Novel isoxazole compound as tm4SF5-specific inhibitor and use thereof

Abstract

The present invention relates to a novel isoxazole compound as a TM4SF5-specific inhibitor and a use thereof and, more specifically, to: a novel isoxazole compound, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising the compound, wherein the isoxazole compound inhibits immune checkpoint functions by downregulating the expression of TM4SF5 protein, suppressing protein-protein binding, inhibiting signal transduction activation, or activating the killing activity of T and NK immune cells or controlling the distribution of the immune cells. Specifically, with the ability to inhibit immune checkpoints of NK cells, the TM4SF5-specific isoxazole compound of the present invention can be advantageously used as an inhibitor against liver diseases or liver cancer.

Description

Novel isoxazole compounds as TM4SF5-specific inhibitors and their uses

[0001] The present invention relates to a novel isoxazole compound as a TM4SF5-specific inhibitor and its use, and more particularly, to a novel isoxazole compound having the effect of modulating the expression of TM4SF5 protein, protein-protein binding, signal transduction activation, or the activity and distribution of T and NK immune cells, a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising such a compound.

[0002] Inflammation of the human liver is both a pathogenesis and a characteristic of various chronic liver diseases. Chronic damage to hepatic epithelial cells and cell death caused by alcohol, viral infections, toxin accumulation, and metabolic dysfunction play a significant role in the initiation and exacerbation of additional liver diseases. Non-alcoholic fatty liver disease (NAFLD), caused by metabolic abnormalities in the normal liver, can progress to steatohepatitis due to inflammation caused by cell damage and death. Furthermore, it can progress to fibrosis and cirrhosis, which result in the accumulation of extracellular matrix and abnormal cell proliferation. Furthermore, changes in the metabolic-inflammatory environment and interactions between epithelial cells and immune cells, including macrophages, T cells, and natural killer (NK) cells, can inhibit or promote carcinogenesis in fibrotic / cirrhotic liver tissue.

[0003] Chronic liver diseases, ranging from normal liver function to non-alcoholic fatty liver (NAFL), non-alcoholic steatohepatitis (NASH), liver fibrosis, cirrhosis, and liver cancer, are caused and aggravated by abnormalities in the metabolic and inflammatory immune systems. Patients with non-alcoholic fatty liver disease (NAFLD), which affects up to 30% of the global population, have no clear diagnostic biomarker and no treatment. Furthermore, if they progress to liver cancer, they often develop late-stage liver cancer. Furthermore, there is no treatment for liver cancer yet, and immunotherapy, which is not effective against solid tumors, has been shown to have adverse effects in liver cancer (developed via NASH) (Nature, 2021. Vol. 592:450). Recently, immunotherapy has been attempted in combination with angiogenesis inhibitors, but its clinical efficacy remains uncertain. Therefore, the identification of new paradigm targets that play a crucial role in the progression of NASH to liver cancer and the development of inhibitors for these targets are essential. The importance of T or NK cell immune checkpoint inhibitors is emerging. In this context, the development of novel TM4SF5-specific inhibitors is considered crucial.

[0004] Transmembrane 4 L six family member 5 (TM4SF5), a tetraspanin that crosses the cell membrane four times, has been shown to be upregulated in hepatic epithelial cells and macrophages following chronic hepatic epithelial cell damage under the action of various cytokines / chemokines. Therefore, the interaction between hepatic epithelial cells, macrophages, T cells, and NK cells is dependent on the expression of TM4SF5 to remodel the inflammatory response and immune environment of the liver, which can induce fibrosis / cirrhosis beyond steatohepatitis, and can enhance the induction of cancer by controlling the function of NK cells. Ultimately, when carcinogenesis occurs, TM4SF5 expression in hepatic epithelial cells enables an immune escape process that suppresses the anti-cancer activity of immune cells, including T and NK (natural killer) cells, thereby increasing effective carcinogenesis or the incidence of cancer.

[0005] Therefore, if small molecule synthetic compounds or antibodies are used as inhibitors that suppress the expression of TM4SF5 or regulate various functions of TM4SF5, it will be possible to reduce the development of liver disease / liver cancer through abnormal proliferation / survival / migration functions of hepatic epithelial cells, or to suppress and control the aggravation of steatohepatitis, fibrosis / cirrhosis by regulating and inhibiting the interaction between hepatic epithelial cells and immune cells in liver tissue, and ultimately, it will be possible to suppress and eliminate the anti-cancer immune evasion functions of T and NK cells, thereby enabling a method of immune checkpoint inhibition for liver cancer.

[0006] The present inventors have confirmed that a novel isoxazole compound can be utilized as a TM4SF5-specific inhibitor and completed the present invention.

[0007] The object of the present invention is to provide a novel isoxazole compound that inhibits the expression of TM4SF5 protein, protein-protein binding, signal transduction activation, or the ability to regulate the activity and distribution of T and NK immune cells.

[0008] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating liver disease, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0009] Another object of the present invention is to provide a pharmaceutical preparation comprising the pharmaceutical composition.

[0010] Another object of the present invention is to provide a method for inhibiting immune checkpoint function by inhibiting the expression of TM4SF5 protein, protein-protein binding, inhibiting signal transduction activation, or activating the killing efficacy of T and NK immune cells or modulating their distribution, in a sample or cell, comprising administering to the sample a pharmaceutically effective amount of the compound.

[0011] Another object of the present invention is to provide a use of the compound or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver disease.

[0012] The present invention provides a compound selected from the compounds of the following chemical formula 1, pharmaceutically acceptable salts, hydrates and solvates thereof:

[0013] [Chemical Formula 1]

[0014]

[0015] In the above chemical formula 1,

[0016] X1 is O or N;

[0017] X2 is C or N;

[0018] X3 is C or N;

[0019] is a single bond or a double bond;

[0020] R1 is hydrogen, R a NH- or R a O- and;

[0021] R a is hydrogen, C 1-5 Alkyl, R b SO2- or R b CO- and,

[0022] Each R b are independently hydrogen, C 1-5 Alkyl, C 2-5 Alkenyl or, unsubstituted or C 1-5 C substituted with alkyl 6-10 It is aryl,

[0023] R2 is hydrogen, halogen, C 1-5 Alkyl, haloC 1-6 Alkyl, R c NH- or R c O- and;

[0024] Rc is hydrogen, C 1-5 Alkyl, R d SO2- or R d CO- and;

[0025] Each R d are independently hydrogen, C 1-5 Alkyl, or, unsubstituted or C 1-5 C substituted with alkyl 6-10 It is aryl,

[0026] n is an integer between 1 and 2.

[0027] (However, when X1 and X2 in the above chemical formula 1 are N, the compound of chemical formula 1 is represented by the compound of chemical formula 3)

[0028] In addition, the present invention provides a pharmaceutical composition for preventing or treating liver disease, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0029] In addition, the present invention provides a pharmaceutical composition for preventing or treating liver disease, comprising the compound or a pharmaceutically acceptable salt thereof as an active ingredient.

[0030] In addition, the present invention provides a method for inhibiting immune checkpoint function by inhibiting the expression of TM4SF5 protein, protein-protein binding, inhibiting signal transduction activation, or activating the killing efficacy of T and NK immune cells or modulating their distribution in a sample or cell, comprising administering to the sample a pharmaceutically effective amount of the compound.

[0031] In addition, the present invention provides a use of the compound or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver disease.

[0032] The isoxazole compound of chemical formula 1 in the present invention has excellent efficacy in regulating the expression of TM4SF5 protein, protein-protein binding inhibition, signal transduction activation inhibition, or the activity and distribution of T and NK immune cells, and thus can be usefully used as a therapeutic agent for liver disease.

[0033] Figure 1 shows the synthesis method of Example 32, a representative compound among isoxazole compounds.

[0034] Figures 2a and 2b show the results of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation by isoxazole compounds.

[0035] Figures 3a to 3c show the results of inhibition of TM4SF5-expression-dependent two-dimensional and three-dimensional cell growth / proliferation by Isoxazole compounds.

[0036] Figure 4 shows the results of inhibition of binding of TM4SF5 to various cell membrane receptors by treatment with isoxazole compounds.

[0037] Figures 5a to 5c show the results of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation and three-dimensional sphere proliferation by Isoxazole compounds.

[0038] Figure 6 shows the results of inhibition of binding of TM4SF5 to various cell membrane receptors and signaling factors by treatment with isoxazole compounds.

[0039] Figure 7 shows the results of TM4SF5-expression-dependent cell migration inhibition by Isoxazole compounds.

[0040] Figures 8a to 8i show the results of TM4SF5-expression-dependent NASH-induced inhibition by Isoxazole compounds.

[0041] Figures 9a to 9c show the results of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation by isoxazole compounds.

[0042] Figures 10a to 10c show the results of TM4SF5-expression-dependent three-dimensional cell growth / proliferation inhibition by Isoxazole compounds.

[0043] Figures 11a to 11e show the results of inhibition of TM4SF5-expression-dependent xenograft liver cancer formation by Isoxazole compounds.

[0044] Figures 12a to 12d show the results of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation and three-dimensional cell growth / proliferation by Isoxazole compounds.

