Mesenchymal stem cell-derived extracellular vesicles and use thereof

Abstract

The present invention relates to human mesenchymal stem cell-derived extracellular vesicles and use thereof. The mesenchymal stem cell-derived extracellular vesicles according to the present invention inhibit the expression of fibrosis-related proteins, wound closure, and cell infiltration, which increase because of TGF-β1 treatment in lung epithelial cells. In addition, microRNAs, contained in large amounts in the extracellular vesicles, inhibit gene expression of fibrosis-related proteins in lung epithelial cells and lung fibroblasts. These extracellular vesicles significantly reduce, in lung fibrosis model mice, the expression of fibrosis-related proteins, collagen production and fibrosis regions. Therefore, the extracellular vesicles according to the present invention can be used to prevent and treat lung fibrosis.

Description

Mesenchymal stem cell-derived extracellular vesicles and their uses

[0001] The present invention relates to extracellular vesicles derived from human mesenchymal stem cells and their uses.

[0002] Idiopathic pulmonary fibrosis (IPF) is the most common form of idiopathic interstitial pneumonia (IIP) within interstitial lung disease (ILD), but its exact cause remains unknown. Previously, chronic inflammation-induced fibrosis was considered the primary cause of IPF.

[0003] Pirfenidone and nintedanib, approved by the FDA in 2014, are currently used as treatments for idiopathic pulmonary fibrosis. However, they do not address the underlying cause, and tolerability and side effects have been reported. Furthermore, drugs currently being developed through clinical trials are single-acting therapies, raising concerns about efficacy and side effects. Therefore, the development of new treatments with multiple therapeutic mechanisms is urgently needed.

[0004] The therapeutic effects of mesenchymal stem cells on idiopathic pulmonary fibrosis have been reported through their immunomodulatory, anti-inflammatory, and epithelial cell regeneration promoting effects (Yang et al., Front Cell Dev Biol. (2021) 9:639657, Xie et al., Front Pharmacol. (2021) 11:590972). However, the biggest problem with stem cells is that the engraftment and survival rates in the body are not consistent across patients, making it difficult to prove their exact efficacy, and there are also problems such as the possibility of stem cells turning into cancer cells. Therefore, research on a treatment method for pulmonary fibrosis using mesenchymal stem cells is needed.

[0005] Accordingly, the inventors of the present invention completed the present invention by confirming that extracellular vesicles isolated from a culture medium of mesenchymal stem cells have an excellent effect in treating pulmonary fibrosis in a pulmonary fibrosis model mouse as a result of efforts to develop a treatment agent for pulmonary fibrosis.

[0006] To achieve the above purpose, one aspect of the present invention provides an extracellular vesicle in which any one microRNA selected from the group consisting of hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, hsa-let-7f-5p, and combinations thereof is overexpressed.

[0007] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating fibrosis comprising the extracellular vesicles as an active ingredient.

[0008] Another aspect of the present invention provides the use of the extracellular vesicles for preventing or treating fibrosis.

[0009] Another aspect of the present invention provides a method for preventing or treating fibrosis comprising administering the extracellular vesicles to a subject.

[0010] The extracellular vesicles derived from mesenchymal stem cells according to the present invention inhibited the expression of fibrosis-related proteins, wound closure, and cell infiltration increased by TGF-β1 treatment in lung epithelial cells. Furthermore, the microRNAs contained in large quantities in the extracellular vesicles suppressed the gene expression of fibrosis-related proteins in lung epithelial cells and lung fibroblasts. In a mouse lung fibrosis model, the extracellular vesicles significantly reduced the expression of fibrosis-related proteins, collagen production, and fibrotic areas. Therefore, the extracellular vesicles according to the present invention can be utilized to prevent and treat pulmonary fibrosis.

[0011] Figure 1 is a schematic diagram showing extracellular vesicles secreted from human mesenchymal stem cells (hMSCs) derived from various human tissues and their use in treating pulmonary fibrosis.

[0012] Figure 2 is a schematic diagram showing a method for isolating extracellular vesicles derived from human mesenchymal stem cells as a specific example of the present invention.

[0013] FIG. 3 is a graph and table showing the results of confirming the particle size distribution and concentration of extracellular vesicles (hMSCs-EV) isolated from a culture medium of human umbilical cord-derived mesenchymal stem cells using a nanoparticle tracking analyzer, as one specific example of the present invention.

[0014] FIG. 4 is a drawing showing the results of observing the double lipid membrane structure of hMSCs-EVs using a cryogenic transmission electron microscope, as one specific example of the present invention.

[0015] FIG. 5 is a drawing showing the results of confirming the marker factor of hMSCs-EV through Western blot as one specific example of the present invention.

[0016] Figure 6 is a graph showing the results of confirming the phenotype of hMSCs-EVs through flow cytometry analysis, as one specific example of the present invention.

[0017] FIG. 7a and FIG. 7b are graphs showing the results of analyzing the internal factors of hMSCs-EVs through small RNA sequencing, as one specific example of the present invention.

[0018] Figure 8 is a graph showing the results of confirming the gene expression of fibrosis-related factors using q-PCR after treating human lung epithelial cells (A549 cells) with TGF-β1 to induce EMT (Epithelial-mesenchymal transition) and then treating hMSCs-EVs.

[0019] Figure 9 is a drawing showing the results of confirming the wound healing effect after inducing EMT by treating human lung epithelial cells (A549 cells) with TGF-β1 and then pretreating them with hMSCs-EVs.

[0020] Figure 10 is a drawing and graph showing the results of confirming the degree of cell migration and cell invasion after inducing EMT by treating human lung epithelial cells (A549 cells) with TGF-β1 and then pretreating them with hMSCs-EVs.

[0021] Figure 11 is a diagram showing the results of confirming the expression of fibrosis-related proteins by Western blot after inducing EMT by treating human lung epithelial cells (A549 cells) with TGF-β1 and then pretreating hMSCs-EVs.

[0022] Figure 12 is a diagram showing the results of confirming the expression of Fibronectin using cell immunofluorescence staining after inducing EMT in human lung epithelial cells (A549 cells) by treating them with TGF-β1 and then pretreating them with hMSCs-EVs.

[0023] Figure 13 is a graph showing the results of confirming the expression of microRNAs through q-PCR after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung epithelial cells (A549 cells).

[0024] Figure 14 is a graph showing the results of confirming the expression of microRNAs through q-PCR after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung fibroblasts (NHLF cells).

[0025] Figures 15a and 15b are graphs showing the results of confirming the gene expression of fibrosis-related factors by TGF-β1 treatment through q-PCR after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung epithelial cells (A549 cells).

[0026] Figure 16 is a graph showing the results of q-PCR analysis of gene expression of fibrosis-related factors by TGF-β1 treatment after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung fibroblasts (NHLF cells).

[0027] Figure 17 is a drawing showing the results of Western blot analysis to confirm the expression of fibrosis-related proteins by TGF-β1 treatment after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung epithelial cells (A549 cells).

[0028] Figure 18 is a drawing showing the results of Western blot analysis of the expression of fibrosis-related proteins by TGF-β1 treatment after overexpressing miR-148a-3p, miR-143-3p, miR-100-5p, Let-7a-5p, Let-7b-5p, or Let-7f-5p in human lung fibroblasts (NHLF cells).

[0029] Figure 19 is a schematic diagram showing the experimental schedule to confirm the therapeutic effect of hMSCs-EV on pulmonary fibrosis in a bleomycin-induced pulmonary fibrosis animal model (BLM-induced C57BL / 6 mouse).

[0030] Figure 20 is a graph showing the results of q-PCR analysis of gene expression of fibrosis-related factors in the lung tissue of mice 8 days after a single administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0031] Figure 21 is a graph showing the results of measuring the concentration of soluble collagen in the lung tissue of mice 8 days after a single administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0032] Figure 22 is a diagram showing the results of Masson's Trichrome staining of lung tissue 8 days after a single administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model. Magnification: 200x, Scale bar: 50 um.

