGGAUAAGCCCAUCAGAGAGCAGGCCGAGAAUAUCAUCCACCUGUUUACCCUGACCAAUCUGGGAGCCCCUGCCGCCUUCAAGUACUUUGACACCACCAUCGACCGGAAGAGGUACACCAGCACCAAAGAGGUGCUGGACGCCACCCUGAUCCACCAGAGCAUCACCGGCCUGUACGAGACACGGAUCGACCUGUCUCAGCUGGGAGGUGACUCCGGCGGCUCCUCCGGCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCAGCGGCGGCAGCAGCGGCGGAAGCUCUGGCGGAUCUAGCGGCGGCUCUACCCUGAACAUCGAGGACGAGUACAGGCUGCACGAGACCAGCAAGGAGCCCGACGUGAGCCUGGGCAGCACCUGGCUGAGCGAUUUCCCUCAGGCUUGGGCCGAGACCGGCGGCAUGGGCCUGGCCGUGCGGCAGGCCCCCCUGAUUAUCCCCCUGAAGGCCACCAGCACCCCCGUGAGCAUCAAGCAGUACCCAAUGUCCCAGGAGGCCAGGCUGGGCAUCAAGCCUCACAUCCAGAGGCUGCUGGACCAGGGCAUCCUGGUGCCAUGCCAGUCCCCCUGGAACACCCCUCUGCUGCCCGUGAAGAAGCCUGGCACCAACGACUACCGGCCCGUGCAGGACCUGAGAGAAGUGAACAAGCGGGUGGAGGACAUCCACCCAACCGUGCCCAACCCUUACAACCUGCUGUCCGGCCUGCCCCCCAGCCACCAGUGGUACACCGUGCUGGACCUGAAGGACGCCUUCUUCUGCCUGAGACUGCACCCCACCUCUCAGCCCCUGUUCGCCUUCGAGUGGCGCGACCCCGAGAUGGGCAUCAGCGGCCAGCUGACCUGGACCAGACUGCCACAGGGCUUUAAGAAUAGCCCAACCCUGUUUAACGAGGCCCUGCACAGGGACCUGGCCGACUUCAGGAUCCAGCACCCCGACCUGAUUCUGCUGCAGUACGUGGACGACCUGCUGCUGGCCGCUACCAGCGAGCUGGACUGCCAGCAGGGCACCAGAGCCCUGCUGCAGACCCUGGGCAACCUGGGCUACAGAGCCAGCGCCAAGAAGGCCCAGAUCUGUCAGAAGCAGGUGAAGUAUCUGGGCUACCUGCUGAAGGAAGGCCAGAGAUGGCUGACCGAGGCCAGAAAGGAGACUGUGAUGGGCCAGCCCACCCCCAAGACCCCCAGGCAGCUGCGGGAGUUCCUGGGCAAGGCCGGCUUUUGCAGACUGUUUAUCCCUGGCUUCGCCGAGAUGGCCGCCCCACUGUACCCUCUGACCAAGCCUGGCACCCUGUUUAACUGGGGCCCCGACCAGCAGAAGGCCUACCAGGAGAUCAAGCAGGCCCUGCUGACCGCCCCCGCCCUGGGCCUGCCCGACCUGACCAAGCCUUUCGAGCUGUUCGUGGACGAGAAGCAGGGAUACGCCAAAGGCGUGCUGACCCAGAAGCUGGGCCCCUGGCGGAGGCCCGUGGCCUACCUGAGCAAAAAACUGGACCCUGUGGCCGCCGGCUGGCCCCCAUGCCUGCGGAUGGUGGCCGCCAUCGCUGUGCUGACCAAGGACGCCGGCAAGCUGACCAUGGGCCAGCCCCUGGUGAUCCUGGCCCCUCACGCCGUGGAGGCUCUGGUGAAGCAGCCUCCAGACAGGUGGCUGUCCAACGCCAGGAUGACCCACUACCAGGCCCUGCUGCUGGACACCGACCGGGUGCAGUUCGGCCCUGUGGUGGCCCUGAACCCCGCCACCCUGCUGCCUCUGCCAGAGGAGGGCCUGCAGCACAACUGCCUGGACAUCCUGGCCGAGGCCCACGGCACCAGGCCCGACCUGACCGACCAGCCCCUGCCUGACGCCGACCACACCUGGUACACCGACGGCAGCUCCCUGCUGCAGGAGGGCCAGAGGAAGGCCGGCGCCGCCGUGACCACCGAGACCGAGGUGAUCUGGGCCAAAGCCCUGCCUGCCGGCACCUCCGCCCAGCGGGCCGAGCUGAUCGCCCUGACCCAGGCCCUGAAGAUGGCUGAGGGCAAGAAGCUGAACGUGUACACCGAUUCCAGAUACGCCUUCGCCACCGCCCACAUCCACGGCGAGAUCUACAGAAGAAGGGGCUGGCUGACCUCCGAGGGCAAGGAGAUCAAGAACAAGGACGAGAUUCUGGCCCUGCUGAAGGCCCUGUUCCUGCCUAAGAGACUGAGCAUCAUCCACUGUCCCGGCCACCAGAAGGGCCACAGCGCCGAGGCCAGAGGCAAUAGAAUGGCCGACCAGGCCGCCAGAAAGGCCGCCAUCACCGAGACCCCCGACACCAGCACCCUGCUGAUCGAGAACAGCAGCCCCAGCGGCGGCUCCAAACGCACCGCCGACGGGAGCGAGUUCGAGCCCAAGAAGAAGAGGAAAGUCUAAUAGUGAGCGGCCGCUUAAUUAAGCUGCCUUCUGCGGGGCUUGCCUUCUGGCCAAGCCCUUCUUCUCUCCCUUGCACCUGUACCUCUUGGUCUUUGAAUAAAGCCUGAGUAGGAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO.: 5).