[0045] Figures 13a to 13j show the results of the inhibition of the expression of ligands related to the natural killing function of NK cells dependent on TM4SF5 expression by isoxazole compounds and the inhibition of binding to TM4SF5.

[0046] Figures 14a to 14d show the importance of N-glycosylation of the two proteins in the reduction of expression of Slamf7s and their binding to TM4SF5 in relation to the natural killing function of NK cells dependent on TM4SF5 expression.

[0047] Figures 15a to 15h show the results of the reduction in expression, degradation, and regulation of intracellular location of ligands related to the natural killing function of NK cells dependent on TM4SF5 expression by isoxazole compounds.

[0048] Figures 16a to 16g show the results of the reduction in the natural killing function of NK cells due to TM4SF5 expression.

[0049] Figures 17a to 17d show the results of inhibition of PD-L1 expression and binding, which induces immune evasion functions of T and NK cells in a TM4SF5 expression-dependent manner by the Isoxazole compound.

[0050] Figures 18a to 18b show the results of suppressing the expression of PD-1 and T cell activation dependent on TM4SF5 expression by the Isoxazole compound.

[0051] Figures 19a to 19e show the results of inhibition of the binding ability of TM4SF5 to cholesterol by isoxazole compounds and isoxazole treatment.

[0052] Figures 20a to 20d show the results of suppressing the expression of liver cancer markers and liver cancer formation in a liver-orthotopic xenograft model of a TM4SF5 expressing cell line by an Isoxazole compound.

[0053] Figures 21a to 21e show the results of inhibition of liver cancer formation and expression of liver cancer markers in a PDX model expressing TM4SF5 by an isoxazole compound.

[0054] Figures 22a to 22e show the results of regulating the expression of ligands related to the natural killing function of NK cells and the infiltration of NK cells into cancer tissues in a liver-orthotopic xenograft model of a TM4SF5-expressing cell line by an Isoxazole compound.

[0055] Figures 23a to 23c show the results of suppressing liver cancer formation and regulating the expression of ligands related to the natural killing function of NK cells in TM4SF5 genetically modified animals treated with DEN by isoxazole compounds.

[0056] Figures 24a to 24d show the results of suppressing liver cancer formation by isoxazole compounds in a subcutaneous xenograft liver cancer model in severe immunodeficient animals (NOD-SCID mice) and regulating the expression of ligands on cancer cells related to the natural killing function of NK cells.

[0057] The present inventors confirmed that TM4SF5 expression increases signal transduction activity and binding functions to membrane receptors due to TM4SF5 expression in TM4SF5 expression-dependent cell line models and animal models, TM4SF5 expression-dependent cell survival / proliferation and migration in two-dimensional and three-dimensional environments, and inhibition of the development of liver diseases including steatohepatitis (NASH-fibrosis) and hepatocellular carcinoma (in particular, two compounds, ST-5-001 and ST-5-002, showed effects at concentrations of 1 μM or 2.5 mpk or less). In particular, the present inventors have confirmed and reported that the existing TM4SF5 can reduce the killing function of NK immune cells (Korean Patent Application No. 10-2021-0171614 and PCT Application No. PCT / KR2021 / 018197), and the novel isoxazole compound of the present invention has shown a mechanism of action that can suppress the reduction in NK cell function caused by TM4SF5. In addition, since the PD-L1 immune checkpoint, which induces immune evasion function along with the generation of liver cancer, is expressed and acts not only in NK cells but also in T cells, it can be interpreted that the novel isoxazole compound of the present invention has shown a mechanism of action that can suppress the reduction in T cell function caused by TM4SF5. Furthermore, TM4SF5 expressed in liver cancer cells binds to ligands such as SLAMF7 that induce NK cell activation, causing translocation to lysosomes for degradation, inhibiting NK cell activation and reducing natural killing efficacy. However, isoxazole compounds, which act as TM4SF5-specific inhibitors, inhibit the degradation function, thereby enhancing NK cell activation and natural killing efficacy. In addition, isoxazole compounds can reverse both the phenomenon in which TM4SF5 increases the expression of PD-L1 and stabilizes it through direct binding, and induces the expression of PD-1 in T cells, thereby inhibiting T cell activation and cancer cell killing function.

[0058] Accordingly, the present invention relates to a novel isoxazole compound that acts as a TM4SF5-specific inhibitor, which can suppress the development of liver disease and liver cancer and cut off the aggravation of the connection between the above diseases, and further has utility as an anti-hepatic cancer agent based on its efficacy as an immune checkpoint inhibitor of T cells and NK cells, which are abundant in the liver.

[0059] In the present invention, the term "TM4SF5 protein" refers to a Transmembrane 4 L six family member (also called Four Transmembrane L6 Superfamily member 5 or 'L6H'), which is a type belonging to the tetraspanin, tetraspan, or Transmembrane 4 Super Family (TM4SF), a group of membrane receptors that cross the cell membrane four times. The TM4SF (transmembrane 4 superfamily) proteins have similar structures that cross the cell membrane four times. They share a structure that includes four hydrophobic regions that are biochemically assumed to be transmembrane domains. In particular, among these, the Four-Transmembrane L6 Superfamily (including L6, TM4SF5, L6D, and IL-TMP) including TM4SF5 is a tetraspanin whose biochemical function is not well known.

[0060] The above TM4SF5 is an insoluble protein with four regions that pass through the cell membrane, two ring structures existing outside the cell, and two terminal structures existing in the cytoplasm, and is known to be highly expressed in various cancer cells including pancreatic cancer, lung cancer, stomach cancer, prostate cancer, breast cancer, esophageal cancer, rectal cancer, and liver cancer (Muller-Pillasch, F., et al., Gene 208:25, 1998; Pascual-Le Tallec, L. et al., J Clin Endocrinol Metab 87:501, 2002).

[0061] In the present invention, the term "liver disease" means any disease that causes a decline in liver function, and is caused by, for example, viruses (e.g., viruses A, B, C, D, or E), alcohol, aflatoxin, drugs (tuberculosis medications, aspirin, antibiotics, anesthetics, antihypertensives, oral contraceptives, etc.), and congenital metabolic disorders. Specific examples of liver diseases include chronic liver damage, non-alcoholic or alcoholic liver disease, fatty liver, hepatitis, liver fibrosis, cirrhosis, liver cancer, etc. The liver diseases are preferably, but are not limited to, liver cancer, fatty liver, hepatitis, liver fibrosis, and cirrhosis.

[0062] In the present invention, unless otherwise stated, the term "halogen" refers to fluorine, chlorine, bromine or iodine, specifically, but not limited to, fluorine.

[0063] In the present invention, unless otherwise stated, the term "alkyl" refers to a saturated, straight-chain or branched monovalent hydrocarbon radical.

[0064] In the present invention, unless otherwise stated, the term "alkenyl" refers to a monovalent hydrocarbon radical containing at least one carbon-carbon double bond, each double bond of which may have an E- or Z-configuration.

[0065] These alkyls and alkenyls may be linear, i.e., straight-chain, or branched. Depending on their respective definitions, the number of carbon atoms in an alkyl group may be 1, 2, 3, 4, 5, or 6, or 1, 2, 3, or 4. Examples of alkyls are methyl, ethyl, propyl including n-propyl and isopropyl, butyl including n-butyl, sec-butyl, isobutyl, and tert-butyl, n-pentyl, 1-methylbutyl, isopentyl, pentyl including neopentyl and tert-pentyl, hexyl including n-hexyl, 3,3-dimethylbutyl, and isohexyl. The double bond in an alkenyl group may be present at any position.

[0066] The term "aryl" in the present invention, unless otherwise stated, represents an aromatic group which may be substituted or unsubstituted, and may include, without limitation, phenyl, biphenyl, naphthyl, toluyl, naphthalenyl, anthracenyl, or all possible isomers thereof.

[0067] In the present invention, the numerical range indicated using the term “to” refers to a range that includes the numerical values ​​described before and after the term “to” as the lower limit and the upper limit, respectively.

[0068] The compound of formula 1 according to the above aspect may exist in the form of a solvate. The term "solvate" may include a molecular complex comprising the compound and one or more pharmaceutically acceptable solvent molecules, such as ethanol or water. A complex in which the solvent molecule is water is also referred to as a "hydrate."

[0069] The compound of formula 1 and its solvate according to the above aspect may exist in the form of a pharmaceutically acceptable salt.

[0070] The term "pharmaceutically acceptable salt" in the present invention means a salt that has low toxicity to the human body and does not adversely affect the biological activity and physicochemical properties of the parent compound. Pharmaceutically acceptable salts include, but are not limited to, acid addition salts of pharmaceutically acceptable free acids and base compounds of formula 1, alkali metal salts (e.g., sodium salts) and alkaline earth metal salts (e.g., calcium salts), organic base addition salts of organic bases and carboxylic acid structures of formula 1, amino acid addition salts, etc.

