Novel peptide having activity of improving skin condition and uses thereof

Abstract

The present invention relates to a peptide having an activity of improving skin conditions. The peptide of the present invention increases the expression levels of extracellular matrix components and skin barrier enhancement factors, reduces the expression of skin cell damage factors increased by UV irradiation, and restores the expression levels of extracellular matrix components and skin barrier enhancement factors reduced by UV irradiation or heat-shock.

Description

Peptides having skin condition improvement activity and uses thereof

[0001] [Cross-citation with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0106435, filed August 14, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to a novel peptide having skin condition improvement activity and its use.

[0005] The skin, an organ that covers all of the body's organs, protects the body from external invasion and plays a crucial role in maintaining homeostasis by conserving moisture and temperature. Histologically, the skin is composed of three layers: the epidermis, dermis, and subcutis. Skin aging can be divided into intrinsic and extrinsic factors. Intrinsic aging occurs naturally with age and is thought to be caused by a decline in skin cell activity due to genetic factors, such as telomere shortening. Extrinsic aging is caused by environmental factors such as sunlight, cold, wind, and fine dust, of which ultraviolet and infrared rays from sunlight are known to be the most important.

[0006] As skin ages, collagen and elastic fibers, which are fibrous tissues that support the skin's structure, harden. Meanwhile, the ground substance, which fills the spaces between cells and between fibrous substances such as collagen and elastic fibers, has a very strong ability to retain moisture. As these ground substances decrease, skin elasticity decreases and wrinkles develop. Representative substances among these ground substances are hyaluronic acid and mucopolysaccharides. As skin ages, hyaluronidase increases, gradually reducing the amount of hyaluronic acid in the dermis. Furthermore, free radicals induced by ultraviolet rays or generated by intracellular respiration react with unsaturated fatty acids in cell membranes to form new radicals, peroxyradicals. These substances initiate a chain reaction in the presence of oxygen, further inducing lipid peroxidation. Lipid peroxidation can further amplify lipid peroxidation reactions and react with proteins, damaging the function of enzymes and receptor systems. Thus, reactive oxygen species are a major cause of damage to skin cells and tissues. Furthermore, reactive oxygen species disrupt the skin's antioxidant defense network, which consists of antioxidant enzymes and non-enzymatic antioxidants, thereby shifting the balance between oxidants and antioxidants toward oxidation. Continued oxidative stress damages biological components through processes such as lipid peroxidation, protein oxidation, activation of proteolytic enzymes that destroy interstitial components, chain scission and abnormal cross-linking of collagen and elastin, cleavage of hyaluronic acid chains, promotion of melanin production, and DNA oxidation.

[0007] Hemidesmosomes are the junctions that attach epithelial tissue to the underlying basal layer. They are mediated by hemidesmosomal integrin proteins, which bind to keratin filaments on the inner surface while simultaneously binding to laminin in the basal layer on the outer surface of the cell, thereby attaching the cell to the basal layer. In skin structure, hemidesmosomes occur at the dermoepidermal junction (DJ), where keratinocytes in the basal layer of the epidermis attach to the extracellular matrix of the dermis. Through this structure, the skin barrier maintains its integrity.

[0008] Patent documents on peptide active substances with skin aging or wrinkle improvement activity are as follows: Korean Patent No. 10-2486996, Korean Patent No. 10-2507392, and International Patent Application PCT-KR2021-011278.

[0009] [Prior Art Literature]

[0010] [Patent Document]

[0011] Republic of Korea Patent No. 10-2486996,

[0012] Republic of Korea Patent No. 10-2507392,

[0013] International Patent Application No. PCT-KR2021-011278

[0014] The inventors of the present invention have dedicated their research efforts to developing an effective active substance that can be used to improve skin conditions, including inhibiting skin aging and improving the appearance of wrinkles. As a result, the inventors experimentally confirmed that the novel peptide they synthesized exhibits excellent skin-conditioning activity, preventing skin aging and wrinkles caused by both endogenous and exogenous factors, thereby completing the present invention.

[0015] Therefore, the purpose of the present invention is to provide a novel peptide having skin condition improvement activity.

[0016] Another object of the present invention is to provide a composition for improving skin condition comprising the peptide as an active ingredient.

[0017] In order to achieve the purpose of the present invention described above,

[0018] One aspect of the present invention provides a peptide comprising the amino acid sequence disclosed in SEQ ID NO: 1.

