Composition for diagnosing liver cancer using methylation change of sort1 gene promoter and use thereof

Abstract

The present invention relates to a composition for diagnosing liver cancer using a methylation change of a SORT1 gene promoter and a use thereof, and the present invention has enabled: establishment of a systematic research method and technique for investigating growth and proliferation of liver cancer, apoptosis, metastasis inhibition, and a signaling pathway; confirmation of whether SORT1, which is a target gene, shows clinical significance, on the basis of a basic experiment; and prediction or diagnosis of liver cancer with high accuracy by measuring the methylation degree of the SORT1 gene, specifically cg16988986 in a promoter region of the SORT1 gene. Therefore, a methylation change of the SORT1 gene promoter is highly likely to be used as a target for diagnosing liver cancer.

Description

Composition for diagnosing liver cancer using methylation changes in the SORT1 gene promoter and use thereof

[0001] The present invention relates to a composition for diagnosing liver cancer using methylation changes in the SORT1 (Sortilin 1) gene promoter and its use.

[0002] Liver cancer is the fifth most common cancer worldwide, and according to statistics published by the National Cancer Center, it has the sixth highest incidence rate and is a fatal disease with an extremely low survival rate of 37%.

[0003] With the continued advancement of industrialization and modernization, the incidence of cancer is steadily increasing. Liver cancer, in particular, is a leading cause of death, characterized by a high incidence, low early diagnosis rate, and poor survival rate. The high mortality rate of liver cancer patients stems from the lack of biomarkers for early diagnosis and the fact that liver cancer is often diagnosed at an advanced stage, when curative treatment is no longer possible.

[0004] Recently, methods for diagnosing cancer through DNA methylation measurements have been proposed. Hypermethylation and hypomethylation of specific genes are known to block their expression (gene silencing) or activate them (gene activation). This is one of the major mechanisms by which gene function is lost or activated in vivo, and can be interpreted as the cause of the loss of function of numerous tumor suppressor genes and the activation of oncogenes in human cancers. Analyzing the methylation of cancer-related genes is making a significant contribution to cancer research.

[0005] Tumor development involves complex molecular mechanisms, and proliferation, metastasis, and angiogenesis occur through interactions with multiple cell types in the tumor microenvironment. Based on this, the development of safe and effective technologies for early tumor diagnosis and treatment is urgent. Therefore, there is a pressing need to identify liver cancer biomarkers for early diagnosis, prognosis, and treatment response prediction.

[0006] The purpose of the present invention is to provide a biomarker composition for diagnosing liver cancer or predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.

[0007] In addition, another object of the present invention is to provide a composition for diagnosing liver cancer, which comprises as an active ingredient an agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter, and a kit for diagnosing liver cancer comprising the same.

[0008] In addition, another object of the present invention is to provide a composition for predicting the prognosis of liver cancer metastasis, which comprises as an active ingredient an agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter, and a kit for predicting the prognosis of liver cancer metastasis, which comprises the same.

[0009] In addition, another object of the present invention is to provide a method for providing information necessary for diagnosing liver cancer or predicting the prognosis of liver cancer metastasis, which comprises a step of measuring the methylation level of a CpG island region of a SORT1 gene promoter.

[0010] To achieve the above purpose, the present invention provides a biomarker composition for diagnosing liver cancer comprising a methylated CpG island region of the SORT1 gene promoter.

[0011] In addition, the present invention provides a biomarker composition for predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.

[0012] In addition, the present invention provides a composition for diagnosing liver cancer, which comprises as an active ingredient an agent capable of measuring the methylation level of a CpG island region of a SORT1 gene promoter.

[0013] In addition, the present invention provides a kit for diagnosing liver cancer comprising the composition.

[0014] In addition, the present invention provides a composition for predicting liver cancer prognosis, which comprises as an active ingredient an agent capable of measuring the methylation level of a CpG island region of the SORT1 gene promoter.

[0015] In addition, the present invention provides a kit for predicting liver cancer prognosis comprising the composition.

