5-aminolevulinic acid-producing bacterium, method for producing same, and method for producing 5-aminolevulinic acid using same

Abstract

The present invention addresses the problem of: producing a 5-aminolevulinic acid high-producing strain, which is a strain suitable with respect to safety in the industrial production of 5-aminolevulinic acid, by utilizing a technology that is a recombinant DNA technology but does not leave a foreign gene in a finally produced strain, particularly a self-cloning technology; and producing 5-aminolevulinic acid using the produced strain.　The problem is solved by producing a strain of a photosynthetic bacterium, and culturing the produced strain, the strain belonging to the class α-Proteobacteria and having, upstream of a gene (hemT) encoding HemT that is a 5-aminolevulinic acid synthesis enzyme, an expression regulation region including an rrnB promoter, wherein the expression regulation region is originated from a photosynthetic bacterium that is the same type of the strain and is capable of inducing the expression of hemT, and the induction causes the increase in 5-aminolevulinic acid productivity compared with a wild-type strain thereof.

Description

5-aminolevulinic acid-producing bacteria, method for producing the same, and method for producing 5-aminolevulinic acid using the same

[0001] The present invention relates to the creation of a self-cloning strain of an α-proteobacterium using a self-cloning technique, and a method for producing 5-aminolevulinic acid using the created strain.

[0002] 5-aminolevulinic acid (ALA) is a compound widely found in the biosphere as a metabolic intermediate in the pigment biosynthesis pathway that synthesizes tetrapyrrole compounds (vitamin B12, heme, chlorophyll, etc.), and plays an important role in living organisms. 5-aminolevulinic acid is also a natural compound that exhibits excellent effects as a herbicide, insecticide, plant growth regulator, and plant photosynthesis enhancer (Patent Documents 1 and 2). Furthermore, 5-aminolevulinic acid is used as a raw material for pharmaceuticals, supplements, cosmetics, feed, fertilizers, and the like, supporting people's lives in various ways.

[0003] 5-aminolevulinic acid is known to be biosynthesized in vivo from glycine and succinyl CoA by 5-aminolevulinic acid synthase, or from glutamic acid via glutamyl tRNA (Patent Document 3).

[0004] Although the usefulness of 5-aminolevulinic acid is widely known, one of the problems in its practical use is its high production cost. Chemical synthesis has been investigated for some time, but a fully satisfactory method has not yet been developed.

[0005] Meanwhile, methods for producing 5-aminolevulinic acid using microorganisms have also been investigated. For example, a method using the genus Propionibacterium, Methanobacterium, or Methanosarcina has been proposed (Patent Document 4). However, the production of 5-aminolevulinic acid by fermentation has been insufficient in terms of production volume, and has not been industrially satisfactory.

[0006] A method using photosynthetic bacteria of the genus Rhodobacter is also known, and it has been reported that this method produces a larger amount of 5-aminolevulinic acid than the methods using the above-mentioned microorganisms (Patent Document 5, etc.). Furthermore, a method has been performed in which bacteria of the genus Rhodobacter are mutagenized, a strain with high 5-aminolevulinic acid productivity is selected, and the selected strain is further subjected to repeated mutagen treatment and selection to obtain a mutant strain with higher 5-aminolevulinic acid production, and this mutant strain is then utilized (Non-Patent Documents 1 and 2).

[0007] Another approach to producing high levels of 5-aminolevulinic acid in microorganisms has been to select or create microbial strains using genetic engineering techniques. Known examples include introducing a 5-aminolevulinic acid synthase gene derived from photosynthetic bacteria into Escherichia coli to produce a transformant (Non-Patent Document 3, Patent Document 6), and introducing a 5-aminolevulinic acid synthase gene derived from photosynthetic bacteria into photosynthetic bacteria to produce a transformant (Patent Document 7).

[0008] From the perspective of production costs and productivity, industrial production of 5-aminolevulinic acid has traditionally been achieved by selecting or creating strains with high 5-aminolevulinic acid productivity using (1) drug-induced mutagenesis or (2) genetic recombination techniques. However, in the case of (1), multiple rounds of mutagenesis and selection are required to obtain the desired highly productive strain, and careful analysis of the properties of the selected strain and the mutated genes is also required to ensure safety. Furthermore, in the case of (2), comprehensive analysis of the properties of the created strain is considered necessary to ensure safety, for reasons such as the fact that transformants often contain foreign genes. Therefore, in both cases, achieving industrial production requires considerable effort and time, and is often accompanied by difficulties.

[0009] JP 61-502814 JP 2-138201 JP 2013-208074 JP 5-184376 JP 5-184376 JP 2005-333907 JP 9-173071

[0010] Nishikawa, S., et al. (1999) Rhodobacter sphaeroides mutants which accumulate 5-aminolevulinic acid under aerobic and dark conditions., J. Biosci. Bioeng., vol. 87, pp. 798-804.Kamiyama et al. (2000) Production of 5-aminolevulinic acid by a mutant strain of a photosynthetic bacterium. -Monograph-, Journal of the Japan Society of Biotechnology., vol. 78, no. 2, pp. 48-55.Xie, L. et al., (2003) Appl. Microbiol. Biotechnol., vol. 63, pp. 267-273.

[0011] When drug-induced mutant strains or transformants into which foreign genes have been introduced are used for industrial production of 5-aminolevulinic acid, as described above, considerable effort and cost are required to ensure safety, and the process is often accompanied by difficulties. An object of the present invention is to avoid or alleviate these problems.

[0012] Therefore, the present inventors attempted to create a strain that is highly productive of 5-aminolevulinic acid and is suitable from the viewpoint of safety for industrial production of 5-aminolevulinic acid by utilizing a genetic recombination technique but a technique that does not leave foreign genes in the final strain, particularly a self-cloning technique. As a result, they unexpectedly found that the above problems can be solved by combining a specific expression control region (such as a promoter) and a 5-aminolevulinic acid synthase gene (ALAS gene), both of which are derived from the genome of the same species, and thus completed the present invention.

[0013] In some aspects, the present invention provides the following [1] to

[20] .

