Tomato plant resistant to viruses of genus tobamovirus, tomato plant cells, and method for producing same

Abstract

The present invention addresses the problem of providing: a Tobamovirus genus virus-resistant tomato that has a property of inhibiting infection of viruses belonging to the genus Tobamovirus, a property of suppressing proliferation of viruses belonging to the genus Tobamovirus after being infected, and / or a property of suppressing onset of symptoms caused by infection of viruses belonging to the genus Tobamovirus; tomato cells; and a method for producing the same. The problem is solved by providing a tomato which has a mutation in at least one gene selected from the group consisting of receptor-like kinase (RLK) genes and homologous genes thereof, and in which, by having said mutation, expression of the mutated gene is suppressed or a protein encoded by the mutated gene is not functional with respect to viruses belonging to the genus Tobamovirus and which is thereby resistant to viruses belonging to the genus Tobamovirus.

Description

Tomato plants and tomato plant cells resistant to tobamoviruses and method for producing the same

[0001] The present invention relates to tomato plants and tomato plant cells that are resistant to viruses of the genus Tobamovirus, and methods for producing the same.

[0002] According to the Food and Agriculture Organization of the United Nations (FAOSTAT) 2018 database and other sources, tomatoes are the second most widely produced horticultural vegetable crop in the world after potatoes, with annual production exceeding 180 million tons, accounting for more than 10% of all vegetable production. However, like other vegetable crops, tomatoes during cultivation are susceptible to infection with various pathogens such as bacteria and viruses, which can often cause significant damage.

[0003] One type of virus that infects tomatoes is the Tobamovirus genus, which has single-stranded RNA (i.e., Tobamovirus viruses). Tobamovirus viruses are a collective term for the Tobacco Mosaic Virus (TMV), which was the first virus discovered in the world. These viruses are highly resistant to inactivation, stable, and highly infectious.

[0004] There are currently no direct and effective antiviral agents against plant viruses. Conventional methods for controlling plant viruses include spraying insecticides on vector insects, using insect nets to physically prevent insect intrusion, and breeding for virus resistance, for insect-borne viruses. For contact- and seed-transmitted tobamoviruses, disinfection of soil and cultivation equipment, seed disinfection, and breeding for resistance are the main methods.

[0005] Among the viruses of the genus Tobamovirus, Tomato brown rugose fruit virus (ToBRFV) is one of the emerging viruses that suddenly appeared in recent years and has been rapidly spreading worldwide (Non-Patent Document 1). Currently, its outbreaks are mainly conspicuous in tomatoes and peppers.

[0006] ToBRFV was first discovered in Israel in the Middle East in 2014, but in the following years, outbreaks have been found in Europe, including Jordan, Italy, Germany, and Turkey, as well as across the ocean in the United States, Canada, and China. The source of the outbreak is likely the Middle East, and because it is a highly contagious virus, trace amounts can adhere to or remain on seeds and other materials, potentially becoming a source of infection, leading to its rapid spread around the world. ToBRFV has yet to be discovered in Japan, and the Ministry of Agriculture, Forestry and Fisheries and the Plant Protection Station have designated it as a critical virus in their "Pest Risk Analysis for Quarantine Pests," implementing border control measures to prevent its introduction and issuing maximum warnings. However, it is highly likely that it will invade Japan in the near future.

[0007] Tomato disease caused by ToBRFV is similar to symptoms of previous tobamoviruses, exhibiting mosaic, silky leaves, yellowing, and necrotic stems, as well as discoloration, necrosis, and ring spots on the fruit. However, ToBRFV is characterized by weaker leaf mosaic symptoms, while the fruit necrotic symptoms are more severe than those of other tobamoviruses. Tobamoviruses are primarily transmitted through contaminated seeds, mechanical contact (conventional agricultural practices), or contaminated soil, water, and equipment (Non-Patent Documents 2 and 3).

[0008] In tomatoes, the tobamovirus resistance genes Tm-2 and Tm-2a (also known as Tm-2) have long been used in breeding. ２ ) is known to be overcome by ToBRFV, and the use of varieties with Tm-2a and the like is in jeopardy (Non-Patent Document 4).

[0009] Given this situation, attempts have been made to develop new resistance genes. However, so far, there have been many cases where there are multiple genes or loci associated with resistance, the effects are insufficient, or there are many conditions that make it difficult to use them for breeding (Non-Patent Document 5), and there are still few definitively good resistance gene candidates.

[0010] Another example is the report in Non-Patent Document 6. This document describes how resistance can be achieved in plants by introducing four gene mutations through gene editing, which involves a large number of related genes. As of 2022, no ToBRFV-resistant varieties have yet been released on the market.

[0011] Meanwhile, Non-Patent Document 7, published in 2021, reported that the BAM gene, a tomato receptor-like kinase, interacts with the TMV movement protein (MP), suggesting that tobamoviruses may use the BAM gene for infection or for movement within plants after infection.

[0012] Salem, et al. “A new tobamovirus infecting tomato crops in Jordan,” Arch. Viol., 2015Creager, et al., “Tobacco Mosaic Virus: Pioneering Research for a Century,” The Plant Cell, March 1999, 301-308Zhang, et al., “Tomato brown rugose fruit virus: An emerging and rapidly spreading plant RNA virus that threatens tomato production worldwide,” Mol. Plant Pathol. 2022; 23:1262-1277Luria, et al., “A New Israeli Tobamovirus Isolate Infects Tomato Plants Harboring Tm-22Resistance Genes,” PLoS ONE 2017, 12(1)Zinger et al., “Identification and Mapping of Tomato Genome Loci Controlling Tolerance and Resistance to Tomato Brown Rugose Fruit Virus,” Plants 2021, 10, 179Ishikawa, et al. “Tomato brown rugose fruit virus resistance generated by quadruple knockout of homologs of TOBAMOVIRUS MULTIPLICATION1 in tomato,” Plant Physiology, 2022: 00:1-8Tran, “Receptor-like kinase BAM1 facilitates early movement of the Tobacco mosaic virus,” Communications Biology, 2021, 4:511

[0013] Currently, only a few resistance gene candidates have been found for controlling infection with tobamovirus viruses, particularly ToBRFV, which has suddenly emerged in recent years. The present inventors have discovered a new resistance gene that is effective in controlling tomato diseases caused by tobamovirus viruses, and have developed a plant variety carrying this gene, thereby providing a method for controlling tobamovirus viruses and a tobamovirus-resistant plant.

[0014] The present invention provides the following tomatoes (i.e., tomato plants), parts thereof, and processed products thereof. [1] A tomato plant having a mutation in at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto, wherein the mutation suppresses expression of the mutated gene or renders the protein encoded by the mutated gene nonfunctional against Tobamovirus viruses, thereby conferring resistance to Tobamovirus viruses. [2] The tomato plant according to [1], wherein the mutation has been introduced into a gene in the genome by genome editing technology. [3] The tomato plant according to [2], wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or discontinuous deletion of 3n bases (n = 1 to 5), and (d) an insertion or substitution of 1 to 10 bases. [4] The tomato according to any one of [1] to [3], wherein the receptor-like kinase RLK gene is the RLK1 gene (Solyc02g091840), the cDNA sequence of which comprises the nucleotide sequence shown in SEQ ID NO: 1, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK1 gene, the cDNA sequence of which comprises a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 1. [5] The tomato according to [4], wherein the RLK1 gene or its homologous gene has a mutation in a region corresponding to the nucleotide sequence shown in SEQ ID NO: 3. [6] The tomato according to [5], wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 has been mutated to a nucleotide sequence shown in one of SEQ ID NOs: 4 to 7. [7] The tomato according to any one of [1] to [3], wherein the receptor-like kinase RLK gene is the RLK2 gene (Solyc03g043770), the cDNA sequence of which comprises the base sequence shown in SEQ ID NO: 16, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK2 gene, the cDNA sequence of which comprises a base sequence having 85% or more sequence identity to the base sequence shown in SEQ ID NO: 16.[8] The tomato according to [7], which has a mutation in a region corresponding to the nucleotide sequence shown in SEQ ID NO: 18 in the RLK2 gene or a gene homologous thereto. [9] The tomato according to [8], wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 18 has been mutated to a nucleotide sequence shown in one of SEQ ID NOs: 19 to 24.

[10] The tomato according to any one of [1] to [9], wherein the Tobamovirus is at least one virus selected from the group consisting of Tomato brown rugose fruit virus (ToBRFV), Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), and Tomato mottle mosaic virus (ToMMV).

[11] The part of the tomato according to any one of [1] to

[10] .

[12] The part of the tomato according to

[11] , which is a fruit.

[13] The tomato part according to

[11] , which is a seed.

[14] A processed product of the tomato part according to any one of

[11] to

[13] .