[0033] Figure 23 is a diagram showing an experimental schedule to confirm the therapeutic effect of hMSCs-EVs on pulmonary fibrosis in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0034] Figure 24 is a drawing showing the results of observing the morphology of mouse lungs after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0035] Figure 25 is a graph showing the results of q-PCR analysis of gene expression of fibrosis-related factors in the lung tissue of mice after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0036] Figure 26a is a graph showing the results of Western blot analysis of the expression of fibrosis-related proteins in the lung tissue of mice after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0037] Figure 26b is a diagram showing the results of Western blot analysis of the expression of fibrosis-related proteins in the lung tissue of mice after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0038] Figure 27 is a graph showing the results of confirming the concentration of soluble collagen in the lung tissue of mice after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model.

[0039] Figure 28 shows the pathological morphology of lung tissue of mice after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model, as analyzed by hematoxylin and eosin staining (drawing) and Ashcroft score (graph).

[0040] Figure 29 is a drawing showing the results of confirming the collagen area of ​​the lung tissue of a mouse through Masson's trichrome staining after administration of hMSCs-EVs in a bleomycin (BLM)-induced pulmonary fibrosis animal model, and a graph showing the results of quantification thereof. X40: 40x magnification, X200: 200x magnification.

[0041] extracellular vesicles

[0042] One aspect of the present invention provides an extracellular vesicle overexpressing any one microRNA selected from the group consisting of hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, hsa-let-7f-5p, and combinations thereof. In this case, the cell is a human-derived cell, and may be a cell, cell line, or stem cell derived from human tissue, and specifically may be a stem cell.

[0043] The cells derived from the human tissue may be cells derived from the human heart, stomach, colon, small intestine, lung, liver, kidney, or uterus. Furthermore, the cells derived from the human tissue may be a human-derived immortalized cell line.

[0044] The stem cell may be a mesenchymal stem cell, a hematopoietic stem cell, a neural stem cell, an embryonic stem cell, or an induced pluripotent stem cell. Specifically, the stem cell may be a mesenchymal stem cell.

[0045] The term "mesenchymal stem cell (MSC)" used herein refers to a stem cell that exists in the stroma of cartilage, bone tissue, adipose tissue, and bone marrow, differentiated from the mesoderm formed by the division of a fertilized egg, and may include mesenchymal stem cells of mammals, such as animals including humans. Mesenchymal stem cells maintain stemness and self-renewal and have the ability to differentiate into various cells including chondrocytes, osteoblasts, muscle cells, and adipocytes, and can be extracted from the umbilical cord, bone marrow, adipose tissue, umbilical cord blood, synovium, trabecular bone, muscle, infrapatellar fat pad, peripheral blood, liver, teeth, and hair follicles. Mesenchymal stem cells are known to have immune-regulating abilities, such as suppressing the activity and proliferation of T cells and B cells, inhibiting the activity of natural killer cells, and regulating the functions of dendritic cells and macrophages, making them suitable for allotransplantation and xenotransplantation.

[0046] The above mesenchymal stem cells may be derived from, but are not limited to, umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, tooth, hair root cell, or placenta, or differentiated from induced pluripotent stem cells.

[0047] As used herein, the term "derived cell", e.g., "derived mesenchymal stem cell", etc., means a cell that is substantially separated from the tissue from which the cell originated or a cell that has differentiated into an induced stem cell.

[0048] As used herein, the term "isolated extracellular vesicles" refers to extracellular vesicles that are substantially separated from the cells from which they originate, such as mesenchymal stem cells. Preferably, they can be isolated from a culture medium of mesenchymal stem cells. In this case, as the medium used for culturing the cells, a conventional medium known in the art to be suitable for cell culture can be used, and the medium may contain serum or may be a serum-free medium. Preferably, it may be a serum-free medium.

[0049] The term "extracellular vesicles (EVs)" as used herein refers to nano-sized particles (about 50 nm to about 1000 nm) that are naturally secreted by living cells and wrapped in a lipid bilayer. They are composed of biologically active substances such as DNA, RNA, and proteins, and extracellular vesicles are known to play a role in transmitting information between cells. In the present invention, the extracellular vesicles may include vesicles (exosomes, microvesicles, multivesicles, and extracellular vesicle-like vesicles) that have a composition similar to that of extracellular vesicles.

[0050] In the present invention, the extracellular vesicles may be those in which any one microRNA selected from the group consisting of hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, hsa-let-7f-5p, and combinations thereof is overexpressed.

[0051] The term "microRNA (miRNA)" as used herein refers to a small RNA that plays a role in controlling gene expression in organisms. It is a small RNA containing 20 to 25 nucleotides that can play an important regulatory role in the gene expression process by suppressing the translation of target mRNA through complementary base pairing with the target mRNA 3'UTR (Untranslated region). The microRNA plays an important role in cellular functions including proliferation, differentiation, and apoptosis, and is an evolutionarily conserved regulatory substance present in all animals. Some microRNAs are known to regulate gene expression through epigenetic regulatory mechanisms (histone modification, DNA methylation, etc.) associated with their promoter regions.

[0052] In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p is overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p is overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-143-3p is overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-let-7a-5p is overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-let-7f-5p is overexpressed.

[0053] In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p and hsa-miR-100-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p and hsa-miR-143-3p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p and hsa-miR-143-3p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-143-3p and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-143-3p and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-let-7a-5p and hsa-let-7f-5p are overexpressed.

[0054] In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, and hsa-miR-143-3p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-143-3p, and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-143-3p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p, hsa-miR-143-3p, and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p, hsa-miR-143-3p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-143-3p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed.

[0055] In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, and hsa-let-7a-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-143-3p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed. In one specific example, the extracellular vesicles may be those in which hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed.

[0056] In one specific example, the extracellular vesicles may be those in which hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, and hsa-let-7f-5p are overexpressed.

[0057] At this time, the extracellular vesicles may contain hsa-miR-148a-3p in an amount of about 1% to about 20% of the total microRNAs in the extracellular vesicles. Specifically, the extracellular vesicles may contain hsa-miR-148a-3p in an amount of about 1% to about 20%, about 5% to about 18%, or about 10% to about 16%. Preferably, the extracellular vesicles may contain hsa-miR-148a-3p in an amount of about 15.1%.

[0058] The extracellular vesicles may comprise hsa-miR-100-5p in an amount of about 1% to about 20% of the total microRNAs in the extracellular vesicles. Specifically, the extracellular vesicles may comprise about 1% to about 20%, about 5% to about 17%, or about 10% to about 14%. Preferably, the extracellular vesicles may comprise about 11% of hsa-miR-100-5p.

[0059] The extracellular vesicles may comprise hsa-miR-143-3p in an amount of about 0.1% to about 10% of the total microRNAs in the extracellular vesicles. Specifically, the extracellular vesicles may comprise about 0.1% to about 10%, about 0.5% to about 8%, or about 1% to about 6%. Preferably, the extracellular vesicles may comprise about 4.9% of hsa-miR-143-3p.

[0060] The extracellular vesicles may comprise hsa-let-7a-5p in an amount of about 0.1% to about 10% of the total microRNA in the extracellular vesicles. Specifically, the extracellular vesicles may comprise about 0.1% to about 10%, about 0.5% to about 8%, or about 1% to about 6%. Preferably, the extracellular vesicles may comprise about 4.6% of hsa-let-7a-5p.

[0061] The extracellular vesicles may comprise hsa-let-7f-5p in an amount of about 0.1% to about 10% of the total microRNA in the extracellular vesicles. Specifically, the extracellular vesicles may comprise about 0.1% to about 10%, about 0.5% to about 8%, or about 1% to about 6%. Preferably, the extracellular vesicles may comprise about 3.8% of hsa-let-7f-5p.

[0062] At this time, the microRNA may have anti-fibrosis activity.

[0063] In one embodiment of the present invention, when TGF-β1 was treated to lung epithelial cells or lung fibroblasts in which the microRNA was overexpressed, it was confirmed that the expression of genes and proteins related to epithelial-mesenchymal transition (EMT) and fibroblast myofibroblast differentiation (FMT) was reduced (Fig. 15a, Fig. 15b and Figs. 16 to 18).