[0014] [1] A photosynthetic bacterial strain belonging to the class α-proteobacteria, which has an expression control region containing a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding 5-aminolevulinic acid synthase HemT, wherein the expression control region is derived from the same species of photosynthetic bacterium as the photosynthetic bacterial strain and induces expression of hemT, such induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain. [2] The strain of [1] above, into which the expression control region containing PrrnB has been inserted by homologous recombination technology, and which is substantially free of foreign gene sequences of heterologous origin. [3] The strain of [1] or [2] above, wherein the photosynthetic bacterium belonging to the class α-proteobacteria is a bacterium of the genus Rhodobacter, Rhodospirillum, Rhodopseudomonas, Chromatium, Ectothiorhodospira, Chlorobium, Prosthecochloris, Chloroflexus, Chloronema, or Helicobacterium. [4] The strain of any one of [1] to [3] above, wherein the photosynthetic bacterium belonging to the class α-proteobacteria is a bacterium of the genus Rhodobacter. [5] The strain according to [4] above, wherein the species of the bacterium of the genus Rhodobacter is Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter sulfidophillus, Rhodobacter adriaticus, or Rhodobacter veldkampii.[6] The strain according to any one of [1] to [5] above, wherein hemT contains any of the following nucleotide sequences: (i) the nucleotide sequence of SEQ ID NO: 1; (ii) a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 2; (iii) a nucleotide sequence having 90% or more sequence identity with the nucleotide sequence of (i) or (ii) above and encoding a protein having 5-aminolevulinic acid synthase activity; and (iv) a nucleotide sequence in which 1 to 120 nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of (i) or (ii) above and encoding a protein having 5-aminolevulinic acid synthase activity. [7] The strain according to any one of [1] to [5] above, wherein hemT is derived from the genome of any of Rhodobacter sphaeroides strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, or KD131, and the photosynthetic bacterial species is Rhodobacter sphaeroides. [8] The strain according to any one of [1] to [7] above, wherein PrrnB contains any of the following base sequences: (i) the base sequence of SEQ ID NO: 3; (ii) the base sequence of SEQ ID NO: 4; (iii) the base sequence of SEQ ID NO: 5; (iv) a base sequence that is a functional fragment of PrrnB, consisting of a base sequence having its 5'-end at any position from 1 to 158 of SEQ ID NO: 5 and its 3'-end at any position from 188 to 195, and that has the activity of inducing the expression of hemT; (v) a base sequence that has 90% or more sequence identity with the base sequence of SEQ ID NO: 4 or 5 and that has the activity of inducing the expression of hemT; and (vi) a base sequence in which 1 to 19 bases have been deleted, substituted, or added to the base sequence of SEQ ID NO: 4 or 5, and that has the activity of inducing the expression of hemT.[9] The strain according to any one of [1] to [7] above, wherein PrrnB is derived from the genome of any of Rhodobacter sphaeroides strains 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.3 (ATCC17025), ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, KD131, or HJ, and the photosynthetic bacterial species is Rhodobacter sphaeroides.

[10] The strain according to any one of [1] to [9] above, wherein the inserted PrrnB is located upstream of the coding region of the hemT gene and within 10,000 bases upstream of the start codon of the hemT gene, preferably within 1,000 bases, more preferably within 100 bases, and even more preferably adjacent to the transcription start site of the hemT gene.

[0015]

[11] A method for producing 5-aminolevulinic acid, comprising culturing the strain of any one of [1] to

[10] above in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and collecting 5-aminolevulinic acid from the culture.

[12] The method for producing 5-aminolevulinic acid according to

[11] above, wherein the medium is a liquid medium and the culture is performed by shaking culture.

[13] The method for producing 5-aminolevulinic acid according to

[10] or

[11] above, wherein the culture is performed under oxygen-limited microaerobic conditions or under anaerobic conditions.

[14] The method for producing 5-aminolevulinic acid according to

[10] or

[11] above, wherein the culture is performed under aerobic conditions.

[0016]

[15] A method for producing a photosynthetic bacterial strain belonging to the class α-proteobacteria, which has an expression control region containing a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding the 5-aminolevulinic acid synthase HemT, wherein the expression control region is derived from the same species of photosynthetic bacterium as the photosynthetic bacterial strain and induces expression of hemT, such that the induction results in increased productivity of 5-aminolevulinic acid compared to a wild-type strain, the method comprising the step of functionally linking PrrnB to hemT.

[16] A method for producing the strain of any one of [1] to

[10] above, the method comprising the step of functionally linking PrrnB to hemT.

[0017]

[17] A method for producing a photosynthetic bacterium strain with high productivity of 5-aminolevulinic acid, comprising the step of inserting into a wild-type strain of the photosynthetic bacterium by homologous recombination an expression control region containing a ribosomal RNA operon promoter (PrrnB) derived from the same species upstream of a gene (hemT) encoding 5-aminolevulinic acid synthase HemT in the genome of the wild-type strain, wherein the inserted PrrnB induces expression of hemT, such that the induction results in increased productivity of 5-aminolevulinic acid compared to the wild-type strain, and the photosynthetic bacterium is a species belonging to the class α-proteobacteria.

[18] The method of

[17] above, wherein a plasmid vector for homologous recombination is used, wherein the plasmid vector contains an expression control region containing PrrnB, and wherein homologous regions consisting of sequences homologous to upstream and downstream regions of the genome adjacent to the target region of homologous recombination are located on both sides of the expression control region containing PrrnB.

[19] The method according to

[17] or

[18] above, wherein the sequence of the homologous region is a base sequence of 20 or more bases, 100 or more bases, 500 or more bases, or 1,000 or more bases.

[20] The method according to any one of

[17] to

[19] above, wherein the region in the plasmid vector containing the expression control region containing PrrnB, which is sandwiched between the two homologous regions, is substantially free of foreign genes derived from a biological species heterologous to the species of photosynthetic bacteria belonging to the class α-proteobacteria.