[15] The processed product according to

[14] , which is edible.

[0015] The present invention also provides the following tomato cells, and tomato plants and parts thereof comprising the same.

[16] A tomato cell having resistance to Tobamovirus viruses, wherein at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto has a mutation, and the mutation suppresses expression of the mutated gene, or the protein encoded by the mutated gene is non-functional against Tobamovirus viruses.

[17] The tomato cell according to

[16] , wherein the mutation has been introduced into a gene in the genome by genome editing technology.

[18] The tomato cell according to

[17] , wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or discontinuous deletion of 3n bases (n = 1 to 5), and (d) an insertion or substitution of 1 to 10 bases.

[19] The tomato cell according to any one of

[16] to

[18] , wherein the receptor-like kinase RLK gene is the RLK1 gene (Solyc02g091840), the cDNA sequence of which comprises the nucleotide sequence shown in SEQ ID NO: 1, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK1 gene, the cDNA sequence of which comprises a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 1.

[20] The tomato cell according to

[19] , which has a mutation in a region of the RLK1 gene or a homologous gene thereof corresponding to the nucleotide sequence shown in SEQ ID NO: 3.

[21] The tomato cell according to

[20] , wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 3 has been mutated to a nucleotide sequence shown in one of SEQ ID NOs: 4 to 7.

[22] The tomato cell according to any one of

[16] to

[18] , wherein the receptor-like kinase RLK gene is the RLK2 gene (Solyc03g043770), the cDNA sequence of which comprises the base sequence shown in SEQ ID NO: 16, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK2 gene, the cDNA sequence of which comprises a base sequence having 85% or more sequence identity to the base sequence shown in SEQ ID NO: 16.

[23] The tomato cell according to

[22] , which has a mutation in a region in the RLK2 gene or a gene homologous thereto, which corresponds to the nucleotide sequence shown in SEQ ID NO: 18.

[24] The tomato cell according to

[23] , wherein the region corresponding to the nucleotide sequence shown in SEQ ID NO: 18 has a mutation in a nucleotide sequence shown in one of SEQ ID NOs: 19 to 24.

[25] The tomato cell according to any one of

[16] to

[24] , wherein the virus of the genus Tobamovirus is at least one selected from the group consisting of Tomato brown rugose fruit virus (ToBRFV), tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV).

[26] A tomato or part thereof, which has the tomato cell according to any one of

[16] to

[25] and is resistant to Tobamovirus.

[27] The tomato part according to

[26] , which is a fruit.

[28] The tomato part according to

[26] , which is a seed.

[29] A processed product of the tomato part according to any one of

[26] to

[28] .

[30] The processed product according to

[29] , which is edible.

[0016] The present invention also provides the following methods for producing tomatoes, and tomato plants obtained by the methods.

[31] A method for producing tomatoes resistant to tobamovirus viruses, comprising the steps of selecting at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto, introducing into the selected gene in the tomato genome a mutation that suppresses expression of the selected gene or a mutation that renders the protein encoded by the selected gene nonfunctional against Tobamovirus viruses, and selecting tomatoes that are resistant to Tobamovirus viruses.

[32] The method for producing tomatoes resistant to tobamovirus viruses according to

[31] , wherein the mutation is introduced into a gene in the genome by genome editing technology.

[33] The method for producing tomatoes resistant to tobamovirus viruses according to

[31] or

[32] , wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or discontinuous deletion of 3n bases (n = 1 to 5), and (d) an insertion or substitution of 1 to 10 bases.

[34] The method for producing a tobamovirus-resistant tomato plant according to any one of

[31] to

[33] , wherein the receptor-like kinase RLK gene is the RLK1 gene (Solyc02g091840), the cDNA sequence of which comprises the nucleotide sequence shown in SEQ ID NO: 1, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK1 gene, the cDNA sequence of which comprises a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 1.

[35] The method for producing a tobamovirus-resistant tomato plant according to

[34] , wherein a mutation is introduced into a region of the RLK1 gene or its homologous gene corresponding to the nucleotide sequence shown in SEQ ID NO: 3.

[36] The method for producing a tomato plant resistant to a Tobamovirus virus according to

[35] , wherein a mutation is introduced into a region corresponding to the base sequence shown in SEQ ID NO: 3 so that the region corresponds to a base sequence shown in one of SEQ ID NOs: 4 to 7.

[37] The method for producing a tobamovirus-resistant tomato plant according to any one of

[31] to

[33] , wherein the receptor-like kinase RLK gene is the RLK2 gene (Solyc03g043770), the cDNA sequence of which comprises the nucleotide sequence shown in SEQ ID NO: 16, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK2 gene, the cDNA sequence of which comprises a nucleotide sequence having 85% or more sequence identity to the nucleotide sequence shown in SEQ ID NO: 16.

[38] The method for producing a tobamovirus-resistant tomato plant according to

[37] , wherein a mutation is introduced into a region of the RLK2 gene or a homologous gene thereof, which corresponds to the nucleotide sequence shown in SEQ ID NO: 18.

[39] The method for producing a tobamovirus-resistant tomato plant according to

[38] , wherein a mutation is introduced into the region corresponding to the nucleotide sequence shown in SEQ ID NO: 18 so that it has a nucleotide sequence shown in one of SEQ ID NOs: 19 to 24.

[40] The method for producing a tobamovirus-resistant tomato plant according to any one of

[31] to

[39] , wherein the tobamovirus is at least one selected from the group consisting of tomato brown rugose fruit virus (ToBRFV), tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV).

[41] A tobamovirus-resistant tomato plant obtained by the method according to any one of

[31] to

[40] .

[0017] The present invention further provides the following methods for producing tomato breeding progeny and tomato plants obtained by the production methods:

[42] A method for producing a breeding progeny of a Tobamovirus virus-resistant tomato, comprising a step of self-pollinating or cross-pollinating a Tobamovirus virus-resistant tomato or its progeny obtained by the production method according to any one of

[31] to

[40] .

[43] A Tobamovirus virus-resistant tomato obtained by the production method according to

[42] .

[0018] According to the present invention, there are provided a tomato plant, a tomato cell, and a method for producing a tomato plant resistant to Tobamovirus viruses, which have the property of inhibiting infection with Tobamovirus viruses, the property of suppressing the proliferation and movement of Tobamovirus viruses after infection, and / or the property of suppressing the manifestation of Tobamovirus virus infection symptoms.

[0019] Figure 1 shows the cDNA sequence of the tomato receptor-like kinase RLK1 gene (Solyc02g091840), with the underlined portion representing exon 1, the wavy underlined portion representing the guide RNA recognition portion within exon 1 (bases 790 to 809 of exon 1), and the boxed portion representing the PAM sequence. Figure 2 shows the cDNA sequence of the tomato receptor-like kinase RLK2 gene (Solyc03g043770), with the underlined portion representing exon 1, the wavy underlined portion representing the guide RNA recognition portion within exon 1 (bases 277 to 296 of exon 1), and the boxed portion representing the PAM sequence. Figure 3 is an electrophoresis photograph showing the results of RT-PCR analysis of the ToBRFV inoculation test. Figure 4 is a diagram showing the mutation pattern in the tomato receptor-like kinase RLK1 gene, where the wavy underlined portion in the wild-type sequence corresponds to the guide RNA recognition site in exon 1, with a - symbol representing a base deletion, a box representing a base insertion, and an underline representing a base substitution. Figure 5 is a diagram showing the mutation pattern in the tomato receptor-like kinase RLK2 gene, where the wavy underlined portion in the wild-type sequence corresponds to the guide RNA recognition site in exon 1, with a - symbol representing a base deletion.

[0020] The present inventors conducted extensive research to solve the above-mentioned problems and concluded that loss of function of the tomato receptor-like ligase RLK gene and its homologous genes may affect the infection and proliferation of TMV and its related tobamovirus viruses. Therefore, they created tomato plants in which alleles of the RLK1 gene (Solyc02g091840) and RLK2 gene (Solyc03g043770) were mutated to homozygous forms, inoculated them with ToBRFV, and examined the presence or absence of virus resistance. As a result, they found that when tomato plants contain a mutation in the receptor-like ligase RLK gene or its homologous gene, and the expression of the mutated gene is suppressed by the mutation or the protein encoded by the mutated gene is nonfunctional against tobamovirus viruses that infect tomatoes, the infection rate of tobamovirus viruses is reduced, and tomato plants are resistant to the viruses. This is the first report of a tomato plant resistant to Tobamoviruses that has a mutated receptor-like ligase RLK gene.

[0021] Hereinafter, a mode for carrying out the present invention (hereinafter also referred to as "the present embodiment") will be described in detail. Note that the present invention is not limited to the following embodiment and drawings, and various modifications can be made within the scope of the gist thereof.

