Use of formononetin in reducing imiquimod-induced inflammatory cytokine expression by means of inhibiting interferon signaling pathway

Abstract

The use of formononetin (FMN) in reducing imiquimod (IMQ)-induced inflammatory cytokine expression by means of inhibiting an interferon (IFN) signaling pathway. The FMN can be used for the prevention and treatment of inflammatory skin diseases and the reduction of disease recurrence in the future. Using animal experiments combined with transcriptomics, it is found that the action of FMN on an IMQ-induced mouse model significantly improves inflammatory skin lesion symptoms, and inhibits pathological phenotypes such as the PASI score and epidermal hyperplasia in mice.

Description

Application of formononetin in inhibiting interferon signaling pathway and reducing imiquimod-induced inflammatory cytokine expression Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of formononetin in inhibiting interferon signaling pathways and reducing IMQ-induced inflammatory cytokine expression, especially skin diseases caused thereby, such as psoriasis. Background Art

[0002] Formononetin (FMN, 7-hydroxy-4'-methoxy isoflavone) is the main bioactive component of Astragalus membranaceus, with the molecular formula C 16 H 12 O4, with a molecular weight of 268.26 and a CAS number of 485-72-3, participates in processes such as cell proliferation, differentiation, apoptosis, and inflammatory responses. Formononetin has anti-cancer effects, preventing and treating breast, prostate, and colon cancers. It also has weak estrogenic properties and can be used clinically as a diuretic. Formononetin has pharmacological activities such as regulating blood lipid metabolism, inhibiting liver fat deposition, preventing atherosclerosis, and exhibiting estrogen-like effects. It is currently widely used in various related pharmaceutical products.

[0003] Patent publication number CN104940185A discloses a novel use of formononetin and related products. Specifically, it discloses the use of formononetin in the preparation of a medicament for preventing or treating herpes virus infection. However, there are no reports on the use of formononetin in inhibiting the interferon signaling pathway and reducing IMQ-induced inflammatory cytokine expression.

[0004] Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide an application of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ.

[0006] Technical content: The specific technical solutions adopted by the present invention are as follows:

[0007] The first aspect of the present invention is the use of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ, wherein the inflammatory cytokines include TNF-α and IL-17.

[0008] In another aspect of the present invention, a pharmaceutical composition for treating skin diseases based on formononetin is provided. The pharmaceutical composition contains formononetin as an active ingredient and further comprises a pharmaceutically acceptable carrier.

[0009] In a preferred embodiment, the pharmaceutical composition is in the form of an external dosage form.

[0010] More preferably, the dosage form of the pharmaceutical composition is a patch, a paste, an ointment, a microneedle, a film coating, a cataplasm, or a spray.

[0011] In another aspect of the present invention, a pharmaceutical composition for treating skin diseases based on formononetin is provided, wherein the pharmaceutical composition contains interferon or its inhibitor as an active ingredient and further comprises a pharmaceutically acceptable carrier.

[0012] In a preferred embodiment, the pharmaceutical composition is in the form of an external dosage form or an internal dosage form.

[0013] More preferably, the dosage form of the pharmaceutical composition is a patch, paste, ointment, microneedle, film coating, cataplasm, spray, capsule, granule, tablet, pill, oral solution or injection.

[0014] Preferably, the preparation method of the cream is as follows:

[0015] 1) Heat the oil phase (5% cetostearyl alcohol, 2% cetearyl alcohol, 3% glyceryl mono- and distearate, 5% light liquid paraffin, 2% polyoxyethylene (21) stearyl ether, 2% polyoxyethylene (2) stearyl ether, 0.1% ethyl paraben) in a water bath to 80°C and melt;

[0016] 2) Cooling the melted composition to 65° C., adding a predetermined amount of formononetin, and stirring to mix thoroughly; heating the aqueous phase (8% glycerol, 2% propylene glycol, 70.9% HEPES buffer) to 80° C.;

[0017] 3) slowly adding the aqueous phase to the oil phase while stirring, stirring, until the mixture is cooled to room temperature, thereby obtaining finished creams with different formononetin contents.