[0019] Another aspect of the present invention provides a composition for improving skin condition comprising the peptide as an active ingredient.

[0020] The present invention is described in detail below.

[0021] Peptides and their activities

[0022] According to one aspect of the present invention, a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 is provided.

[0023] [Amino acid sequence of sequence number 1]

[0024] EIVRKKPI

[0025] The term "peptide" as used herein means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0026] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, for example, the activity of improving skin condition.

[0027] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0028] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, or 98% or more, with the amino acid sequence of SEQ ID NO: 1. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0029] The peptide of the present invention may be modified at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity. Such N-terminus and / or C-terminus modifications can significantly improve the stability of the peptide of the present invention, for example, increasing the half-life of the peptide when administered in vivo. The term "stability" encompasses not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0030] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), an azide (-NHNH2), or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0031] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0032] The peptide of the present invention has the activity of improving skin condition.

[0033] In one embodiment, the peptide of the present invention has the following activities with respect to improving skin condition:

[0034] (i) Increases the expression level of genes for collagen Iα1, fibronectin, and elastin, which are components of the extracellular matrix.

[0035] (ii) Increases the expression of pro-collagen Iα1 and hyaluronic acid, which are components of the extracellular matrix.

[0036] (iii) Increases the expression levels of SIRT1 (Sirtuin 1) gene and AQP3 (Aquaporin 3) gene, which are skin barrier strengthening factors.

[0037] (iv) Reduces the level of reactive oxygen species increased by ultraviolet irradiation.

[0038] (v) Increases the expression levels of genes for collagen Iα 1, fibronectin, and elastin, which are extracellular matrix components reduced by ultraviolet irradiation.

[0039] (vi) Increases the expression levels of SIRT1, AQP3, COL17A1, ITGB1, ITGB4, ITGA6, and Plectin, which are skin barrier strengthening factors reduced by UV irradiation.

[0040] (vii) Reduces the expression level of MMP-1 increased by UV irradiation and heat shock.

[0041] Composition for improving skin condition

[0042] According to another aspect of the present invention, a composition for improving skin condition is provided, which comprises a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0043] The peptide of the present invention having the above-described activity exhibits excellent efficacy in improving skin condition and can be used for improving skin condition.

[0044] In one embodiment, the improvement of skin condition in the composition for improving skin condition may be improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of skin barrier.

[0045] In one embodiment, the composition for improving skin condition of the present invention has one or more of the following activities:

[0046] (i) Increases the expression level of genes for collagen Iα1, fibronectin, and elastin, which are components of the extracellular matrix.

[0047] (ii) Increases the expression of pro-collagen Iα1 and hyaluronic acid, which are components of the extracellular matrix.

[0048] (iii) Increases the expression levels of SIRT1 (Sirtuin 1) gene and AQP3 (Aquaporin 3) gene, which are skin barrier strengthening factors.

[0049] (iv) Reduces the level of reactive oxygen species increased by ultraviolet (UV) irradiation.

[0050] (v) Increases the expression levels of genes for collagen Iα 1, fibronectin, and elastin, which are extracellular matrix components reduced by ultraviolet irradiation.

[0051] (vi) Increases the expression levels of SIRT1, AQP3, COL17A1, ITGB1, ITGB4, ITGA6, and Plectin, which are skin barrier strengthening factors reduced by UV irradiation.

[0052] (vii) Reduces the expression level of MMP-1 increased by UV irradiation and heat shock.

[0053] The composition for improving skin condition of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 μM, specifically, the peptide of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0054] In one embodiment, the composition for improving skin condition described above may be a cosmetic composition.

[0055] The above cosmetic composition may be prepared in any formulation commonly manufactured in the technical field to which the present invention pertains, and may be a topical skin preparation. For example, it may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto.

[0056] The above cosmetic composition can be manufactured in various forms such as a solution, sol-gel, emulsion, oil, wax, aerosol, etc., such as a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, a powder, a hair tonic, a hair cream, a hair lotion, a hair shampoo, a hair rinse, a hair conditioner, a hair spray, a hair aerosol, a pomade, a gel, etc., but is not limited thereto.

[0057] The cosmetic composition of the present invention may include other additives such as excipients and carriers, and it is possible to apply and mix as much as necessary the usual ingredients mixed in general skin cosmetics.