[0022] [I] Virus-Resistant Tomato In one aspect, the present embodiment relates to a tomato that is resistant to a Tobamovirus virus. In this embodiment, the virus-resistant tomato is, for example, a tomato that has the property of inhibiting infection by a Tobamovirus virus, the property of suppressing the proliferation and movement of the virus even if infected, and / or the property of suppressing the manifestation of infection symptoms of the virus. The virus-resistant tomato is preferably a tomato that has the property of inhibiting infection by the virus or the property of suppressing the proliferation and movement of the virus even if infected.

[0023] In this embodiment, "tobamovirus" is a generic term for viruses that have single-stranded RNA and are related to the tobacco mosaic virus (TMV), which was the first virus discovered in the world. Tobamovirus viruses are known to be highly resistant to inactivation, stable, and highly infectious, causing leaf mosaic, silky leaves, yellowing, stem necrosis, and fruit discoloration, necrosis, ring spots, and other symptoms in infected plants.

[0024] In the present invention, the tobamovirus genus viruses targeted for infection and control are not particularly limited as long as they are tobamovirus genus viruses that infect tomatoes, and specific examples include tomato brown rugose fruit virus (ToBRFV), tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV). In the following description, "tobamovirus genus viruses" may also be abbreviated as "tobamovirus."

[0025] In this embodiment, tomato refers to Solanum lycopersicum, and refers to the entire plant, not just the fruit.

[0026] In one aspect, the tobamovirus-resistant tomato of the present embodiment has a mutation in at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto.

[0027] The RLK gene is a tomato gene that encodes a "Receptor-Like Kinase," i.e., a receptor-like kinase. In Arabidopsis, RLK is called BAM1 (Barley Any Meristem 1) and encodes a CLAVATA1-related receptor-like kinase protein that is necessary for shoot and floral meristem function, involved in leaf and gametogenesis. Furthermore, the existence of BAM2, which is highly homologous to Arabidopsis BAM1, has been recognized, and recent research has revealed the existence of highly homologous homologs in tomato as well. Such homologs include the tomato "RLK1 gene" (Solyc02g091840, on chromosome 2) and the "RLK2 gene" (Solyc03g043770, on chromosome 3). In the present invention, as described below, genetic mutations effective for controlling tobamoviruses have been discovered in each of the tomato RLK1 gene and RLK2 gene. Therefore, the term "RLK gene" refers collectively to the "RLK1 gene" (Solyc02g091840) or the "RLK2 gene" (Solyc03g043770), or both, and the individual genes will be referred to as the "RLK1 gene" or the "RLK2 gene."

[0028] In this embodiment, it should be understood that the term "homologous genes of the RLK gene" can include both "homologous genes of the RLK1 gene" and "homologous genes of the RLK2 gene" described below.

[0029] In this embodiment, the "RLK1 gene" preferably has a cDNA sequence that includes or consists of the base sequence shown in SEQ ID NO:1.

[0030] In this embodiment, a "homologous gene of the RLK1 gene" preferably has a cDNA sequence that includes a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 1, or consists of a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 1. In the present invention, "sequence homology" means sequence identity. There is no particular limitation on the homology to the nucleotide sequence of SEQ ID NO: 1, but it is preferably 85% or more and less than 100%. The lower limit of homology may be any value as long as it is 85% or more, such as 87% or more, 90% or more, 93% or more, 95% or more, 97% or more, 99% or more, or 99.5% or more.

[0031] In this embodiment, the "RLK2 gene" preferably has a cDNA sequence that includes or consists of the base sequence shown in SEQ ID NO:16.

[0032] In this embodiment, a "homologous gene of the RLK2 gene" preferably has a cDNA sequence that includes a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 16, or consists of a nucleotide sequence having sequence homology to the nucleotide sequence shown in SEQ ID NO: 16. In the present invention, "sequence homology" means sequence identity. There are no particular limitations on the homology to the nucleotide sequence of SEQ ID NO: 16, but it is preferably 85% or more and less than 100%. The lower limit of homology may be any value as long as it is 85% or more, such as 87% or more, 90% or more, 93% or more, 95% or more, 97% or more, 99% or more, or 99.5% or more.

[0033] The homology (i.e., identity) between a specific nucleotide sequence and the cDNA sequence of a homologous gene can be determined by a known method, for example, by using a known homology search program such as BLAST.

[0034] (Tobamovirus Resistance Gene) In this embodiment, the tomato plant has a mutation in at least one gene selected from the group consisting of the RLK gene or its homologous genes (hereinafter, a gene having a mutation is also referred to as a "virus resistance gene" or "tobamovirus resistance gene"). The mutation suppresses expression of the mutated gene or makes a protein encoded by the mutated gene or a gene related to it non-functional against tobamoviruses. A protein that is non-functional against the virus refers to a protein that cannot be used by the virus when it infects, multiplies, and moves in plants, or that reduces infection and proliferation of the virus. In one aspect, the tobamovirus resistance gene may be mutated so that it does not encode a protein.

[0035] Without being bound by theory, it is believed that when tobamoviruses infect tomatoes, they interact with a specific RLK among multiple RLK isoforms present in tomatoes. At this time, a gene encoding the specific isoform used by tobamoviruses (i.e., an RLK functional against tobamoviruses) mutates, preventing the production of the specific RLK protein used by tobamoviruses. Alternatively, if the RLK protein produced is nonfunctional for tobamoviruses, translation of proteins encoded on the viral genome and necessary for infection and proliferation is inhibited. Alternatively, it is believed that tomato acquires resistance to tobamoviruses because tobamovirus proteins that require interaction with RLK are no longer able to function, inhibiting tobamovirus infection and proliferation.

[0036] On the other hand, even if one of the multiple RLK homologs present in tomato mutates, the tomato itself can utilize other homologs, or the tomato itself can utilize a non-functional RLK protein against tobamoviruses, so it is thought that it is possible to confer tobamovirus resistance without affecting the growth of the host tomato.

[0037] As described above, tomatoes carrying a tobamovirus resistance gene acquire tobamovirus resistance. For example, a plant can be determined to have "tobamovirus resistance" if the amount of tobamovirus accumulated in the plant is the same as or lower than that of a non-tobamovirus-inoculated strain even 18 days or more after tobamovirus inoculation, and / or if no tobamovirus infection symptoms are visually observed. Specifically, the tobamovirus resistance of a plant can be determined by infecting the plant with a tobamovirus using a conventional method and confirming the accumulation of tobamovirus in the plant using known techniques such as ELISA or PCR. Furthermore, the tobamovirus resistance of a tomato can also be determined by confirming the presence or absence of tobamovirus infection symptoms (e.g., leaf mosaic, silky leaves, yellowing, stem necrosis, and fruit discoloration, necrosis, and ring spots) in the tobamovirus-infected plant. Due to quarantine issues, it is extremely difficult to bring ToBRFV or virus-infected leaves into Japan, making it difficult to conduct tests using ToBRFV itself. However, many tobamoviruses can infect plants not only in the form of virus particles but also with their genomic RNA alone, and as described in Non-Patent Document 6, it is also possible to test for ToBRFV resistance by using a synthetic infectious RNA equivalent to the ToBRFV genomic RNA (e.g., SEQ ID NO: 45) instead of the virus.

[0038] As long as the tomato has the above-mentioned tobamovirus resistance, the genetic mutation may be present in at least one gene selected from the group consisting of the RLK1 gene and its homologous genes, and the RLK2 gene and its homologous genes.

[0039] Furthermore, when the tobamovirus-resistant tomato of this embodiment has a mutation in the RLK1 gene, it may have mutations in all of the genes encoding RLK1 proteins functional against tobamovirus. For example, in the case of a polyploid plant such as an amphidiploid, it is preferable that all of the multiple genes encoding RLK1 proteins functional against tobamovirus are mutated into tobamovirus resistance genes. Such tobamovirus-resistant tomato may have another normal RLK1 gene, as long as the gene encoding the RLK1 protein functional against tobamovirus is mutated. Alternatively, it may be a tomato in which all endogenous genes encoding RLK1 proteins functional against tobamovirus have been deleted, destroyed, or otherwise rendered nonfunctional, and an exogenous RLK1 gene has been introduced instead.

[0040] The same applies to tobamovirus-resistant tomatoes with a mutation in the RLK2 gene. That is, as long as the gene encoding any protein functional against tobamovirus according to the present invention is mutated, the tobamovirus-resistant tomato may also have other normal genes. Alternatively, the tobamovirus-resistant tomato may have all of its endogenous genes encoding any RLK2 protein functional against tobamoviruses deleted, disrupted, or otherwise rendered nonfunctional, and instead, an exogenous homologous gene introduced.