[0018] In another aspect of the present invention, the use of the interferon signaling pathway as a target in screening and preparing drugs for preventing and treating inflammatory skin diseases is provided.

[0019] In the present invention, the thorn lily plays an important role in regulating skin inflammation through the interferon signaling pathway. Related studies have found that the expression levels of IFN-α and IFN-γ are significantly increased in the skin lesions of patients with certain inflammatory skin diseases, and can induce or aggravate the condition. Interferon can induce the proliferation and abnormal differentiation of keratinocytes through IL-22. In addition, interferon promotes dendritic cells and T cells to produce chemokines, causing the aggregation and migration of neutrophils to the epidermis, resulting in the formation of epidermal microabscesses. At the same time, dendritic cells and T cells can also produce interferon, thereby forming a positive feedback loop, leading to the occurrence and expansion of inflammatory reactions in skin lesions.

[0020] The beneficial effects of the present invention are as follows:

[0021] 1. The present invention uses transcriptomics combined with animal experiments to discover the application of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ. After formononetin acts on the IMQ-induced mouse model, the symptoms of inflammatory skin lesions are significantly improved, and the pathological phenotypes such as PASI score and epidermal hyperplasia of mice are suppressed.

[0022] 2. Further analysis revealed that the interferon signaling pathway plays a key role in regulating skin inflammation. Expression of IFN-α, IFN-β, and IFN-γ was elevated in the lesions of mice with IMQ-induced lesional dermatopathy, and was significantly downregulated after topical application of formononetin. This suggests that the interferon signaling pathway is a key pathway in regulating skin inflammation. By downregulating the interferon signaling pathway, formononetin improves inflammatory infiltration, attenuates excessive cell proliferation, and alleviates skin lesion symptoms. This suggests that the interferon signaling pathway is a promising target for inflammatory skin diseases.

[0023] In general, the results of the present invention demonstrate that the application of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ can be used to prevent and treat inflammatory skin diseases and reduce disease recurrence in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1. Determination of the drug concentration of FMN acting on HaCaT cells. (A) The viability of HaCaT cells stimulated by M5 treated with FMN at different concentrations. Data are from 4 independent experiments and are expressed as mean ± standard deviation. (B) The effect of FMN at different concentrations on the mRNA expression of inflammatory factors TNF-α and IL-6. Data are from 4 independent experiments and are expressed as mean ± standard deviation. (vs. NC group, ### p<0.001; vs.M5 group, *** p<0.001, ** p<0.01, * p<0.05)

[0025] Figure 2. Differentially expressed genes (DEGs) induced by 20 μM FMN treatment. (A) Volcano plot showing differentially expressed mRNAs. Blue dots indicate downregulated mRNAs, red dots indicate upregulated mRNAs, and gray dots indicate mRNAs with no significant differences. (B) Heat map showing all differentially expressed mRNAs between FMN-treated HaCaT cells (n=3) and normal HaCaT cells (n=3), with adjusted p<0.05 and |Log2FC|>0.58. Upregulated genes are indicated by red dots, while downregulated genes are indicated by blue. (C) GO enrichment analysis. (D) KEGG enrichment analysis.

[0026] Figure 3. Symptoms of IMQ-induced skin lesions in mice were improved after FMN treatment. (A) PASI scores of the back and thickness of ear lesions in mice induced by IMQ treated with different concentrations of FMN, n=6 / group. (B) Appearance of ear and back lesions in mice on day 12, n=6 / group. (C) PASI scores of the back from day 0 to day 12, including scaling, thickness and erythema, n=6 / group. (D) Thickness and PASI scores of ear lesions in mice from day 0 to day 12, n=6 / group. (E) and (F) HE staining of ear and back lesions in mice on day 12, scale bar = 50 μM, n=6 / group. (G) and (H) Epidermal thickness of ear and back lesions in mice on day 12, n=6 / group. (vs. Control group, ### p<0.001, ## p<0.01, # p<0.05; vs.IMQ group, *** p<0.001, ** p<0.01, * p<0.05)