[0309] pegRNA sequence:

[0310] GGCCCAGACUGAGCACGUGAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUCUGCCAUCAAAGCGUGCUCAGUCUGUUUU (SEQ ID NO.: 6).OTHER EMBODIMENTS

[0311] The above examples are to be understood as illustrative examples. Further examples are envisaged, which include combinations of features as indicated in the following list, which contains various envisaged claim dependencies for the claims originally filed with thisapplication. Hence, in addition to the description above, this list provides basis for examples having a combination of features of claims filed herewith. Hence, the following list also discloses embodiments of the invention.

[0312] Embodiment !. A cyclic peptide-lipid conjugate comprising: a cyclic peptide comprising 4 to 30 amino acid residues. wherein 1, 2, or 3 amino acid residues comprise a positive charge; and at least one lipid component conjugated to the cyclic peptide, wherein the at least one lipid component is connected to at least one amino acid residue side chain. wherein each lipid component comprises a lipid linker and a lipid chain, wherein the lipid linker comprises a biodegradable group and the lipid chain comprises a branched or unbranched, substituted or unsubstituted, cyclic or acyclic aliphatic group.

[0313] Embodiment 2. The cyclic peptide-lipid conjugate of Embodiment 1, wherein the cyclic peptide comprises 5-10 or 5-7 amino acid residues.

[0314] Embodiment 3. The cyclic peptide-lipid conjugate of Embodiment 1 or 2, wherein the cyclic peptide comprises naturally occurring amino acid residues, non-naturally occurring amino acid residues, derivatives, or combinations thereof.

[0315] Embodiment 4. The cyclic peptide-lipid conjugate of any one of Embodiments 1-3, wherein the amino acid residues that comprise a positive charge comprise arginine, lysine, histidine, or derivatives thereof.

[0316] Embodiment 5. The cyclic peptide-lipid conjugate of any one of Embodiments 1-4, wherein the at least one amino acid residue side chain that connects to the lipid component comprises a serine-, cysteine-, aspartic acid-, or glutamate-side chains, or derivatives thereof.

[0317] Embodiment 6. The cyclic peptide-lipid conjugate of any one of Embodiments 1-5, wherein the biodegradable group of the lipid linker comprises an ether, ester, thioether, thioester, disulfide, amide, carbamate bond, or combinations thereof.