[0064] In addition, the extracellular vesicles include hsa-miR-151a-3p, hsa-let-7b-5p, hsa-miR-21-5p, hsa-miR-10a-5p, hsa-miR-92a-3p, hsa-miR-486-5p, hsa-miR-99b-5p, hsa-let-7i-5p, hsa-miR-320a, hsa-miR-409-3p, hsa-miR-10b-5p, hsa-miR-127-3p, hsa-miR-26a-5p, hsa-miR-221-3p, hsa-let-7e-5p, hsa-miR-493-5p, hsa-miR-25-3p, hsa-miR-574-3p, hsa-miR-423-5p, hsa-miR-122-5p, hsa-miR-382-5p, hsa-miR-155-5p, hsa-miR-451a, hsa-miR-30a-3p, hsa-miR-28-3p, hsa-let-7g-5p, hsa-miR-379-5p, hsa-miR-23a-3p, hsa-miR-485-5p, hsa-miR-30a-5p, hsa-miR-30d-5p, hsa-miR-423-3p, hsa-miR-99a-5p, hsa-let-7c-5p, hsa-miR-92b-3p, hsa-miR-323a-3p, hsa-miR-574-5p, Any one microRNA selected from the group consisting of hsa-miR-197-3p, hsa-miR-432-5p, hsa-miR-140-3p, hsa-miR-370-3p, hsa-miR-196a-5p, hsa-miR-654-5p, hsa-miR-184, hsa-miR-181a-2-3p, and combinations thereof may be additionally expressed.

[0065] The particle size of the extracellular vesicles may be from about 10 nm to about 1000 nm. Specifically, the particle size of the extracellular vesicles may be from about 10 nm to about 1000 nm, from about 20 nm to about 900 nm, from about 30 nm to about 800 nm, from about 40 nm to about 700 nm, from about 50 nm to about 600 nm, or from about 60 nm to about 500 nm.

[0066] Pharmaceutical composition

[0067] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating fibrosis, comprising the extracellular vesicles as an active ingredient. The extracellular vesicles are the same as described above.

[0068] As used herein, the term "fibrosis" refers to the formation of excessive fibrous connective tissue in an organ or tissue. This can be distinguished from fibrous tissue as a normal component of the organ or tissue. Fibrosis can be understood as a fatal disease in which the excessive accumulation of extracellular matrix materials, such as fibronectin and collagen, by fibroblasts leads to the persistent loss of tissue function due to the stiffening of organ tissue.

[0069] The fibrosis may occur in any one or more selected from the group consisting of, for example, the kidneys, liver, lungs, skin, heart, pancreas, urinary system, reproductive system, sweat glands, nerves, brain, bone marrow, muscles, and joints.

[0070] In the present invention, the fibrosis may be liver fibrosis, pulmonary fibrosis, skin fibrosis, joint fibrosis, nerve fibrosis, pancreatic fibrosis, renal fibrosis, muscle fibrosis, or peritoneal fibrosis. Specifically, it may be pulmonary fibrosis, but is not limited thereto.

[0071] As used herein, the term "pulmonary fibrosis" refers to the development of scarred (fibrous) tissue in the lungs due to the formation or development of excessive fibrous connective tissue (fibrosis). Specifically, pulmonary fibrosis is a chronic disease that causes swelling and scarring of the alveoli and interstitial tissue of the lungs. This scar tissue replaces healthy tissue, causing inflammation, and chronic inflammation can be a precursor to fibrosis. This damage to lung tissue can cause the lungs to become stiff and make it difficult for the individual to breathe on their own.

[0072] Specifically, the pulmonary fibrosis may include, but is not limited to, any one or more selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis and diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and pulmonary fibrosis due to metabolic diseases.

[0073] In the present invention, the extracellular vesicles, which are the active ingredient of the pharmaceutical composition, may be included in any amount (effective amount) depending on the intended use, formulation, mixing purpose, etc., as long as they can exhibit anti-fibrosis activity. Typically, the effective amount of the extracellular vesicles will be determined within the range of 0.001 wt% to 20.0 wt% based on the total weight of the composition. Here, the "effective amount" refers to the amount of the active ingredient capable of inducing an anti-fibrosis effect. This effective amount can be experimentally determined within the normal capabilities of those skilled in the art.

[0074] As used herein, the term "treatment" may be used to encompass both therapeutic treatment and preventative treatment. In this context, prevention may be used to mean alleviating or reducing a pathological condition or disease in a subject. In one embodiment, the term "treatment" encompasses all applications or any form of medication for treating a disease in mammals, including humans. Furthermore, the term encompasses inhibiting or slowing the progression of a disease or condition; restoring or repairing damaged or defective functions, thereby partially or completely alleviating a disease; or stimulating an inefficient process; or alleviating a serious condition.

[0075] As used herein, the term "efficacy" may be determined by one or more parameters, such as survival or disease-free survival over a period of time, such as one year, five years, or ten years. Furthermore, the parameters may include suppression of the size of at least one tumor in a subject.

[0076] Pharmacokinetic parameters, such as bioavailability, and underlying parameters, such as clearance rate, can also influence efficacy. Therefore, "enhanced efficacy" (e.g., improved efficacy) can be attributed to improved pharmacokinetic parameters and enhanced efficacy, and can be measured by comparing clearance rates and tumor growth in test animals or human subjects, or by comparing parameters such as survival, relapse rate, or disease-free survival.

[0077] The pharmaceutical composition of the present invention can be administered orally or parenterally (e.g., intravenously, subcutaneously, intradermally, nasally, or intratracheally), depending on the intended method. Parenteral administration is preferred. The dosage varies depending on the patient's condition and weight, the severity of the disease, the drug form, the route of administration, and the time of administration, but can be appropriately selected by those skilled in the art.

[0078] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, a pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, concomitant drugs, and other factors well known in the medical field. The composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0079] Specifically, the preferred dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, sex, age, severity of the disease, and route of administration, and is generally about 0.001 mg to about 150 mg per kg of body weight, preferably about 0.01 mg to about 100 mg, administered daily or every other day, or divided into 1 to 3 times a day. However, since the dosage may increase or decrease depending on the route of administration, severity of the disease, sex, weight, age, etc., the dosage does not limit the scope of the present invention in any way.

[0080] The subject to which the above pharmaceutical composition can be applied (prescribed) may be a mammal, preferably a human. In addition to the active ingredient, the pharmaceutical composition of the present invention may additionally include any compound or natural extract that has already been proven safe and known to have anti-fibrotic activity, in order to increase and / or enhance anti-fibrotic activity.

[0081] The pharmaceutical composition may further include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be any non-toxic substance suitable for delivery to a patient. Examples of such carriers include distilled water, alcohol, fats, waxes, and inert solids. Pharmaceutically acceptable adjuvants (buffers, dispersants) may also be included in the pharmaceutical composition.

[0082] Specifically, the pharmaceutical composition may be prepared as a parenteral formulation according to the route of administration by a conventional method known in the art, including a pharmaceutically acceptable carrier in addition to the active ingredient. Here, "pharmaceutically acceptable" means that the composition does not inhibit the activity of the active ingredient and does not exhibit toxicity exceeding that to which the subject of application (prescription) can adapt.

[0083] When the above pharmaceutical composition is prepared as a parenteral dosage form, it can be formulated in the form of injections, transdermal administration, nasal inhalation, and suppositories using a suitable carrier according to a method known in the art. When formulated as an injection, suitable carriers include sterile water, ethanol, polyols such as glycerol or propylene glycol, or mixtures thereof, and preferably, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, sterile water for injection, and isotonic solutions such as 5% dextrose can be used. Methods for formulating pharmaceutical compositions are known in the art, and specific references may be made to literature [Remington's Pharmaceutical Sciences (19th ed., 1995)], etc. The above literature is considered to be a part of the present specification.

[0084] Another aspect of the present invention provides a use of the extracellular vesicles or a pharmaceutical composition comprising the extracellular vesicles as an active ingredient for preventing or treating fibrosis.

[0085] Another aspect of the present invention provides a method for preventing or treating fibrosis, comprising administering to a subject the extracellular vesicles or a pharmaceutical composition comprising the extracellular vesicles as an active ingredient. Here, the extracellular vesicles, the pharmaceutical composition, fibrosis, prevention, treatment, and administration are the same as described above. The subject may be a mammal, preferably a human. Furthermore, the subject may be a patient suffering from a disease or a subject at high risk of suffering from a disease.