[0041] In one aspect, the tobamovirus-resistant tomato of this embodiment has a mutation in a gene in its genome. The gene mutation is not particularly limited as long as it confers virus resistance.

[0042] Specific examples of mutations in the RLK gene (RLK1 gene and / or RLK2 gene) and its homologous genes include the following (a) to (d): (a) frameshift mutation, (b) nonsense mutation, (c) deletion of 3n consecutive or non-consecutive bases (n = 1 to 5), and (d) insertion or substitution of 1 to 10 bases.

[0043] (a) Frameshift mutations are mutations that result in the deletion or insertion of bases, shifting the reading frame of a codon and resulting in the encoding of a different amino acid sequence. The change in the encoded amino acid sequence makes the mutant gene a tobamovirus resistance gene.

[0044] (b) Nonsense mutations are mutations that change a codon that originally encoded an amino acid into a stop codon, resulting in a tobamovirus resistance gene.

[0045] (c) The deletion of 3n consecutive or non-consecutive bases (n = 1 to 5) alters the amino acid sequence encoded by the base sequence downstream from the deletion region, resulting in a tobamovirus resistance gene.

[0046] (d) The insertion or substitution of 1 to 10 bases changes the reading frame of the amino acid sequence encoded by the base sequence downstream of the mutation region. The change in reading frame alters the originally encoded amino acid sequence, resulting in a change in protein structure, etc., resulting in a tobamovirus resistance gene. In one aspect, this mutation is preferably a mutation in a base other than the third base of the codon. The number of bases to be inserted or substituted is not particularly limited as long as a tobamovirus resistance gene is obtained, but can be, for example, 1 to 5, 1 to 3, or 1 to 2.

[0047] The mutation in the tobamovirus resistance gene is preferably at least one selected from the group consisting of (a) to (d) above. Note that the mutations (a) to (d) above are not alternatives; for example, mutations (c) and (d) may result in mutations (a) and (b).

[0048] There are no particular limitations on the mutation in the tomato genome, as long as it suppresses the expression of the mutated gene or renders the protein encoded by the gene non-functional against tobamoviruses, thereby conferring tobamovirus resistance to a plant having the mutated gene and not significantly impairing the life and growth of the plant.

[0049] Next, such mutations will be described in detail. In one aspect, when tomato has a mutation in the RLK1 gene, the mutation is preferably present in exon 1 (SEQ ID NO: 2) of the RLK1 gene, and more preferably in the region containing bases 790 to 809 of exon 1, i.e., the region containing TCTCTAGAGTACCTTGCAGT shown in SEQ ID NO: 3. When tomato has a mutation in a gene homologous to the RLK1 gene, the mutation is preferably present in a region within the homologous gene corresponding to the nucleotide sequence shown in SEQ ID NO: 2, and more preferably in a region within the homologous gene corresponding to the nucleotide sequence shown in SEQ ID NO: 3. Note that when a mutation is present in the region shown in SEQ ID NO: 3 or a corresponding region, the mutation may also be present in a portion of exon 1 other than the region.

[0050] When tomato has a mutation in exon 1 shown in SEQ ID NO: 2 or the corresponding region, the mutation is preferably a seven-base deletion, a five-base deletion, a one-base insertion, or a base substitution. Examples of such mutations include a seven-base deletion at positions 793 to 799 in exon 1, a five-base deletion at positions 793 to 797, an insertion of one base between bases 795 and 796, and a substitution at bases 806 to 808. Specifically, mutations include a five-base deletion at positions 793 to 797 (mutation C1), a seven-base deletion at positions 793 to 799 (mutation C2), an insertion of one base (adenine) between bases 795 and 796 (mutation C3), and a five-base deletion at positions 793 to 797 and a substitution at bases 806 to 808 (substitution of CAG to ACG) (mutation C4) (see Figure 4). The nucleotide sequences of the mutated regions are shown in SEQ ID NOs: 4 to 7.

[0051] In one aspect, when tomato has a mutation in the RLK2 gene, the mutation is preferably present in exon 1 (SEQ ID NO: 17) of the RLK2 gene, and more preferably present in the region containing bases 790 to 809 of exon 1, i.e., the region containing GAGGTGTCACGTGTGACCGGTATCGTCACGTGACTTCTCTC as shown in SEQ ID NO: 18. When tomato has a mutation in a gene homologous to the RLK2 gene, the mutation is preferably present in a region within the homologous gene corresponding to the base sequence shown in SEQ ID NO: 17, and more preferably present in a region within the homologous gene corresponding to the base sequence shown in SEQ ID NO: 18. Note that when a mutation is present in the region shown in SEQ ID NO: 18 or a corresponding region, the mutation may also be present in a portion of exon 1 other than the region.

[0052] When tomato has a mutation in exon 1 shown in SEQ ID NO: 2 or a region corresponding thereto, the mutation is preferably a 12-, 6-, 5-, 3-, or 1-base deletion. Specific examples of such mutations include a 12-base deletion at positions 269-280 of exon 1 (mutation P1), a 12-base deletion at positions 272-283 (mutation P2), a 6-base deletion at positions 279-285 (mutation P3), a 5-base deletion at positions 279-284 (mutation P4), a 3-base deletion at positions 279-281 (mutation P5), and a 1-base deletion at position 279 (mutation P6) (see Figure 5). The nucleotide sequences of the mutated regions are shown in SEQ ID NOs: 19-24.

[0053] The present embodiment relates to a mutant RLK1 gene itself having a mutated exon 1 set forth in any of SEQ ID NOS: 8 to 11, which are tobamovirus resistance genes, and a mutant RLK2 gene itself having a mutated exon 1 set forth in any of SEQ ID NOS: 25 to 30. Preferred such genes are a mutant RLK1 gene whose cDNA sequence includes or consists of the nucleotide sequence set forth in any of SEQ ID NOS: 12 to 15, and a mutant RLK2 gene whose cDNA sequence includes or consists of the nucleotide sequence set forth in any of SEQ ID NOS: 31 to 36. The present embodiment also relates to the use of the mutant RLK1 gene and / or mutant RLK2 gene for conferring tobamovirus resistance to tomatoes.

[0054] The mutations present in tomatoes are not limited to the above-mentioned regions, and mutations may be present in other regions of the RLK1 gene and / or the RLK2 gene, or in other genes, as long as tobamovirus resistance is not impaired.

[0055] In one aspect, the mutation in a tomato gene is preferably introduced into a gene in the genome by genome editing technology such as the CRISPR system described below.

[0056] A mutant gene in a genome may be homozygous, in which it is present in both of two alleles, or heterozygous, in which it is present in only one allele, but is preferably homozygous, because the homozygous form, in which the two alleles are characterized by the same mutant sequence, is thought to more strongly reflect the properties brought about by the mutant gene.

[0057] (Virus-Resistant Tomato and Portion thereof) The tobamovirus-resistant tomato of this embodiment may be a multiple-resistant tomato that exhibits resistance to other viruses and bacteria, as long as it exhibits resistance to Tobamovirus viruses.

[0058] In one aspect, the present embodiment relates to tomato parts that are resistant to tobamoviruses. Such parts include parts taken from the tomato plants and their progeny or clones, or derivatives obtained from the plants or parts. Specific examples of parts include organs such as fruit, shoots, stems, roots, shoots, and anthers, as well as plant tissues and cells. Such parts may be in any form, including suspension cultures, protoplasts, embryos, callus tissue, leaf segments, gametophytes, sporophytes, pollen, and microspores. Derivatives of tomatoes include seeds.

[0059] The tobamovirus-resistant tomato part of this embodiment may be a scion, rootstock, etc. used for grafting. In one aspect, this embodiment also relates to plant cells (including callus) etc. that can regenerate the above-mentioned virus-resistant tomato, and the tobamovirus-resistant tomato of this embodiment also includes plants obtained from such plant cells.

[0060] The virus-resistant part of the tomato is preferably the fruit, which is useful for eating raw or processing, or preferably the seed, which is useful for producing progeny.

[0061] (Processed product of tomato or part thereof) In one aspect, the present embodiment relates to a processed product of tomato or part thereof. The processed product is not particularly limited, and examples include processed products for edible, industrial, medical, etc., and is particularly preferably a processed product for edible use.

[0062] For example, if the virus-resistant tomato is a tomato, examples of edible processed tomato products include canned tomatoes, tomato paste, ketchup, tomato sauce, tomato soup, dried tomatoes, tomato juice, tomato powder, tomato concentrate, etc. Nutritional supplements made from tomatoes are also examples of processed products.

[0063] [II] Tomato Cells Resistant to Tobamovirus In one aspect, the present embodiment relates to tomato cells resistant to tobamovirus.

[0064] The tomato cells of this embodiment have a mutation in at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto. These genes and their mutations are as described above in relation to the tobamovirus-resistant tomatoes.