[0071] Preferred salt forms of the compound according to the present invention include salts with inorganic acids or organic acids. In this case, inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, and hydrobromic acid can be used. In addition, organic acids such as acetic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, fumaric acid, maleic acid, malonic acid, phthalic acid, succinic acid, lactic acid, citric acid, citric acid, gluconic acid, tartaric acid, salicylic acid, malic acid, oxalic acid, benzoic acid, embonic acid, aspartic acid, and glutamic acid can be used. Organic bases that can be used for preparing organic base addition salts include tris(hydroxymethyl)methylamine and dicyclohexylamine. Amino acids that can be used for preparing amino acid addition salts include natural amino acids such as alanine and glycine. It will be apparent to those skilled in the art that other acids or bases may be used in addition to the inorganic acids, organic acids, organic bases and amino acids exemplified above.

[0072] The above salt can be prepared by a conventional method. For example, the compound of the above chemical formula 1 can be prepared by dissolving it in a solvent that can be mixed with water, such as methanol, ethanol, acetone, or 1,4-dioxane, adding a free acid or free base, and then crystallizing the resulting solution.

[0073] The details of the above preventive or therapeutic method can be applied as is to the above description of the pharmaceutical composition according to one aspect of the present invention.

[0074] In the present invention, the term “treatment” is used as a concept that includes treatment, improvement, amelioration or management of a disease.

[0075] The term "prevention" in the present invention refers to preventing a disease, for example, preventing a disease, condition or disorder in an individual who may be predisposed to the disease, condition or disorder but has not yet experienced or exhibited the pathology or signs of the disease.

[0076] The term “administration” in the present invention means providing a predetermined composition of the present invention to a subject by any suitable method.

[0077] The term "subject" or "patient" in the present invention means any animal including mammals, for example, C. elegans, fruit flies, zebrafish, mice, rats, other rodents, rabbits, dogs, cats, pigs, cows, sheep, horses or primates, and humans.

[0078]

[0079] Hereinafter, the present invention will be described in more detail.

[0080]

[0081] According to one embodiment of the present invention, the novel isoxazole compound can be represented by the following chemical formula 1.

[0082] [Chemical Formula 1]

[0083] A compound selected from the compounds of the following chemical formula 1, pharmaceutically acceptable salts, hydrates and solvates thereof:

[0084]

[0085] In the above chemical formula 1,

[0086] X1 is O or N;

[0087] X2 is C or N;

[0088] X3 is C or N;

[0089] is a single bond or a double bond;

[0090] R1 is hydrogen, R a NH- or R a O-, preferably amine, acetamide, methanesulfonamide, methylbenzenesulfonamide, methylbenzamide, acrylamide, methoxy or hydroxy,

[0091] R a is hydrogen, C 1-5 Alkyl, R b SO2- or R b CO- and,

[0092] Each R b are independently hydrogen, C 1-5 Alkyl, C 2-5 Alkenyl or, unsubstituted or C 1-5 C substituted with alkyl 6-10 It is aryl;

[0093] R2 is hydrogen, halogen, C 1-5 Alkyl, haloC 1-6 Alkyl, R c NH- or R c O-, preferably methoxy, propoxy, t-butyl, fluorine, trifluoromethyl, hydroxy, methylbenzenesulfonate, acetamide or methylbenzamide;

[0094] R c is hydrogen, C 1-5 Alkyl, R d SO2- or R d CO- and;

[0095] Each R d are independently hydrogen, C 1-5 Alkyl, or, unsubstituted or C 1-5 C substituted with alkyl 6-10 It is aryl;

[0096] n is an integer between 1 and 2.

[0097] (However, when X1 and X2 in the above chemical formula 1 are N, the compound of chemical formula 1 is represented by the compound of chemical formula 3)

[0098] According to another embodiment of the present invention, the compound represented by the above chemical formula 1 may be represented by any one of the following chemical formulas 2 to 4.

[0099] [Chemical Formula 2]

[0100]

[0101] [Chemical Formula 3]

[0102]

[0103] [Chemical Formula 4]

[0104]

[0105] In the above chemical formulas 2 to 4,

[0106] X1, X3, R1, R a , R b , R2, R c , R d and n are as defined in claim 1.

[0107] In addition, preferred examples of the compound of the above chemical formula 1 according to the present invention are as follows, but are not limited thereto:

[0108] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline;

[0109] 4-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline;

[0110] 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline;

[0111] 4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline;

[0112] 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline;

[0113] 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline;

[0114] 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline;

[0115] 4-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline;

[0116] 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline;

[0117] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0118] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)methanesulfonamide;

[0119] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0120] N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0121] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide;

[0122] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide;

[0123] N-(4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0124] N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0125] N-(4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0126] N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0127] N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)acetamide;

[0128] N-(4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)acetamide;

[0129] N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide;

[0130] N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide;

[0131] N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0132] N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide;

[0133] N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide;

[0134] 4-(3-(4-acetamidophenyl)isoxazol-5-yl)phenyl 4-methylbenzenesulfonate;

[0135] N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide;

[0136] N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide;

[0137] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide;

[0138] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide;

[0139] N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide;

[0140] N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide;

[0141] N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide;

[0142] N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide;

[0143] N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; and

[0144] N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide.

[0145] In addition, preferred examples of the compound of the chemical formula 1 according to the present invention are described in Table 1 below.

[0146]

[0147] Example Structural Formula Experiment Number Name 1 ST-1-0254-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline 2 ST-2-0044-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline 3 ST-2-0054-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline 4 ST-2-0064-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline 5 ST-2-0074-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline 6 ST-2-0084-(5-(4-fluorophenyl)isoxazol-3-yl)aniline 7 ST-2-0094-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline 8 ST-2-0114-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline 9 ST-2-0103-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline 10 ST-2-001N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide11 ST-2-002N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)methanesulfonamide12 ST-2-003N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide 13 ST-1-024N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide14 ST-3-009N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide15 ST-3-010N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide16 ST-3-001N-(4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide17 ST-3-002N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide18 ST-3-003N-(4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)acetamide19 ST-3-004N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide20 ST-3-005N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)acetamide21 ST-3-006N-(4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)acetamide22 ST-3-007N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide23 ST-3-008N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide24 ST-3-011N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide25 ST-3-012N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide26 ST-4-001N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide27 ST-4-0024-(3-(4-acetamidophenyl)isoxazol-5-yl)phenyl 4-methylbenzenesulfonate28 ST-4-003N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide29 ST-4-004N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide30 ST-4-005N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide31 ST-5-001N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide32 ST-5-002N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide33 ST-1-001N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide34 ST-4-007N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide35 ST-1-002N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide36 ST-1-004N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide37 ST-4-006N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide

[0148]

[0149] According to another embodiment of the present invention, a pharmaceutical composition for preventing or treating liver disease is provided, comprising the compound of the above chemical formula 1 and a pharmaceutically acceptable salt thereof as an active ingredient.

[0150] The above liver disease may be liver cancer, chronic liver damage, non-alcoholic or alcoholic liver disease, fatty liver, hepatitis, liver fibrosis, or cirrhosis.

[0151] The pharmaceutical composition may be used to treat liver disease by inhibiting the expression, protein-protein binding, or signal transduction activation of TM4SF5 protein, or by activating the killing efficacy of T and NK immune cells or regulating their distribution to inhibit immune checkpoint function.

[0152] According to another embodiment of the present invention, a pharmaceutical preparation comprising the pharmaceutical composition is provided.

[0153] The pharmaceutical preparation of the present invention may be in various oral dosage forms such as patches, ointments, inhalants, nasal drops, tablets, pills, powders, capsules, syrups or emulsions, or in parenteral dosage forms such as intramuscular, intravenous or subcutaneous administration such as injections.

[0154] In addition, the above pharmaceutical preparation may be formulated according to a conventional method by adding, in addition to the active ingredient, a conventional non-toxic pharmaceutically acceptable additive, for example, at least one selected from the group consisting of a carrier, an adjuvant, and an excipient.

[0155] Excipients that can be used in the pharmaceutical preparation of the present invention include, but are not limited to, sweeteners, binders, solubilizers, solubilizers, wetting agents, emulsifiers, isotonic agents, adsorbents, disintegrants, antioxidants, preservatives, lubricants, fillers, fragrances, etc. For example, excipients that can be used include lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, glycine, silica, magnesium aluminum silicate, starch, gelatin, gum tragacanth, alginic acid, sodium alginate, methylcellulose, sodium carboxymethylcellulose, water, ethanol, polyethylene glycol, polyvinylpyrrolidone, sodium chloride, calcium chloride, orange essence, strawberry essence, vanilla flavor, etc.

[0156] When the pharmaceutical preparation of the present invention is in an oral dosage form, examples of carriers used include, but are not limited to, cellulose, calcium silicate, corn starch, lactose, sucrose, dextrose, calcium phosphate, stearic acid, magnesium stearate, calcium stearate, gelatin, talc, etc.

[0157] When the pharmaceutical preparation of the present invention is in the form of an injection, the carrier may include, but is not limited to, water, saline solution, glucose aqueous solution, similar sugar aqueous solution, alcohol, glycol, ether, oil, fatty acid, fatty acid ester, glyceride, etc.