[0086] In addition, the route of administration, dosage, and number of administrations can be administered to the subject in various ways and amounts depending on the patient's condition and the presence or absence of side effects, and the optimal administration method, dosage, and number of administrations can be selected within an appropriate range by a person skilled in the art.

[0087] Specifically, the preferred dosage of the extracellular vesicles or the pharmaceutical composition may vary depending on the patient's condition, weight, sex, age, severity of the disease, and route of administration, and is generally about 0.001 mg to about 150 mg per kg of body weight, preferably about 0.01 mg to about 100 mg, administered daily or every other day, or divided into 1 to 3 times a day. However, since the dosage may increase or decrease depending on the route of administration, severity of the disease, sex, weight, age, etc., the dosage does not limit the scope of the present invention in any way.

[0088] Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended only to illustrate the present invention and the present invention is not limited thereto.

[0089] Example 1. Isolation of extracellular vesicles from mesenchymal stem cells

[0090] Extracellular vesicles were isolated from umbilical cord-derived mesenchymal stem cells by a process as shown in Fig. 2.

[0091] Specifically, human umbilical cord-derived mesenchymal stem cells were cultured in CSBM-A06 (Sigma Aldrich) culture medium containing 10% fetal bovine serum (FBS, Gibco, 16000-044), 1% penicillin / streptomycin (P / Streptomycin, Gibco, 15140-122), and 1% GlutaMax (Gibco, 236320). After culture, the mesenchymal stem cells were washed with Dulbecco's phosphate buffered saline (DPBS, Gibco, 14040-177), replaced with medium containing 1% GlutaMax, and cultured for 48 hours before collecting the cell culture supernatant. The reason for using serum-free medium is that fetal bovine serum (FBS) contains a large amount of extracellular vesicles derived from fetal bovine serum, and this was to prevent the mixing of extracellular vesicles derived from FBS with extracellular vesicles secreted by stem cells.

[0092] The harvested cell culture medium was centrifuged at 300xg for 10 minutes to remove any remaining cells. The obtained supernatant was re-centrifuged at 2,000xg for 20 minutes to remove cell debris and filtered using a 0.2 um filter. The filtrate was centrifuged at 100,000xg, 4℃ for 70 minutes using an ultracentrifuge. After ultracentrifugation, the supernatant was removed, and the extracellular vesicle pellet remaining in the lower layer was suspended in DPBS and re-centrifuged at 100,000xg, 4℃ for 70 minutes. The supernatant was removed, and the extracellular vesicle pellet remaining in the lower layer was diluted in normal saline (Normal saline, Daehan Pharmaceutical) and used in the following experiments.

[0093] Example 2. Comparison of physical and biochemical properties of extracellular vesicles derived from mesenchymal stem cells.

[0094] The physical and biochemical properties of human mesenchymal stem cell-derived extracellular vesicles (hMSCs-EVs) were confirmed using a nanoparticle tracking analyzer, cryogenic transmission electron microscopy, Western blot, and flow cytometry in the same manner as in Example 1.

[0095] First, the size and number of particles of extracellular vesicles were measured using a nanoparticle tracking analyzer. As shown in Fig. 3, it was confirmed that the extracellular vesicles had an average size of less than 200 nm.

[0096] In addition, as a result of observing the cell membrane using a cryogenic transmission electron microscope, a double phospholipid membrane structure was observed in the extracellular vesicles, as shown in Fig. 4.

[0097] Expression of extracellular vesicle marker proteins was confirmed by Western blot. Antibodies used were anti-CD9 antibody (Santa Cruz, sc-13118), anti-CD63 antibody (Santa Cruz, sc-5275), anti-CD81 antibody (Santa Cruz, sc-7637), anti-GRP94 antibody (Santa Cruz, sc-32249), anti-β-actin antibody (Santa Cruz, sc-47778), or anti-Cytochrome C antibody (Santa Cruz, sc-13156).

[0098] As a result, as shown in Fig. 5, the expression of CD9, CD63, and CD81, which are marker proteins of extracellular vesicles (exosomes), was confirmed in the extracellular vesicle samples. In contrast, GRP94, Cytochrome C, and β-actin (for purity confirmation), proteins known to be not expressed in extracellular vesicles, were expressed only in cell samples.

[0099] Additionally, the phenotype of extracellular vesicles was reconfirmed using flow cytometry. Antibodies used were anti-CD9-PE antibody (BD, 555372), anti-CD63-PE antibody (BD, 556020), anti-CD81-APC antibody (BD, 551112), anti-GM130-PE antibody (Santa Cruz, sc55590), and anti-Calnexin-FITC antibody (Santa Cruz, sc-23954). PE-isotype IgG1 (BD Biosciences, 555749), APC-isotype IgG1 (BD Biosciences, 555751), or FITC-isotype IgG1 (BD Biosciences, 555748), respectively.

[0100] As a result, as shown in Fig. 6, it was confirmed that CD9, CD63, and CD81, which are extracellular vesicle marker proteins, were expressed at more than 90% in the extracellular vesicle sample, and GM130 and Calnexin, which are proteins for confirming purity, were expressed at less than 10%.

[0101] Example 3. Isolation of extracellular vesicles from mesenchymal stem cells

[0102] In order to evaluate the internal factors of the human mesenchymal stem cell-derived extracellular vesicles (hMSCs) isolated in Example 1 above, small RNA sequencing was performed to analyze the types and expression levels of microRNAs.

[0103] Specifically, RNA quality control (QC) testing was performed on extracellular vesicles using the Bioanalyzer 2100 system. Total RNA was extracted according to the analytical company's protocol, and a cDNA library was constructed from samples that passed the QC test and analyzed using next-generation sequencing (NGS) technology. The results were used to conduct a comparative analysis of the entire microRNA profile.

[0104] As a result, as shown in Figures 7a and 7b, it was confirmed that 50 microRNAs were contained within the extracellular vesicles. In particular, it was confirmed that among the microRNAs, miR-148a-3p, let-7a-5p, let-7b-5p, miR-100-5p, miR-143-3p, and let-7f-5p were contained in large quantities.

[0105] Example 4. In vitro evaluation of the therapeutic efficacy of human mesenchymal stem cell-derived extracellular vesicles for pulmonary fibrosis

[0106] Example 4.1. Gene expression analysis of fibrosis-related factors

[0107] In order to confirm the inhibitory effect of the extracellular vesicles obtained by the method of Example 1 on pulmonary fibrosis, an in vitro model such as the pathological mechanism of EMT and FMT using pulmonary epithelial cells was constructed, and the efficacy of treating pulmonary fibrosis was evaluated.

[0108] Specifically, 2 x 10 human lung epithelial cells (A549 cells) or human lung fibroblast cells (NHLF cells) were seeded in 6 wells. 5 After inoculating at a concentration of 10 cells / well, the cells were cultured for 24 hours under 5% CO2 and 37°C conditions. Then, the cell culture medium was removed, washed twice with PBS, and TGF-β1 (Transforming growth factor β1) (10 ng / ml) and hMSCs-EV (1 x 10) prepared by the method of Example 1 were added. 8 Particles / mL, 1 x 10 9(particles / mL) were treated. After 48 hours of additional culture, the cell culture medium was removed and washed with PBS. RNA was extracted from the cells using the Easy-BLUE Total RNA Extraction kit (Intron Bio) according to the protocol provided by the manufacturer, and RNA was quantified using Nanodrop. cDNA synthesis was performed using Maxime RT Premix (Oligo dT primer) using the RNA (1 ug) as a template through a nucleic acid amplification device according to the protocol provided by the manufacturer. The nucleic acid amplification device was operated at 45°C for 60 minutes and 95°C for 5 minutes. The cDNA after the reaction was diluted 1 / 5 in DEPC-treated water (80 uL) and used as sample cDNA. The gene expression levels of each sample were analyzed by q-PCR using primers for TGF-β1, Fibronectin, α-SMA (smooth muscle actin), CTGF (connective tissue growth factor), COL3A1 (collagen type III alpha 1 chain), E-cadherin, and GAPDH. The primer sequences used are shown in Table 1.