[0016] In addition, the present invention provides a method for providing information necessary for diagnosing liver cancer, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of the CpG island region of the SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with that of a control sample; and (4) determining that the sample is liver cancer if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to that of the control sample.

[0017] In addition, the present invention provides a method for providing information necessary for predicting the prognosis of liver cancer metastasis, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of the CpG island region of the SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with that of a control sample; and (4) predicting and determining that the possibility of liver cancer metastasis is high when the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to that of the control sample.

[0018] The present invention relates to a composition for diagnosing liver cancer using methylation changes in the SORT1 gene promoter and a use thereof, and establishes systematic research methods and techniques for elucidating growth and proliferation, cell death and metastasis inhibition of liver cancer and signal transduction pathways, and confirms whether the target gene SORT1 shows clinical significance based on basic experiments, and can predict or diagnose liver cancer with high accuracy by measuring the methylation level of the SORT1 gene, specifically, cg16988986 in the promoter region of the SORT1 gene. Therefore, the methylation change in the SORT1 gene promoter is highly likely to be utilized as a target for diagnosing liver cancer.

[0019] Figure 1 shows the association between SORT1 expression and copy number in the TCGA_LIHC dataset.

[0020] Figure 2 shows the results of correlation analysis between SORT1 activation and methylation in the TCGA_LIHC data set.

[0021] Figure 3 shows the results of identifying a specific probe region that regulates the activation of SORT1.

[0022] Figure 4 shows the beta-value analysis results of the four selected probe regions.

[0023] Figure 5 shows the results of overall survival, disease-free survival, and disease-specific survival curves according to cg16988986 methylation level.

[0024] Figure 6 shows the results of measuring methylation levels in liver cancer patient tissues using qMSP analysis.

[0025] Figure 7 shows the results of evaluating the diagnostic ability of liver cancer using the methylation level of SORT1.

[0026] Figure 8 shows the results of confirming the clinical correlation between the methylation level of SORT1 and liver cancer.

[0027] Figure 9 shows the results of confirming the correlation between the expression of SORT1 and the methylation level in qRT-PCR and qMSP data.

[0028] The present invention provides a biomarker composition for diagnosing liver cancer comprising a methylated CpG island region of the SORT1 gene promoter.

[0029] In addition, the present invention provides a biomarker composition for predicting the prognosis of liver cancer metastasis, which comprises a methylated CpG island region of the SORT1 gene promoter.

[0030]

[0031] The term “diagnosis” as used herein includes determining the susceptibility of a subject to a particular disease or condition, determining whether a subject currently has a particular disease or condition, determining the prognosis of a subject having a particular disease or condition, or therametrics (e.g., monitoring the condition of a subject to provide information about the efficacy of a treatment).

[0032]

[0033] As used herein, the term "prognosis prediction" refers to the process of predicting the outcome of a treatment for a pathological condition by collecting data on the progression of the condition and the treatment process. For the purposes of the present invention, prognosis prediction may be interpreted as assessing the likelihood of metastasis after liver cancer treatment or the likelihood of death due to metastasis, but is not limited thereto.

[0034]

[0035] In the present invention, the term "methylation" refers to a phenomenon that occurs at a cytosine in a CpG island in the promoter region of a specific gene, thereby blocking the binding of a transcription factor and thus blocking the expression of the specific gene. For the purpose of the present invention, methylation refers to methylation in a CpG island in the promoter region of the SORT1 gene.

[0036]

[0037] As used herein, the term "CpG island" refers to a genomic region where CpGs are clustered at an exceptionally high frequency, and refers to a region of 0.2 to 3 kb in length, where the C+G content is 50% or more and the CpG ratio is 3.75% or more. In the CpG, C represents cytosine, G represents guanine, and p represents a phosphodiester bond between cytosine and guanine. There are approximately 45,000 CpG islands in the human genome, and most of them are found in promoter regions that regulate gene expression. In fact, the CpG islands are found in the promoters of housekeeping genes, which account for approximately 50% of human genes (Cross, S. and Bird, A., Curr. Opin. Gene Develop., 5:309, 1995). In normal human somatic cells, the CpG islands in the promoter regions of the housekeeping genes are unmethylated, while genes that are not expressed during development, such as imprinted genes and genes on the inactive X chromosome, are methylated.