[0318] Embodiment 7. The cyclic peptide-lipid conjugate of any one of Embodiments 1-6, wherein the lipid chain comprises a branched or unbranched, substituted or unsubstituted C1-C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl.

[0319] Embodiment 8. The cyclic peptide-lipid conjugate of Embodiment 7, wherein the lipid chain comprises a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl.

[0320] Embodiment 9. The cyclic peptide-lipid conjugate of Embodiment 8, wherein at least one double bond in the C2-C20 alkenyl is in a cis configuration.

[0321] Embodiment 10. A compound of Formula I or Formula II:wherein each a is independently 0-15; each b is independently 0-15; each R1is independently an amino acid side chain, or isomers or derivatives thereof; each L is independently a serine-, cysteine-, aspartic acid- or glutamic acid-side chain; each R2is independently a branched or unbranched, substituted or unsubstituted Ci- C20 alkyd; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ether-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted sulfanyl-, ester- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched,substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide- containing C1-C20 alky l, C2-C20 alkenyl, or C2-C20 alkynyl; or a branched or unbranched, substituted or unsubstituted carbamoyl-containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl, orwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently70-10; each Y is independently absent, -C(O)O-, or -OC(O)-; eacheach e is independently^ 0-10; each f is independently 0 or 1 ; each g is independently 0 or 1 ; each h is independently 0 or 1 ; and each R3is independently H, a branched or unbranched, substituted or unsubstituted C1-C20 alky l; a branched or unbranched, substituted or unsubstituted C2- C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; provided that the compound of Formula I or Formula II comprises at least one and no more than three atoms with a positive charge, wherein the one to three positive charges are present in R1and / or R2.

[0322] Embodiment 11. The compound of Embodiment 10, wherein the compound of Formula I is a compound of Formulas I-A-l to I-A-4:

[0323] Embodiment 12. The compound of Embodiment 10, wherein the compound ofFormula II is a compound of Formulas 1I-A-1 to 1I-A-4:

[0324] Embodiment 13. The compound of Embodiment 10. wherein the compound ofFormula I is a compound of Formulas I-B-l to I-B-4:Formula I-B-3; or

[0325] Embodiment 14. The compound of Embodiment 10, wherein the compound ofFormula II is a compound of Formulas II-B-1 to II-B-4:

[0326] Embodiment 15. The compound of Embodiment 10, wherein the compound ofFormula I is a compound of Formulas I-C-l to I-C-4:

[0327] Embodiment 16. The compound of Embodiment 10. wherein the compound ofFormula II is a compound of Formulas II-C-1 to II-C-4:Formula II-C-3; or Formula II-C-4.

[0328] Embodiment 17. The compound of Embodiment 10, wherein a is 0 and b is 1.

[0329] Embodiment 18. The compound of Embodiment 10, wherein a is 1 and b is 1.

[0330] Embodiment 19. The compound of Embodiment 10. wherein a is 1 and b is 2.

[0331] Embodiment 20. The compound of any one of Embodiments 10-19, wherein at least one R1is a lysine-side chain.

[0332] Embodiment 21. The compound of any one of Embodiments 10-19, wherein at least one R1is an arginine-side chain.

[0333] Embodiment 22. The compound of any one of Embodiments 10-21, wherein each L is a serine-side chain.

[0334] Embodiment 23. The compound of Embodiment 22. wherein each R2is

[0335] Embodiment 24. The compound of Embodiment 23, wherein each X is -C(O)-;each c is independently 2; each Y is independently absent; each Z is independently I ; and each e. f. g, and h is independently 0.

[0336] Embodiment 25. The compound of Embodiment 23, wherein each X is -C(O)-; each c is independently 3; each Y is independently -C(O)O-; each Z is independentlyeach e. f, g, and h is independently 0.

[0337] Embodiment 26. The compound of Embodiment 23. wherein each X is -C(O)-;^CH' / each c is independently 0; each Y is independently absent; each Z is independently I ; and each e, f. g, and h is independently 0.

[0338] Embodiment 27. The compound of any one of Embodiments 10-21, wherein each L is a cysteine-side chain.