[0018] The present invention relates to the production of photosynthetic bacterial strains using self-cloning technology. Expression of the 5-aminolevulinic acid synthase, HemT, is driven by a homologous or endogenous ribosomal RNA operon promoter (PrrnB), thereby enhancing 5-aminolevulinic acid productivity without the use of heterologous genes. The resulting strains are substantially free of heterologous nucleic acid sequences. The self-cloning strains of the present invention are less susceptible to unexpected side effects resulting from genetic recombination, making them a boon for industries requiring high product safety, such as the pharmaceutical, food, and beverage industries, as well as for consumers. For example, the European Regulation on the Protection of Human Health and the Environment (Commission of the European Communities, Directorate-General XI, 1992) stipulates that self-cloning used in the genetic modification of non-pathogenic microorganisms should be exempt from regulatory oversight. Therefore, the strains of the present invention have regulatory advantages over drug-induced mutants and transformants containing exogenous genes, making them advantageous for industrial production of 5-aminolevulinic acid.

[0019] This figure shows a schematic diagram of the procedure for preparing a promoter-inserted strain of photosynthetic bacteria using self-cloning technology. More specifically, FIG. 1 shows the procedure for inserting the rrnB promoter (PrrnB) or rsp_7571 promoter (Prsp_7571) derived from the photosynthetic bacterium Rhodobacter sphaeroides 2.4.1 strain upstream of the hemA gene in the genome of the same strain by homologous recombination. In the vector used for homologous recombination, adjacent to PrrnB or Prsp_7571, Up (genomic sequence upstream of the hemA locus) and hemA are placed on either side of the promoter as homologous regions. Outside the homologous region, a gentamicin resistance gene (Gm) is inserted as a positive selection marker. rThe levansucrase gene (sacB) was inserted as a negative selection marker. The final strain, in which PrrnB was inserted upstream of the hemA gene, was designated the BA strain, and the strain in which Prsp_7571 was inserted was designated the 7A strain. The genomic gene organization around the ALAS gene (hemA or hemT) in strains constructed by inserting promoters using self-cloning technology is shown. (A) shows the gene organization of the region of chromosome 1 in the R. sphaeroides genome where the hemA gene is located. (B) shows the genes of the region of chromosome 2 in the R. sphaeroides genome where the hemT gene is located. In the figure, white arrows indicate the coding sequence of the gene, and black arrows indicate the transcription start site and direction. The thick black line indicates the inserted promoter sequence (PrrnB or Prsp_7571). WT indicates a rifampicin-resistant strain derived from R. sphaeroides strain 2.4.1 (wild-type strain). BA indicates a strain in which PrrnB was inserted upstream of hemA. BAT indicates a strain in which PrrnB was inserted upstream of hemA and upstream of hemT. 7A indicates a strain in which Prsp_7571 was inserted upstream of hemA. 7AT indicates a strain in which Prsp_7571 was inserted upstream of hemA and upstream of hemT. BT indicates a strain in which PrrnB was inserted upstream of hemT. 7T indicates a strain in which Prsp_7571 was inserted upstream of hemT. The figures show the results of RT-PCR quantification of the expression level of the ALAS gene (hemA or hemT) in strains constructed by inserting a promoter using self-cloning technology. The upper panel shows the expression level of the hemA gene relative to the expression level in the WT strain under aerobic conditions, which is set to 1. The lower panel shows the expression level of the hemT gene relative to the expression level in the WT strain under aerobic conditions, which is set to 1. The white bars show the results when the strain was cultured under aerobic conditions, and the gray bars show the results when the strain was cultured under microaerobic conditions. The names of the WT and the six strains prepared by self-cloning technology are the same as in Figure 2. The graph shows the time course of 5-aminolevulinic acid productivity in strains constructed by inserting a promoter using self-cloning technology.The vertical axis represents the 5-aminolevulinic acid (ALA) concentration (mM), and the horizontal axis represents the culture time (h). The names of the WT and the six strains prepared by self-cloning technology are the same as those in Figure 2.

[0020] Hereinafter, several embodiments of the present invention will be described in detail, but the present invention is not limited to the following embodiments.

[0021] A photosynthetic bacterial strain according to one embodiment of the present invention is a photosynthetic bacterial strain belonging to the class α-proteobacteria in which an expression control region including a ribosomal RNA operon promoter (PrrnB) is located upstream of a gene (hemT) encoding HemT, a 5-aminolevulinic acid synthase, and the expression control region is derived from the same species of photosynthetic bacterium as the strain and induces expression of hemT, which induction results in increased productivity of 5-aminolevulinic acid compared to a wild-type strain.

[0022] First, photosynthetic bacteria will be described. Photosynthetic bacteria are bacteria that belong to the α-proteobacteria class in biological taxonomy. Photosynthetic bacteria may be any bacteria that grow photosynthetically by photoautotrophy or photosynthetically organotrophy using light energy. Examples of photosynthetic bacteria include bacteria belonging to the genera Rhodobacter, Rhodospirillum, Rhodopseudomonas, Chromatium, Ectothiorhodospira, Chlorobium, Prosthecochloris, Chloroflexus, Chloronema, and Helicobacterium, with bacteria belonging to the genus Rhodobacter being preferred.

[0023] Examples of bacteria belonging to the genus Rhodobacter include bacteria belonging to Rhodobacter sphaeroides, Rhodobacter capsulatus, Rhodobacter sulfidophillus, Rhodobacter adriaticus, Rhodobacter veldkampii, etc., with preferred examples being bacteria belonging to Rhodobacter sphaeroides.

[0024] The classification system of photosynthetic bacteria is still in flux, undergoing successive divisions and reorganizations. In recent years, some species of the genus Rhodobacter have been transferred to three new genera: Cereibacter, Fuscovulum, and Phaeovulum. As a result, Rhodobacter sphaeroides and Rhodobacter veldkampii, both of which belong to the genus Rhodobacter, are now classified as Cereibacter sphaeroides and Phaeovulum veldkampii, respectively. However, these species remain classified in the order Rhodobacter and are still widely recognized as species of the genus Rhodobacter. Therefore, in this specification, Cereibacter sphaeroides and Phaeovulum veldkampii are synonymous with Rhodobacter sphaeroides and Rhodobacter veldkampii, respectively, and are treated as bacterial species belonging to the genus Rhodobacter.