[0038] In the genomic DNA of mammalian cells, in addition to A, C, G, and T, there is a fifth base called 5-methylcytosine, which has a methyl group attached to the fifth carbon of the cytosine ring (5-mC). 5-mC attaches only to the C of the CG dinucleotide (5'-mCG-3'), called CpG. The C of CpG is mostly methylated by contact with a methyl group. Methylation of CpG suppresses the expression of transposons and repetitive sequences in the genome. Furthermore, CpG is the site where most epigenetic changes frequently occur in mammalian cells. This is because the 5-mC of CpG readily deamidates naturally to form thymine (T).

[0039]

[0040] In addition, the present invention provides a composition for diagnosing liver cancer, which comprises as an active ingredient an agent capable of measuring the methylation level of a CpG island region of a SORT1 gene promoter.

[0041] In addition, the present invention provides a composition for predicting the prognosis of liver cancer metastasis, comprising as an active ingredient an agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter.

[0042] Preferably, the agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter may be at least one selected from the group consisting of a primer pair capable of amplifying a fragment within the methylated CpG island region of the SORT1 gene, a probe capable of hybridizing with the methylated CpG island region of the SORT1 gene, a methylation-specific binding protein capable of binding to the methylated CpG island region of the SORT1 gene, a methylation-specific binding antibody or aptamer of the SORT1 gene; and a methylation-sensitive restriction enzyme, but is not limited thereto.

[0043] Preferably, the CpG island region of the SORT1 gene promoter may be cg16988986, but is not limited thereto.

[0044]

[0045] As used herein, the term "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a polymerization reagent (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and the lengths of the sense and antisense primers can be appropriately selected according to techniques known in the art.

[0046] The primers of the present invention can be preferably designed according to the sequence of the CpG island to be analyzed for methylation, and can be a primer pair that can specifically amplify cytosine that is methylated and not modified by bisulfite, and a primer pair that can specifically amplify cytosine that is not methylated and modified by bisulfite.

[0047] As used herein, the term "probe" refers to a nucleic acid fragment, such as RNA or DNA, ranging from a few bases to several hundred bases in length, capable of specifically binding to mRNA, and is labeled so that the presence or absence of a specific mRNA and its expression level can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single-stranded DNA probe, a double-stranded DNA probe, an RNA probe, etc. The selection of an appropriate probe and hybridization conditions can be appropriately selected according to techniques known in the art.

[0048] As used herein, the term "antibody" is a term known in the art and refers to a specific immunoglobulin directed against an antigenic site. The antibody in the present invention refers to an antibody that specifically binds to the PMVK of the present invention, and the antibody can be prepared according to a conventional method in the art. The form of the antibody includes a polyclonal antibody or a monoclonal antibody, and all immunoglobulin antibodies are included. The antibody refers to a complete form having two full-length light chains and two full-length heavy chains. The antibody also includes specialized antibodies such as humanized antibodies.

[0049] As used herein, the term "aptamer" refers to a type of polynucleotide composed of a special type of single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristics of being able to bind to a target molecule with high affinity and specificity. As described above, aptamers can specifically bind to an antigenic substance in the same way as antibodies, but are composed of polynucleotides that are more stable than proteins, have a simpler structure, and are easy to synthesize, and therefore can be used as a substitute for antibodies.

[0050] The term "methylation-sensitive restriction enzyme" as used herein refers to a restriction enzyme that can specifically detect methylation of a CpG island and may be a restriction enzyme containing CG as a recognition site of the restriction enzyme. Examples thereof include, but are not limited to, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, etc. Depending on methylation or unmethylation at C of the restriction enzyme recognition site, whether or not the restriction enzyme cuts is different and this can be detected through PCR or Southern Blot analysis. Other methylation-sensitive restriction enzymes other than the above restriction enzymes are well known in the art.