[0158] For use of the compounds according to the present invention as medicaments, the latter are prepared in the form of pharmaceutical preparations, which contain, in addition to the active ingredients for oral or parenteral administration, suitable pharmaceutically organic or inorganic inert carrier substances, such as water, gelatin, gum arabic, lactose, starch, vegetable oils, polyalkylene glycols, etc. The pharmaceutical preparations may be in solid form, such as tablets, dragees, suppositories or capsules, or in liquid form, such as solutions, suspensions or emulsions. In addition, they optionally contain auxiliaries, such as preservatives, stabilizers, wetting agents or emulsifiers; salts or buffers for altering the osmotic pressure.

[0159] For parenteral administration, injectable solutions or suspensions are particularly preferred.

[0160] As carrier systems, surfactants, for example, bile salts or animal or plant phospholipids, or mixtures thereof, and liposomes or components thereof may also be used.

[0161] For oral administration, tablets, dragees, or capsules containing talc and / or a hydrocarbon vehicle or binder, such as lactose, corn starch, or potato starch, are particularly suitable. Liquid forms, such as juices with added sweeteners, may also be used.

[0162] According to another embodiment of the present invention, a method is provided for inhibiting immune checkpoint function by inhibiting expression of TM4SF5 protein, protein-protein binding, inhibiting signal transduction activation, or activating the killing efficacy of T and NK immune cells or regulating their distribution, comprising administering to the subject a pharmaceutically effective amount of a compound of the above chemical formula 1.

[0163] According to another embodiment of the present invention, a method for preventing or treating liver disease in a subject is provided, comprising administering to the subject a pharmaceutically effective amount of a compound of the above formula 1. Preferably, the subject refers to, but is not limited to, an individual or a patient.

[0164] According to another embodiment of the present invention, a use of the compound of formula 1 or a pharmaceutically acceptable salt thereof for the prevention or treatment of liver disease is provided.

[0165]

[0166] Hereinafter, the present invention will be described in more detail with the following examples and experimental examples. However, these examples and experimental examples are intended only to aid understanding of the present invention and are not intended to limit the scope of the present invention in any way.

[0167]

[0168] Example 1: Preparation of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline

[0169]

[0170] Step 1) Preparation of tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate

[0171]

[0172] Tert-Butyl (4-formylphenyl)carbamate (3.00 g, 13.56 mmol), sodium acetate (3.34 g, 40.67 mmol), and hydroxyl ammonium chloride (2.83 g, 40.67 mmol) were dissolved in ethanol (50 mL) and stirred at room temperature for 3 hours. After the reaction was completed, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:4), and the resulting solution was concentrated to obtain the target compound (2.10 g, 66% yield).

[0173] 1 H NMR (DMSO-d6, 800 MHz) δ 10.98 (s, 1H), 9.50 (s, 1H), 8.02 (s, 1H), 7.48-7.45 (m, 4H), 1.47 (s, 9H)

[0174]

[0175] Step 2) Tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0176]

[0177] Tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate (750 mg, 3.17 mmol) and 4-ethynylanisole (286 mg, 2.12 mmol) prepared in the above step 1) were dissolved in 1,4-dioxane:water (5:1, 36 mL), and [bis(trifluoroacetoxy)iodo]benzene (1.82 g, 4.24 mmol) was added dropwise. The mixture was stirred at room temperature for 3 hours. After the reaction was completed, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate:n-hexane = 1:3), and the obtained solution was concentrated to obtain the target compound (650 mg, 82% yield).

[0178] 1 H NMR (DMSO-d6, 800 MHz) δ 9.62 (s, 1H), 7.84 (d, J = 8.8 Hz, 2H), 7.79 (d, J = 8.7 Hz, 2H), 7.61 (d, J = 8.4 Hz, 2H), 7.37 (s, 1H), 7.12 (d, J = 8.8 Hz, 2H), 3.84 (s, 3H), 1.49 (s, 9H)

[0179]

[0180] Step 3) Preparation of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline

[0181]

[0182] Tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (310 mg, 0.85 mmol) prepared in the above step 2) was dissolved in dichloromethane (15 mL), and trifluoroacetic acid (0.65 mL, 8.46 mmol) was added dropwise. The mixture was stirred at room temperature for 3 hours. After the reaction was completed, the mixture was concentrated under reduced pressure. The obtained residue was dissolved in dichloromethane, and a saturated aqueous solution of sodium bicarbonate was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:2), and the resulting solution was concentrated to obtain the target compound (215 mg, 96% yield).

[0183] 1 H NMR (DMSO-d6, 800 MHz) δ 7.81 (d, J = 8.8 Hz, 2H), 7.55 (d, J = 8.6 Hz, 2H), 7.23 (s, 1H), 7.10 (d, J = 8.9 Hz, 2H), 6.65 (d, J = 8.6 Hz, 2H), 5.56 (s, 2H), 3.83 (s, 3H)

[0184]

[0185] Example 2: Preparation of 4-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline

[0186]

[0187] Step 1) Preparation of tert-butyl (4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0188]

[0189] The process of Example 1, Step 2) was repeated except that 1-ethynyl-3-methoxybenzene (93 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining the target compound in an amount of 160 mg, in a yield of 62%.

[0190] 1 H NMR (DMSO-d6, 800 MHz) δ 9.63 (s, 1H), 7.80 (d, J = 8.7 Hz, 2H), 7.62 (d, J = 8.5 Hz, 2H), 7.56 (s, 1H), 7.49-7.47 (m, 2H), 7.44-7.43 (m, 1H), 7.11-7.08 (m, 1H), 3.86 (s, 3H), 1.50 (s, 9H)

[0191]

[0192] Step 2) Preparation of 4-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline

[0193]

[0194] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (100 mg, 0.27 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain the target compound (64 mg, 88% yield).

[0195] 1 H NMR (DMSO-d6, 800 MHz) δ 7.57 (d, J = 8.5 Hz, 2H), 7.48-7.44 (m, 2H), 7.42 (s, 1H), 7.41-7.40 (m, 1H), 7.08 (ddd, J = 7.6, 2.5, 1.9 Hz, 1H), 6.65 (d, J = 8.5 Hz, 2H), 5.57 (s, 2H), 3.85 (s, 3H)

[0196]

[0197] Example 3: Preparation of 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline

[0198]

[0199] Step 1) Preparation of tert-butyl (4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0200]

[0201] The process of Example 1, Step 2) was repeated except that 1-ethynyl-2-methoxybenzene (93 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining the target compound in an amount of 185 mg, in a yield of 72%.

[0202] 1 H NMR (DMSO-d6, 800 MHz) δ 9.61 (s, 1H), 7.88 (dd, J = 7.7, 1.6 Hz, 1H), 7.84 (d, J = 8.7 Hz, 2H), 7.61 (d, J = 8.4 Hz, 2H), 7.53-7.51 (m, 1H), 7.31 (s, 1H), 7.25 (d, J = 8.3 Hz, 1H), 7.14-7.12 (m, 1H), 3.99 (s, 3H), 1.50 (s, 9H)

[0203]

[0204] Step 2) Preparation of 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline

[0205]

[0206] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (30 mg, 0.08 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain 19 mg of the target compound in a yield of 87%.

[0207] 1H NMR (DMSO-d6, 800 MHz) δ 7.86 (dd, J = 7.7, 1.6 Hz, 1H), 7.59 (d, J = 8.5 Hz, 2H), 7.50 (ddd, J = 8.5, 7.2, 1.5 Hz, 1H), 7.23 (d, J = 8.1) Hz, 1H), 7.18 (s, 1H), 7.12 (td, J = 7.5, 0.8 Hz, 1H), 6.65 (d, J = 8.6 Hz, 2H), 5.55 (s, 2H), 3.98 (s, 3H)

[0208]

[0209] Example 4: Preparation of 4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline

[0210]

[0211] Step 1) Preparation of tert-butyl (4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0212]

[0213] The process of Example 1, Step 2) was repeated except that 4-ethynyl-1,2-dimethoxybenzene (115 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining 120 mg of the target compound in a yield of 43%.

[0214] 1 H NMR (DMSO-d6, 800 MHz) δ 9.62 (s, 1H), 7.79 (d, J = 8.6 Hz, 2H), 7.61 (d, J = 8.5 Hz, 2H), 7.47 (dd, J = 8.3, 1.9 Hz, 1H), 7.43 (dd, J = 8.3, 1.9 Hz, 1H), 7.43 (s, 1H), 7.13 (d, J = 8.4 Hz, 1H), 3.87 (s, 3H), 3.83 (s, 3H), 1.50 (s, 9H)

[0215]

[0216] Step 2) Preparation of 4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline

[0217]

[0218] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)carbamate (100 mg, 0.25 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain the target compound (68 mg, 91% yield).