[0058] When the formulation of the above cosmetic composition is in the form of a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0059] When the formulation of the above cosmetic composition is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included, but is not limited thereto.

[0060] When the formulation of the above cosmetic composition is in the form of a solution or emulsion, a solvent, a solubilizer or an emulsifier may be used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0061] When the formulation of the above cosmetic composition is in the form of a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethyl sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0062] When the formulation of the above cosmetic composition is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0063] When the formulation of the above cosmetic composition is a hair shampoo, base ingredients for forming a shampoo, such as a thickener, a surfactant, a viscosity modifier, a moisturizer, a pH adjuster, a preservative, and essential oils, may be mixed. CDE may be used as the thickener, LES, which is an anionic surfactant, and coco betaine, which is an amphoteric surfactant, polyquat may be used as the viscosity modifier, glycerin may be used as the moisturizer, and citric acid or sodium hydroxide may be used as the pH adjuster. Grapefruit extract or the like may be used as the preservative, and in addition, essential oils such as cedarwood, peppermint, and rosemary, as well as silk amino acids, pentaol, or vitamin E may be added.

[0064] The ingredients included in the above cosmetic composition may further include, in addition to the peptide of the present invention and the carrier component as active ingredients, ingredients commonly used in cosmetic compositions, such as conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, but are not limited thereto.

[0065] According to another aspect of the present invention, a functional food composition for improving skin condition is provided, which comprises a peptide having an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0066] The above skin condition improvement may be improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

[0067] The activity related to improving skin condition in the functional food composition of the present invention is the same as that described in the composition for improving skin condition described above, and therefore, this is cited and will not be described again.

[0068] In the functional food composition of the present invention, the active ingredient, peptide, may be included in an appropriate amount selected within a range of 10 wt% or less, specifically 0.000001 wt% to 10 wt%, based on the total composition weight.

[0069] The functional food composition of the present invention may include a food-related effective amount of a peptide and a food-related acceptable carrier.

[0070] The functional food composition of the present invention comprises not only the peptide as the effective ingredient, but also components commonly added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents, thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

[0071] In addition to the above-described ingredients, the functional food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juices and fruit juice drinks and vegetable drinks. For example, when the functional food composition of the present invention is produced as a drink, in addition to the peptide, which is an effective ingredient of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc. may be additionally contained.

[0072] There are no specific restrictions on the types of the above functional foods. Examples of the above functional foods or foods include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea drinks, alcoholic beverages, vitamin complexes, dairy products, fermented milk, etc., and all functional foods or foods in the conventional sense can be included.

[0073] According to another aspect of the present invention, a pharmaceutical composition for preventing or treating skin aging is provided, comprising a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0074] In one embodiment, the skin aging may be photoaging of the skin.

[0075] In one embodiment, the photoaging of the skin may be photoaging caused by ultraviolet rays.

[0076] In one embodiment, the photoaging of the skin may be photoaging caused by infrared rays.

[0077] In one embodiment, the pharmaceutical composition for preventing or treating skin aging of the present invention or the peptide comprising the amino acid sequence of SEQ ID NO: 1 included in the composition has one or more of the following activities:

[0078] (i) Increases the expression level of genes for collagen Iα1, fibronectin, and elastin, which are components of the extracellular matrix.

[0079] (ii) Increases the expression of pro-collagen Iα1 and hyaluronic acid, which are components of the extracellular matrix.

[0080] (iii) Increases the expression levels of SIRT1 (Sirtuin 1) gene and AQP3 (Aquaporin 3) gene, which are skin barrier strengthening factors.

[0081] (iv) Reduces the level of reactive oxygen species increased by ultraviolet (UV) irradiation.

[0082] (v) Increases the expression levels of genes for collagen Iα 1, fibronectin, and elastin, which are extracellular matrix components reduced by ultraviolet irradiation.

[0083] (vi) Increases the expression levels of SIRT1, AQP3, COL17A1, ITGB1, ITGB4, ITGA6, and Plectin, which are skin barrier strengthening factors reduced by UV irradiation.

[0084] (vii) Reduces the expression level of MMP-1 increased by ultraviolet irradiation and heat shock (infrared irradiation).

[0085] The pharmaceutical composition of the present invention may contain a therapeutically effective amount of a peptide comprising the amino acid of sequence number 1 of the present invention.