[0109] Gene identification primer sequence (5' to 3') Species sequence number TGF-β1 FTACCTGAACCCGTGTTGCTCTC Human 1 RGTTGCTGAGGTATCGCCAGGA2 Vimentin FAGGCAAAGCAGGAGTCCACTGA Human 3 RATCTGGCGTTCCAGGGACTCAT4 CTGFFCTTGCGAAGCTGACCTGGAAGA Human 5 RCCGTCGGTACATACTCCACAGA6 COL3 A1 FGACCCTAACCAAGGATGCAA Human 7 RGGAAGTTCAGGATTGCCGTA8 E-cadherin FGCCT CCTGAAAAGAGAGTGGAAGHuman9RTGGCAGTGTCTCTCCAAATCCG10GAPDHFGTCTCCTCTGACTTCAACAGCGHuman11RACCACCCTGTTGCTGTAGCCAA12COL1A1FTCCTCCAGGGATCCAACGAMouse13RGGCAGGCGGGAGGTCTT14COL3A1FGTGAAACTGGTGAACGTGGCMouse15RATAGGACCTGGATGCCCACT16CTGFFGGGCCTCTTCTGCGATTTCMouse17RATC CAGGCAAGTGCATTGGTA18ElastinFTTGCTGATCCTCTTGCTCAACmouse19RGCCCCTGGATAATAGACTCCAC20RPL13AFCCCTCACCCTATGACAAGAmouse21RCCTTTTTCCTT CCGTTTCTCC22Timp1FGCAACTCGGACCTGGTCATAAmouse23RCGGCCCGTGATGAGAAACT24α-SMAFGTCCCAGACATCAGGGAGTAAmouse25RTCGGATACTTCAGCGTCAGGA26 FibronectinFTGACGCTGGCTTTAAGCTCAMouse27RTCATCCGCTGGCCATTTTCT28FibronectinFACAACACCGAGGTGACTGAGAHuman29RGGACACAACGATGCTTCCTGAG30α-SMAFCTTTCTACAATGAGCTTCGTGHuman31RATTTGAGTCATTTTCTCCCG32β-actinFTGGAATCCTGTGGCATCCATGAAACMouse33RTAAAACGCAGCTCAGTAACAGTCCG34

[0110] As a result, as shown in Fig. 8, it was confirmed that the gene expression of fibrosis-related factors was significantly reduced in the TGF-β1+hMSCs-EV treatment group compared to the TGF-β1 alone treatment group.

[0111] Example 4.2. Analysis of wound healing effects

[0112] To confirm the epithelial-mesenchymal transition (EMT) inhibitory effect of the extracellular vesicles obtained by the method of Example 1, a wound closure experiment was performed.

[0113] Specifically, A549 cells were seeded at 6 x 10 in 6-well plates. 5 After inoculation at a concentration of 10 cells / well, the cells were cultured for 24 hours under 5% CO2 and 37°C conditions. After 24 hours, a single cell layer was scraped with a 200 uL pipette tip to create a scratch. After removing the cell culture medium, the cells were washed twice with PBS and incubated with TGF-β1 (10 ng / mL) and hMSCs-EVs (1 x 10) prepared by the method of Example 1. 8 Particles / mL, 1 x 10 9 (particles / mL) and cultured for an additional 48 hours. Cells were observed under a microscope and photographed during the culture period (0 h, 24 h, and 48 h).

[0114] As a result, as shown in Fig. 9, it was confirmed that wound healing was delayed in a concentration- and treatment time-dependent manner in the TGF-β1+hMSCs-EV treatment group compared to the TGF-β1 only treatment group.

[0115] Example 4.3. Analysis of cell invasion inhibition effect

[0116] The cell invasion (migration and invasion) inhibition effect of the extracellular vesicles obtained by the method of Example 1 was confirmed.

[0117] Specifically, a 0.8 μm pore size Transwell (Corning) was used to confirm invasion and migration. The cell medium used in the migration assay was serum-free DMEM / High glucose medium supplemented with TGF-β1 (10 ng / mL) and hMSCs-EVs (1 x 10) using the method of Example 1. 8 Particles / mL, 1 x 10 9 particles / mL) were treated and prepared. A549 cells were cultured at 5 x 10 4 The cells were suspended in the medium prepared as above to make 300 uL and loaded into the upper chamber of the transwell, and DMEM / High glucose medium (700 uL) supplemented with 10% FBS was loaded into the lower chamber, and the two chambers were combined. After culturing for 24 hours at 37°C and 5% CO2, the cells were fixed with 70% ethanol and stained with crystal violet solution. The membrane of the upper chamber was then wiped with a cotton swab and observed under a microscope to count the number of cells present within the membrane.

[0118] The invasion assay was performed by coating the upper chamber of the transwell with 100 uL (20 ug / well) of Matrigel, and then performing the experiment using the same method as the invasion assay.

[0119] As a result, as shown in Fig. 10, it was confirmed that cell migration and invasion were reduced in the TGF-β+hMSCs-EV treatment group compared to the TGF-β alone treatment group.

[0120] Example 4.4. Analysis of cell invasion inhibition effect

[0121] In order to confirm the mechanism of action of the extracellular vesicles obtained by the method of Example 1 above on the inhibition of epithelial-mesenchymal transition (EMT), the expression of fibrosis-related proteins was confirmed through Western blot.

[0122] Specifically, A549 cells were seeded at 2 x 10 in 6 wells. 5 After inoculating at a concentration of 10 cells / well, the cells were cultured for 24 hours under 5% CO2 and 37°C conditions. The culture medium was removed, washed twice with PBS, and then TGF-β1 (10 ng / mL) and hMSCs-EVs (1 x 10) prepared by the method of Example 1 were added. 8 Particles / mL, 1 x 10 9 (particles / mL) was treated to the cells. After 48 hours of additional culture, the culture medium was removed and washed with PBS. The cells were scraped with a scraper, collected in a 15 mL tube, centrifuged, the supernatant was removed, and the cell pellet was resuspended in RIPA solution containing protease inhibitors. The suspension was vortexed and incubated on ice for 30 minutes (vortexed once every 10 minutes) and then centrifuged (13,000 rpm, 30 minutes, 4°C). The supernatant was collected and protein quantified using the Bradford assay (BioRad).

[0123] The protein (30 µg) obtained through the above process was electrophoresed using a 10% SDS-PAGE gel and transferred to a PVDF (Polyvinylidene difluoride) membrane. After transfer, the membrane was blocked with blocking buffer (TBST buffer containing 5% skim milk powder) at room temperature for 1 hour, and then the primary antibody was added and reacted overnight at 4°C. At this time, the primary antibodies used were anti-TGFβ1 antibody (Abcam, ab92486), anti-Fibronectin antibody (Abcam, ab2413), anti-COL1A1 antibody (Abcam, ab34710), anti-E-cadherin antibody (Cell Signaling, 3195S), anti-p-Smad2 antibody (Cell Signaling, 3108T), anti-Smad2 antibody (Cell Signaling, 5339T), or anti-β-actin antibody (Santa Cruz, sc-47778).

[0124] After primary antibody reaction, the sections were washed three times with TBST (Tris-buffered saline and Tween 20) solution, and then incubated with secondary antibodies for 1 hour at room temperature. Anti-mouse antibodies (Cell Signaling, 7076s) or anti-rabbit antibodies (Cell Signaling, 7074s) were used as secondary antibodies. Protein expression was then confirmed by chemiluminescence imaging using ECL solution.

[0125] At this time, β-actin was used as an indicator to confirm the protein amount of each sample loaded in equal amounts. TGF-β1 was used as an EMT inducer, and TGF-β1, Fibronectin, and COL1A1 were used as fibrosis markers. In addition, E-cadherin was used as an epithelial cell marker, and p-Smad2 and Smad2 were used as EMT downstream signaling-related proteins by TGF-β.

[0126] As a result, as shown in Fig. 11, it was confirmed that the expression of Fibronectin, COL1A1, p-Smad2, and TGF-β1, which are markers of mesenchymal cells, increased by treatment with TGF-β1. On the other hand, it was confirmed that the expression of markers of mesenchymal cells increased by TGF-β1 decreased and the expression of E-cadherin, a marker of epithelial cells, increased by treatment with extracellular vesicles.

[0127] Example 4.5. Cell immunofluorescence staining analysis

[0128] In order to confirm the mechanism of action of the extracellular vesicles obtained by the method of Example 1 above on the inhibition of epithelial-mesenchymal transition (EMT), the expression of fibronectin was confirmed through cell immunofluorescence staining.