[0065] Tobamovirus resistance of tomato cells can be confirmed by the above-mentioned methods. For example, the presence or absence of virus resistance can be confirmed by infecting plant cells with a tobamovirus using a standard method and detecting the accumulation of the virus in the cells using a known method such as ELISA or PCR.

[0066] The tobamovirus-resistant tomato cells of this embodiment may be isolated from the above-mentioned tobamovirus-resistant tomato plant or its progeny or clone, or may be plant cells into which a genetic mutation has been introduced and obtained by the method for producing a tobamovirus-resistant tomato described below. Furthermore, the form of the tobamovirus-resistant tomato cells is not particularly limited, and suspension cultures and protoplasts are also included.

[0067] In one aspect, the present embodiment relates to a tomato plant or a part thereof that contains the tomato cell described above and has tobamovirus resistance. The tomato plant or part thereof includes a plant or a part such as a tissue or organ regenerated from a tomato plant cell into which a genetic mutation has been introduced. The part of the plant regenerated from the tomato plant cell also contains the tomato cell described above. Details of the part are as described above in connection with the virus-resistant tomato.

[0068] The tomato part is preferably a fruit that is useful for eating raw or processing, or a seed that is useful for producing progeny.

[0069] In one aspect, the present embodiment relates to a processed product of a tomato or a part thereof. The processed product is not particularly limited, and examples thereof include processed products for edible, industrial, and medical purposes, and is particularly preferably a processed product for edible purposes.

[0070] [III] Method for Producing Virus-Resistant Tomato Plants In one aspect, the present embodiment relates to a method for producing a virus-resistant tomato of the present invention. Specifically, the method comprises the following steps: selecting at least one gene from the group consisting of receptor-like ligase RLK genes and genes homologous thereto, introducing into the selected gene in the genome of a tomato plant a mutation that suppresses expression of the selected gene or that renders the protein encoded by the selected gene non-functional against Tobamovirus viruses that cause yellow leaf curl symptoms in tomato, and selecting tomatoes that are resistant to Tobamovirus viruses.

[0071] First, the target gene to be mutated is selected from the group consisting of the RLK gene and its homologous genes. The selected gene may be a single gene or a combination of two or more different genes. These genes are as described above in relation to virus-resistant tomatoes. Next, a specific method for producing virus-resistant tomatoes will be described.

[0072] Next, a mutation is introduced into the selected gene. Methods for introducing a mutation into a gene in a genome can be broadly divided into the following two methods, as exemplified below. (1) Direct genome editing: This method involves directly editing the genome of a plant having an RLK gene functional against tobamovirus, thereby introducing a mutation at a targeted location and producing a plant having a tobamovirus resistance gene. (2) Mutant gene introduction: This method combines the following procedures (A) and (B). (A): A tobamovirus resistance gene is created and introduced into the plant using an appropriate promoter. (B): Of the endogenous genes that the plant has and that correspond to the tobamovirus resistance gene created in (A) above, a gene that is functional against tobamovirus is made non-functional against tobamovirus. Each method is described below.

[0073] (1) Direct genome editing Direct genome editing can be performed using known genome editing techniques using site-specific nucleases, such as CRISPR and TALEN. When a double-strand break is introduced using a restriction enzyme capable of cleaving a specific site in the genome, various mutations are introduced due to repair errors when the break is repaired. As a result, a mutation is introduced into the target gene (in this embodiment, a gene encoding RLK functional against tobamovirus).

[0074] Since it can introduce mutations with particularly high specificity and high efficiency, it is preferable to use the CRISPR system, and it is particularly preferable to use the CRISPR / Cas9 system.In the CRISPR / Cas9 system, the guide RNA (sgRNA) that comprises the sequence of about 20 bases long that is complementary to the target gene recognizes the target, and the Cas9 protein cuts the double strand, and when this is repaired by the non-homologous end joining (NHEJ) repair pathway, the repair error introduces mutations into the target site.

[0075] The Cas protein and sgRNA can be delivered to plants via vectors encoding them using methods known to those skilled in the art, such as the Agrobacterium method, standard transfection methods, electroporation, particle bombardment, etc.

[0076] Conveniently, as shown in the Examples below, a binary vector incorporating the Cas gene and sgRNA can be constructed, used to transform Agrobacterium, and then used to transform a plant, thereby delivering the Cas protein and sgRNA to the plant (see Friedrich Fauser et al., "The Plant Journal," 2014, 79: 348-359, and Ryo Osawa and Hiroshi Ezura, "Understanding New Plant Breeding Techniques - NBT (New Plant Breeding Techniques)," Kokusai Bunkensha, 2013, etc.).

[0077] The form of the plant to be transformed with Agrobacterium is not particularly limited as long as it can regenerate the plant body, and examples include suspension-cultured cells, protoplasts, leaf slices, callus, etc. After removing the Agrobacterium, the plant is cultured in a medium containing a drug appropriate for the vector used, and the slice into which the target gene has been incorporated can be selectively cultured using drug resistance as an indicator.

[0078] Guide RNA can be designed so that it can be highly efficiently introduced into target site mutation.In CRISPR system, the 3 bases before the 3 base sequence called PAM sequence (NGG when using the most common S.pyogenes derived Cas9) are generally cut.Since the PAM sequence must be present immediately after the target sequence, guide RNA can be designed with the upstream of the PAM sequence as the target sequence.

[0079] When designing a guide RNA, it is preferable to take the GC content into consideration, since the higher the GC content of the base sequence, the higher the cleavage efficiency. Furthermore, the guide RNA can be designed to minimize non-specific cleavage due to off-target effects. For example, in Figure 1, which shows the cDNA sequence (SEQ ID NO: 1) of the RLK1 gene present on chromosome 2 of tomato, the boxed portion present in exon 1 (single underlined portion in Figure 1, SEQ ID NO: 2) is used as the PAM sequence, and a guide RNA can be designed targeting the usual 20 bases (wavy underlined portion in Figure 1, SEQ ID NO: 3) upstream of this PAM sequence. In this way, a mutation can be introduced into the target site to create a plant having a tobamovirus-resistant RLK1 gene. In addition, in Figure 2 which shows the cDNA sequence (SEQ ID NO: 16) of the RLK2 gene present on tomato chromosome 3, the boxed portion present in exon 1 (single underlined portion in Figure 2, SEQ ID NO: 17) is used as the PAM sequence, and a guide RNA can be designed targeting typically 20 bases (wave-underlined portion in Figure 2, bases 20 to 39 of SEQ ID NO: 18) three bases upstream of this PAM sequence.

[0080] When a double-strand break is introduced into a gene using the CRISPR system, approximately 20 bases are repaired, and it is thought that a mutation is introduced due to the repair error. Thus, in one aspect, the tobamovirus resistance gene of this embodiment has a variety of mutations. The mutation to be introduced does not necessarily have to be limited to the target site. That is, the mutation may exist in a region other than the target site, for example, in a region adjacent to the target site. For example, in the present invention, the mutation introduced into the RLK1 gene was limited to the target site (see FIG. 4), but the mutation introduced into the RLK2 gene was also present in a region adjacent to the target site (see FIG. 5).

[0081] This embodiment also relates to a guide RNA and a vector containing the guide RNA used to create the tobamovirus-resistant tomatoes. The sequence of the guide RNA is as described above. This embodiment also relates to a kit containing the guide RNA. The kit may also contain site-specific nucleases and the like necessary for genome editing using the CRISPR system, and can be used to create tobamovirus-resistant tomatoes.

[0082] (2) Mutant Gene Introduction Mutant gene introduction is a method that combines the following procedures (A) and (B). (A): A tobamovirus resistance gene is created and introduced into a plant using an appropriate promoter. (B): Of the endogenous genes possessed by the plant that correspond to the tobamovirus resistance gene created in (A) above, a gene that is functional against tobamovirus is made non-functional against tobamovirus. The order in which steps (A) and (B) above are performed is not particularly limited as long as it does not result in plant death, and (B) may be performed first. Note that the method of performing only (B) at a specific site is the above-mentioned (1) direct genome editing.

[0083] In step (A), a mutant gene encoding a non-functional RLK protein against tobamovirus is constructed and introduced into a plant using an appropriate promoter. The construction of the mutant gene can be carried out using techniques known to those skilled in the art. For example, a nucleotide sequence having the desired mutation can be synthesized and amplified by PCR or the like. The mutation introduced here is as described above in relation to tobamovirus-resistant tomatoes.

[0084] The constructed mutant gene can also be introduced into a plant using techniques known to those skilled in the art. Conveniently, this can be done using a vector carrying the mutant gene, for example, the polyethylene glycol method, electroporation, Agrobacterium method, particle gun method, etc. The mutant gene introduced here is a tobamovirus resistance gene obtained by mutating the RLK gene (or a homologous gene) derived from tomato, or it may be a tobamovirus resistance gene of another plant species.