[0086] The term "therapeutically effective amount" above means an amount sufficient for the peptide, which is an active ingredient of the pharmaceutical composition of the present invention, to achieve its activity or efficacy, for example, an amount sufficient to achieve the efficacy of treating or preventing skin aging described above.

[0087] The term "prevention" as used herein means reducing the risk of developing a disease or disorder, and means any action that inhibits or delays the onset of a disease by preventing the disease or one or more of its clinical symptoms from progressing.

[0088] The term "treatment" as used herein means alleviating a disease or disorder, and includes any action that improves or beneficially alters the symptoms of a disease by arresting or reducing the progression of the disease or one or more of its clinical symptoms.

[0089] The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.

[0090] The pharmaceutically acceptable carriers mentioned above are those commonly used in formulations, and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

[0091] The pharmaceutical composition of the present invention may additionally include, in addition to the above ingredients, a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, etc., but is not limited thereto.

[0092] Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: The Science and Practice of Pharmacy, (21st ed., 2005, Lippincott Williams & Wilkins).

[0093] The pharmaceutical composition of the present invention can be administered by any suitable route for treating skin aging, for example, it can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, topical administration, transdermal administration, skin application, etc.

[0094] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 μg to 1000 mg, 0.001 μg to 1000 mg, 0.01 μg to 1000 mg, 0.1 μg to 1000 mg, 0.1 μg to 500 mg, or 1.0 μg to 1000 mg per day, and may be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and response sensitivity.

[0095] The pharmaceutical composition of the present invention can be manufactured in a unit dosage form or can be manufactured by inserting it into a multi-dose container by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method that can be easily performed by a person having ordinary skill in the art to which the present invention pertains. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or in the form of an extract, powder, granules, tablet or capsule, and may additionally include a dispersing agent or stabilizer.

[0096] The pharmaceutical composition of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 mM, specifically, the peptide of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 900 mM, 0.01 μM to 500 mM, 0.01 μM to 300 mM, 0.01 μM to 100 mM, 0.01 μM to 50 mM, 0.01 μM to 30 mM, 0.01 μM to 10 mM, 0.01 μM to 1 mM, 0.01 μM to 0.1 mM, 0.01 μM to 0.01 mM, 1.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0097] Uses of Peptides

[0098] According to another aspect of the present invention, there is provided a use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for improving skin condition.

[0099] According to another aspect of the present invention, there is provided a use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for the manufacture of cosmetics or functional foods for improving skin conditions.

[0100] According to another aspect of the present invention, a method for improving a skin condition is provided, comprising administering to a patient or subject in need of improvement of a skin condition a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 or a composition comprising the peptide as an active ingredient.

[0101] The term "patient" or "subject" as used herein refers to a human or a non-human animal, such as a human, a primate, a mammal, or a vertebrate. According to another aspect of the present invention, there is provided a use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for treating or preventing skin aging.

[0102] According to another aspect of the present invention, there is provided a use of a peptide comprising the amino acid sequence disclosed in SEQ ID NO: 1 for the manufacture of a medicament for treating or preventing skin aging. According to another aspect of the present invention, there is provided a method for treating skin aging, comprising administering a peptide comprising the amino acid sequence disclosed in SEQ ID NO: 1 to a patient or subject in need of treatment for skin aging.

[0103] The term “patient” or “subject” as used herein refers to a human or non-human animal, such as humans, primates, mammals, and vertebrates.

[0104] The above-described uses, methods for improving skin conditions, and methods for treating skin aging are all equally applicable to the peptides of the present invention, their activities, and compositions, and are not described repeatedly to avoid excessive complexity of the specification.

[0105] The peptide of the present invention has skin condition-improving activity. The peptide of the present invention increases the expression levels of extracellular matrix components and skin barrier strengthening factors, reduces the expression of skin cell damage factors increased by UV irradiation, and restores the expression levels of extracellular matrix components and skin barrier strengthening factors decreased by UV irradiation or heat shock.

[0106] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0107] Figures 1a and 1b show that the peptide of the present invention increases the mRNA expression levels of genes for collagen Iα1 (Collagen Iα1, COLA1), fibronectin (FN1), and elastin (ELN) in NIH3T3 cells.

[0108] Figure 2 shows that the peptide of the present invention increases the secretion of Pro-Collagen I α 1 and hyaluronic acid in NIH3T3 cells and HaCaT cells.