[0025] Next, 5-aminolevulinic acid synthase (ALAS) will be described. Two biosynthetic pathways for 5-aminolevulinic acid are known: the C4 pathway and the C5 pathway. ALAS (EC 2.3.1.37) found in photosynthetic bacteria has the enzyme activity of catalyzing the reaction of producing 5-aminolevulinic acid from glycine and succinyl-CoA in the C4 pathway (also known as the Shemin pathway). The basic genetic structures of photosynthetic bacteria, Rhodobacter sphaeroides, and Rhodobacter sphaeroides are substantially identical or highly similar to each other. Therefore, it is believed that the same effects can be obtained in the present invention regardless of the ALAS gene derived from any bacterium, as long as it has an ALAS gene that is homologous in sequence and / or function.

[0026] Specific examples of ALAS include HemA and HemT of Rhodobacter sphaeroides. HemA and HemT share the common feature of catalyzing the reaction that produces 5-aminolevulinic acid from succinyl-CoA, but their expression is regulated differently. The hemA gene encoding the former is located on chromosome 1 and is induced to express under anaerobic conditions, whereas the hemT gene encoding the latter is located on chromosome 2 and has been reported to be a silent gene in Rhodobacter sphaeroides strain 2.4.1. As described in detail in the Examples below, self-cloning strains were created in which the expression control regions of these genes were replaced with the expression control regions of other genes by homologous recombination technology, and then tested. High productivity of 5-aminolevulinic acid was observed when the rrnB promoter (PrrnB) was located upstream of the hemT gene, whereas no improvement in 5-aminolevulinic acid productivity was observed when the rrnB promoter (PrrnB) was located upstream of the hemA gene. Therefore, the strain of the present invention is a photosynthetic bacterium strain that has a gene encoding HemT (hemT) under the control of PrrnB and expresses ALAS, and is highly productive of 5-aminolevulinic acid. Here, the hemT gene is preferably a gene derived from the same species as the photosynthetic bacterium or an endogenous gene.

[0027] Next, we will explain the hemT gene, whose expression is induced by the rrnB promoter (PrrnB) derived from the genome of the same species and introduced by homologous recombination into the photosynthetic bacterial strain of the present invention. The hemT gene is derived from the genome of a photosynthetic bacterium and may have any sequence as long as it encodes a polypeptide having 5-aminolevulinic acid synthase activity. Examples of hemT genes include the following: Rhodobacter sphaeroides strain 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, or KD131. When inducing the expression of these hemT genes, a self-cloning technique is used, and therefore the strain of the present invention is a strain of Rhodobacter sphaeroides, which is the same species as the species from which the hemT gene is derived. Here, the strain of the present invention does not necessarily have to be the same strain as the strain from which the hemT gene is derived, as long as it is the same species as the species from which the hemT gene is derived.

[0028] A specific example of the hemT gene is a nucleic acid comprising a nucleotide sequence encoding a protein having the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2. Here, the nucleotide sequence of SEQ ID NO: 1 corresponds to the full-length coding region of the hemT gene contained in the genome of Rhodobacter sphaeroides strain 2.4.1, and SEQ ID NO: 2 corresponds to the amino acid sequence encoded by the hemT gene. Also suitable for use in the present invention are nucleotide sequences that have 90% or more (preferably 92% or more, more preferably 95% or more, even more preferably 98% or more, and most preferably 99% or more) sequence identity with a nucleotide sequence encoding a protein having the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and that encode a protein having 5-aminolevulinic acid synthase activity, and nucleotide sequences in which 1 to 120 (preferably 1 to 60, more preferably 1 to 40, even more preferably 1 to 20, and most preferably 1 to 10) nucleotides have been deleted, substituted, added, or inserted from the nucleotide sequence encoding a protein having the nucleotide sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and that encode a protein having 5-aminolevulinic acid synthase activity. When a BLAST search was performed on the base sequence of SEQ ID NO: 1, the hemT genes derived from the genomes of any of the Rhodobacter sphaeroides strains H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, CH10, and KD131 all showed sequence identity of 91% or more.

[0029] Next, we will explain the PrrnB gene derived from the genome of the photosynthetic bacterium of the present invention, which is introduced into the strain by homologous recombination to induce expression of the hemT gene. PrrnB is a nucleic acid derived from the ribosomal RNA operon promoter (PrrnB) in the genome of the photosynthetic bacterium, and an expression control region containing this PrrnB is used in the present invention. The expression control region containing the rrnB promoter may have any sequence as long as it has the activity to induce expression of the hemT gene under its control in the strain of the present invention. Examples of such expression control regions include the PrrnB-containing expression control regions in the genomes of the following strains: That is, an expression control region containing PrrnB derived from the genome of any of the following Rhodobacter sphaeroides strains: 2.4.1, H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, ATH 2.4.3 (ATCC17025), ATH 2.4.9 (ATCC 17029), IFO 12203, CH10, KD131, or HJ.

[0030] A specific example of PrrnB is a nucleic acid containing the nucleotide sequence of SEQ ID NO: 4 or 5. Here, the nucleotide sequence of SEQ ID NO: 4 or 5 corresponds to the rrnB promoter region having a length of 58 or 195 bases contained in the genome of Rhodobacter sphaeroides strain 2.4.1, or a nucleic acid containing the same. Also suitable for use in the present invention are nucleotide sequences that have 90% or more (preferably 94% or more, more preferably 96% or more, even more preferably 98% or more, and most preferably 99% or more) sequence identity with the nucleotide sequence of SEQ ID NO: 4 or 5 and have hemT expression-inducing activity, and nucleotide sequences in which 1 to 19 (preferably 1 to 15, more preferably 1 to 10, even more preferably 1 to 5, and most preferably 1 to 3) nucleotides have been deleted, substituted, added, or inserted relative to the nucleotide sequence of SEQ ID NO: 4 or 5, and that have hemT expression-inducing activity. When a BLAST search was performed on the base sequence of SEQ ID NO: 4 or 5, PrrnB derived from the genome of any of the Rhodobacter sphaeroides strains H2, DSM158, MBTLJ-20, MBTLJ-13, MBTLJ-8, AB24, AB25, AB27, AB29, CH10, KD131, and HJ strains all showed sequence identity of 96% or 94% or more.