[0085] The form of the plant into which the vector is introduced is not particularly limited as long as it is capable of regenerating the plant body, and examples thereof include suspension culture cells, protoplasts, leaf slices, callus, and the like.

[0086] Next, in step (B), endogenous RLK genes (or homologous genes) possessed by the plant that are functional against tobamoviruses are changed to ones that are non-functional against tobamoviruses. To carry out step (B), known methods for introducing mutations into plants can be used. For example, mutagen treatment such as ion beam or EMS can be used. Genome editing techniques such as the above-mentioned CRISPR and TALEN can also be used. It is desirable to make all endogenous RLK genes that are functional against tobamoviruses non-functional against tobamoviruses.

[0087] Next, a plant is regenerated from a plant part (e.g., a leaf piece or a plant cell) carrying the tobamovirus resistance gene. Plant regeneration can be performed by a method known to those skilled in the art depending on the type of plant. For example, in the case of tomato, regeneration can be performed with reference to Sun HJ et al., "Plant Cell Physiol.," 2006, 47: 426, etc.

[0088] Furthermore, tomatoes resistant to tobamovirus are selected from the regenerated plants. This selection can be performed using the above-mentioned methods for confirming tobamovirus resistance. For example, plants resistant to tobamovirus can be selected by infecting plants with tobamovirus using standard methods and confirming tobamovirus accumulation in the plants using known techniques such as ELISA or PCR. Tomatoes resistant to tobamovirus can also be selected by confirming the presence or absence of tobamovirus infection symptoms (leaf mosaic, silky leaves, yellowing symptoms, stem necrosis symptoms, fruit discoloration, necrosis and ring spots, etc.) in tobamovirus-infected plants. When ToBRFV is used as the tobamovirus, ToBRFV resistance can also be tested using a synthetic infectious RNA (e.g., SEQ ID NO: 45) corresponding to the genomic RNA of ToBRFV instead of the virus, as described in Non-Patent Document 6.

[0089] In one aspect, the present embodiment relates to a tomato plant produced by the above-described method, which is similar to the tobamovirus-resistant tomato plant described above.

[0090] Once a tobamovirus-resistant tomato plant carrying a tobamovirus resistance gene is obtained, progeny or clones of the plant can be obtained by known techniques. Therefore, the tobamovirus-resistant tomato plant of this embodiment also includes these progeny and clones.

[0091] In one aspect, the present embodiment relates to a method for producing a progeny of a tobamovirus-resistant tomato, the method comprising the step of self-pollinating or cross-pollinating a tobamovirus-resistant tomato (founder generation) obtained by the above-described production method or its progeny. Self-pollination or cross-pollination of a plant can be carried out by a method known in the art, and can be carried out naturally or artificially. The progeny thus obtained can be further self-pollinated or cross-pollinated to produce further progeny.

[0092] The tomatoes crossed with the primary or progeny in cross-pollination may be tomatoes with the same mutation in the same gene, tomatoes with different mutations in the same gene, or tomatoes with mutations in different genes. For example, a plant with a mutation in the RLK1 gene may be crossed with a plant with a mutation in the RLK2 gene. Furthermore, by performing multiple crosses, it is possible to produce plants with mutations in three or more genes.

[0093] Example 1: Preparation of Recombinant Agrobacterium A for Introducing a Mutation into the RLK1 Gene A site recognized by a guide RNA was arbitrarily designed within exon 1 of the RLK1 gene (Solyc02g091840) (SEQ ID NO: 1), which is believed to be present on chromosome 2 of tomato. Double-stranded DNA corresponding to the designed 20-base-long site (SEQ ID NO: 3: TCTCTAGAGTACCTTGCAGT) was synthesized and inserted into the BbsI restriction enzyme site in the vector pUC19_AtU6oligo (obtained from the National Institute of Agrobiological Sciences, now the National Agriculture and Food Research Organization) to construct a recombinant binary vector. The cDNA sequence of the RLK1 gene present on chromosome 2 of wild-type tomato is shown in Figure 1 and SEQ ID NO: 1.

[0094] The cassette portion containing the guide RNA sequence region was excised from each of the constructed recombinant vectors and inserted into the restriction enzyme I-SceI site in the binary vector pZD_OsU3gYSA_HolgerCas9_NPTII to obtain a recombinant binary vector. These binary vectors were used to transform Agrobacterium LBA4404 (Takara Bio Inc.) using standard methods to obtain recombinant Agrobacterium A.

[0095] Example 2: Preparation of Recombinant Agrobacterium B for Introducing a Mutation into the RLK2 Gene A site recognized by a guide RNA was designed within exon 1 of the RLK2 gene (Solyc03g043770) (SEQ ID NO: 16) present on chromosome 3 of tomato. Double-stranded DNA corresponding to the designed 20-base-long site (bases 20 to 39 of SEQ ID NO: 18: GTATCGTCACGTGACTTCTC) was synthesized and inserted into the BbsI restriction enzyme site of the vector pUC19_AtU6oligo (obtained from the National Institute of Agrobiological Sciences, now the National Agriculture and Food Research Organization) to construct a recombinant binary vector. The cDNA sequence of the RLK2 gene present on chromosome 3 of wild-type tomato is shown in Figure 2 and SEQ ID NO: 16.

[0096] The cassette portion containing the guide RNA sequence region was excised from each of the constructed recombinant vectors and inserted into the restriction enzyme I-SceI site in the binary vector pZD_OsU3gYSA_HolgerCas9_NPTII to obtain a recombinant binary vector. These binary vectors were used to transform Agrobacterium LBA4404 (Takara Bio Inc.) using standard methods to obtain recombinant Agrobacterium B.

[0097] Example 3: Tomato transformation The tomato to be transformed was the known fixed variety Manymaker (hereinafter abbreviated as "MM") or our own fixed variety S. Tomato transformation using Agrobacterium was performed according to the method described in a general textbook (e.g., "Protocols for Plant Transformation" edited by Yutaka Tabei, Kagaku Dojinsha, 2012). Specifically, cotyledon segments obtained by germinating tomato seeds in a sterile medium, or sterilized cotyledon segments or true leaf segments from seedlings sown normally, were prepared. Next, recombinant Agrobacterium A obtained in Example 1 or recombinant Agrobacterium B obtained in Example 2 were cultured until the turbidity reached 0.5 to 2.0, respectively, to prepare culture solutions. Tomato leaf segments were immersed in the culture solutions for approximately 10 minutes to infect Agrobacterium A or B.

[0098] Three days after infection, the Agrobacterium was removed. Tomato leaf pieces were transferred onto Murashige and Skoog medium (sometimes abbreviated as MS basal medium; MS basal medium supplemented with 3% sucrose, 1.5 mg / L zeatin, and 1% agar) supplemented with carbenicillin (100-500 mg / ml) and kanamycin (20-100 mg / ml) and subjected to selective culture at 25°C under illumination (16 hours of light / 8 hours of darkness). Callus formation from the leaf pieces was promoted by changing the medium every 10 days to 2 weeks after the start of culture and by transplanting and subculturing. Adventitious shoots were subsequently induced by repeated subculturing.

[0099] When the adventitious shoots grew to a size of several centimeters, they were transplanted onto rooting medium (MS basal medium supplemented with 1.5% sucrose, 1% agar, 50-250 mg / ml carbenicillin, 20-100 mg / ml kanamycin, and sometimes naphthaleneacetic acid (NAA)) and cultured for 1-3 months, subculturing every month.

[0100] All cultures were sterile until they were cultured on rooting medium. Rooted individuals (in a seedling-like state) were removed from the sterile medium and transplanted into potting soil containing commercially available black soil or Akadama soil, and then grown. The regenerated individuals were designated as transgenic current generations (hereinafter sometimes abbreviated as TO).

[0101] Example 4: Selection of gene-edited lines To confirm whether or not genetic recombination and editing sites (base deletion, insertion, or substitution) were present in the target gene of the current transgenic line, leaves from TO tomatoes were crushed and genomic DNA was extracted using a NucleoSpin Plant II kit (Takara Bio Inc.) or the like according to the method attached to the kit.

[0102] Furthermore, 1 μL of the extracted DNA was used to amplify the target site by PCR using the following primers: Primer 1 (5′-TTAACACGTCTGCGTAACCTC-3′, SEQ ID NO: 37) and Primer 2 (5′-CCGGTGAAGGTATTGTAGTATCC-3′, SEQ ID NO: 38) were used for the region in the RLK1 gene (Solyc02g091840), and Primer 3 (5′-CTCCACTTCACCACCGCAAA-3′, SEQ ID NO: 39) and Primer 4 (5′-TACCGGAGATGGGTAAGCTG-3′, SEQ ID NO: 40) were used for the region in the RLK2 gene (Solyc03g043770). PCR was carried out using a T100 thermal cycler (BIORAD) and KOD One (Toyobo) according to the attached manual to amplify DNA.