[0051]

[0052] In addition, the present invention provides a kit for diagnosing liver cancer comprising the composition.

[0053] In addition, the present invention provides a composition for predicting the prognosis of liver cancer metastasis comprising the composition.

[0054] In the present invention, the kit may be any one selected from the group consisting of an RT-PCR kit, a microarray chip kit, a DNA kit, and a protein chip kit, but is not limited thereto.

[0055]

[0056] In addition, the present invention provides a method for providing information necessary for diagnosing liver cancer, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of the CpG island region of the SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with that of a control sample; and (4) determining that the sample is liver cancer if the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to that of the control sample.

[0057] In addition, the present invention provides a method for providing information necessary for predicting the prognosis of liver cancer metastasis, comprising the steps of: (1) obtaining genomic DNA from a sample isolated from a patient; (2) measuring the methylation level of the CpG island region of the SORT1 gene promoter in the obtained genomic DNA; (3) comparing the measured methylation level of the CpG island region of the SORT1 gene promoter with that of a control sample; and (4) predicting and determining that the possibility of liver cancer metastasis is high when the measured methylation level of the CpG island region of the SORT1 gene promoter is decreased compared to that of the control sample.

[0058] Preferably, the measurement of the methylation level of the CpG island region of the SORT1 gene promoter can be performed by a method selected from the group consisting of, but not limited to, PCR, methylation specific PCR, real time methylation specific PCR, PCR using a methylated DNA specific binding protein, ChIP analysis using a methylated DNA specific binding antibody or aptamer, DNA chip, pyrosequencing, and bisulfite sequencing.

[0059] Preferably, the CpG island region of the SORT1 gene promoter may be cg16988986, but is not limited thereto.

[0060] Preferably, the step (4) is performed by a cut-off value, and the cut-off value may be 0.0885 when the relative methylation level of the SORT1 gene promoter is log10 substituted, but is not limited thereto.

[0061] Preferably, the isolated sample may be, but is not limited to, isolated cells, tissue, blood, saliva or urine.

[0062] Below, the present invention is described in detail using examples that do not limit the scope of the invention. The following examples are intended to concretize the invention and do not limit or restrict the scope of the invention. Therefore, anything that a specialist in the technical field can easily infer from the detailed description and examples of the invention is interpreted as falling within the scope of the invention.

[0063]

[0064] <Experimental Example>

[0065] The following experimental examples are intended to provide experimental examples commonly applied to each embodiment according to the present invention.

[0066]

[0067] 1. Preparation of liver cancer samples

[0068] A total of 116 liver cancer tissue samples were used for methylation analysis, including non-tumor (NT) and liver cancer tissue (T) from 58 patients who underwent hepatectomy.

[0069]

[0070] 2. Analysis of public omics data

[0071] TCGA LIHC data were used to validate methylation, expression, and survival analyses.

[0072]

[0073] 3. DNA extraction from tissue samples

[0074] Genomic DNA of the tissue was extracted using the DNeasy Blood & Tissue kit (Qiagen, #69504) according to the kit's manual.

[0075] Approximately 8mm 3 After freezing the tissue in liquid nitrogen, it was ground in a sterilized mortar and pestle, and 180 ul of Buffer ATL and 20 ul of proteinase K were added, vortexed, and reacted in a shaking incubator at 56°C for more than 12 hours.

[0076] After briefly vortexing the above reaction solution, 200 μl of Buffer AL and 200 μl of EtOH were added and mixed well by vortexing. After preparing a DNA spin column and collection tube, the entire reaction solution was transferred to the column, centrifuged at room temperature for 1 minute at 12,000 rpm, and only the column was placed in a new collection tube.

[0077] 500 ul of washing buffer was added to the column, centrifuged at 12,000 rpm at room temperature for 1 minute, and the collection tube was replaced. Repeated this process, and then centrifuged at 14,000 rpm for 3 minutes to dry the column membrane.

[0078] DNA adsorbed to the column was separated using elution buffer, and the amount and purity of the separated genomic DNA were measured using a NanoPhotometer (Implen).