[0219] 1 H NMR (DMSO-d6, 800 MHz) δ 7.55 (d, J = 8.5 Hz, 2H), 7.44 (dd, J = 8.3, 2.0 Hz, 1H), 7.41 (d, J = 2.0 Hz, 1H), 7.29 (s, 1H), 7.11 (d, J = 8.4) Hz, 1H), 6.65 (d, J = 8.6 Hz, 2H), 5.55 (s, 2H), 3.86 (s, 3H), 3.83 (s, 3H)

[0220]

[0221] Example 5: Preparation of 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline

[0222]

[0223] Step 1) Preparation of tert-butyl (4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)carbamate

[0224]

[0225] The process of Example 1, Step 2) was repeated except that 1-(tert-butyl)-4-ethynylbenzene (112 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining 194 mg of the target compound in a yield of 70%.

[0226] 1H NMR (DMSO-d6, 800 MHz) δ 9.63 (s, 1H), 7.83 (d, J = 8.4 Hz, 2H), 7.81 (d, J = 8.7 Hz, 2H), 7.61 (d, J = 8.4 Hz, 2H), 7.59 (d, J = 8.5 Hz, 2H), 7.46 (s, 1H), 1.50 (s, 9H), 1.32 (s, 9H)

[0227]

[0228] Step 2) Preparation of 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline

[0229]

[0230] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)carbamate (90 mg, 0.23 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain the target compound (61 mg, 91% yield).

[0231] 1 H NMR (DMSO-d6, 800 MHz) δ 7.80 (d, J = 8.4 Hz, 2H), 7.57 (d, J = 8.4 Hz, 4H), 7.32 (s, 1H), 6.65 (d, J = 8.5 Hz, 2H), 5.56 (s, 2H), 1.32 (s, 9H)

[0232]

[0233] Example 6: Preparation of 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline

[0234]

[0235] Step 1) Preparation of tert-butyl (4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)carbamate

[0236]

[0237] The process of Example 1, Step 2) was repeated except that 1-ethynyl-4-fluorobenzene (85 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining 210 mg of the target compound in a yield of 84%.

[0238] 1 H NMR (DMSO-d6, 800 MHz) δ 9.64 (s, 1H), 7.96 (dd, J = 8.7, 5.3 Hz, 2H), 7.80 (d, J = 8.7 Hz, 2H), 7.62 (d, J = 8.4 Hz, 2H), 7.52 (s, 1H), 7.43 (t, J = 8.8 Hz, 2H), 1.50 (s, 9H)

[0239]

[0240] Step 2) Preparation of 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline

[0241]

[0242] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)carbamate (30 mg, 0.08 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain 20 mg of the target compound in a yield of 93%.

[0243] 1 H NMR (DMSO-d6, 800 MHz) δ 7.93 (dd, J = 8.8, 5.4 Hz, 2H), 7.56 (d, J = 8.5 Hz, 2H), 7.41 (t, J = 88 Hz, 2H), 7.38 (s, 1H), 6.65 (d, J = 8.5) Hz, 2H), 5.58 (s, 2H)

[0244]

[0245] Example 7: Preparation of 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline

[0246]

[0247] Step 1) Preparation of tert-butyl (4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)carbamate

[0248]

[0249] The process of Example 1, Step 2) was repeated except that 1-ethynyl-4-(trifluoromethyl)benzene (96 mg, 0.56 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining 195 mg of the target compound in 85% yield.

[0250] 1 H NMR (DMSO-d6, 800 MHz) δ 9.65 (s, 1H), 8.13 (d, J = 8.2 Hz, 2H), 7.95 (d, J = 8.3 Hz, 2H), 7.82 (d, J = 8.6 Hz, 2H), 7.75 (s, 1H), 7.63 (d, J = 8.4 Hz, 2H), 1.50 (s, 9H)

[0251]

[0252] Step 2) Preparation of 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline

[0253]

[0254] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)carbamate (80 mg, 0.20 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain the target compound (52 mg, 86% yield).

[0255] 1H NMR (DMSO-d6, 800 MHz) δ 8.10 (d, J = 8.2 Hz, 2H), 7.93 (d, J = 8.3 Hz, 2H), 7.61 (s, 1H), 7.59 (d, J = 8.5 Hz, 2H), 6.66 (d, J = 8.6 Hz, 2H), 5.61 (s, 2H)

[0256]

[0257] Example 8: Preparation of 4-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline

[0258]

[0259] Step 1) Preparation of tert-butyl (4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0260]

[0261] The process of Example 1, Step 2) was repeated except that 1-ethynyl-4-propoxybenzene (114 mg, 0.71 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2), thereby obtaining 220 mg of the target compound in a yield of 79%.

[0262] 1 H NMR (DMSO-d6, 800 MHz) δ 9.62 (s, 1H), 7.82 (d, J = 8.7 Hz, 2H), 7.79 (d, J = 8.7 Hz, 2H), 7.61 (d, J = 8.4 Hz, 2H), 7.36 (s, 1H), 7.10 (d, J = 8.8 Hz, 2H), 4.01 (t, J = 6.4 Hz, 2H), 1.78-1.74 (m, 2H), 1.00 (t, J = 7.3 Hz, 3H)

[0263]

[0264] Step 2) Preparation of 4-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline

[0265]

[0266] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (30 mg, 0.08 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain 19 mg of the target compound in a yield of 85%.

[0267] 1 H NMR (DMSO-d6, 800 MHz) δ 7.79 (d, J = 8.8 Hz, 2H), 7.55 (d, J = 8.5 Hz, 2H), 7.22 (s, 1H), 7.09 (d, J = 8.8 Hz, 2H), 6.64 (d, J = 8.5 Hz, 2H), 5.55 (s, 2H), 4.01 (t, J = 6.5 Hz, 2H), 1.78-1.73 (m, 2H), 0.99 (t, J = 7.4 Hz, 3H)

[0268]

[0269] Example 9: Preparation of 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline

[0270]

[0271] Step 1) Preparation of tert-butyl (E)-(3-((hydroxyimino)methyl)phenyl)carbamate

[0272]

[0273] Except for using tert-butyl (3-formylphenyl)carbamate (800 mg, 3.62 mmol) instead of tert-butyl (4-formylphenyl)carbamate in Example 1, Step 1), the process of Example 1, Step 1) was repeated to obtain the target compound in an amount of 355 mg, 42% yield.

[0274] 1H NMR (DMSO-d6, 800 MHz) δ 8.08 (s, 1H), 7.62 (s, 1H), 7.35 (d, J = 7.8 Hz, 1H), 7.28 (t, J = 7.9 Hz, 1H), 7.24 (s, 2H), 7.22 (d, J = 7.7) Hz, 1H), 1.50 (s, 9H)

[0275]

[0276] Step 2) Preparation of tert-butyl (3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate

[0277]

[0278] The procedure of Example 1, Step 2) was repeated except that tert-butyl (E)-(3-((hydroxyimino)methyl)phenyl)carbamate (290 mg, 1.23 mmol) was used instead of tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate in Example 1, Step 2), thereby obtaining 250 mg of the target compound in a yield of 84%.

[0279] 1 H NMR (DMSO-d6, 800 MHz) δ 9.55 (s, 1H), 8.11 (s, 1H), 7.88 (d, J = 8.8 Hz, 2H), 7.51 (d, J = 7.7 Hz, 1H), 7.47 (dt, J = 6.3, 1.3 Hz, 1H), 7.41 (t, J = 7.8 Hz, 1H), 7.35 (s, 1H), 7.12 (d, J = 8.9 Hz, 2H), 3.84 (s, 3H), 1.50 (s, 9H)

[0280]

[0281] Step 3) Preparation of 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline

[0282]

[0283] The procedure of Example 1, Step 3) was repeated except that tert-butyl (3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate (210 mg, 0.57 mmol) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain 135 mg of the target compound in 88% yield.

[0284] 1 H NMR (DMSO-d6, 800 MHz) δ 7.85 (d, J = 8.9 Hz, 2H), 7.28 (s, 1H), 7.16 (t, J = 7.7 Hz, 1H), 7.12-7.10 (m, 3H), 6.99 (dt, J = 6.2, 1.2 Hz, 1H), 6.68 (ddd, J = 7.9, 2.2, 0.8 Hz, 1H), 5.31 (s, 2H), 3.84 (s, 3H)

[0285]

[0286] Example 10: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0287]

[0288] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) and N,N-diisopropylethylamine (0.04 mL, 0.23 mmol) prepared in the above Example 1, Step 3) were dissolved in dichloromethane (2 mL), and acetyl chloride (0.02 mL, 0.15 mmol) was added dropwise at 0 degrees. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was completed. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:1), and the obtained solution was concentrated to obtain the target compound (21 mg, 91% yield).

[0289] 1H NMR (DMSO-d6, 800 MHz) δ 10.16 (s, 1H), 7.84 (d, J = 8.9 Hz, 2H), 7.83 (d, J = 8.9 Hz, 2H), 7.74 (d, J = 8.6 Hz, 2H), 7.38 (s, 1H), 7.12 (d, J = 8.8 Hz, 2H), 3.84 (s, 3H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.5, 168.6, 162.1, 160.8, 141.0, 127.2, 127.1, 123.1, 119.6, 119.1, 114.7, 96.9, 55.4, 24.1

[0290]

[0291] Example 11: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)methanesulfonamide

[0292]

[0293] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (50 mg, 0.19 mmol) prepared in the above Example 1, Step 3) was dissolved in pyridine (2.5 mL), and methanesulfonyl chloride (0.02 mL, 0.28 mmol) was added dropwise. The mixture was stirred at room temperature for 1 hour, and water was added dropwise after the reaction was completed. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:3), and the obtained solution was concentrated to obtain the target compound (60 mg, 93% yield).