[0109] Figure 3 shows that the peptide of the present invention increases the mRNA expression levels of SIRT1 (Sirtuin 1) gene and AQP3 (Aquaporin 3) gene in HaCaT cells.

[0110] Figures 4a and 4b show that the peptide of the present invention reduces intracellular ROS (reactive oxygen species) levels increased by UV irradiation in NIH3T3 cells and HaCaT cells.

[0111] Figures 5a and 5b show that the peptide of the present invention increases the mRNA expression levels of the genes for collagen Iα 1 (Collagen Iα 1, COLA1), fibronectin (FN1), and elastin (ELN), which were reduced by UV irradiation in NIH3T3 cells.

[0112] Figures 6a and 6b show that the peptide of the present invention increases the mRNA levels of SIRT1 and AQP3, which were decreased by UV irradiation in HaCaT cells.

[0113] Figures 6c and 6d show that the peptide of the present invention increases the mRNA levels of COL17A1 (Collagen XVII α 1), ITGB1 (Integrin β 1), ITGB4 (Integrin β 4), ITGA6 (Integrin α 6), and Plectin, which were decreased by UV irradiation in HaCaT cells.

[0114] Figures 7a and 7b show that the peptide of the present invention reduces the expression of MMP-1 increased by UV irradiation in NIH3T3 cells and HaCaT cells.

[0115] Figure 8 shows that the peptide of the present invention reduces the expression of MMP-1 increased by heat-shock in NIH3T3 cells.

[0116] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0117] Manufacturing Example 1: Manufacturing of peptides

[0118] A peptide having the amino acid sequence of SEQ ID NO: 1 shown in Table 1 below was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Х 100 mm, 1.7 μm, Waters Co, USA).

[0119] Sequence number Amino acid sequence (N-terminal -> C-terminal) 1EIVRKKPI

[0120] The efficacy of the peptide of sequence number 1 manufactured above was evaluated through the following experiment.

[0121] Experimental Example 1: Expression Analysis of Extracellular Matrix Component Genes

[0122] The effect of the peptide manufactured in Manufacturing Example 1 on the expression of extracellular matrix (ECM) components was evaluated by measuring the mRNA expression level of the genes of each component.

[0123] NIH3T3 cells (mouse fibroblast cell line) 3 X 10 5Cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells were cultured in a CO2 incubator at 37°C for 24 hours, washed twice with PBS, and RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea), followed by PCR using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2 below.

[0124] As a result of the experiment, it was confirmed that the mRNA expression level of the genes for collagen Iα1 (Collagen, type I, alpha 1), fibronectin, and elastin, which are components of the extracellular matrix (ECM), increased by the peptide of sequence number 1 in NIH3T3 cells (Fig. 1).

[0125] Experimental Example 2: Expression Analysis of Extracellular Matrix Component Proteins

[0126] The effect of the peptide manufactured in Manufacturing Example 1 on the expression of extracellular matrix (ECM) components was evaluated by measuring the expression levels of Collagen I α 1 and HA (Hyaluronic acid).

[0127] NIH3T3 cells (mouse fibroblast cell line) and HaCaT cells (human keratinocyte cell line) were cultured at 1 x 10 4Cells were seeded in 24-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells were cultured in a 37°C CO2 incubator for 72 hours. NIH3T3 cell cultures and HaCaT cell cultures were centrifuged to settle cells and impurities, and only the supernatant of the culture medium was transferred to an Eppendorf tube. Pro-Collagen ELISA (abcam, Cat No.: ab210579, UK) and HA (Hyaluronic acid) ELISA (ECHELON biosciences, Cat No.: K-1200, USA) were performed using the obtained culture medium.

[0128] As a result of the experiment, it was confirmed that the secretion of Pro-Collagen I α 1, one of the components of the extracellular matrix, increased in NIH3T3 cells due to the peptide of sequence number 1 (Fig. 2). In addition, it was confirmed that the secretion of Hyaluronic acid (HA), one of the components of the extracellular matrix, increased in HaCaT cells due to the peptide of sequence number 1 (Fig. 2).

[0129] Experimental Example 3: Expression Analysis of Skin Barrier-Related Genes

[0130] The effect of the peptide manufactured in Manufacturing Example 1 on the expression of genes related to the skin barrier was evaluated.