[0339] Embodiment 28. The compound of Embodiment 27. wherein each R2is

[0340] Embodiment 29. The compound of Embodiment 28, wherein each X is -S-; each c is independently 3; each Y is independently -C(O)O-; each Z is independentlyeach e, f, g, and h is independently 0.

[0341] Embodiment 30. The compound of any one of Embodiments 23-30, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

[0342] Embodiment 31. A compound of Formula I-A-l :Formula I-A-l; wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof;wherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10;each Y is independently absent, -C(O)O-. or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C1-C20 alkyl.

[0343] Embodiment 32. The compound of Embodiment 31, wherein one or two R1is a lysine-side chain.

[0344] Embodiment 33. The compound of Embodiment 31, wherein one or two R1is an arginine-side chain.

[0345] Embodiment 34. The compound of Embodiment 31 or 32, wherein the remaining R1is a leucine-side chain.

[0346] Embodiment 35. The compound of any one of Embodiments 32-34, wherein each X is -C(O)-; each c is independently 2; each Y is independently absent; and each Z is independently

[0347] Embodiment 36. The compound of any one of Embodiments 32-34, wherein each X is -C(O)-; each c is independently 3; each Y is independently -C(O)O-; and each Z is independently

[0348] Embodiment 37. The compound of any one of Embodiments 32-34, wherein each X is -C(O)-; each c is independently 0; each Y is independently absent; and each Z is independently

[0349] Embodiment 38. The compound of any one of Embodiments 32-37, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

[0350] Embodiment 39. A compound of Formula I-A-2:wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof; eachwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C 1-C20 alky l.

[0351] Embodiment 40. The compound of Embodiment 39, wherein each R1is a lysine- or an arginine-side chain.

[0352] Embodiment 41. The compound of Embodiment 39 or 40, wherein each X is -S- ; each c is independently 3; each Y is independently -C(O)O-; and each Z is independently

[0353] Embodiment 42. The compound of any one of Embodiments 39-41, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

[0354] Embodiment 43. A compound selected from the group consisting of:or a salt thereof.

[0355] Embodiment 44. A pharmaceutically acceptable salt of a cyclic peptide-lipid conjugate of any one of Embodiments 1-9 or a compound of any one of Embodiments 10-43.

[0356] Embodiment 45. A lipid nanoparticle (LNP) composition comprising a cyclic peptide-lipid conjugate of any one of Embodiments 1-9 or a compound of any one of Embodiments 10-43.

[0357] Embodiment 46. A lipid nanoparticle (LNP) composition comprising: a cyclic peptide-lipid conjugate of any one of Embodiments 1-9 or a compound of any one of Embodiments 10-43; and at least one of:a cationic lipid; a phospholipid; a PEG-containing lipid; or a sterol.

[0358] Embodiment 47. The LNP composition of Embodiment 46, further comprising a prime editor comprising a DNA binding domain and a DNA polymerase domain, or one or more polynucleotides encoding the prime editor.

[0359] Embodiment 48. The LNP composition of Embodiment 46 or 47, further comprising a prime editing guide RNA (PEgRNA) or a polynucleotide encoding the PEgRNA.

[0360] Embodiment 49. The LNP composition of any one of Embodiments 46-48, further comprising a nick guide RNA (ngRNA) or a polynucleotide encoding the ngRNA.

[0361] Embodiment 50. The LNP composition of any one of Embodiments 46-49, further comprising a second PEgRNA or a polynucleotide encoding the second PEgRNA.

[0362] Embodiment 51. A pharmaceutical composition comprising the LNP composition of any one of Embodiments 46-50.

[0363] Embodiment 52. A method for delivering polynucleotides into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic pepti de-lipid conjugate of any one of Embodiments 1-9 or a compound of any one of Embodiments 10-43; and (2) one or more polynucleotides.

[0364] Embodiment 53. A method for delivering a prime editing system into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic pepti de-lipid conjugate of any one of Embodiments 1-9 or a compound of any one of Embodiments 10-43; and (2) one or more components of a prime editing system.