[0079]

[0080] 4. Bisulfite modification of DNA

[0081] 1 μg of genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold™ kit (Zymo research, D5005).

[0082] DNA bisulfite conversion was performed by combining 1 ug DNA and DW to make 20 ul and adding 130 ul of CT conversion reagent to make a total of 150 ul.

[0083] After processing the above sample in the following order: 98℃ for 10 minutes, 64℃ for 2 hours and 30 minutes, and storage at 4℃, the sample and 600ul of binding buffer were added to the Zymo-Spin IC column, and centrifuged at 12,000g for 30 seconds to allow DNA to be adsorbed to the column.

[0084] After washing the column once with M-wash buffer, 200 ul of M-desulphonation buffer was added, left at room temperature for 20 minutes, and centrifuged again at 12,000 g for 30 seconds.

[0085] After washing twice with M-wash buffer, the bisulfite-converted genomic DNA was separated from the column using M-elution buffer.

[0086]

[0087] 5. Quantitativemethylation-specific polymerase chain reaction (qMSP)

[0088] The information of the probe derived from the methylation analysis of the gene is as follows.

[0089] Candidate ID Probe Position Sequence Size cg16988986chr1:109,398,437-109,398,556CCCGCTCACTGGAGCGCCCATTGTCTGCTAAGCAGCTGCCTTGCTGCAAGAAGGTGAATG[CG]AACTGATGTGGGCCACATCCTACGGAGACAGACATCAGGACATCCGTGACTCCTGCAAGC122 bp

[0090] The location of the target probe was identified in the UCSC genome brower (https: / genome.ucsc.edu / index.html) and primers for qMSP were designed using MethPrimer (https: / www.urogene.org / cgi-bin / methprimer / methprimer.cgi) for the sequence of chr1:109,397,301-109,399,000 (1700 bp) containing the target probe and CpG islands.

[0091] Real-time monitoring was performed using AmfiSure qGreen Q-PCR Master Mix (GenDEPOT). Primer sequences are as follows.

[0092]

[0093] Forward sequenceReverse sequenceSORT1_Methyl5'-GTTTTGTTGTAAGAAGGTGAATGC-3'5'-AAAAAAATAAAAAAAACCAACGTA-3'SORT1_Unmethyl5'-GTTTTGTTGTAAGAAGGTGAATGTG-3'5'-AAAAAAATAAAAAAAACCAAACATA-3'

[0094] qMSP was performed using a total of 10 ul of reaction mixture containing 2X qPCR master mix (Gendepot, Q5602), 10 uM primer, and bisulfite-modified DNA under the following conditions.

[0095] A. Stage 1: 95℃, 2 minutes

[0096] B. Stage 2: 95℃, 15 seconds

[0097] C. : 58℃, 34 seconds

[0098] D. : 72℃, 30 seconds

[0099] E. Repeat Stage 2 40 cycles

[0100]

[0101] 6. Quantitative real-time polymerase chain reaction (qRT-PCR)

[0102] cDNA was synthesized from 500 ng of RNA in a total volume of 10 μl using 5X PrimeScript™RT Master Mix (Takara), and AmfiSure qGreen Q-PCR Master Mix (GenDEPOT) was used at 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 34 s, and 72°C for 30 s, followed by a dissociation stage of 95°C for 10 s, 65°C for 5 s, and 95°C for 5 s. Real-time monitoring was confirmed using a CFX Connect Real-Time PCR Detection System (Bio-Rad). The primer NM number of SORT1 is NM_001205228.1, the product size is 198 bp, and the sequence is as follows.

[0103] Forward: 5'-AGTTTCAGTGACCCACGTCAG-3'

[0104] Reverse: 5'-AGTAGGTCAGGTAACAAAGTCCAGT-3'

[0105]

[0106] <Example>

[0107] To determine the regulatory mechanism by which SORT1, which is non-specifically overexpressed in liver cancer, is activated, we first analyzed whether there were changes in gene copy number variation using the TCGA_LIHC dataset. Gene copy number variation is one of the genetic structural variations existing in the human genome and is closely related to gene expression, and affects the final activity of the gene and the increase or decrease of the gene product, the transcript, or protein expression. Therefore, we determined the rate at which mutation deletion, which occurs when a part of a chromosome is lost during genetic recombination, diploid, which is a set of two polyploids, gain, which is an abnormal duplication in normal diploid, and amplification, which is an increase in the number of gene copies, occurred in SORT1, and confirmed that there was no correlation between SORT1 expression and copy number (Fig. 1).