[0031] Functional fragments of the rrnB promoter (PrrnB) can also be used in the present invention as long as they have the activity of inducing hemT expression. According to Henry et al. (Proc. Natl. Acad. Sci. USA, (2020) vol. 117, pp. 29658-29668), PrrnB contains a 6-base sequence (TTGCGC) in the -35 region recognized by transcription factors and a 6-base sequence (TAGAAA) in the -10 region recognized by RNA polymerase. A 29-base sequence (TTGCGCCCGGGGCCGTCTGCTCCTAGAAA; SEQ ID NO: 3) containing both sequences, or a 58-base sequence (TACGGAGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTCA; SEQ ID NO: 4) containing both sequences is considered to be the minimum unit or promoter region that functions as a functional fragment of the rrnB promoter, and is a suitable functional fragment of PrrnB. Here, the nucleotide sequence of SEQ ID NO: 3 or 4 corresponds to the nucleotide sequence of positions 159 to 187 or 138 to 195 of the nucleotide sequence of SEQ ID NO: 5. Therefore, nucleic acids comprising a nucleotide sequence that includes the entire nucleotide sequence of SEQ ID NO: 3 or 4 and corresponds to a partial sequence of the nucleotide sequence of SEQ ID NO: 5, having a 5'-end at any position from 1 to 158 of SEQ ID NO: 5 and a 3'-end at any position from 188 to 195, or a nucleotide sequence that has a 5'-end at any position from 1 to 137 of SEQ ID NO: 3 and a 3'-end at position 194 or 195, are also suitable for use in the present invention as functional fragments or promoter regions of PrrnB of the present invention. In the nucleotide sequences of SEQ ID NO: 4 and SEQ ID NO: 5, the adenine residue at the 3'-end serves as the transcription initiation site. In the present invention, the expression-inducing activity of hemT literally means the activity of inducing the expression of hemT, and although not necessarily limited to this, it means, for example, the activity of inducing hemT expression 5-fold, 10-fold, 20-fold, or 30-fold, and particularly preferably 40-fold or more, compared to the expression of hemT in a wild-type strain or a standard strain; from another perspective, it means an activity that is equal to or greater than the expression-inducing activity of hemT by a nucleic acid having the base sequence of any of SEQ ID NOs: 3, 4, or 5.

[0032] Next, the insertion position of the rrnB promoter (PrrnB) or a functional fragment thereof will be described. The insertion position is not necessarily limited as long as PrrnB or a functional fragment thereof functions as a promoter and induces transcription of the hemT gene located downstream thereof. Typically, the insertion position is upstream of the coding region of the hemT gene, the transcription start site, or the ribosome binding sequence. An example of an insertion position is upstream of the coding region of the hemT gene, and within 10,000 bases, preferably within 1,000 bases, more preferably within 100 bases, and even more preferably adjacent to the transcription start site of the hemT gene, from the start codon of the hemT gene. However, since the purpose is to induce expression of the hemT gene, it is required that a transcription termination sequence does not exist between the inserted PrrnB or a functional fragment thereof and the start codon of the hemT gene. Therefore, if a transcription termination sequence exists, the sequence is modified to remove the transcription termination sequence. In addition, the insertion sequence containing the promoter region of PrrnB or a functional fragment thereof may also contain other elements such as a transcription initiation site (adenine base), a ribosome binding sequence, or other genes, as appropriate.

[0033] A photosynthetic bacterial strain according to one embodiment of the present invention is produced by self-cloning technology and is substantially free of nucleic acid sequences derived from heterologous organisms, such as foreign genes. In self-cloning, organisms of the same species are used as the source of transforming DNA and the host for transformation. Thus, in the present invention, an insertion sequence containing PrrnB or a functional fragment thereof derived from a certain species of photosynthetic bacterium is used as the source and inserted into the host genome of the same species of photosynthetic bacterium. This insertion functionally links PrrnB or a functional fragment thereof derived from the same species of photosynthetic bacterium to the hemT gene, and expression of hemT is induced in the self-cloning strain by the expression-inducing activity of the rrnB promoter. The genome of the strain of the present invention produced by self-cloning technology is completely or substantially free of nucleic acids derived from organisms of a species different from the host photosynthetic bacterium. Here, "substantially free" refers to the limited presence of heterologous nucleic acids or artificial nucleic acid sequences with very short sequences of approximately 1 to 30 bases (preferably 20 bases or less, more preferably 10 bases or less, and even more preferably 6 bases or less), such as polylinkers used to facilitate in vitro cloning. Here, it is not intended to encompass heterologous nucleic acids such as heterologous antibiotic resistance genes used as selection markers.

[0034] Self-cloning is a technique well known to those skilled in the art (see Akada et al., (1999) J. Biosci. Bioeng., vol. 87, pp. 43-48, JP 2003-144164 A, etc., if necessary), and can be appropriately performed by those skilled in the art by combining and applying general molecular biological experimental techniques.

[0035] One embodiment of the present invention is a method for producing a photosynthetic bacterium strain with high productivity of 5-aminolevulinic acid. The method comprises the step of inserting, into a wild-type strain of photosynthetic bacterium by homologous recombination, an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of a gene (hemT) encoding 5-aminolevulinic acid synthase HemT in the genome of the wild-type strain, wherein the inserted PrrnB induces expression of hemT, resulting in increased productivity of 5-aminolevulinic acid compared to the wild-type strain, and the photosynthetic bacterium is a species belonging to the class α-Proteobacteria.

[0036] One embodiment of the method of the present invention for producing a photosynthetic bacterium strain with high 5-aminolevulinic acid productivity is a method using a plasmid vector for homologous recombination. The plasmid vector contains an expression control region containing PrrnB, and homologous regions consisting of sequences homologous to the upstream and downstream regions of the genome adjacent to the target region of homologous recombination are located on both sides of the expression control region containing PrrnB. The homologous regions may be of any sequence length as long as they can induce homologous recombination efficiently and specifically at the target site, for example, a sequence length of 20 bases or more, 100 bases or more, 500 bases or more, or 1,000 bases or more. The portion located outside the homologous region relative to the expression control region containing PrrnB is not inserted into the host by homologous recombination, and may therefore contain nucleic acid heterologous to the host genome. An example of such heterologous nucleic acid is a positive selection marker (Gm R These include antibiotic resistance genes (e.g., sacB) and negative selection markers (e.g., sacB).