[0365] Embodiment 54. The method of Embodiment 53, wherein the one or more components of a prime editing system comprises a construct encoding prime editor components.

[0366] Embodiment 55. The method of Embodiment 53, wherein the one or more components of a prime editing system comprises an mRNA encoding prime editor components.

[0367] Embodiment 56. The method of Embodiment 54 or 55, wherein the prime editor components comprise a prime editing guide RNA (PEgRNA), and optionally a nick guide RNA (ngRNA).

[0368] Embodiment 57. The method of Embodiment 54 or 55, wherein the prime editor components comprise a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA.

[0369] Embodiment 58. The method of Embodiment 53, wherein the one or more components of a prime editing system comprises a construct encoding a prime editor fusion protein or an mRNA encoding a prime editor fusion protein.

[0370] Embodiment 59. The method of Embodiment 53, wherein the one or more components of a prime editing system comprises one or more constructs encoding one or more of a prime editor fusion protein, PEgRNA, ngRNA, or a PEgRNA pair.

[0371] Embodiment 60. The method of Embodiment 53, wherein the one or more components of a prime editing system comprises a prime editor fusion protein, a PEgRNA, a ngRNA, or a PEgRNA pair.

[0372] Embodiment 61. The LNP composition of any one of Embodiments 46-50, wherein the LNP composition is formulated to deliver the at least one polynucleotide or one or more components of the prime editing system to target cells.

[0373] Embodiment 62. The method of any one of Embodiments 53-60 or the LNP composition of Embodiment 61, wherein the target cells are or comprise human cells, mammalian cells, liver cells, bone marrow cells, lung cells, eye cells, muscle cells, or cells in the central nervous system.

[0374] It is to be understood that while the disclosure has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the disclosure, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A cyclic pepti de-lipid conjugate comprising: a cyclic peptide comprising 4 to 30 amino acid residues. wherein 1, 2, or 3 amino acid residues comprise a positive charge; and at least one lipid component conjugated to the cyclic peptide, wherein the at least one lipid component is connected to at least one amino acid residue side chain, wherein each lipid component comprises a lipid linker and a lipid chain, wherein the lipid linker comprises a biodegradable group and the lipid chain comprises a branched or unbranched, substituted or unsubstituted, cyclic or acyclic aliphatic group.

2. The cyclic peptide-lipid conjugate of claim 1. wherein the cyclic peptide comprises 5- 10 or 5-7 amino acid residues.

3. The cyclic peptide-lipid conjugate of claim 1 or 2, wherein the cyclic peptide comprises naturally occurring amino acid residues, non-naturally occurring amino acid residues, derivatives, or combinations thereof.

4. The cyclic peptide-lipid conjugate of any one of claims 1-3, wherein the amino acid residues that compnse a positive charge comprise arginine, lysine, histidine, or derivatives thereof.

5. The cyclic peptide-lipid conjugate of any one of claims 1-4, wherein the at least one amino acid residue side chain that connects to the lipid component comprises a serine-, cysteine-, aspartic acid-, or glutamate-side chains, or derivatives thereof.

6. The cyclic peptide-lipid conjugate of any one of claims 1-5, wherein the biodegradable group of the lipid linker comprises an ether, ester, thioether, thioester, disulfide, amide, carbamate bond, or combinations thereof.

7. The cyclic peptide-lipid conjugate of any one of claims 1-6, wherein the lipid chain comprises a branched or unbranched, substituted or unsubstituted C1-C20 alkyd; a branched orunbranched, substituted or unsubstituted C2-C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl.

8. The cyclic peptide-lipid conjugate of claim 7. wherein the lipid chain comprises a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl.

9. The cyclic pepti de-lipid conjugate of claim 8, wherein at least one double bond in theC2-C20 alkenyl is in a cis configuration.