[0129] Specifically, A549 cells were seeded at 2 x 10 in 6 wells. 5 After inoculation at a concentration of 10 cells / well, the cells were cultured for 24 hours under 5% CO2 and 37°C conditions. The culture medium was removed, washed twice with PBS, and then hMSCs-EVs (1 x 10) were cultured with TGF-β1 (10 ng / mL) and the method of Example 1. 8 Particles / mL, 1 x 10 9 (particles / mL) were treated to the cells. After an additional 48-hour incubation, the culture medium was removed and washed with PBS. The cells were fixed with 4% paraformaldehyde for 15 minutes and washed three times with PBS. Blocking solution was added, blocked at 60 rpm for 30 minutes, and washed three times with PBS. The primary antibody diluted 1:1000 was reacted overnight at 4°C. The primary antibody used was an anti-Fibronectin antibody (Abcam, ab2413).

[0130] After the primary antibody reaction, the sections were washed three times with PBS, and then the secondary antibody was diluted 1:1000 and incubated for 1 hour at room temperature, protected from light. The secondary antibody used was an anti-rabbit antibody (Invitrogen, A11008). After washing three times with PBS, DAPI (ThermoScientific, 62248) was added and incubated for 5 minutes at room temperature, protected from light, to stain the nuclei. After washing three times with PBS, the sections were observed using a fluorescence microscope.

[0131] As a result, as shown in Fig. 12, it was confirmed that the expression of Fibronectin was reduced in the TGF-β1+hMSCs-EV treatment group compared to the TGF-β1 treatment group.

[0132] Example 5. Evaluation of the therapeutic efficacy of pulmonary fibrosis by increasing microRNA expression in vitro.

[0133] Example 5.1. Production of lung epithelial cells and lung fibroblasts with increased microRNA expression

[0134] To confirm the therapeutic effect of pulmonary fibrosis according to increased microRNA expression in lung epithelial cells or lung fibroblasts, microRNA (miR-148a-3p (SEQ ID NO: 35), miR-100-5p (SEQ ID NO: 38), miR-143-3p (SEQ ID NO: 39), let-7a-5p (SEQ ID NO: 36), let-7b-5p (SEQ ID NO: 37), or let-7f-5p (SEQ ID NO: 40)) was first transduced into A549 cells (Fig. 13) and lung fibroblasts (NHLF) (Fig. 14), respectively, and then gene expression analysis was performed to confirm whether the transduced microRNAs were overexpressed.

[0135] Specifically, A549 cells, a human lung epithelial cell line, or Normal human lung fibroblast (NHLF) cells, a human lung fibroblast cell line, were seeded at 1 x 10 in a 6-well plate. 5After inoculating cells / well, they were cultured for 24 hours at 37°C in 5% CO2. Afterwards, the culture medium in each well was removed, the cells were washed twice with PBS, and the lentivirus (VectorBuilder) containing each microRNA to be overexpressed was diluted in serum-free medium and treated to each well at a concentration of MOI 10. After 6 hours, the culture medium in each well was removed, the cells were washed twice with PBS, and then serum-containing medium was added and cultured for 48 hours at 37°C in 5% CO2.

[0136] Afterwards, the cell culture medium from each well was removed and washed twice with PBS, and then RNA was extracted. At this time, RNA was extracted using the miRNeasy Tissue / Cells Advanced Micro Kit (QIAGEN) according to the protocol provided by the manufacturer, and the extracted RNA was quantified using Nanodrop. cDNA synthesis was performed using a nucleic acid amplifier using 200 ng of RNA using the miRCURY LNA RT Kit (QIAGEN) according to the protocol provided by the manufacturer (reaction at 40°C for 60 minutes and 95°C for 5 minutes). The cDNA synthesized as above was diluted 1 / 60 and used as template cDNA. Gene expression was analyzed using a real-time nucleic acid polymerase chain reaction (PCR) using the miRCURY LNA SYBR Green PCR Kit (QIAGEN) with miR-148a-3p, let-7a-5p, let-7b-5p, miR-100-5p, miR-143-3p, or let-7f-5p, and U6 primer (QIAGEN).

[0137] As a result, as shown in Figures 13 and 14, it was confirmed that the expression of the transfected microRNA increased in A549 cells and NHLF cells overexpressing each microRNA.

[0138] Example 5.2. Confirmation of changes in fibrosis-related gene expression due to increased microRNA expression in vitro.

[0139] A549 cells or NHLF cells overexpressing each microRNA were treated with TGF-β1 (10 ng / mL) in the same manner as in Example 5.1. After 24 hours, the gene expression of TGF-β1, Fibronectin, α-SMA, Vimentin, CTGF (Connective tissue growth factor), E-cadherin, or U6 was confirmed through q-PCR in the same manner as in Example 4.1. The primer sequences used at this time are shown in Table 1.

[0140] As a result, in the case of A549 cells, as shown in Fig. 15a and Fig. 15b, compared to the Scramble treatment group, in miR-148a-3p overexpressing cells, the expression of TGF-β1, Vimentin, and CTGF increased by TGF-β1 treatment decreased, and the expression of E-cadherin increased. In miR-143-3p overexpressing cells, the expression of α-SMA decreased, in let-7a-5p overexpressing cells, the expression of TGF-β1 decreased, and in let-7b-5p overexpressing cells, the expression of TGF-β1 and Vimentin decreased.

[0141] In the case of NHLF cells, as shown in Fig. 16, compared to the Scramble treatment group, the expression of TGF-β1, Vimentin, Fibronectin, and COL3A1, which were increased by TGF-β1 treatment, decreased in miR-148a-3p overexpressing cells, and the expression of TGF-β1, α-SMA, Vimentin, and COL3A1 decreased in miR-100-5p overexpressing cells. In addition, the expression of TGF-β1, α-SMA, Vimentin, CTGF, Fibronectin, and COL3A1 decreased in miR-143-3p overexpressing cells, and the expression of Vimentin and COL3A1 decreased in let-7b-5p overexpressing cells. The expression of Fibronectin and COL3A1 decreased in let-7f-5p overexpressing cells.

[0142] Example 5.3. Confirmation of changes in fibrosis-related protein expression due to increased microRNA expression in vitro.

[0143] A549 cells or NHLF cells overexpressing each microRNA were treated with TGF-β1 (10 ng / mL) in the same manner as in Example 5.1. After 24 hours, the medium in each well was removed, washed with PBS, and then PBS (1 mL) was applied to each well again, and the cells were harvested using a scraper. Western blotting was performed on the cells obtained in the above manner in the same manner as in Example 4.4.

[0144] At this time, the primary antibodies used were anti-TGFβ1 antibody (Abcam, ab92486), anti-Vimentin antibody (Cell Signaling, 5741S), anti-CTGF antibody (Abcam, ab6992), anti-E-cadherin antibody (Cell Signaling, 3195S), anti-p-Smad2 antibody (Cell Signaling, 3108T), anti-Smad2 antibody (Cell Signaling, 5339T), or anti-β-actin antibody (Santa Cruz, sc-47778). TGF-β1 was used as an EMT inducer, and TGF-β1, α-SMA, CTGF, E-cadherin, and Vimentin were used as evaluation markers. In addition, p-Smad2 was used to confirm whether the EMT sub-mechanism was inhibited by TGF-β.

[0145] As a result, in the case of A549 cells, as shown in Fig. 17 (A549), it was confirmed that the protein expression of TGF-β1 and Vimentin was decreased in cells overexpressing miR-148a-3p, let-7a-5p, let-7b-5p, miR-100-5p, or miR-143-3p compared to the Scramble treatment group. In addition, in the case of NHLF cells, as shown in Fig. 18, it was confirmed that the protein expression of TGF-β1 and α-SMA was decreased in cells overexpressing miR-148a-3p, miR-100-5p, or miR-143-3p compared to the Scramble treatment group. On the other hand, it was confirmed that the expression of SMAD7, which can suppress the expression of TGF-β, was increased.

[0146] Example 6. In vivo evaluation of the therapeutic efficacy of human mesenchymal stem cell-derived extracellular vesicles for pulmonary fibrosis.