[0037] Another embodiment of the present invention is a method for producing 5-aminolevulinic acid, comprising culturing a photosynthetic bacterial strain of the present invention in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and recovering 5-aminolevulinic acid from the culture. Cultivating photosynthetic bacteria for the purpose of producing 5-aminolevulinic acid and recovering the product, 5-aminolevulinic acid, are both well-known techniques, and those skilled in the art can appropriately perform these procedures by referring to known literature. As long as 5-aminolevulinic acid can be produced, the medium may be solid or liquid. Furthermore, the medium components may be any as long as they contain a substrate (e.g., glycine) involved in 5-aminolevulinic acid production and are suitable for the growth of photosynthetic bacteria. As described in Patent Document 3, a medium containing a plant protein hydrolysate in addition to conventional nutrients such as yeast extract can also be used. A preferred example of the method for producing 5-aminolevulinic acid of the present invention is a method using a liquid medium and performing shaking culture. The oxygen conditions for cultivation may be aerobic, microaerobic (oxygen-limited), or anaerobic as long as 5-aminolevulinic acid can be produced, but microaerobic conditions are preferred. This is because oxygen inhibits pigment synthesis in photosynthetic bacteria, particularly purple nonsulfur bacteria, and 5-aminolevulinic acid synthase is also known to be inactivated by oxygen. Microaerobic conditions can be achieved by artificially suppressing oxygen supply, but they can also be achieved naturally through continuous shaking cultivation in an environment with insufficient ventilation. Furthermore, if light irradiation is not performed during cultivation, photosynthetic bacteria will be placed in a heterotrophic environment, requiring oxygen for growth, making anaerobic conditions unsuitable. To increase the productivity of 5-aminolevulinic acid, various environmental conditions for the cultivation of the strain, such as medium components, oxygen supply, and light irradiation, including their combinations, can be appropriately adjusted.

[0038] The culture temperature and medium pH may be any temperature and pH as long as the photosynthetic bacterium strain of the present invention grows and produces 5-aminolevulinic acid, but for example, the culture temperature is preferably 10 to 40°C, particularly 20 to 35°C, and the medium pH is preferably 3 to 9, particularly 6 to 8. If the pH changes during the production of 5-aminolevulinic acid, it is preferable to adjust the pH using an alkaline solution such as sodium hydroxide, ammonia, or potassium hydroxide, or an acid such as hydrochloric acid, sulfuric acid, or phosphoric acid.

[0039] The 5-aminolevulinic acid produced by the photosynthetic bacterial strain of the present invention through cultivation can be purified by a conventional method, such as ion exchange, chromatography, or extraction, as needed.

[0040] The present invention will be described in detail below with reference to examples, but these are given for illustrative purposes only and the present invention is not limited to these examples.

[0041] <Materials and Methods> 1. Strains, Media, Culture, Plasmids, and Primers Rhodobacter sphaeroides strains were grown aerobically in PYS medium (0.3% Bacto-peptone, 0.3% Bacto-yeast extract, 2 mM CaCl2, and 2 mM MgSO4) at 30°C in a shaker. Escherichia coli was grown at 37°C in Luria-Bertani medium (1% Bacto-tryptone, 0.5% Bacto-yeast extract, 0.5% NaCl). The strains, plasmids, and primers used in the following examples are listed below.

[0042] JM109; Yanisch-Perron et al., Gene (1985) vol. 33, pp. 103-119. JM109 λ pir; JM109 lysogenized with λ pir bacteriophage; Penfold and Pemberton, Gene (1992) vol. 118, pp. 145-146. S17-1; F-, thi, pro, hsdR, [RP4-2 Tc::Mu Km::Tn7 (Tp Sm)]; Simon et al., Bio / Technology (1983) vol. 1, pp. 784-791. S17-1; S17-1 lysogenized with λ pir bacteriophage; De Lorenzo, et al., J. Bacteriol. (1990) vol. 172, pp. 6568-6572.

[0043] Photosynthetic bacterium Rhodobacter sphaeroides 2.4.1; wild-type strain; Sistrom, J. Gen. Microbiol., (1960) vol. 22, pp. 778-785. WT; rifampicin-resistant strain BA derived from strain 2.4.1; The rrnB promoter was inserted upstream of the hemA transcription start site BT; The rrnB promoter was inserted upstream of the hemT transcription start site BAT; The rrnB promoter was inserted upstream of both the hemA and hemT transcription start sites 7A; The rsp_7571 promoter was inserted upstream of the hemA start codon 7T; The rsp_7571 promoter was inserted upstream of the hemT start codon 7AT; The rsp_7571 promoter was inserted upstream of both the hemA start codon and hemT start codon. WT, BA, BT, BAT, 7A, 7T, and 7AT strains were newly constructed in the present invention.

[0044] Plasmid pZJD29A; Suicide vector, sacB, Gm r; Swem et al., EMBO J. (2003) vol. 22, pp. 4699-4708. pZJD29A PrrnB hemA; Sequence to insert PrrnB upstream of the hemA transcription start site on pZJD29A. pZJD29A PrrnB hemT; Sequence to insert PrrnB upstream of the hemT transcription start site on pZJD29A. pZJD29A Prsp_7571 hemA; Sequence to insert Prsp_7571 upstream of the hemA coding sequence on pZJD29A. pZJD29A Prsp_7571 hemT; Sequence to insert Prsp_7571 upstream of the hemT coding sequence on pZJD29A