10. A compound of Formula I or Formula II:Formula I Formula II wherein each a is independently 0-15; each b is independently 0-15; each R1is independently an amino acid side chain, or isomers or derivatives thereof; each L is independently a serine-, cysteine-, aspartic acid- or glutamic acid-side chain; each R2is independently a branched or unbranched, substituted or unsubstituted Ci- C20 alkyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkenyl; a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ester-containing C1-C20 alky l, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted ether-containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide- containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched,substituted or unsubstituted disulfide-, ester-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted sulfanyl-, ester- containing C1-C20 alky l, C2-C20 alkenyl, or C2-C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide-containing C1-C20 alkyl, C2-C20 alkenyl, or C2- C20 alkynyl; a branched or unbranched, substituted or unsubstituted disulfide-, amide- containing C1-C20 alkyl, C2-C20 alkenyl, or C2-C20 alkynyl; or a branched or unbranched, substituted or unsubstituted carbamoyl-containing C1-C20 alkyd, C2-C20 alkenyl, or C2-C20 alkynyl, orwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach e is independently 0-10; each f is independently 0 or 1; each g is independently 0 or 1 ; each h is independently 0 or 1 ; and each R3is independently H, a branched or unbranched, substituted or unsubstituted C1-C20 alkyd; a branched or unbranched, substituted or unsubstituted C2- C20 alkenyl; or a branched or unbranched, substituted or unsubstituted C2-C20 alkynyl, provided that the compound of Formula I or Formula II comprises at least one and no more than three atoms with a positive charge, wherein the one to three positive charges are present in R1and / or R2.

11. The compound of claim 10, wherein the compound of Formula I is a compound of Formulas I-A-l to I-A-4:

12. The compound of claim 10, wherein the compound of Formula II is a compound ofFormulas II-A-1 to II-A-4:

13. The compound of claim 10, wherein the compound of Formula I is a compound ofFormulas I-B-l to I-B-4:Formula I-B-3; or14. The compound of claim 10, wherein the compound of Formula II is a compound ofFormulas II-B-1 to II-B-4:

15. The compound of claim 10, wherein the compound of Formula I is a compound ofFormulas 1-C-l to I-C-4:Formula I-C-l; Formula I-C-2;16. The compound of claim 10, wherein the compound of Formula II is a compound ofFormulas II-C-1 to II-C-4:

17. The compound of claim 10, wherein a is 0 and b is 1.

18. The compound of claim 10, wherein a is 1 and b is 1.

19. The compound of claim 10, wherein a is 1 and b is 2.

20. The compound of any one of claims 10-19, wherein at least one R1is a lysine-side chain.

21. The compound of any one of claims 10-19, wherein at least one R1is an arginine-side chain.

22. The compound of any one of claims 10-21, wherein each L is a serine-side chain.

23. The compound of claim 22, wherein each R2is24. The compound of claim 23, wherein each X is -C(O)-; each c is independently 2;each Y is independently absent; each Z is independently I ; and each e, f, g, and h is independently 0.

25. The compound of claim 23, wherein each X is -C(O)-; each c is independently 3;each Y is independently -C(O)O-; each Z is independently I ; each e, f. g, and h is independently 0.

26. The compound of claim 23, wherein each X is -C(O)-; each c is independently 0;each Y is independently absent; each Z is independently I ; and each e, f, g, and h is independently 0.

27. The compound of any one of claims 10-21, wherein each L is a cysteine-side chain.

28. The compound of claim 27, wherein each R2is29. The compound of claim 28, wherein each X is -S-; each c is independently 3; each Yis independently -C(O)O-; each Z is independently I ; and each e, f, g, and h is independently 0.

30. The compound of any one of claims 23-30, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

31. A compound of Formula I- A- 1:Formula I-A-l; wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof; eachwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-, or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C1-C20 alkyl.

32. The compound of claim 31, wherein one or two R1is a lysine-side chain.

33. The compound of claim 31, wherein one or two R1is an arginine-side chain.

34. The compound of claim 31 or 32, wherein the remaining R1is a leucine-side chain.

35. The compound of any one of claims 32-34, wherein each X is -C(O)-; each c isindependently 2; each Y is independently absent; and each Z is independently I36. The compound of any one of claims 32-34, wherein each X is -C(O)-; each c isindependently 3; each Y is independently -C(O)O-; and each Z is independently I37. The compound of any one of claims 32-34, wherein each X is -C(O)-; each c isindependently 0; each Y is independently absent; and each Z is independently I38. The compound of any one of claims 32-37, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

39. A compound of Formula I-A-2:Formula I-A-2; wherein each R1is independently an amino acid side chain, or isomers or derivatives thereof; eachwherein each X is independently absent, -CH2-, -S-, or -C(O)-; each c is independently 0-10; each Y is independently absent, -C(O)O-. or -OC(O)-; each Z is independentlyeach R3is independently H, or a branched or unbranched, substituted or unsubstituted C1-C20 alkyd.