[0294] 1 H NMR (DMSO-d6, 800 MHz) δ 10.08 (s, 1H), 7.85 (dd, J = 12.7, 8.8 Hz, 4H), 7.40 (s, 1H), 7.34 (d, J = 8.6 Hz, 2H), 7.12 (d, J = 8.9 Hz, 2H), 3.84 (s, 3H), 3.08 (s, 3H)

[0295]

[0296] Example 12: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0297]

[0298] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (30 mg, mmol) and pyridine (0.02 mL, 0.23 mmol) prepared in the above Example 1, Step 3) were dissolved in dichloromethane (3 mL), and 4-toluenesulfonyl chloride (43 mg, 0.23 mmol) was added dropwise. The mixture was stirred at room temperature for 6 hours, and after the reaction was completed, water was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:2), and the obtained solution was concentrated to obtain the target compound (30 mg, 63% yield).

[0299] 1 H NMR (DMSO-d6, 800 MHz) δ 10.56 (s, 1H), 7.81 (d, J = 8.8 Hz, 2H), 7.75 (d, J = 8.7 Hz, 2H), 7.70 (d, J = 8.4 Hz, 2H), 7.36 (d, J = 8.2 Hz, 2H), 7.32 (s, 1H), 7.23 (d, J = 8.7 Hz, 2H), 7.11 (d, J = 8.9 Hz, 2H), 3.83 (s, 3H), 2.33 (s, 3H)

[0300]

[0301] Example 13: Preparation of N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0302]

[0303] N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide (30 mg, 0.07 mmol) prepared in Example 12 was dissolved in dichloromethane (3 mL), and boron tribromide (0.11 mL, 0.11 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and water was added dropwise after the reaction was completed. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:1), and the obtained solution was concentrated to obtain the target compound (18 mg, 62% yield).

[0304] 1 H NMR (DMSO-d6, 800 MHz) δ 10.54 (s, 1H), 10.08 (s, 1H), 7.74 (d, J = 8.7 Hz, 2H), 7.70 (d, J = 8.2 Hz, 2H), 7.69 (d, J = 8.7 Hz, 2H), 7.36 (d, J = 8.1 Hz, 2H), 7.23 (d, J = 8.8 Hz, 2H), 7.22 (s, 1H), 6.91 (d, J = 8.7 Hz, 2H), 2.33 (s, 3H)

[0305]

[0306] Example 14: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide

[0307]

[0308] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) and N,N-diisopropylethylamine (0.04 mL, 0.23 mmol) prepared in the above Example 1, Step 3) were dissolved in dichloromethane (3 mL), and p-toluoyl chloride (0.02 mL, 0.15 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and after the reaction was completed, water was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:3), and the obtained solution was concentrated to obtain the target compound (21 mg, 73% yield).

[0309] 1 H NMR (DMSO-d6, 800 MHz) δ 10.38 (s, 1H), 7.96 (d, J = 8.7 Hz, 2H), 7.90 (d, J = 8.2 Hz, 2H), 7.89 (d, J = 8.7 Hz, 2H), 7.85 (d, J = 8.8 Hz, 2H), 7.43 (s, 1H), 7.36 (d, J = 7.8 Hz, 2H), 7.13 (d, J = 8.8 Hz, 2H), 3.85 (s, 3H), 2.40 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.6, 165.6, 162.1, 160.9, 141.8, 141.0, 131.8, 129.0, 127.8, 127.3, 127.0, 123.6, 120.4, 119.6, 114.7, 96.9, 55.4, 21.0

[0310]

[0311] Example 15: Preparation of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide

[0312]

[0313] 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) prepared in the above Example 1, Step 3) was dissolved in a saturated aqueous solution of tetrahydrofuran:sodium bicarbonate (4:1, 2.5 mL), and acrylyl chloride (0.01 mL, 0.11 mmol) was added dropwise. The mixture was stirred at room temperature for 12 hours, and after the reaction was completed, water was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate:n-hexane = 1:1), and the obtained solution was concentrated to obtain the target compound (17 mg, 71% yield).

[0314] 1 H NMR (DMSO-d6, 800 MHz) δ 10.38 (s, 1H), 7.87 (d, J = 8.7 Hz, 2H), 7.85 (d, J = 8.8 Hz, 2H), 7.83 (d, J = 8.7 Hz, 2H), 7.41 (s, 1H), 7.13 (d, J = 8.8 Hz, 2H), 6.47 (dd, J = 16.9, 10.2 Hz, 1H), 6.30 (dd, J = 17.0, 1.7 Hz, 1H), 5.80 (dd, J = 10.1, 1.7 Hz, 1H), 3.84 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.6, 163.4, 162.1, 160.9, 140.7, 131.7, 127.4, 127.2, 127.2, 123.6, 119.6, 119.5, 114.7, 96.9, 55.4

[0315]

[0316] Example 16: Preparation of N-(4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0317]

[0318] The procedure of Example 10 was repeated, except that 4-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) prepared in Example 2, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain 21 mg of the target compound in a yield of 91%.

[0319] 1 H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.84 (d, J = 8.6 Hz, 2H), 7.75 (d, J = 8.6 Hz, 2H), 7.58 (s, 1H), 7.50-7.47 (m, 2H), 7.45-7.44 (m, 1H), 7.11-7.09 (m, 1H), 3.86 (s, 3H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.3, 168.6, 162.2, 159.7, 141.1, 130.5, 128.1, 127.2, 122.9, 119.1, 117.8, 116.4, 110.6, 98.7, 55.4, 24.1

[0320]

[0321] Example 17: Preparation of N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0322]

[0323] The procedure of Example 10 was repeated, except that 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline (6 mg, 0.02 mmol) prepared in Example 3, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound (6 mg, 86% yield).

[0324] 1H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.90-7.88 (m, 3H), 7.74 (d, J = 8.6 Hz, 2H), 7.52 (ddd, J = 8.8, 7.4, 1.7 Hz, 1H), 7.33 (s, 1H), 7.25 (d, J = 8.2 Hz, 1H), 7.13 (td, J = 7.6, 0.9 Hz, 1H), 3.99 (s, 3H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 168.6, 165.7, 162.0, 156.0, 141.0, 131.8, 127.2, 127.0, 123.1, 120.8, 119.1, 115.4, 112.2, 101.4, 55.8, 24.1

[0325]

[0326] Example 18: Preparation of N-(4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0327]

[0328] The procedure of Example 10 was repeated, except that 4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.07 mmol) prepared in Example 4, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound in 17 mg (74% yield).

[0329] 1 H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.83 (d, J = 8.7 Hz, 2H), 7.74 (d, J = 8.6 Hz, 2H), 7.47 (dd, J = 8.3, 2.0 Hz, 1H), 7.44 (s, 1H), 7.44 (s, 1H), 7.13 (d, J = 8.4 Hz, 1H), 3.87 (s, 3H), 3.84 (s, 3H), 2.08 (s, 3H) 13C NMR (DMSO-d6, 200 MHz) δ 169.7, 168.6, 162.1, 161.6, 149.1, 133.2, 127.1, 123.1, 119.7, 119.1, 118.5, 116.4, 112.0, 108.9, 97.1, 55.7, 55.6, 24.2

[0330]

[0331] Example 19: Preparation of N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0332]

[0333] The procedure of Example 10 was repeated, except that 4-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline (9 mg, 0.03 mmol) prepared in Example 8, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound in 8 mg, 78% yield.

[0334] 1 H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.82 (dd, J = 8.7, 3.1 Hz, 4H), 7.73 (d, J = 8.6 Hz, 2H), 7.37 (s, 1H), 7.11 (d, J = 8.8 Hz, 2H), 4.02 (t, J = 6.5 Hz, 2H), 2.08 (s, 3H), 1.78-1.74 (m, 2H), 1.00 (t, J = 7.4 Hz, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.6, 168.6, 162.1, 160.3, 141.0, 127.2, 127.1, 123.1, 119.4, 119.1, 115.1, 96.8, 69.2, 24.1, 21.9, 10.3

[0335]

[0336] Example 20: Preparation of N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)acetamide

[0337]

[0338] The procedure of Example 10 was repeated, except that 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline (27 mg, 0.09 mmol) prepared in Example 7, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound (25 mg, 81% yield).

[0339] 1 H NMR (DMSO-d6, 800 MHz) δ 10.15 (s, 1H), 8.09 (d, J = 8.1 Hz, 2H), 7.92 (d, J = 8.3 Hz, 2H), 7.83 (d, J = 8.7 Hz, 2H), 7.74-7.71 (m, 4H), 2.05 (s, 3H)

[0340]

[0341] Example 21: Preparation of N-(4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)acetamide

[0342]

[0343] The procedure of Example 10 was repeated, except that 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline (10 mg, 0.04 mmol) prepared in Example 6, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound in 9 mg (77% yield).