[0045] Primers (for cloning): MCShemAUP-F; SEQ ID NO:6; upstream of hemA transcription start site PrrnB; hemAUP-R; SEQ ID NO:7; upstream of hemA transcription start site PrrnB; hemADW-F; SEQ ID NO:8; downstream of hemA transcription start site MCShemADW-R; SEQ ID NO:9; downstream of hemA transcription start site hemAUPPrrnB-F; SEQ ID NO:10; Promotor of rrnB; hemADWPrrnB-R; SEQ ID NO:11; Promotor of rrnB; MCShemTUP-F; SEQ ID NO:12; upstream of hemT transcription start site PrrnB; hemTUP-R; SEQ ID NO:13; upstream of hemT transcription start site PrrnB; hemTDW-F; SEQ ID NO:14; downstream of hemT transcription start site MCShemTDW-R; SEQ ID NO:15; downstream of hemT transcription start site hemTUPPrrnB-F; SEQ ID NO:16; Promotor of rrnB hemTDWPrrnB-R; SEQ ID NO: 17; Promotor of rrnB MCShemAUP-F2; SEQ ID NO: 18; upstream of hemA start codon P7571hemAUP-R; SEQ ID NO: 19; upstream of hemA start codon P7571hemADW-F; SEQ ID NO: 20; downstream of hemA start codon MCShemADW-R2; SEQ ID NO: 21; downstream of hemA start codon hemAUPP7571-F; SEQ ID NO: 22; Promotor of rsp_7571 hemADWP7571-R; SEQ ID NO: 23; Promotor of rsp_7571 MCShemTUP-F2;SEQ ID NO: 24: upstream of hemT start codon P7571hemTDW-F; SEQ ID NO: 25: upstream of hemT start codon P7571hemTUP-R; SEQ ID NO: 26: downstream of hemT start codon MCShemTDW-R2; SEQ ID NO: 27: downstream of hemT start codon hemTUPP7571-F; SEQ ID NO: 28: Promotor of rsp_7571 hemTDWP7571-R; SEQ ID NO: 29: Promotor of rsp_7571;

[0046] 2. Quantitative Real-Time PCR. RNA was extracted from logarithmically growing cells using the RNeasy Mini Kit (QIAGEN). cDNA was synthesized from RNA by reverse transcription using the PrimeScript RT reagent Kit (TaKaRa bio). cDNA was quantified by real-time PCR using TB Green Premix Ex Taq II (TaKaRa bio) and the Thermal Cycler Dice Real Time System III (TaKaRa bio). Each cDNA sample was quantified three times as technical replicates. The primer sequences used for amplification are shown below. The cycle threshold (Ct) value of each sample was calculated using the second derivative maximum method. The normalized ΔCt was calculated using the rpoZ gene, which encodes the ω subunit of RNA polymerase, as an endogenous control for each cell type. The ΔΔCt of each sample was calculated using the ΔCt of wild-type cells grown under aerobic conditions as a calibrator.

[0047] The primers used for quantitative real-time PCR are as follows: rpoZqRT-F; SEQ ID NO: 30; Gomelsky et al., Microbiology (2003) vol. 149, pp. 377-388. rpoZqRT-R; SEQ ID NO: 31; Gomelsky et al., Microbiology (2003) vol. 149, pp. 377-388. hemTqRT-F; SEQ ID NO: 32; newly designed in this application; hemTqRT-R; SEQ ID NO: 33; newly designed in this application; hemAqRT-F; SEQ ID NO: 34; newly designed in this application; hemAqRT-F; SEQ ID NO: 35; newly designed in this application.

[0048] 3. Detection of ALAS Activity. ALAS activity in crude cell extracts was measured according to the method of Yubisui et al. (Arch. Biochem. Biophys., (1972), 150, 77-85). The culture medium was centrifuged at 8,000 × g for 5 minutes at 4°C, and the resulting cell pellet was suspended in ice-cold 50 mM Tris-HCl buffer (pH 7.5). The cell suspension was sonicated and centrifuged at 10,000 × g for 5 minutes at 4°C. The protein concentration of the resulting supernatant was measured by Bradford protein assay. The enzyme solution (95% cell lysate supernatant, 20 mM Tris-HCl (pH 7.5), 0.35 mM pyridoxal phosphate) and substrate solution (0.5 M glycine, 1 mM succinyl-CoA) were incubated at 37°C for 5 minutes. The enzyme reaction was initiated by adding 25% of the substrate solution to the enzyme solution. After 5 minutes, the reaction was stopped by adding 30% of the volume of 10% trichloroacetic acid to the reaction mixture and cooling on ice. The concentration of 5-aminolevulinic acid in each reaction mixture was determined according to the method of Mauzerall et al. (J. Biol. Chem., (1956), 219, 435.). 5-aminolevulinic acid in each sample was boiled at 100°C for 15 minutes in 2 M acetate buffer (pH 4.6) and reacted with 1% acetylacetone. The reaction mixture was mixed with 175% of the volume of modified Ehrlich's reagent (20 g / L p-dimethylaminobenzaldehyde, 12% perchloric acid, 60% glacial acetic acid), and the resulting pyrrole compound was quantified colorimetrically by measuring the absorbance at 553 nm.

[0049] 4. Fermentative Production of 5-Aminolevulinic Acid 5-Aminolevulinic acid was produced in various strains of Rhodobacter sphaeroides using the method of Nishikawa et al. (J. Biosci. Bioeng., (1999), 87, 798-804). Each strain was cultured in 120 mL of GGY2 medium (50 mM glucose, 3.8 g / L monosodium L-glutamate monohydrate, 2.0 g / L Bacto yeast extract, 1.13 g / L NaH2PO4·12H2O, 1.07 g / L NaH2PO4·2H2O, 0.8 g / L (NH4)2HPO4, 0.2 g / L MgSO4·7H2O, 53 mg / L CaCl2·2H2O, 1.2 mg / L MnSO4, 1.0 mg / L nicotinic acid, 1.0 mg / L thiamine hydrochloride, and 0.01 mg / L biotin) in a 300 mL baffled Erlenmeyer flask with 2.4 mL of preculture medium. The cultures were incubated at 30°C, 170 rpm, and 48 h in the dark under aerobic conditions. Each culture was centrifuged at 5,000 × g for 5 minutes. A 1.0 g wet cell pellet was suspended in 20 ml of fresh GGY2 medium containing the substrate (60 mM glycine) and metabolic inhibitor (30 mM levulinic acid) and cultured in a test tube at 30°C, 150 rpm, and in the dark. Each strain was cultured in three independent test tubes. After 0, 12, 18, 24, 36, 42, and 48 hours of culture, the 5-aminolevulinic acid concentration in each culture supernatant was measured as described above (detection of ALAS activity).