[0103] The amplified DNA was purified using NucleoSpin Gel and PCR Clean-up (Takara Bio Inc.) according to the kit's instructions, and the base sequence of the amplified site was then sequenced by the Sanger method using the forward primer (primer 1 or primer 3 described above) of the primers used in PCR for the gene in question to confirm the presence or absence of editing. However, it is possible that the edited portion differs depending on the allele, i.e., that the allele is heterozygous. In this case, when DNA amplification products of the same region are sequenced, different base signals are detected overlapping, making it impossible to decipher. Therefore, when sequencing the relevant sequence for the first time, the amplified fragment obtained by PCR of the relevant region was cloned into a TA vector using the TArget Clone-Plus kit (Toyobo Co., Ltd.), and then sequencing was performed using the Sanger method (when cloning, the amplified DNA is cloned molecule by molecule, so the sequence can be confirmed for each clone, and by sequencing multiple clones, it can be inferred that if all have the same editing pattern sequence, the allele is homozygous, and if there are two patterns, the allele is heterozygous).

[0104] As a result, it was confirmed that the base sequence of the RLK1 gene or the RLK2 gene had been edited in some regenerated individuals, and edited lines were selected. The edited lines of the RLK1 gene and the RLK2 gene are sometimes designated by the initial numbers "C" and "P."

[0105] [Example 5] Production of transgenic progeny Furthermore, these edited lines were self-pollinated, and seeds of the progeny (the generation following the TO generation was designated T1, and the subsequent generation was designated T2) were collected. Genomic DNA was extracted from the sown seedlings using the method of [Example 4], and the base sequence near the edited site was amplified by PCR, and the editing pattern was confirmed by sequencing.

[0106] Example 6: Preparation of ToBRFV inoculum (infectious RNA) Tomato brown rugose fruit virus (ToBRFV) was used as the tobamovirus. Due to quarantine issues, it is extremely difficult to bring ToBRFV or virus-infected leaves into Japan. Therefore, following the report in Non-Patent Document 6, infectious RNA (SEQ ID NO: 45) was synthesized in vitro by linking the genomic sequence of the Jordan strain of ToBRFV (Genbank: KT383474) (with bases 6 to 9 deleted, making it 6,388 bases long) under the control of a T7 promoter (17 bases long). Note that ToBRFV is an RNA virus, and its genomic sequence is an RNA sequence. SEQ ID NO: 45 shows the DNA sequence in which U (uracil) in RNA is replaced by T (thymine) in DNA.

[0107] Using the synthesized sequence as a template, PCR was performed using primer 5 (5'-AGCTTGCATGCCTGCAGGTCT-3', SEQ ID NO: 41), primer 6 (5'-TGGGGCCCCTCCGGGGTTCCGGGGAATTCGAATC-3', SEQ ID NO: 42), and KOD One (Toyobo Co., Ltd.) under the conditions provided with KOD One to amplify the full-length viral fragment beginning with the T7 promoter sequence. The primers were removed from the PCR-amplified fragment using NucleoSpin (registered trademark) Gel and PCR Clean-up (Takara Bio Inc.) according to the kit's instructions. Furthermore, using this purified amplified fragment as a template, RNA was transcribed and synthesized using T7 polymerase (HiScribe T7 Quick High Yield RNA Synthesis Kit; New England Biolabs) at 37°C for 4 hours according to the protocol attached to the reagent.

[0108] Example 6 Inoculation with ToBRFV One-tenth to one-half of the 20 μL of RNA synthesized in Example 6 was inoculated onto true leaves (compound leaves) at approximately the middle position of test tomato seedlings (3- to 5-leaf stage) by mechanical inoculation (rubbing inoculation) using the carborundum method.

[0109] Example 7: Extraction of Total RNA On the 18th day after inoculation, leaves inoculated with RNA (infectious RNA substituted for the virus) (inoculated leaves) and upper leaves not inoculated (upper leaves) were selected, and approximately 100 mg of each was frozen in liquid nitrogen, ground, and dissolved in 1 mL of TRIsol Reagent (Ambion) preheated to 50°C. The mixture was transferred to a microtube and heated in a 50°C incubator for 10 minutes to extract RNA. Subsequently, 1 / 5 the volume of chloroform was added, the mixture was stirred, and the mixture was centrifuged at 15,000 rpm for 15 minutes. An equal volume of isopropanol was added to the supernatant after centrifugation, and the mixture was stirred and centrifuged at 15,000 rpm for 15 minutes. After rinsing with 70% ethanol, the extracted RNA precipitate was dissolved in 50 μL of DNase- and RNase-free water.

[0110] Example 8: RNA Analysis of ToBRFV Using 5-10 μL of the RNA sample obtained in Example 7, first-strand cDNA was synthesized using the SuperScript VILO cDNA Synthesis Kit (Invitrogen) according to the conditions in the kit's instructions. Furthermore, PCR was performed using 2 μL of this cDNA sample with primer 7 (5'-GAGACTTACGTCGCCGATTC-3', SEQ ID NO: 43) and primer 8 (5'-GTACCACGTGTGTTTGCAGAC-3', SEQ ID NO: 44) using GoTaq Green Master Mix (Promega). PCR was performed under the following conditions: 95°C for 2 minutes, 30 cycles of 95°C for 30 seconds, 53°C for 30 seconds, and 72°C for 30 seconds, followed by 72°C for 5 minutes. After PCR, 1 / 10 of the PCR product was subjected to 1.5% agarose gel electrophoresis to confirm the presence or absence of ToBRFV.

[0111] Figure 3 shows an electrophoresis photograph showing the results of the RT-PCR analysis of the ToBRFV inoculation test. In Figure 3, M represents the ladder marker, WT represents the wild-type cultivar (Manymaker), R1 represents a mutant with a frameshift mutation in the RLK1 gene, R2 represents a mutant with a frameshift mutation in the RLK2 gene, and PC represents the positive control. As a result of the above analysis, ToBRFV was detected in both the inoculated leaves and upper leaves of the control cultivar Manymaker. However, in the RLK1 and RLK2 mutants, ToBRFV was detected in the inoculated leaves but not in the upper leaves. This result indicated that the RLK1 and RLK2 mutants restricted or inhibited viral movement within the plant body, and the mutants were resistant.

[0112] Among the edited lines selected in Example 4, the gene mutations of the edited lines confirmed to be resistant to ToBRFV in the above test are summarized in Figures 4 and 5. Figure 4 shows mutations C1 to C4 found in the RLK1 gene together with the wild-type sequence, and Figure 5 shows mutations P1 to P6 found in the RLK2 gene together with the wild-type sequence.

[0113] This application claims priority based on Japanese Patent Application No. 2023-106936, filed June 29, 2023, the entire contents of which are incorporated herein by reference.

[0114] The present invention provides a method for producing tomato plants, tomato cells, and tomatoes resistant to tobamovirus viruses, which have the property of inhibiting infection with tobamovirus viruses, the property of suppressing the proliferation and movement of tobamovirus viruses after infection, and / or the property of suppressing the manifestation of symptoms of infection with tobamovirus viruses.The present invention can solve a problem mainly in the agricultural field, such as reduced tomato yields due to infection with tobamovirus viruses.