[0027] Figure 4. DEGs validation. (A) TNF-α, IL-17, IFN-α, IFN-β, and IFN-γ were validated by ELISA, n = 6 / group. (B) Cxcl9, Cxcl10, Cxcl11, and Cxcr3 mRNA expression was determined by RT-qPCR, n = 6 / group. (C) Representative staining of p-STAT1, p-STAT3, and CD3 in ear lesions, scale bar = 100 μM, n = 6 / group. (D) and (E) Quantitative analysis of p-STAT1+ and p-STAT3+ cells in ear lesions, n = 6 / group. (vs. Control group, ### p<0.001, ## p<0.01; vs.IMQ group, *** p<0.001, ** p<0.01, * (p<0.05) (F) On the 12th day of FMN induction, the protein expressions of IRF1, p-STAT1, and p-STAT3 in the skin of mouse samples were detected by Western blot. DETAILED DESCRIPTION

[0028] After extensive and in-depth research, the inventors of the present application have found the application of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ.

[0029] Interferon signaling pathway

[0030] The pathogenesis of certain inflammatory skin diseases involves multiple cytokines, including interferons. Interferons are a class of cytokines that are classified into type I, type II, and type III interferons based on the receptors to which they bind. Type I interferons include IFN-α, IFN-β, IFN-δ, IFN-ε, IFN-κ, IFN-τ, and IFN-ω. Type II interferons are IFN-γ. Related studies have found that IFN-α and IFN-γ expression levels are significantly increased in lesions of inflammatory skin diseases.

[0031] The inflammatory cascade in certain inflammatory skin diseases is initiated by plasmacytoid myeloid dendritic cells (pDCs) and myeloid dendritic cells (mDCs). pDCs and mDCs produce activated type I interferons, primarily IFN-α and IFN-β. IFN-α activates mDCs, which in turn produce TNF-α and IL-23. IL-23 then combines with other inflammatory cytokines to promote the activation, proliferation, migration, and massive accumulation of autoimmune T cells in the epidermis. Activated T cells produce a large number of cytokines, such as IFN-γ, IL-17, and IL-22. IL-17 strongly induces the expression of neutrophil chemokines, leading to the accumulation of large numbers of neutrophils in the epidermis and promoting the formation of epidermal microabscesses. Furthermore, the T helper (Th) cell 1 inflammatory chemokines Cxcl9, Cxcl10, and Cxcl11, and their co-receptor Cxcr3, play a crucial role in the pathogenesis of lesional skin diseases. These chemokines are produced in response to IFN-γ and trigger inflammation with the recruitment of activated lymphocytes.

[0032] As previously mentioned, in the early stages of inflammatory skin diseases, pDCs in lesional skin continuously produce large amounts of IFN-α. IFN-α not only promotes IL-22 expression but also specifically upregulates IL-22R expression on the surface of keratinocytes. Similarly, high levels of IFN-γ in lesional skin strongly induce IL-22R expression on the surface of keratinocytes. IL-22 binds to IL-22R on the surface of keratinocytes, triggering tyrosine phosphorylation of STAT3 in the keratinocyte nucleus and activating STAT3. This further inhibits keratinocyte differentiation, promotes keratinocyte proliferation and migration, enhances the skin's inflammatory response, and leads to epidermal hyperplasia. Studies have shown that STAT1 expression and activity in lesional skin of patients are significantly higher than in non-lesional areas. In vitro culture of human keratinocytes has shown that IFN-α and IFN-γ can induce STAT1 phosphorylation.

[0033] Interferon regulatory factor (IRF) is a major transcription factor involved in regulating the transcription and expression of interferon. As a transcriptional activator of type I IFN inducers, IRF1 is involved in the differentiation and development of immune cells. Studies have shown that mice lacking IRF1 exhibit inflammatory skin lesions, which may be related to the lack of IRF1 in CD8 + It is related to the overexpression of type I interferon mediated by T cells.