[0344] 1 H NMR (DMSO-d6, 800 MHz) δ 10.18 (s, 1H), 7.98-7.96 (m, 2H), 7.84 (d, J = 8.7 Hz, 2H), 7.75 (d, J = 9.0 Hz, 2H), 7.53 (s, 1H), 7.44-7.41 (m, 2H), 2.08 (s, 3H) 13C NMR (DMSO-d6, 200 MHz) δ 168.7, 168.6, 163.8, 162.5, 162.3, 141.1, 133.2, 128.1, 128.0, 127.2, 123.6, 122.9, 119.1, 116.5, 116.4, 98.3, 24.1

[0345]

[0346] Example 22: Preparation of N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide

[0347]

[0348] The procedure of Example 10 was repeated, except that 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline (15 mg, 0.05 mmol) prepared in Example 5, Step 2 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the target compound (11 mg, 64% yield).

[0349] 1 H NMR (DMSO-d6, 800 MHz) δ 10.17 (s, 1H), 7.85 (d, J = 8.7 Hz, 2H), 7.83 (d, J = 8.5 Hz, 2H), 7.74 (d, J = 8.6 Hz, 2H), 7.59 (d, J = 8.5 Hz, 2H), 7.48 (s, 1H), 2.08 (s, 3H), 1.33 (s, 9H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.6, 168.6, 162.1, 153.2, 141.1, 127.2, 126.1, 125.4, 124.3, 123.0, 119.1, 97.8, 34.7, 30.9, 24.1

[0350]

[0351] Example 23: Preparation of N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide

[0352]

[0353] The procedure of Example 1, Step 2) was repeated except that 4-ethynylpyridine (58.2 mg, 0.56 mmol) was used instead of 4-ethynylanisole in Example 1, Step 2) to obtain 130 mg of tert-butyl (4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)carbamate in a yield of 45%.

[0354] The process of Example 1, Step 3) was repeated except that the obtained tert-butyl (4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)carbamate was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3) to obtain the target compound in 62 mg (77% yield).

[0355] The procedure of Example 10 was repeated except that the obtained 4-(5-(pyridin-4-yl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, thereby obtaining the final target compound in an amount of 18 mg, a yield of 77%.

[0356] 1 H NMR (DMSO-d6, 800 MHz) δ 10.20 (s, 1H), 8.79 (dd, J = 4.4, 1.6 Hz, 2H), 7.87-7.86 (m, 3H), 7.86 (s, 1H), 7.84 (s, 1H), 7.76 (d, J = 8.6 Hz, 2H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 168.7, 167.1, 162.5, 150.8, 141.3, 133.4, 127.3, 122.5, 119.4, 119.1, 101.4, 24.1

[0357]

[0358] Example 24: Preparation of N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0359]

[0360] The procedure of Example 10 was repeated, except that 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) prepared in Example 9, Step 3 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain 15 mg of the target compound in a yield of 65%.

[0361] 1 H NMR (DMSO-d6, 800 MHz) δ 10.14 (s, 1H), 8.18 (t, J = 1.7 Hz, 1H), 7.88 (d, J = 8.9 Hz, 2H), 7.70 (dd, J = 8.1, 1.0 Hz, 1H), 7.54 (dt, J = 6.5, 1.2 Hz, 1H), 7.46 (t, J = 7.9 Hz, 1H), 7.37 (s, 1H), 7.13-7.11 (m, 2H), 3.84 (s, 3H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.8, 168.5, 162.5, 160.9, 139.9, 129.5, 129.1, 127.3, 121.5, 120.7, 119.5, 116.6, 114.7, 97.1, 55.4, 24.0

[0362]

[0363] Example 25: Preparation of N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide

[0364]

[0365] The procedure of Example 14 was repeated, except that 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline (20 mg, 0.08 mmol) prepared in Example 9, Step 3 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 14, to obtain the target compound (22 mg, 76% yield).

[0366] 1 H NMR (DMSO-d6, 800 MHz) δ 10.36 (s, 1H), 8.39 (t, J = 1.8 Hz, 1H), 7.92 (d, J = 8.1 Hz, 3H), 7.89 (d, J = 8.8 Hz, 2H), 7.61 (dt, J = 6.4, 1.3 Hz, 1H), 7.52 (t, J = 7.9 Hz, 1H), 7.41 (s, 1H), 7.36 (d, J = 7.8 Hz, 2H), 7.13 (d, J = 8.9 Hz, 2H), 3.84 (s, 3H), 2.40 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.8, 165.5, 162.5, 160.9, 141.8, 139.9, 131.8, 129.4, 129.0, 129.0, 127.7, 127.3, 122.0, 122.0, 119.5, 118.1, 114.7, 97.1, 55.4, 21.0

[0367]

[0368] Example 26: Preparation of N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide

[0369]

[0370] The procedure of Example 13 was repeated, except that N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide (20 mg, 0.07 mmol) prepared in Example 10 was used instead of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13, to obtain 16 mg of the target compound in a yield of 84%.

[0371] 1H NMR (DMSO-d6, 800 MHz) δ 10.12 (s, 1H), 10.05 (s, 1H), 7.78 (d, J = 8.7 Hz, 2H), 7.69 (d, J = 8.5 Hz, 2H), 7.69 (d, J = 8.6 Hz, 2H), 7.24 (s, 1H), 6.88 (d, J = 8.7 Hz, 2H), 2.04 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.9, 168.6, 162.0, 159.4, 141.0, 127.3, 127.1, 123.2, 119.1, 118.1, 116.0, 96.1, 24.1

[0372]

[0373] Example 27: Preparation of 4-(3-(4-acetamidophenyl)isoxazol-5-yl)phenyl 4-methylbenzenesulfonate

[0374]

[0375] The procedure of Example 12 was repeated except that N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide (5 mg, 0.02 mmol) prepared in Example 26 was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 12 and potassium carbonate (3.5 mg, 0.03 mmol) was used instead of pyridine, to obtain the target compound (6 mg, 79% yield).

[0376] 1 H NMR (DMSO-d6, 800 MHz) δ 10.18 (s, 1H), 7.91 (d, J = 8.7 Hz, 2H), 7.82 (d, J = 8.7 Hz, 2H), 7.78 (d, J = 8.3 Hz, 2H), 7.74 (d, J = 8.7 Hz, 2H), 7.55 (s, 1H), 7.49 (d, J = 8.0 Hz, 2H), 7.23 (d, J = 8.8 Hz, 2H), 2.43 (s, 3H), 2.08 (s, 3H) 13C NMR (DMSO-d6, 200 MHz) δ 168.6, 168.2, 162.3, 150.1, 146.1, 141.2, 131.1, 130.3, 128.3, 127.4, 127.2, 126.0, 123.1, 122.7, 119.1, 99.1, 24.1, 21.2

[0377]

[0378] Example 28: Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide

[0379]

[0380] Step 1) Preparation of (E)-4-methoxybenzaldehyde oxime

[0381]

[0382] The procedure of Example 1, Step 1 was repeated except that 4-methoxybenzaldehyde (2.0 g, 14.69 mmol) was used instead of tert-butyl (4-formylphenyl)carbamate in Example 1, Step 1, to obtain 1.37 g of the target compound in a yield of 62%.

[0383] 1 H NMR (CDCl3, 800 MHz) δ 8.14 (d, J = 9.0 Hz, 2H), 7.90 (s, 1H), 7.05 (d, J = 9.1 Hz, 2H), 3.92 (s, 3H)

[0384]

[0385] Step 2) Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide

[0386]

[0387] The procedure of Example 1, Step 2 was repeated except that (E)-4-methoxybenzaldehyde oxime (610 mg, 4.04 mmol) prepared in Example 28, Step 1 was used instead of tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate in Example 1, Step 2, and N-(4-ethynylphenyl)acetamide (428 mg, 2.69 mmol) was used instead of 4-ethynylanisole, to obtain the target compound (560 mg, 68% yield).

[0388] 1 H NMR (DMSO-d6, 800 MHz) δ 10.22 (s, 1H), 7.85-7.82 (m, 4H), 7.76 (d, J = 8.6 Hz, 2H), 7.40 (s, 1H), 7.09 (d, J = 8.8 Hz, 2H), 3.83 (s, 3H), 2.09 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.3, 168.7, 162.1, 160.7, 141.2, 128.0, 126.3, 121.5, 121.0, 119.1, 114.5, 97.2, 55.3, 24.1

[0389]

[0390] Example 29: Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide

[0391]

[0392] N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide (10 mg, 0.03 mmol) prepared in Example 28, Step 2 was dissolved in ethanol (2 mL), and 37% aqueous hydrochloric acid solution (0.3 mL) was added dropwise. After heating to 70°C, the mixture was stirred for 3 hours. After completion of the reaction, a saturated aqueous sodium bicarbonate solution was added dropwise at room temperature. The mixture was extracted three times with a mixed solution of chloroform:isopropyl alcohol (4:1), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate:n-hexane = 1:2), and the obtained solution was concentrated to obtain the target compound (8.0 mg, 93% yield).