40. The compound of claim 39, wherein each R1is a lysine- or an arginine-side chain.

41. The compound of claim 39 or 40, wherein each X is -S-; each c is independently 3;each Y is independently -C(O)O-; and each Z is independently I42. The compound of any one of claims 39-41, wherein each R3is independently an unbranched, unsubstituted C1-C20 alkyl.

43. A compound selected from the group consisting of:

44. A pharmaceutically acceptable salt of a cyclic peptide-lipid conjugate of any one of claims 1-9 or a compound of any one of claims 10-43.

45. A lipid nanoparticle (LNP) composition comprising a cyclic peptide-lipid conjugate of any one of claims 1-9 or a compound of any one of claims 10-43.

46. A lipid nanoparticle (LNP) composition comprising: a cyclic peptide-lipid conjugate of any one of claims 1-9 or a compound of any one of claims 10-43; and at least one of: a cationic lipid: a phospholipid; a PEG-containing lipid; or a sterol.

47. The LNP composition of claim 46. further comprising a prime editor comprising a DNA binding domain and a DNA polymerase domain, or one or more polynucleotides encoding the prime editor.

48. The LNP composition of claim 46 or 47. further comprising a prime editing guide RNA (PEgRNA) or a polynucleotide encoding the PEgRNA.

49. The LNP composition of any one of claims 46-48. further comprising a nick guide RNA (ngRNA) or a polynucleotide encoding the ngRNA.

50. The LNP composition of any one of claims 46-49. further comprising a second PEgRNA or a polynucleotide encoding the second PEgRNA.

51. A pharmaceutical composition comprising the LNP composition of any one of claims 46-50.

52. A method for delivering polynucleotides into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic pepti de-lipid conjugate of any one of claims 1-9 or a compound of any one of claims 10-43; and (2) one or more polynucleotides.

53. A method for delivering a prime editing system into a cell comprising: introducing into the cell at least one lipid nanoparticle comprising (1) a cyclic pepti de-lipid conjugate of any one of claims 1-9 or a compound of any one of claims 10-43; and (2) one or more components of a prime editing system.

54. The method of claim 53, wherein the one or more components of a prime editing system comprises a construct encoding prime editor components.

55. The method of claim 53, wherein the one or more components of a prime editing system comprises an mRNA encoding prime editor components.

56. The method of claim 54 or 55, wherein the prime editor components comprise a prime editing guide RNA (PEgRNA), and optionally a nick guide RNA (ngRNA).

57. The method of claim 54 or 55. wherein the prime editor components comprise a PEgRNA pair, wherein the PEgRNA comprises a first PEgRNA and / or a second PEgRNA.

58. The method of claim 53, wherein the one or more components of a prime editing system comprises a construct encoding a prime editor fusion protein or an mRNA encoding a prime editor fusion protein.

59. The method of claim 53, wherein the one or more components of a prime editing system comprises one or more constructs encoding one or more of a prime editor fusion protein, PEgRNA, ngRNA, or a PEgRNA pair.

60. The method of claim 53, wherein the one or more components of a prime editing system comprises a prime editor fusion protein, a PEgRNA, a ngRNA, or a PEgRNA pair.

61. The LNP composition of any one of claims 46-50, wherein the LNP composition is formulated to deliver the at least one polynucleotide or one or more components of the prime editing system to target cells.

62. The method of any one of claims 53-60 or the LNP composition of claim 61, wherein the target cells are or comprise human cells, mammalian cells, liver cells, bone marrow cells, lung cells, eye cells, muscle cells, or cells in the central nervous system.

Images