[0034] Formononetin

[0035] Formononetin (FMN, 7-hydroxy-4'-methoxy isoflavone) is the main bioactive component of Astragalus membranaceus, with the molecular formula C 16 H 12 O4, molecular weight 268.26, CAS number 485-72-3, participates in cell proliferation, differentiation, apoptosis and inflammatory response, and plays an anti-inflammatory, antioxidant and immune function regulation role. It is reported that formononetin can upregulate tumor necrosis factor α-induced protein 3 by activating G protein-coupled estrogen receptor (GPER).

[0036] In addition, formononetin can also inhibit the secretion of vascular endothelial growth factor (VEGF) and the expression of hypoxia-inducible factor 1α (HIF1α) and NF-κB in a mouse model of ear swelling, thereby exerting an anti-inflammatory effect.

[0037] use

[0038] The present invention provides the use of formononetin in inhibiting the interferon signaling pathway and reducing the expression of inflammatory cytokines induced by IMQ. It can be used to prevent and treat inflammatory skin diseases and reduce disease recurrence in the future.

[0039] Pharmaceutical composition

[0040] The pharmaceutical composition of the present invention may contain the active agent described herein and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are generally safe and non-toxic and include various excipients and diluents. This term refers to pharmaceutical carriers that are not necessary active ingredients themselves and are not overly toxic after use. Suitable carriers are well known to those of ordinary skill in the art. A full explanation of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co. NJ 1991). Pharmaceutically acceptable carriers in the composition may contain liquids such as water, saline, glycerol and ethanol. In addition, auxiliary substances such as emulsifiers, fillers, adhesives, wetting agents, disintegrants, penetration enhancers, colorants, solubilizers, etc. may also be present in these carriers. The emulsifiers include monoglycerol fatty acid esters, diglycerol fatty acid esters, sucrose esters, sorbitol fats, soybean lecithin, monolaurin, propylene glycol fatty acid esters, calcium stearoyl lactylate, diacetyl tartaric acid, monostearate, modified soybean lecithin, etc.; the excipients include magnesium stearate, microcrystalline cellulose, lactose, milk sugar, high molecular weight polyethylene glycol, etc.; the fillers include starch, mannitol, silicic acid, dextrin, calcium hydrogen phosphate, cellulose, etc.; the binders include carboxymethyl cellulose, alginate, gelatin, polyvinyl pyrrolidone, gum arabic, starch slurry, hydroxypropyl starch, modified starch, pregelatinized starch, dextrin, microcrystalline cellulose, poly Vinylpyrrolidone glue, gelatin paste; wetting agents such as glycerol; disintegrants such as agar, calcium carbonate, potato starch, tapioca starch, alginic acid, hydroxypropyl starch, modified starch, sodium carboxymethyl starch, microcrystalline cellulose, guar gum, xanthium gum, xanthan gum, etc.; penetration enhancers such as menthol, laurocapron, borneol, etc.; colorants such as plant colorants, animal colorants, or microbial colorants such as beetroot red, turmeric, chlorophyll, shellac red, cochineal red, red yeast rice colorant, etc.; solubilizers such as β-cyclodextrin, maltodextrin, Tween, ethanol, spans, sodium lauryl sulfate, propylene glycol, polyethylene glycol, glycerol, etc. However, those skilled in the art will also know that the pharmaceutical carriers that can be used in the present invention are not limited to the above types.

[0041] Dosage form

[0042] There is no particular limitation on the dosage form of the pharmaceutical composition of the present invention, and the pharmaceutical composition may be any dosage form suitable for external use, including but not limited to patches, pastes, ointments, microinjections, film coatings, or papules. The pharmaceutical composition may also be any dosage form suitable for internal use, including but not limited to capsules, granules, tablets, pills, oral solutions, or injections.

[0043] Treatment

[0044] The present invention provides a method for using formononetin to inhibit the interferon signaling pathway and reduce IMQ-induced inflammatory cytokine expression. This method can be used to prevent and treat inflammatory skin diseases and reduce disease recurrence. The method comprises administering formononetin and an interferon inhibitor to a subject in need thereof. The amount administered is a therapeutically effective amount, which can be determined based on the individual's age, weight, sex, disease type, and severity. The subject can be a mammal, particularly a human, mouse, rabbit, pig, sheep, or dog. The method of administration is conventional in the art, such as application or patching, and can be adjusted for different agents.