[0108] Next, in order to confirm whether the expression of SORT1 is regulated by methylation, which is known as a core process of epigenetics, we analyzed the beta-value, which is known as a methylation ratio measurement index, and the closer the beta-value is to 1 among the values ​​of 0 and 1, the higher the methylation intensity. When the correlation between the expression of SORT1 and the beta-value for 371 liver cancer patients in the TCGA_LIHC dataset was analyzed, the higher the expression of SORT1, the closer the beta-value was to 0, and it was confirmed that there was a strong negative correlation (Fig. 2, Pearson r=-0.626).

[0109] Additionally, when the beta-value was checked in the liver cancer and non-liver cancer tissues of the same 50 liver cancer patients, it was confirmed that the beta-value was concentrated at 0 in the liver cancer tissues compared to the non-liver cancer tissues, indicating that the methylation of SORT1 was relatively low (Fig. 2).

[0110] Based on the previous analysis that the expression activation of SORT1 is closely related to methylation, to determine whether there is a significant difference in the CpG island of the SORT1 5' promoter region among liver cancer patients, the correlation between the methylation of each SORT1 CpG probe region and SORT1 expression was analyzed using MEXPRESS, and it was confirmed that a total of four probe regions existing in the CpG site of the SORT1 promoter showed a significant correlation between the methylation of non-liver cancer and liver cancer samples (Fig. 3).

[0111] Among the four probe regions selected using the TCGA_LIHC dataset, when the beta values ​​in the non-tumor group and tumor group of 50 liver cancer patients were analyzed, only cg16988986 was confirmed to be hypomethylated with a significantly lower beta value in the tumor group compared to the non-tumor group (Fig. 4).

[0112] To confirm the correlation between the methylation level of a specific probe region, cg16988986, and the patient's prognosis, we analyzed the overall survival (OS), disease-free survival (DFS), and disease-specific survival (DSS) using TCGA data, and confirmed that the lower the methylation level of cg16988986, the worse the prognosis (Fig. 5).

[0113] This study aimed to analyze the methylation level of CpG cg16988986 of the SORT1 promoter using qMSP in tissues obtained from liver cancer patients who underwent hepatectomy at Ajou University Hospital. Significantly hypomethylated patients were observed in 65% and 57.9% of the test cohort (n = 20) and validation cohort (n = 38), respectively (Fig. 6). The methylation rate in tumor tissues was evaluated to be higher than that in non-tumor tissues. When the methylation level was analyzed in a total of 58 tissue pairs, the methylation rate in the tumor group was confirmed to be lower than that in the non-tumor group. Specifically, when the methylation level of qMSP was converted to log10, the average value of non-tumor tissues was 0.1874, and the average value of liver cancer tissues was -0.1729.

[0114] In addition, when evaluating the diagnostic ability of liver cancer by the methylation level of SORT1, the relative methylation level of SORT1 showed high accuracy with an AUC value of 0.80 (95% CI = 0.716 to 0.86) when log10-substituted was 0.0885 (Fig. 7).

[0115] To assess the clinical relevance of SORT1 methylation, we compared it with various clinical variables. Methylation levels were lower in patients with metastasis in liver cancer, and methylation levels decreased with advancing mUICC stage. Furthermore, methylation levels were lower in G3 / G4, which are relatively poorly differentiated, according to the Edmondson grading scale (Fig. 8). Overall, lower SORT1 methylation levels were associated with worse clinical outcomes.

[0116] Finally, the expression and methylation levels of SORT1 were reanalyzed in the Ajou University Hospital cohort, and it was confirmed that higher expression was associated with lower methylation, which was consistent with the initial TCGA data analysis (Fig. 9).