[0147] Example 6.1. Evaluation of the therapeutic efficacy of pulmonary fibrosis in an animal model of pulmonary fibrosis created through intraperitoneal administration of bleomycin.

[0148] Example 6.1.1. Establishment of an animal model of pulmonary fibrosis and administration of extracellular vesicles

[0149] In order to confirm the therapeutic effect of the extracellular vesicles obtained by the method of Example 1 on pulmonary fibrosis, an animal model of pulmonary fibrosis was created, and the therapeutic effect of the extracellular vesicles on pulmonary fibrosis was evaluated using this model.

[0150] Specifically, as shown in the animal experiment schematic of Fig. 19, a lung fibrosis model was created by intraperitoneally administering bleomycin (BLM), known to induce lung fibrosis, at a concentration of 25 units / kg (100 uL) to 8-week-old male C57BL / 6 mice (25 g) once daily for a total of 6 days. The extracellular vesicles to be used in the experiment were the extracellular vesicles obtained by the method of Example 1, at a concentration of 2 x 10 per mouse. 10 It was prepared as an injection by dispersing it in saline solution so that it can be administered at a concentration of 1 particle / milligram.

[0151] Extracellular vesicles (2 x 10) prepared as above 10 Each of the particles / animal) was administered intravenously as a single dose of 100 μL per animal to the above pulmonary fibrosis model mice (16 days after the start of bleomycin administration). During the administration and observation period, general symptoms and body weight were observed once a day, and recorded for each animal for 8 days. On the 8th day after the administration of extracellular vesicles (24 days after the start of bleomycin administration), lung tissues were collected from the mice and subjected to soluble collagen assay and Masson's Trichrome staining to confirm the therapeutic effect of extracellular vesicles on pulmonary fibrosis.

[0152] Example 6.1.2. Confirmation of changes in gene expression of fibrosis-related factors in lung tissue.

[0153] Lung tissue was obtained from the experimental mice of Example 6.1.1 above, and gene expression of fibrosis-related factors in the lung tissue was confirmed through q-PCR.

[0154] Specifically, the right middle lobe of the lung tissue of the experimental mouse of Example 6.1.1 was extracted and ground using a homogenizer. Trizol solution (1 mL) was added to the ground tissue sample and reacted overnight at -80℃. Then, RNA was extracted using an RNA extraction kit, and after measuring the RNA concentration, cDNA was synthesized according to the protocol provided by the manufacturer. The gene expression level in each sample was confirmed through q-PCR using primers for COL1A1 (Collagen type I alpha 1 chain), COL3A1, CTGF, Elastin, and RPL13A (Ribosomal protein L13a). The primer sequences used at this time are shown in Table 1.

[0155] As a result, as shown in Fig. 20, it was confirmed that the gene expression of COL1A1, COL3A1, CTGF, and Elastin increased by bleomycin (BLM) administration, and the expression of the increased genes decreased by BLM+hMSCs-EV administration.

[0156] Example 6.1.3. Confirmation of collagen deposition in lung tissue using an available collagen assay.

[0157] Lung tissue was obtained from the experimental mouse of Example 6.1.1 above, and the concentration of collagen present in the lung tissue was measured through a soluble collagen assay.

[0158] Specifically, the right middle lobe of the lung of the experimental mouse of Example 6.1.1 was extracted and the extracted tissue was ground using a homogenizer. The ground tissue was treated with a Pepsin-ascorbic acid solution and reacted overnight at 4°C. Then, after centrifugation at 3,000xg for 10 minutes, the supernatant was obtained. The supernatant (100 uL) and Sircol dye reagent (1 uL) were mixed and reacted at room temperature for 30 minutes while rocking. After the reaction was completed, centrifugation was performed at 13,000xg for 10 minutes, the entire supernatant was removed, and Acid-salt wash reagent (750 uL) was added and vortexed to mix. The mixture was centrifuged again at 13,000xg for 10 minutes, the supernatant was removed, Alkali reagent (1 uL) was added, and vortexed to mix. The above mixture (200 uL) was transferred to a 96-well plate and the absorbance (556 nm) was measured using a microplate reader.

[0159] As a result, as shown in Fig. 21, it was confirmed that the collagen concentration contained in lung tissue increased by bleomycin (BLM) administration, but significantly decreased by BLM+hMSCs-EV administration.

[0160] Example 6.1.4. Confirmation of collagen deposition in lung tissue using Masson's trichrome staining.

[0161] Collagen deposition in the lung tissue of the experimental mouse of Example 6.1.1 above was confirmed using the Masson's trichrome staining method.

[0162] Specifically, the left lobe of the lung tissue of the experimental mouse of Example 6.1.1 was removed and fixed by treating with a 4% paraformaldehyde solution. The fixed mouse lung tissue was cut into 4 μm thick sections to prepare paraffin tissue sections.

[0163] Paraffin was removed from the tissue sections, and after a water treatment, they were washed with water. The washed tissue sections were treated with Bouin's solution, refixed at 56°C for 1 hour, and washed in running water for 5 to 10 minutes. The tissue sections were then stained with Weigert's iron hematoxylin solution for 10 minutes, washed in running water for 10 minutes, and washed again with distilled water. Next, the tissue sections were treated with Biebrich scarlet-acid fuchsin solution, stained for 10 to 15 minutes, and washed again with distilled water. After reacting with a phosphomolybdic-phosphotungstic acid solution for 10 to 15 minutes, they were reacted with an aniline blue solution for 5 to 10 minutes. The stained tissue sections were washed with distilled water and reacted with a 1% acetic acid solution for 2 to 5 minutes. Then, the dehydration process was performed by treating with 95% ethanol, and after treating with a xylene solution, it was mounted with a mounting solution and observed under a microscope.

[0164] As a result, as shown in Figure 22, in the bleomycin (BLM)-administered group, a stained collagen area was observed over a wide area. In contrast, in the BLM+hMSCs-EV-administered group, the degree of collagen deposition in lung tissue was confirmed to be reduced to a level similar to that in the normal group.

[0165] Example 6.2. Evaluation of the therapeutic efficacy of pulmonary fibrosis in an animal model of pulmonary fibrosis created by intrabronchial administration of bleomycin.

[0166] Example 6.2.1. Establishment of an animal model of pulmonary fibrosis and administration of extracellular vesicles

[0167] In order to confirm the therapeutic effect of the extracellular vesicles obtained by the method of Example 1 on pulmonary fibrosis, a pulmonary fibrosis animal model was created, and the therapeutic effect of the extracellular vesicles on pulmonary fibrosis was evaluated using the created pulmonary fibrosis animal model.

[0168] Specifically, a lung fibrosis model was created by intratracheally administering bleomycin (BLM), known to induce lung fibrosis, at a concentration of 1 mg / kg (100 μL) once a day to 8-week-old male C57BL / 6N mice (Fig. 23). The extracellular vesicles used in the experiment were obtained by the method of Example 1, and administered at a concentration of 1 x 10 per mouse. 3 particles, 1 x 10 5 Particle or 1 x 10 7 It was prepared by dispersing it in saline solution so that it could be administered as particles and making it into an injection.

[0169] Extracellular vesicles prepared as above (1 x 10 3 , 1 x 10 5 , 1 x 10 7 Each of the particles / mice was administered intravenously as a single dose of 100 μL per mouse to the above-mentioned pulmonary fibrosis model mice (8 days after the start of bleomycin administration). During the administration and observation period, general symptoms and body weight were observed once a day and recorded for each animal. On the 13th day after the administration of extracellular vesicles (21 days after the start of bleomycin administration), lung tissues of the mice were collected to confirm the morphology (Fig. 24), and the therapeutic effect of extracellular vesicles on pulmonary fibrosis was confirmed through the confirmation of fibrosis marker gene and protein expression, soluble collagen assay, and Masson's trichrome staining.

[0170] Example 6.2.2. Confirmation of changes in gene expression of fibrosis-related factors in lung tissue.

[0171] Lung tissue was obtained from the experimental mice of Example 6.2.1 above, and gene expression of fibrosis-related factors in the lung tissue was confirmed through q-PCR.