[0045] The specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0046] Example 1

[0047] 1. Methods and Materials

[0048] 1. Cell Assay

[0049] 1.1 Cell culture and treatment

[0050] HaCaT cell line (300493) was obtained from Fuheng Biotechnology (China) and grown in DMEM supplemented with 10% fetal bovine serum, 100 U / ml penicillin, and 100 μg / ml streptomycin. These cells were incubated at 37°C in a 5% CO2 incubator. HaCaT cells were stimulated with M5 (10 ng / ml each of IL-1α, IL-17A, IL-22, oncostatin M, and tumor necrosis factor-α) to mimic inflammatory characteristics. FMN (E-0216, Tauto) was diluted in DMSO at final concentrations of 0, 2, 5, 10, 20, 50, and 100 μM.

[0051] 1.2 HaCaT cell activity detection

[0052] CCK8 assays were performed using a CCK8 kit (Beyotime, Shanghai, China). Briefly, after 48 hours of cell plating and incubation, the culture medium was aspirated, and 10 μL of CCK8 and 100 μL of culture medium were added to each well. After incubation at 37°C in a humidified incubator containing 5% CO2 for 3 hours, the cell proliferation capacity was measured using a spectrophotometer at 450 nm.

[0053] 1.3 Transcriptome Sequencing

[0054] HaCaT cells were treated with 20 μM FMN for 48 h. Total RNA was extracted by lysing the cells with TRIzol reagent (Beyotime, China). RNA integrity was assessed using an Agilent Bioanalyzer (Agilent Technologies, Santa Clara). Libraries were constructed using the TruSeq Stranded mRNA LT Sample Preparation Kit (Illumina). RNA-seq analysis was performed by Ouyi Biotechnology Co., Ltd. (Shanghai, China). Transcriptome sequencing data were deposited in the NCBI database under accession number PRJNA917333.

[0055] DEGs were selected based on adjusted p < 0.05 and |log2FC| > 0.58. GO enrichment and KEGG enrichment analysis of DEGs were performed using R language, respectively.

[0056] 2. Preparation of FMN Cream

[0057] The oil phase (5% cetostearyl alcohol, 2% cetearyl alcohol, 3% mono- and distearic glyceryl, 5% light liquid paraffin, 2% polyoxyethylene (21) stearyl ether, 2% polyoxyethylene (2) stearyl ether, 0.1% ethyl hydroxybenzoate) was heated in a water bath to 80°C and melted, then cooled to 65°C. A set dose of formononetin was added and stirred to mix evenly. The water phase (8% glycerol, 2% propylene glycol, 70.9% HEPES buffer) was heated to 80°C. The water phase was slowly added to the oil phase while stirring, and the mixture was cooled to room temperature to obtain 1%, 2%, and 3% (total proportion of the oil phase and water phase) cream products, which were used in subsequent mouse model efficacy experiments.

[0058] 3. Animal Experiments

[0059] 3.1 Mouse modeling and intervention

[0060] In vivo studies were conducted using an IMQ-induced lesional mouse model. Male BABL / c mice, 6-8 weeks old and weighing 20 g ± 2 g, were randomly divided into groups of 6 mice per group. The grouping and treatment schedules were as follows: (1) Normal control group (Control): 62.5 mg of petrolatum cream was applied daily to the back of the mice and the inner and outer sides of both auricles. (2) Model group (IMQ): 62.5 mg of 5% IMQ cream was applied to the back of the mice and the inner and outer sides of both auricles. Six hours later, 62.5 mg of petrolatum cream was applied to the back of the mice and the inner and outer sides of both auricles. (3) 1% FMN group (IMQ + 1% FMN): 62.5 mg of 5% IMQ cream was applied to the back of the mice and the inner and outer sides of both auricles. After 6 hours, 60 mg of 1% FMN cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. (4) 2% FMN group (IMQ+2% FMN): 62.5 mg of 5% IMQ cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. After 6 hours, 60 mg of 2% FMN cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. (4) 3% FMN group (IMQ+3% FMN): 62.5 mg of 5% IMQ cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. After 6 hours, 60 mg of 3% FMN cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. (5) Positive control group (IMQ+Cal): 62.5 mg of 5% IMQ cream was evenly applied to the back of the mouse and the inner and outer sides of both auricles. After 6 hours, 60 mg of 0.005% calcipotriol ointment was evenly applied to the back of the mouse and the inner and outer sides of both auricles. All animal experiments were approved by the Ethics Committee of Yueyang Hospital of Integrated Traditional Chinese and Western Medicine Affiliated to Shanghai University of Traditional Chinese Medicine (No. YYLAC-2021-107-5).