[0117]

[0118] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A biomarker composition for diagnosing liver cancer comprising a methylated CpG island region of the SORT1 gene promoter.

2. A biomarker composition for predicting the prognosis of liver cancer metastasis, comprising a methylated CpG island region of the SORT1 gene promoter.

3. A composition for diagnosing liver cancer, comprising as an active ingredient an agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter.

4. In the third paragraph, the agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter is characterized in that at least one selected from the group consisting of a primer pair capable of amplifying a fragment within the methylated CpG island region of the SORT1 gene, a probe capable of hybridizing with the methylated CpG island region of the SORT1 gene, a methylation-specific binding protein capable of binding to the methylated CpG island region of the SORT1 gene, a methylation-specific binding antibody or aptamer of the SORT1 gene, and a methylation-sensitive restriction enzyme.

5. A composition for diagnosing liver cancer, characterized in that the CpG island region of the SORT1 gene promoter in paragraph 4 is cg16988986.

6. A kit for diagnosing liver cancer comprising a composition according to any one of claims 3 to 5.

7. A composition for predicting the prognosis of liver cancer metastasis, comprising as an active ingredient a preparation capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter.

8. A composition for predicting the prognosis of liver cancer metastasis, characterized in that in paragraph 7, the agent capable of measuring the methylation level of the CpG island region of the SORT1 gene promoter is at least one selected from the group consisting of a primer pair capable of amplifying a fragment within the methylated CpG island region of the SORT1 gene, a probe capable of hybridizing with the methylated CpG island region of the SORT1 gene, a methylation-specific binding protein capable of binding to the methylated CpG island region of the SORT1 gene, a methylation-specific binding antibody or aptamer of the SORT1 gene, and a methylation-sensitive restriction enzyme.

9. A composition for predicting the prognosis of liver cancer metastasis, characterized in that the CpG island region of the SORT1 gene promoter in paragraph 8 is cg16988986.

10. A kit for predicting the prognosis of liver cancer metastasis, comprising a composition according to any one of claims 7 to 9. 11.(1) A step of obtaining genomic DNA from a sample isolated from a patient; (2) A step of measuring the methylation level of the CpG island region of the SORT1 gene promoter in the genomic DNA obtained above; (3) a step of comparing the methylation level of the CpG island region of the SORT1 gene promoter measured above with that of a control sample; and (4) A method for providing information necessary for diagnosing liver cancer, including a step of determining that the sample is liver cancer when the methylation level of the CpG island region of the SORT1 gene promoter measured above is reduced compared to a control sample. 12.(1) A step of obtaining genomic DNA from a sample isolated from a patient; (2) A step of measuring the methylation level of the CpG island region of the SORT1 gene promoter in the genomic DNA obtained above; (3) a step of comparing the methylation level of the CpG island region of the SORT1 gene promoter measured above with that of a control sample; and (4) A method for providing information necessary for predicting the prognosis of liver cancer metastasis, including a step of predicting and determining that there is a high possibility of liver cancer metastasis when the methylation level of the CpG island region of the SORT1 gene promoter measured above is reduced compared to a control sample.

13. A method according to claim 11 or 12, characterized in that the measurement of the methylation level of the CpG island region of the SORT1 gene promoter is performed by a method selected from the group consisting of PCR, methylation specific PCR, real time methylation specific PCR, PCR using a methylated DNA-specific binding protein, ChIP analysis using a methylated DNA-specific binding antibody or aptamer, DNA chip, pyrosequencing, and bisulfite sequencing.

14. A method according to claim 11 or 12, characterized in that the CpG island region of the SORT1 gene promoter is cg16988986.

15. A method according to claim 11 or 12, wherein step (4) is performed by a cut-off value, wherein the cut-off value is characterized in that the relative methylation level of the SORT1 gene promoter is 0.0885 when log10 substituted.

16. A method according to claim 11 or 12, wherein the separated sample is selected from the group consisting of separated cells, tissues, blood, saliva, and urine.

Images