[0115] SEQ ID NO: 1: cDNA sequence of RLK1 gene, bases 1 to 2818 are exon 1, bases 790 to 809 are the target sequence SEQ ID NO: 2: Exon 1 of RLK1 gene, bases 790 to 809 are the target sequence SEQ ID NO: 3: Wild-type target sequence in exon 1 of RLK1 gene SEQ ID NO: 4: Mutation region C1 of RLK1 gene SEQ ID NO: 5: Mutation region C2 of RLK1 gene SEQ ID NO: 6: Mutation region C3 of RLK1 gene SEQ ID NO: 7: Mutation region C4 of RLK1 gene SEQ ID NO: 8: Exon 1 of RLK1 gene containing mutation region C1 SEQ ID NO: 9: Exon 1 of RLK1 gene containing mutation region C2 SEQ ID NO: 10: Exon 1 of RLK1 gene containing mutation region C3 SEQ ID NO: 11: Exon 1 of RLK1 gene containing mutation region C4 SEQ ID NO: 12: cDNA sequence of mutant RLK1 gene having mutation region C1 SEQ ID NO: 13: cDNA sequence of mutant RLK1 gene having mutation region C2 SEQ ID NO: 14: cDNA sequence of mutant RLK1 gene having mutation region C3 SEQ ID NO: 15: cDNA sequence of mutant RLK1 gene having mutation region C4 SEQ ID NO: 16: cDNA sequence of RLK2 gene, bases 1 to 830 are exon 1, bases 277 to 296 are the target sequence SEQ ID NO: 17: exon 1 of RLK2 gene, bases 277 to 296 are the target sequence SEQ ID NO: 18: Wild-type region in exon 1 of RLK2 gene containing the target sequence SEQ ID NO: 19: Mutation region P1 of RLK2 gene SEQ ID NO: 20: Mutation region P2 of RLK2 gene SEQ ID NO: 21: Mutation region P3 of RLK2 gene SEQ ID NO: 22: Mutation region P4 of RLK2 gene SEQ ID NO: 23: Mutation region P5 of the RLK2 gene SEQ ID NO: 24: Mutation region P6 of the RLK2 gene SEQ ID NO: 25: Exon 1 of the RLK2 gene containing mutation region P1 SEQ ID NO: 26: Exon 1 of the RLK2 gene containing mutation region P2 SEQ ID NO: 27: Exon 1 of the RLK2 gene containing mutation region P3 SEQ ID NO: 28: Exon 1 of the RLK2 gene containing mutation region P4 SEQ ID NO: 29: Exon 1 of the RLK2 gene containing mutation region P5 SEQ ID NO: 30: Exon 1 of the RLK2 gene containing mutation region P6SEQ ID NO: 31: cDNA sequence of mutant RLK2 gene having mutated region P1 SEQ ID NO: 32: cDNA sequence of mutant RLK2 gene having mutated region P2 SEQ ID NO: 33: cDNA sequence of mutant RLK2 gene having mutated region P3 SEQ ID NO: 34: cDNA sequence of mutant RLK2 gene having mutated region P4 SEQ ID NO: 35: cDNA sequence of mutant RLK2 gene having mutated region P5 SEQ ID NO: 36: cDNA sequence of mutant RLK2 gene having mutated region P6 SEQ ID NO: 37: Primer 1 SEQ ID NO: 38: Primer 2 SEQ ID NO: 39: Primer 3 SEQ ID NO: 40: Primer 4 SEQ ID NO: 41: Primer 5 SEQ ID NO: 42: Primer 6 SEQ ID NO: 43: Primer 7 SEQ ID NO: 44: Primer 8 SEQ ID NO: 45: The base sequence of the infectious RNA of ToBRFV as DNA, bases 1 to 17 are the T7 promoter, and bases 18 to 6405 are the RNA for ToBRFV infection.

Claims

1. A tomato having resistance to Tobamovirus viruses, wherein at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto has a mutation, and expression of the gene having the mutation is suppressed by the mutation, or a protein encoded by the gene having the mutation is non-functional against Tobamovirus viruses.

2. The tomato of claim 1, wherein the mutation has been introduced into a gene in the genome by genome editing technology.

3. The tomato according to claim 2, wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or non-consecutive deletion of 3n bases (n=1 to 5), and (d) an insertion or substitution of 1 to 10 bases.

4. The tomato according to claim 1 or 2, wherein the receptor-like kinase RLK gene is the RLK1 gene (Solyc02g091840) and its cDNA sequence comprises the base sequence shown in SEQ ID NO:1, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK1 gene and its cDNA sequence comprises a base sequence having 85% or more sequence homology to the base sequence shown in SEQ ID NO:

1.

5. The tomato according to claim 4, which has a mutation in a region corresponding to the base sequence shown in SEQ ID NO:3 in the RLK1 gene or a gene homologous thereto.

6. The tomato according to claim 5, wherein the region corresponding to the base sequence shown in SEQ ID NO:3 is mutated to a base sequence shown in one type selected from SEQ ID NOs:4 to 7.

7. The tomato according to claim 1 or 2, wherein the receptor-like kinase RLK gene is the RLK2 gene (Solyc03g043770) and its cDNA sequence comprises the base sequence shown in SEQ ID NO:16, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK2 gene and its cDNA sequence comprises a base sequence having 85% or more sequence homology to the base sequence shown in SEQ ID NO:

16.

8. The tomato according to claim 7, which has a mutation in a region corresponding to the base sequence shown in SEQ ID NO:18 in the RLK2 gene or a gene homologous thereto.

9. The tomato according to claim 8, wherein a region corresponding to the base sequence shown in SEQ ID NO:18 has been mutated to a base sequence shown in one type selected from SEQ ID NOs:19 to 24.

10. The tomato according to claim 1 or 2, wherein the Tobamovirus is at least one virus selected from the group consisting of Tomato brown rugose fruit virus (ToBRFV), Tomato mosaic virus (TMV), Tomato mosaic virus (ToMV), and Tomato mottle mosaic virus (ToMMV).

11. A tomato portion according to any one of claims 1 or 2.

12. The tomato part of claim 11 which is a fruit.

13. The tomato part of claim 11 which is a seed.

14. A processed product of tomato parts according to claim 11.

15. The processed product according to claim 14, which is edible.

16. A tomato cell having a mutation in at least one gene selected from the group consisting of receptor-like kinase RLK genes and genes homologous thereto, wherein the mutation suppresses expression of the gene having the mutation or the protein encoded by the gene having the mutation is non-functional against Tobamovirus viruses, and the tomato cell has resistance to Tobamovirus viruses.

17. A tomato or part thereof comprising the tomato cell of claim 16 and having resistance to Tobamoviruses.

18. A method for producing tomatoes resistant to Tobamovirus viruses, comprising the steps of: selecting at least one gene selected from the group consisting of receptor-like kinase RLK genes and their homologous genes; introducing into the selected gene in the genome of tomato a mutation that suppresses expression of the selected gene, or a mutation that renders the protein encoded by the selected gene non-functional against Tobamovirus viruses; and selecting tomatoes having resistance to Tobamovirus viruses.

19. The method for producing a tobamovirus-resistant tomato as described in claim 18, wherein the mutation is introduced into a gene in the genome by genome editing technology.

20. The method for producing a tomato resistant to a Tobamovirus virus according to claim 18 or 19, wherein the mutation is at least one of the following (a) to (d): (a) a frameshift mutation, (b) a nonsense mutation, (c) a consecutive or discontinuous deletion of 3n bases (n = 1 to 5), and (d) an insertion or substitution of 1 to 10 bases.

21. A method for producing a tomato resistant to a Tobamovirus virus as described in claim 18 or 19, wherein the receptor-like kinase RLK gene is the RLK1 gene (Solyc02g091840) and its cDNA sequence contains the base sequence shown in SEQ ID NO: 1, and a homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK1 gene and its cDNA sequence contains a base sequence having 85% or more sequence homology to the base sequence shown in SEQ ID NO:

1.

22. A method for producing a tobamovirus-resistant tomato as described in claim 21, which comprises introducing a mutation into a region corresponding to the base sequence shown in SEQ ID NO:3 in the RLK1 gene or a gene homologous thereto.

23. A method for producing a tomato resistant to a Tobamovirus virus as described in claim 22, comprising introducing a mutation so that the region corresponding to the base sequence shown in SEQ ID NO: 3 becomes a base sequence shown in one type selected from SEQ ID NOs: 4 to 7.

24. A method for producing a tomato resistant to a Tobamovirus virus as described in claim 18 or 19, wherein the receptor-like kinase RLK gene is the RLK2 gene (Solyc03g043770) and its cDNA sequence contains the base sequence shown in SEQ ID NO: 16, and the homologous gene of the receptor-like kinase RLK gene is a homologous gene of the RLK2 gene and its cDNA sequence contains a base sequence having 85% or more sequence homology to the base sequence shown in SEQ ID NO:

16.

25. A method for producing a tobamovirus-resistant tomato as described in claim 24, which comprises introducing a mutation into a region corresponding to the base sequence shown in SEQ ID NO:18 in the RLK2 gene or a homologous gene thereof.

26. A method for producing a tomato resistant to a Tobamovirus virus as described in claim 25, comprising introducing a mutation into a region corresponding to the base sequence shown in SEQ ID NO:18 so that it becomes a base sequence shown in one of SEQ ID NOs:19 to 24.

27. The method for producing a tobamovirus-resistant tomato according to claim 18 or 19, wherein the tobamovirus is at least one virus selected from the group consisting of tomato brown rugose fruit virus (ToBRFV), tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV).

28. A tomato resistant to a Tobamovirus virus, obtained by the method of claim 18 or 19.

29. A method for producing a breeding progeny of a Tobamovirus virus-resistant tomato, comprising a step of self-pollinating or cross-pollinating a Tobamovirus virus-resistant tomato or its progeny obtained by the production method described in any one of claims 18 or 19.

30. A tomato resistant to a Tobamovirus virus obtained by the method of claim 29.

Images