[0061] 3.2 Evaluation of skin lesions in mice

[0062] On days 0, 2, 4, 6, 8, 10, and 12, the backs and ears of the mice were photographed. The severity of inflammation on the backs and ears was scored using the Psoriasis Area and Severity Index (PASI) scale, which includes erythema, thickness, and scaling. The scores indicate severity: 0 (none), 1 (mild), 2 (moderate), 3 (severe), and 4 (very severe). Concurrently, ear thickness was measured at the midpoint of the ear of each group using a vernier caliper on the aforementioned days. Three measurements were taken per mouse, and the average was calculated.

[0063] 3.3 Histopathology

[0064] After recording the above data on the 12th day, the mice were euthanized and the ears and back of each group of mice were taken. 2Skin tissue was fixed with 4% formalin solution for 48 hours, embedded in paraffin, and sectioned for HE staining. Epidermal thickness was measured at five different locations per mouse using Image J software, and the average was used as the epidermal thickness.

[0065] 3.4 RT-qPCR

[0066] Total RNA was extracted from tissues and cells using Trizol reagent (Beyotime, China) according to the manufacturer's instructions. TM cDNA was synthesized using RT kit (TaKaRa Bio, Otsu, Japan, #RR037A). Premix Ex Taq TM Quantitative PCR was performed using a Lightcycler 480 real-time system (TaKaRa, Japan, #R820A). Relative quantitative data were calculated using the 2-ΔΔCt method. Primer sequences: TNF-α:

[0067] 5'CTCTTCTGCCTGCTGCACTTTG3'(Forward Primer),

[0068] 5'ATGGGCTACAGGCTTGTCACTC3' (Reverse Primer); IL-6: 5'

[0069] CCACCGGGAACGAAAGAGAA3'(Forward Primer),5'

[0070] GAGAAGGCAACTGGACCGAA3'(Reverse Primer); Cxcl9:

[0071] 5'CTTCCTGGAGCAGTGTGGAG3'(Forward Primer),

[0072] 5'AGTCCGGATCTAGGCAGGTT3' (Reverse Primer); Cxcl10: 5'

[0073] AAGCTATGTGGAGGTGCGAC3' (Forward Primer), 5'AACCCCTTGGGAAGATGGTG3' (Reverse Primer); Cxcl11: 5'CGGACCAGTGCTGGATTCAA3' (Forward Primer), 5'GATGTTCGTGTGCCTCGTGA3' (Reverse Primer); Cxcr3:

[0074] 5'AATGCCACCCATTGCCAGTA3'(Forward Primer),

[0075] 5'TAGCTCGAAAACGCCTCTGG3' (Reverse Primer); β-actin (human): 5'

[0076] GTCATTCCAAATATGAGATGCGT3'(Forward Primer),5'

[0077] TGTGGACTTGGGAGAGGACT3'(Reverse Primer); β-actin(mouse):

[0078] 5'GAGCGCAAGTACTCTGTGTG3'(Forward Primer),

[0079] 5'GGTGTAAAACGCAGCTCAGTAA3'(Reverse Primer).