[0131] HaCaT cells (human keratinocyte cell line) were seeded at 3 x 10 5Cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells were cultured in a CO2 incubator at 37°C for 24 hours, washed twice with PBS, and RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea), followed by PCR using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0132] Sirtuin 1 (SIRT1) and Aquaporin 3 (AQP3) are known to influence the maintenance of the skin barrier by regulating the aging and hydration of cells constituting the epidermis. Experimental results confirmed that the peptide with sequence number 1 increased the mRNA expression levels of the Sirtuin 1 (SIRT1) and Aquaporin 3 (AQP3) genes, which are skin barrier strengthening factors, in HaCaT cells (Fig. 3).

[0133] Experimental Example 4: Inhibition of UV-induced reactive oxygen species (ROS) production

[0134] It was evaluated whether the peptide manufactured in Manufacturing Example 1 inhibits the production of reactive oxygen species (ROS) induced by UV.

[0135] NIH3T3 cells (mouse fibroblast cell line) and HaCaT cells (human keratinocyte cell line) were cultured at 5 x 10 5The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culture, the medium was removed from the cells, and PBS was added. Using a UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France), NIH3T3 cells were irradiated with UVA at 6 J / cm 2 , and for HaCaT cells, UVB was applied at 15 mJ / cm 2 After removing PBS, the peptide medium solution at each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37°C for 24 hours. After treating with 10 μM DCFH-DA (2', 7'-dichlorofluorescein diacetate), the cells were wrapped in foil and cultured in a CO2 incubator at 37°C for 30 minutes. After washing twice with PBS, the cells were harvested and the fluorescence values ​​were measured using FACS.

[0136] Experimental results confirmed that the peptide of sequence number 1 reduced the intracellular ROS level increased by UV irradiation in NIH3T3 cells (Fig. 4a). In addition, it was confirmed that the peptide of sequence number 1 again reduced the intracellular ROS level increased by UV irradiation in HaCaT cells (Fig. 4b).

[0137] Experimental Example 5: Restoration of extracellular matrix gene expression reduced by UV irradiation.

[0138] It was evaluated whether the peptide of sequence number 1 manufactured in Manufacturing Example 1 restores the expression level of extracellular matrix genes reduced by UV irradiation.

[0139] NIH3T3 cells (mouse fibroblast cell line) 5 x 10 5 The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells, and PBS was added. A UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France) was used to irradiate them with UVA at 8 J / cm. 2 was investigated. After removing PBS, the peptide medium solution for each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 6 hours. After washing twice with PBS, RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, and 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea). Subsequently, PCR was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0140] Experimental results showed that the mRNA expression levels of collagen Iα 1, fibronectin, and elastin genes were reduced by UV irradiation in NIH3T3 cells. However, when the peptide of sequence number 1 was treated, the expression levels of the genes that had been reduced were increased again (Figs. 5a and 5b).

[0141] Experimental Example 6: Restoration of skin barrier-related gene expression reduced by UV irradiation

[0142] It was evaluated whether the peptide of sequence number 1 manufactured in Manufacturing Example 1 restores the expression level of skin barrier-related genes reduced by UV irradiation.

[0143] HaCaT cells (human keratinocyte cell line) were seeded at 5 x 10 5 The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells and PBS was added. A UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France) was used to irradiate UVB at 20 mJ / cm 2 was investigated. After removing PBS, the peptide medium solution for each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 4 hours. After washing twice with PBS, RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, and 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea). Subsequently, PCR was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0144] SIRT1 (Sirtuin 1) and AQP3 (Aquaporin 3) are known to affect the maintenance of the skin barrier by regulating the aging and hydration of cells constituting the epidermis. Experimental results showed that the mRNA levels of SIRT1 and AQP3 decreased in HaCaT cells due to UV irradiation, and treatment with the peptide of sequence number 1 restored the decreased mRNA expression levels of these genes (Figs. 6a and 6b).

[0145] Hemidesmosomes are the area where keratinocytes in the basal layer of the epidermis attach to the extracellular matrix (ECM) of the dermis, thereby maintaining the density of the skin barrier. Experimental results showed that in HaCaT cells, the mRNA levels of hemidesmosome components COL17A1 (Collagen XVII α 1), ITGB1 (Integrin β 1), ITGB4 (Integrin β 4), ITGA6 (Integrin α 6), and Plectin were reduced by UV irradiation, and the mRNA expression levels of these genes that had been reduced were restored by treatment with the peptide of sequence number 1 (Fig. 6c and Fig. 6d).