[0050] Example 1: Construction of Self-Cloning Strains Containing the rrnB or rsp_7571 Promoter Inserted Upstream of the hemA or hemT Gene of Rhodobacter sphaeroides (Figures 1 and 2) (1) To insert the rrnB promoter upstream of the hemA transcription start site, a suicide vector, pZJD29A PrrnB hemA, was constructed. Sixty-hundred-bp DNA fragments upstream and downstream of the hemA transcription start site, along with the rrnB promoter, were PCR-amplified and inserted into pZJD29A. Similarly, pZJD29A PrrnB hemT was constructed. These plasmids were conjugated to Rhodobacter sphaeroides using Escherichia coli, and single-recombinant strains were obtained in which the plasmid had undergone homologous recombination into the genome using the antibiotic resistance gene on the plasmid as a marker. These strains were selected on sucrose plates to obtain double-recombinant strains in which the plasmid-derived sequence had been removed from the genome by homologous recombination. The genomes of the resulting strains were confirmed to contain the promoter. We constructed R. sphaeroides strains in which the rrnB promoter was inserted upstream of hemA, hemT, or both hemA and hemT. Specifically, the 195-bp region upstream of the rrnB transcription start site was inserted upstream of the transcription start sites of hemA, hemT, or both hemA and hemT (Figure 2). The strain in which PrrnB was inserted only in hemA was designated BA, the strain in which PrrnB was inserted only in hemT was designated BT, and the strain in which PrrnB was inserted in both hemA and hemT was designated BAT. The transcription start sites of rrnB, hemA, and hemT were determined based on Dryden et al. (J. Bacteriol., (1993), 175, 6392-6402) and Neidle et al. (J. Bacteriol., (1993), 175, 2292-2303). The rrnB promoter (PrrnB) is known to be a constitutive promoter that exhibits the highest transcriptional activity among the promoters of the ribosomal RNA operons (rrnA, rrnB, rrnC).

[0051] (2) Self-cloning strains of R. sphaeroides carrying the rsp_7571 promoter inserted upstream of the transcription start site of the hemA or hemT gene were constructed as follows. To insert the rsp_7571 promoter upstream of the hemA start codon, pZJD29A Prsp_7571 hemA was constructed. Two 600-bp DNA fragments, one upstream and one downstream of the hemA start codon, and the rsp_7571 promoter were amplified by PCR and inserted into pZJD29A. Similarly, pZJD29A Prsp_7571 hemT was constructed. These plasmids were used to construct R. sphaeroides strains carrying the rsp_7571 promoter. Specifically, 498 bp upstream of the rsp_7571 start codon was inserted upstream of the start codon of hemA and / or hemT (Figure 2). The strain in which Prsp_7571 was inserted only into hemA was designated 7A, the strain in which Prsp_7571 was inserted only into hemT was designated 7T, and the strain in which Prsp_7571 was inserted into both hemA and hemT was designated 7AT. The promoter of rsp_7571 (Prsp_7571) is known to be a highly active constitutive promoter in Rhodobacter sphaeroides strain 2.4.1.

[0052] Example 2: Functional Verification of the Inserted PrrnB and Prsp_7571 Promoters To verify the functionality of the inserted PrrnB promoter, we quantified the mRNA expression of hemA and hemT in WT, BA, BT, and BAT strains grown under aerobic and microaerobic conditions (Figure 3). In BA and BAT strains with PrrnB inserted upstream of hemA, hemA mRNA levels increased 3.5-fold and 2.4-fold, respectively, under aerobic conditions. Under microaerobic conditions, the difference narrowed due to induction of WT hemA expression, but hemA expression levels in BA and BAT were still 1.3-fold higher than in WT (Figure 3, top). In BT and BAT strains with PrrnB inserted upstream of hemT, hemT expression increased 24-fold and 41-fold, respectively, under aerobic conditions and 37-fold and 46-fold, respectively, under microaerobic conditions (Figure 3, bottom). These results demonstrate that insertion of PrrnB into the promoter region of the ALAS gene increases its expression. On the other hand, no positive effect was observed from the insertion of Prsp_7571 into the hemA and hemT promoters. The transcription levels of hemA and hemT did not increase in 7A, 7T, and 7AT compared to those of WT under aerobic and semi-aerobic conditions (Figure 3). These results confirm the favorable results of the self-cloning strains BT and BAT, in which the rrnB promoter is located upstream of the hemT gene.

[0053] Example 3: Fermentative Production of 5-aminolevulinic Acid The productivity of 5-aminolevulinic acid was evaluated for the constructed strains using a medium supplemented with glycine, a substrate of 5-aminolevulinic acid, and levulinic acid, a metabolic inhibitor of 5-aminolevulinic acid. After transferring the cells to the production medium, an increase (up to around 20 hours) and a decrease (after 20 hours) in the amount of 5-aminolevulinic acid accumulated were observed in the BT and WT cultures (Figure 4). In particular, the maximum 5-aminolevulinic acid concentration in the BT culture medium was 9.2 mM, approximately 12-fold higher than that of the WT (0.78 mM). In the cultures of the other strains, BA and BAT, 5-aminolevulinic acid accumulated at a lower level than that of the WT (Figure 4).

Claims

1. A photosynthetic bacterial strain belonging to the class α-proteobacteria having an expression control region including a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding the 5-aminolevulinic acid synthase HemT, said expression control region being derived from the same species of photosynthetic bacteria as said strain and inducing expression of hemT, said induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain.

2. A method for producing 5-aminolevulinic acid, comprising culturing the strain according to claim 1 in a medium, producing and accumulating 5-aminolevulinic acid in the strain and the medium, and collecting 5-aminolevulinic acid from the culture.

3. A method for producing a photosynthetic bacterial strain belonging to the class α-proteobacteria, which has an expression control region containing a ribosomal RNA operon promoter (PrrnB) upstream of the gene (hemT) encoding the 5-aminolevulinic acid synthase HemT, said expression control region being derived from the same species of photosynthetic bacteria as the strain and inducing expression of hemT, said induction resulting in increased productivity of 5-aminolevulinic acid compared to a wild-type strain, said method for producing said strain, characterized in that it includes a step of functionally linking PrrnB to hemT.

Images