[0080] 3.5 Western blot analysis

[0081] Mouse dorsal skin tissue was lysed using Pro-read protein extraction buffer (intRON, Sungnam), and total protein concentration was determined using Bradford reagent (Bio-Rad, Hercules, CA, USA). After electrophoresis and transfer to a membrane, the cells were incubated with the corresponding antibodies to detect IRF1, p-STAT1, and p-STAT3 protein expression in the dorsal region of each group. Specific antibodies used included anti-IRF1 (1:1000; Cell Signaling Technology; 8478), anti-GAPDH (1:3,000; EpiZyme; LF206), anti-p-STAT1 (1:1000; Cell Signaling Technology; 7649), anti-p-STAT3 (1:2,000; Cell Signaling Technology, 9145), and anti-β-Actin (1:2000; Abcam; ab8227).

[0082] 3.6 ELISA

[0083] ELISA assays were performed using mouse IFN-α ELISA kit (ab252352, Abcam), mouse IFN-β ELISA kit (ab252363, Abcam), mouse IFN-γ ELISA kit (ab282874, Abcam), mouse TNF-α ELISA kit (ab208348, Abcam), and mouse IL-17 ELISA kit (ab100702, Abcam). According to the instructions of the ELISA kits, a standard curve was generated and the concentration of each sample was calculated.

[0084] 3.7 Statistical analysis

[0085] Experimental data were analyzed using GraphPad Prism 9. All data are expressed as mean ± standard deviation. Data were analyzed by one-way or two-way ANOVA. P < 0.05 was considered statistically significant.

[0086] 2. Results

[0087] 1. Formononetin can inhibit M5-induced HaCaT cell proliferation and reduce IL-6 and TNF-α mRNA expression

[0088] First, CCK-8 was used to detect the effect of different concentrations of formononetin on the proliferation activity of HaCaT cells stimulated by M5 to screen the effective concentration of formononetin in vitro. We found that the half inhibitory concentration of formononetin was 40.64 μM, i.e., IC 50 =40.64μM (Figure 1A). Therefore, RT-qPCR was subsequently performed on HaCaT cells stimulated with formononetin at concentrations of 10μM, 20μM, and 40μM to detect its effect on the mRNA expression of inflammatory factors IL-6 and TNF-α. The results showed that the expression of inflammatory factors IL-6 and TNF-α mRNA in HaCaT cells induced by M5 decreased at concentrations of 10μM, 20μM, and 40μM, with the most significant decrease at 20μM (Figure 1B).

[0089] 2. mRNA Sequencing Analysis of Formononetin-Regulated Gene Expression in HaCaT Cells

[0090] A total of 1,840 DEGs were identified, of which 985 were upregulated and 855 were downregulated. Figures 2A and 2B show the 20 most significantly upregulated and downregulated DEGs after formononetin treatment. To further reveal the mechanism of action of formononetin, the biological properties of potential targets of formononetin were evaluated by GO and KEGG analyses. Figures 2C and 2D show the top 20 potential targets regulated by GO and KEGG analyses. These results suggest that the interferon signaling pathway plays an important role in formononetin intervention.

[0091] 3. Formononetin significantly improved the symptoms of IMQ-induced inflammatory skin lesions

[0092] The study found that formononetin significantly improved the symptoms of IMQ-induced skin lesions in mice, with 2% formononetin cream showing the most significant effect (Figure 3A). IMQ-induced lesions showed typical erythema, scaling, and thickening. After treatment with formononetin, the skin lesions of mice were significantly alleviated (Figure 3B). The PASI scores and ear thickness of the ear and back lesions after IMQ induction were significantly increased compared with the normal control group, while intervention with all concentrations of formononetin cream significantly decreased them (Figure 3C, D).

[0093] HE staining showed that the epidermis of the back and ear skin of mice in the control group was thinner, and no inflammatory cell infiltration was observed. Compared with the control group, the back and ear skin of mice in the IMQ group showed hyperkeratosis with parakeratosis. Neutrophil microabscesses were observed in the parakeratotic areas, the granular layer was significantly reduced, and the basal layer was thickened with epidermal protrusions extending downward. Inflammatory cell infiltration and epidermal hyperplasia in the back and ear skin of mice in the IMQ+FMN group (2% FMN cream) were significantly reduced (Figure 3E-H). TNF-α is considered an important pathogenic factor in inflammatory skin diseases. It can cause abnormal behavior of local immune cells in the body, leading to immune imbalance. IL-17 is a strong inflammatory factor that causes neutrophil infiltration in inflammatory skin lesions. The results showed that after intervention with formononetin, the production of inflammatory cytokines TNF-α and IL-17 induced by IMQ was inhibited (Figure 4A).