[0146] Experimental Example 7: Inhibition of UV-induced MMP-1 expression

[0147] The effect of the peptide of sequence number 1 manufactured in Manufacturing Example 1 on MMP-1 expression induced by UV was evaluated.

[0148] NIH3T3 cells (mouse fibroblast cell line) and HaCaT cells (human keratinocyte cell line) were cultured at 5 x 10 5The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells, and PBS was added. Using a UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France), NIH3T3 cells were irradiated with UVA at 6 J / cm. 2 , and HaCaT cells were exposed to UVB at 15 mJ / cm 2was investigated. After removing PBS, the peptide medium solution for each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 24 hours. After washing twice with PBS, the cells were lysed by adding cell lysis buffer. After processing with 5X sample buffer, SDS-PAGE was performed using 10% SDS-PAGE gel. The proteins separated by SDS-PAGE were transferred to PVDF membrane. Blocking was performed with 5% skim milk for 1 hour at room temperature. Anti-MMP-1 antibody (Abcam, Cat No.: ab137332, UK) was diluted 1:1000 in 5% skim milk and reacted with the membrane for 2 hours. The loading control was reacted in the same manner using an anti-α-tubulin antibody (Santa Cruz Biotechnology, Cat No.: sc69969, USA). The membrane was washed three times for 10 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). Goat Anti-Rabbit IgG (H+L) secondary antibody (Jackson ImmunoResearch, Cat No.: 111-035-003, USA) was diluted 1:3000 in 5% skim milk and reacted with the membrane for 1 hour. The secondary antibody for the loading control α-tubulin was also reacted in the same manner using the same product. After treatment with ECL solution (GE Healthcare, Cat. No.: RPN2232, USA), the expression level was analyzed using ImageQuant 800 (Cytiva, Cat. No: 29-3994-81, USA) equipment.

[0149] Experimental results showed that UV irradiation increased the expression of MMP-1 in NIH3T3 cells, and the peptide of sequence number 1 inhibited the increase in MMP-1 expression induced by UV irradiation (Fig. 7a). In addition, UV irradiation increased the expression of MMP-1 in HaCaT cells, and the peptide of sequence number 1 inhibited the increase in MMP-1 expression induced by UV irradiation (Fig. 7b).

[0150] Experimental Example 8: Inhibition of heat-induced MMP-1 expression

[0151] The effect of the peptide of sequence number 1 manufactured in Manufacturing Example 1 on MMP-1 expression induced by heat was evaluated.

[0152] NIH3T3 cells (mouse fibroblast cell line) 5 x 10 5Cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured for 1 hour in a 37°C CO2 incubator. The lid and the lower plate of the 6-well plate were sealed with paraffin film, and the lower plate was submerged in a 44°C water bath and cultured for 30 minutes. After removing the existing medium, the medium solutions containing the peptides dissolved in the concentrations mentioned above were added again and cultured in a 37°C CO2 incubator for 8 hours. The cells were washed twice with PBS and lysed with cell lysis buffer. After processing with 5X sample buffer, SDS-PAGE was performed using a 10% SDS-PAGE gel. The proteins separated by SDS-PAGE were transferred to a PVDF membrane. Blocking was performed with 5% skim milk for 1 hour at room temperature. Anti-MMP-1 antibody (Abcam, Cat No.: ab137332, UK) was diluted 1:1000 in 5% skim milk and reacted with the membrane for 2 hours. The loading control was reacted in the same manner using anti-α-tubulin antibody (Santa Cruz Biotechnology, Cat No.: sc69969, USA). The membrane was washed three times for 10 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). Goat Anti-Rabbit IgG (H+L) secondary antibody (Jackson ImmunoResearch, Cat No.: 111-035-003, USA) was diluted 1:3000 in 5% skim milk and reacted with the membrane for 1 hour.The secondary antibody against α-tubulin, a loading control, was reacted in the same manner using the same product. After treatment with ECL solution (GE Healthcare, Cat. No.: RPN2232, USA), the expression level was analyzed using ImageQuant 800 (Cytiva, Cat. No.: 29-3994-81, USA) equipment.

[0153] As a result of the experiment, the expression of MMP-1 was increased by heat-shock in NIH3T3 cells, and the peptide of sequence number 1 inhibited the increase in MMP-1 expression induced by heat-shock (Fig. 8).