[0172] Specifically, the right middle lobe of the lung tissue of the experimental mouse of Example 6.2.1 was extracted and ground using a homogenizer. Trizol solution (1 mL) was added to the ground tissue sample and reacted overnight at -80°C. Then, RNA was extracted using an RNA extraction kit, and after measuring the RNA concentration, cDNA was synthesized according to the protocol provided by the manufacturer. The gene expression level in each sample was confirmed through q-PCR using primers for COL1A1 (Collagen type I alpha 1 chain), α-SMA, Timp, and Fibronectin. The primer sequences used at this time are shown in Table 1.

[0173] As a result, as shown in Figure 25, it was confirmed that the gene expression of COL1A1 (Collagen type I alpha 1 chain), Timp, and Fibronectin increased by bleomycin (BLM) administration, and that the expression of the increased genes decreased by hMSCs-EV administration.

[0174] Example 6.2.3. Confirmation of expression of fibrosis-related proteins in lung tissue

[0175] The right middle lobe of the lung of the experimental mouse of Example 6.2.1 was extracted, and the extracted tissue was pulverized using RIPA buffer and a homogenizer. The pulverization was performed for 20 minutes at 2-8°C, and the protein in the upper layer was separated and used by centrifugation at 13,000 rpm for 15 minutes.

[0176] Protein samples were subjected to Western blotting in the same manner as in Example 4.4 to confirm the expression of fibrosis-related proteins. The primary antibodies used were anti-Timp1 antibody (Cell signaling, #63363), anti-α-SMA antibody (Abcam, ab5694), anti-Col1a1 antibody (Abcam, ab260043), anti-Fibronectin antibody (Abcam, ab2413), and anti-GAPDH antibody (Cell signaling, #2118), and the secondary antibody used was anti-rabbit IgG, HRP-linked antibody (Cell signaling, 7074S).

[0177] As a result, as shown in Figures 26a and 26b, it was confirmed that the expression of fibrosis-related proteins (α-SMA, COL1A1, Timp1, and Fibronectin) was reduced in the BLM+hMSCs-EV administration group compared to the bleomycin (BLM) administration group.

[0178] Example 6.2.4. Determination of the concentration of soluble collagen in lung tissue

[0179] The inferior lobe and superior lobe of the lung of the experimental mouse of the above Example 6.2.1 were extracted, the extracted tissue was pulverized using a homogenizer, and the concentration of soluble collagen in the tissue was measured using the same method as in the above Example 6.1.3.

[0180] As a result, as shown in Figure 27, it was confirmed that the concentration of collagen was reduced in both the inferior lobe and superior lobe of the BLM+hMSCs-EV administration group compared to the bleomycin (BLM) administration group.

[0181] Example 6.2.5. Pathological morphology of lung tissue using hematoxylin and eosin staining.

[0182] The left lobe of the lung of the experimental mouse of Example 6.2.1 was extracted, and tissue sections were prepared in the same manner as in Example 6.1.4, and stained with hematoxylin and eosin. At this time, Weigert's iron hematoxylin working solution was applied, and the tissue sections were stained for 30 seconds with eosin working solution, and then washed in running water for 3 minutes. Afterwards, dehydration (ethanol 70% (2 minutes), ethanol 80% (2 minutes), ethanol 90% (2 minutes), ethanol 100% (2 minutes), xylene (3 minutes)) was performed, and after mounting, the pathological morphology of the lung tissue was confirmed through a microscope. In addition, the observation results were expressed as Ashcroft scores (Fig. 28).

[0183] Example 6.2.6. Confirmation of collagen expression sites in lung tissue using Masson's trichrome staining.

[0184] The collagen expression site in the lung tissue of the experimental mouse of Example 6.2.1 above was confirmed through Masson's trichrome staining in the same manner as Example 6.1.4 above.

[0185] As a result, as shown in Fig. 29, the collagen area in the lung tissue of the BLM+hMSCs-EV administration group was significantly reduced compared to the bleomycin (BLM) administration group, and it was confirmed that this was at a level almost similar to that of the normal group.

[0186] Through the above results, it was confirmed that extracellular vesicles isolated from human mesenchymal stem cells have the effect of improving or treating pulmonary fibrosis.

Claims

1. Extracellular vesicles overexpressing any one microRNA selected from the group consisting of hsa-miR-148a-3p, hsa-miR-100-5p, hsa-miR-143-3p, hsa-let-7a-5p, hsa-let-7f-5p, and combinations thereof.

2. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle comprises hsa-miR-148a-3p at 1 to 20% of the total microRNA of the extracellular vesicle.

3. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle comprises hsa-miR-100-5p at 1 to 20% of the total microRNA of the extracellular vesicle.

4. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle comprises hsa-miR-143-3p in an amount of 0.1 to 10% of the total microRNA of the extracellular vesicle.

5. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle comprises hsa-let-7a-5p in an amount of 0.1 to 10% of the total microRNA of the extracellular vesicle.

6. In paragraph 1, An extracellular vesicle, wherein the extracellular vesicle comprises hsa-let-7f-5p in an amount of 0.1 to 10% of the total microRNA of the extracellular vesicle.

7. In paragraph 1, The above microRNA is an extracellular vesicle that exhibits anti-fibrosis activity.

8. In paragraph 1, The extracellular vesicles include hsa-miR-151a-3p, hsa-let-7b-5p, hsa-miR-21-5p, hsa-miR-10a-5p, hsa-miR-92a-3p, hsa-miR-486-5p, hsa-miR-99b-5p, hsa-let-7i-5p, hsa-miR-320a, hsa-miR-409-3p, hsa-miR-10b-5p, hsa-miR-127-3p, hsa-miR-26a-5p, hsa-miR-221-3p, hsa-let-7e-5p, hsa-miR-493-5p, hsa-miR-25-3p, hsa-miR-574-3p, hsa-miR-423-5p, hsa-miR-122-5p, hsa-miR-382-5p, hsa-miR-155-5p, hsa-miR-451a, hsa-miR-30a-3p, hsa-miR-28-3p, hsa-let-7g-5p, hsa-miR-379-5p, hsa-miR-23a-3p, hsa-miR-485-5p, hsa-miR-30a-5p, hsa-miR-30d-5p, hsa-miR-423-3p, hsa-miR-99a-5p, hsa-let-7c-5p, hsa-miR-92b-3p, hsa-miR-323a-3p, hsa-miR-574-5p, hsa-miR-197-3p, An extracellular vesicle, wherein any one microRNA selected from the group consisting of hsa-miR-432-5p, hsa-miR-140-3p, hsa-miR-370-3p, hsa-miR-196a-5p, hsa-miR-654-5p, hsa-miR-184, hsa-miR-181a-2-3p, and combinations thereof is additionally expressed.

9. In paragraph 1, The above extracellular vesicles are extracellular vesicles isolated from human-derived stem cells.

10. In paragraph 9, The above stem cells are mesenchymal stem cells, extracellular vesicles.

11. In paragraph 10, The above mesenchymal stem cells are extracellular vesicles derived from umbilical cord, umbilical cord blood, bone marrow, fat, muscle, nerve, skin, amniotic membrane, teeth, hair root cells or placenta, or differentiated from induced pluripotent stem cells.

12. In paragraph 1, Extracellular vesicles, wherein the particle size of the extracellular vesicles is 10 nm to 1000 nm.

13. A pharmaceutical composition for preventing or treating fibrosis, comprising the extracellular vesicle of paragraph 1 as an active ingredient.

14. In paragraph 13, A pharmaceutical composition for preventing or treating fibrosis, wherein the above fibrosis is pulmonary fibrosis.

15. In paragraph 13, A pharmaceutical composition for preventing or treating fibrosis, wherein the pulmonary fibrosis is at least one selected from the group consisting of idiopathic pulmonary fibrosis, radiation-induced lung injury, nonspecific interstitial pneumonia, acute interstitial pneumonia, cryptogenic organizing pneumonia, respiratory bronchiolitis-associated interstitial lung, desquamative interstitial pneumonia, lymphoid interstitial pneumonia, interstitial pulmonary fibrosis and diffuse pulmonary fibrosis, pulmonary edema, cystic fibrosis, and pulmonary fibrosis due to metabolic diseases.

16. Use of the extracellular vesicles of paragraph 1 for preventing or treating fibrosis.

17. A method for preventing or treating fibrosis, comprising administering the extracellular vesicle of paragraph 1 to an individual.

Images