[0094] 4. Formononetin can inhibit the expression of interferon signaling pathway in IMQ-induced inflammatory skin lesions

[0095] Bioinformatics analysis results showed that the IFN signaling pathway is a potential core pathway for the action of formononetin. Furthermore, the expression of IFN-α, IFN-β, and IFN-γ in IMQ-induced skin lesions was evaluated. The results showed that the expression of IFN-α, IFN-β, and IFN-γ decreased after formononetin intervention compared with the IMQ group (Figure 4A). RT-qPCR was used to detect the mRNA expression levels of Cxcl9, Cxcl10, Cxcl11, and Cxcr3 in the ear lesions of mice in each group. The results showed that the inhibitory effect of formononetin on Cxcl9, Cxcl10, Cxcl11, and Cxcr3 was comparable to that of the Cal group (Figure 4B). Subsequently, immunohistochemistry analysis was performed to determine the tissue expression levels of p-STAT1, p-STAT3, and CD3. The results showed that the protein expression of p-STAT1, p-STAT3, and CD3 was significantly reduced after formononetin treatment (Figures 4C-E).

[0096] Western blot analysis of IRF1 protein expression, an important transcription factor in the interferon pathway, revealed that IRF1 expression was downregulated after formononetin treatment (Figure 4F). Taken together, these data suggest that the effects of formononetin on inflammatory skin diseases are mediated by downregulation of the interferon signaling pathway.

[0097] The above results indicate that formononetin improves the symptoms of IMQ-induced inflammatory skin lesions and downregulates the expression of genes related to the interferon signaling pathway.

[0098] The present invention is not limited to the above-mentioned embodiments. Those skilled in the art may make equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications and substitutions are all included in the scope defined by the claims of this application.

Claims

1. Application of formononetin in inhibiting interferon signaling pathway and reducing IMQ-induced inflammatory cytokine expression.

2. The inflammatory cytokines according to claim 1, comprising TNF-α and IL-17.

3. A pharmaceutical composition for use in inhibiting interferon signaling pathway and reducing IMQ-induced inflammatory cytokine expression according to claim 1, characterized in that: The pharmaceutical composition uses formononetin as an active ingredient and further comprises a pharmaceutically acceptable carrier.

4. The pharmaceutical composition for reducing the expression of inflammatory cytokines induced by IMQ according to claim 3, characterized in that: The pharmaceutical composition has interferon or its inhibitor as an active ingredient, and further comprises a pharmaceutically acceptable carrier.

5. The pharmaceutical composition according to any one of claims 3 or 4, characterized in that The dosage form of the pharmaceutical composition is an external dosage form or an internal dosage form.

6. The pharmaceutical composition according to claim 5, characterized in that The dosage form of the pharmaceutical composition is a patch, paste, ointment, cream, emulsion, microneedle, film coating, papule, spray, capsule, granule, tablet, pill, oral liquid or injection.

7. The pharmaceutical composition according to claim 6, characterized in that The preparation method of the emulsifiable paste is as follows: 1) Heat the oil phase (5% cetostearyl alcohol, 2% cetearyl alcohol, 3% glyceryl mono- and distearate, 5% light liquid paraffin, 2% polyoxyethylene (21) stearyl ether, 2% polyoxyethylene (2) stearyl ether, 0.1% ethylparaben) in a water bath to 80°C and melt; 2) Cooling the melted composition to 65° C., adding a set dose of formononetin, stirring and mixing evenly; heating the aqueous phase (8% glycerol, 2% propylene glycol, 70.9% HEPES buffer) to 80° C.; 3) slowly adding the water phase into the oil phase while stirring, until the mixture is cooled to room temperature, to obtain finished creams with different formononetin contents.

Images