[0154] 프라이머서열 (5' -> 3')서열번호Col1a1 Forward(5') CAC CCT CAA GAG CCT GAG TC (3')2Col1a1 Reverse(5') AGA CGG CTG AGT AGG GAA CA (3')3Fibronectin Forward(5') CCA GGA ACC GAG TAC ACC AT (3')4Fibronectin Reverse(5') ATA CCC AGG TTG GGT GAT GA (3')5Elastin Forward(5') GCAAGACCTGGCTTTGGACT (3')6Elastin Reverse(5') GGGAGTTTCTGGTTAGGGCTG (3')7AQP3 Forward(5') CCT TCT TGG GTG CTG GAA TA (3')8AQP3 Reverse(5') ACA CGA TAA GGG AGG CTG TG (3')9SIRT1 Forward(5') TCA GTG GCT GGA ACA GTG AG (3')10SIRT1 Reverse(5') TCT GGC ATG TCC CAC TAT CA (3')11COL17A1 Forward(5') CTG ACT TTG CTG GAG ATC TGG (3')12COL17A1 Reverse(5') TAG GCC ATC CCT TGC AGT AG (3')13ITGB1 Forward(5') CGC CGC GCG GAA AAG ATG (3')14ITGB1 Reverse(5') AAA CAC CAG CAG CCG TGT AA (3')15ITGB4 Forward(5') CGA GGT AGG TCC AGG ACG G (3')16ITGB4 Reverse(5') GGC TCC TTC AGC TTC TCA GG (3')17ITGA6 Forward(5') AAA AGG GTG TTG GGA GGG TG (3')18ITGA6 Reverse(5') GAA TCC CAT TGC TTT GGC AC (3')19Plectin Forward(5') CAC CTC ATC AAG GCC CAG AG (3')20PlectinReverse(5') AGC TGG AGG TGA AGT TGT CG (3')21GAPDH Forward(5') GGA GCC AAA AGG GTC ATC AT (3')22GAPDH Reverse(5') GTG ATG GCA TGG ACT GTG GT (3')23

[0155] Although representative embodiments of the present application have been described above as examples, the scope of the present application is not limited to the specific embodiments described above, and a person with ordinary knowledge in the relevant field will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A peptide comprising the amino acid sequence of sequence number 1.

2. A composition for improving skin condition, comprising the peptide of claim 1 as an effective ingredient.

3. In claim 2, A composition for improving skin condition, wherein the improvement of the above skin condition is improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

4. In claim 2, The composition has a skin condition improvement activity through one or more of the following activities: (i) activity that increases the expression levels of genes for collagen Iα1, fibronectin, and elastin; (ii) activity that increases the expression of pro-collagen Iα1 and hyaluronic acid; (iii) Activity that increases the expression levels of SIRT1 (Sirtuin 1) gene and AQP3 (Aquaporin 3) gene, which are skin barrier strengthening factors; (iv) Activity in reducing the level of reactive oxygen species increased by ultraviolet (UV) irradiation; (v) Activity that increases the expression levels of genes for collagen Iα 1, fibronectin, and elastin reduced by ultraviolet irradiation; (vi) activity that increases the expression levels of SIRT1, AQP3, COL17A1, ITGB1, ITGB4, ITGA6, and Plectin, which are skin barrier strengthening factors reduced by UV irradiation; and (vii) Activity in reducing the expression level of MMP-1 increased by ultraviolet irradiation and heat shock.

5. In claim 2, The composition above is a cosmetic composition, a composition for improving skin condition.

6. In claim 5, A composition for improving skin condition, wherein the commercial cosmetic composition is in any one formulation selected from the group consisting of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

7. A functional food composition for improving skin condition, comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

8. In claim 7, A functional food composition for improving skin condition, wherein the improvement of the above skin condition is improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

9. A pharmaceutical composition for preventing or treating skin aging, comprising a peptide comprising an amino acid sequence of sequence number 1 as an active ingredient.

10. In claim 9, A pharmaceutical composition for preventing or treating skin aging, wherein the above skin aging is photoaging of the skin.

11. In claim 10, A pharmaceutical composition for preventing or treating skin aging, wherein the photoaging of the skin is photoaging caused by ultraviolet rays.

12. In claim 10, A pharmaceutical composition for preventing or treating skin aging, wherein the photoaging of the skin is photoaging caused by infrared rays.

Images