[0393] The procedure of Example 12 was repeated except that the obtained 4-(3-(4-methoxyphenyl)isoxazol-5-yl)aniline (10 mg, 0.04 mmol) was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 12, to obtain the final target compound (14 mg, 89% yield).

[0394] 1 H NMR (DMSO-d6, 800 MHz) δ 10.64 (s, 1H), 7.81 (d, J = 8.8 Hz, 2H), 7.74 (d, J = 8.2 Hz, 2H), 7.70 (d, J = 8.3 Hz, 2H), 7.36 (d, J = 7.8 Hz, 1H), 7.35 (s, 1H), 7.23 (d, J = 7.9 Hz, 2H), 7.08 (d, J = 8.9 Hz, 2H), 3.82 (s, 3H), 2.33 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 162.1, 160.7, 129.8, 128.0, 126.7, 120.9, 119.4, 114.5, 55.3, 20.9

[0395]

[0396] Example 30: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide

[0397]

[0398] The procedure of Example 13 was repeated except that N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide (15 mg, 0.04 mmol) prepared in Example 29, step 2) was used instead of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13, to obtain the target compound (11 mg, 76% yield).

[0399] 1 H NMR (DMSO-d6, 800 MHz) δ 10.63 (s, 1H), 9.92 (s, 1H), 7.74 (d, J = 8.7 Hz, 2H), 7.70 (d, J = 7.9 Hz, 2H), 7.69 (d, J = 8.5 Hz, 2H), 7.36 (d, J = 8.1 Hz, 2H), 7.30 (s, 1H), 7.25 (d, J = 8.7 Hz, 2H), 6.88 (d, J = 8.7 Hz, 2H), 2.33 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 168.7, 162.3, 159.2, 143.6, 139.7, 136.4, 129.8, 128.1, 126.7, 126.7, 122.3, 119.4, 119.3, 115.8, 97.5, 20.9

[0400]

[0401] Example 31: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide

[0402]

[0403] The procedure of Example 13 was repeated except that N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide (15 mg, 0.05 mmol) prepared in Example 28, step 2) was used instead of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide in Example 13, to obtain the target compound (10 mg, 70% yield).

[0404] 1 H NMR (DMSO-d6, 800 MHz) δ 10.21 (s, 1H), 9.95 (s, 1H), 7.82 (d, J = 8.7 Hz, 2H), 7.75 (d, J = 8.7 Hz, 2H), 7.72 (d, J = 8.6 Hz, 2H), 7.33 (s, 1H), 6.89 (d, J = 8.6 Hz, 2H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.1, 168.7, 162.3, 141.1, 128.1, 126.3, 121.6, 119.4, 119.1, 115.8, 97.1, 24.1

[0405]

[0406] Example 32: Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0407]

[0408] Step 1) Preparation of N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0409]

[0410] The procedure of Example 14 was repeated except that 4-(3-(4-methoxyphenyl)isoxazol-5-yl)aniline (15 mg, 0.06 mmol) prepared in Example 29, step 1) was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 14, to obtain 13 mg of the target compound in a yield of 60%.

[0411] 1 H NMR (DMSO-d6, 800 MHz) δ 10.42 (s, 1H), 7.99 (d, J = 8.7 Hz, 2H), 7.90 (d, J = 8.1 Hz, 2H), 7.89 (d, J = 8.7 Hz, 2H), 7.85 (d, J = 8.7 Hz, 2H), 7.45 (s, 1H), 7.36 (d, J = 7.9 Hz, 2H), 7.10 (d, J = 8.8 Hz, 2H), 3.84 (s, 3H), 2.40 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.3, 165.6, 162.1, 160.7, 141.9, 141.2, 131.8, 129.0, 128.0, 127.8, 126.1, 122.0, 121.0, 120.4, 114.5, 97.4, 55.3, 21.0

[0412]

[0413] Step 2) Preparation of N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide

[0414]

[0415] The procedure of Example 13 was repeated except that N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide (108 mg, 0.28 mmol) prepared in Step 1) was used instead of N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide in the above Example 13, to obtain 65 mg of the target compound in a yield of 63%.

[0416] 1H NMR (DMSO-d6, 800 MHz) δ 10.41 (s, 1H), 9.96 (s, 1H), 7.99 (d, J = 8.7 Hz, 2H), 7.90 (d, J = 8.0 Hz, 2H), 7.88 (d, J = 8.7 Hz, 2H), 7.73 (d, J = 8.6 Hz, 2H), 7.38 (s, 1H), 7.36 (d, J = 7.9 Hz, 2H), 6.90 (d, J = 8.6 Hz, 2H), 2.08 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 169.1, 165.6, 162.3, 159.2, 141.9, 141.1, 131.8, 129.0, 128.1, 127.8, 126.1, 122.0, 120.4, 119.4, 115.8, 97.3, 21.0

[0417]

[0418] Example 33: Preparation of N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide

[0419]

[0420] Step 1) Preparation of 4-(4-(4-aminophenyl)-1H-1,2,3-triazol-1-yl)phenol

[0421]

[0422] 4-Ethynylaniline (100 mg, 0.85 mmol), 4-iodophenol (187.8 mg, 0.85 mmol), sodium azide (82.9 mg, 1.28 mmol), cuprous iodide (32.4 mg, 0.17 mmol), L-proline (19.6 mg, 0.17 mmol), and sodium carbonate (135.1 mg, 1.28 mmol) were dissolved in dimethyl sulfoxide (3 mL). After heating to 70°C, the mixture was stirred for 12 hours. After the reaction was completed, water was added dropwise. The mixture was extracted three times with a mixed solution of chloroform:isopropyl alcohol (4:1), dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 3:2), and the obtained solution was concentrated to obtain 114 mg of the target compound in 80% yield.

[0423] 1 H NMR (DMSO-d6, 400 MHz) δ 9.92 (s, 1H), 8.91 (s, 1H), 7.68 (d, J = 8.8 Hz, 2H), 7.57 (d, J = 8.8 Hz, 2H), 6.94 (d, J = 8.8 Hz, 2H), 6.64 (d, J = 6.8 Hz, 2H), 5.27 (s, 2H)

[0424]

[0425] Step 2) Preparation of N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide

[0426]

[0427] 4-(4-(4-aminophenyl)-1H-1,2,3-triazol-1-yl)phenol (50 mg, 0.2 mmol) and pyridine (0.03 mL, 0.4 mmol) prepared in Example 33, Step 1 were dissolved in dichloromethane (2 mL), and 4-toluenesulfonyl chloride (45.3 mg, 0.24 mmol) and 4-dimethylaminopyridine (4.8 mg, 0.04 mmol) were added dropwise. After stirring at room temperature for 12 hours, 1 N aqueous hydrochloric acid solution was added dropwise. The mixture was extracted three times with dichloromethane, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 2:1), and the obtained solution was concentrated to obtain 40 mg of the target compound in a 50% yield.

[0428] 1 H NMR (DMSO-d6, 800 MHz) δ 10.16 (s, 1H), 8.90 (s, 1H), 7.73 (d, J = 8.5 Hz, 2H), 7.65 (d, J = 8.2 Hz, 2H), 7.64 (d, J = 8.8 Hz, 2H), 7.33 (d, J = 8.2 Hz, 2H), 7.15 (d, J = 8.5 Hz, 2H), 6.93 (d, J = 8.9 Hz, 2H), 2.30 (s, 3H)

[0429]

[0430] Example 34: Preparation of N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide

[0431]

[0432] N-(4-ethynylphenyl)acetamide (50 mg, 0.31 mmol), 1-azido-4-methoxybenzene (42 mg, 0.28 mmol), copper sulfate dihydrate (12 mg, 0.05 mmol), and sodium ascorbate (28 mg, 0.14 mmol) were dissolved in tetrahydrofuran:water (1:1, 3 mL). After stirring at room temperature for 12 hours, a 1N hydrochloric acid aqueous solution was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate:n-hexane = 1:1), and the obtained solution was concentrated to obtain the target compound (45 mg, 46% yield).

[0433] 1 H NMR (DMSO-d6, 800 MHz) δ 10.06 (s, 1H), 9.09 (s, 1H), 7.85-7.83 (m, 4H), 7.69 (d, J = 8.6 Hz, 2H), 7.17 (d, J = 9.0 Hz, 2H), 3.84 (s, 3H), 2.07 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 168.4, 159.2, 147.00, 139.2, 130.1, 125.7, 125.1, 121.6, 119.2, 118.9, 114.9, 55.6, 24.0

[0434]

[0435] Example 35: Preparation of N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0436]

[0437] (E)-N-(4-(3-(4-hydroxyphenyl)acrylyl)phenyl)-4-methylbenzenesulfonamide (TSAHC) (100 mg, 0.25 mmol) and hydrazine hydrate (0.03 mL, 0.51 mmol) were dissolved in ethanol (2.5 mL), heated to 70°C, and stirred for 12 hours. After the reaction was completed, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 2:1), and the resulting solution was concentrated to obtain the target compound (45 mg, 44% yield).

[0438] 1 H NMR (DMSO-d6, 800 MHz) δ 13.05 (s, 1H), 10.32 (s, 1H), 9.78 (s, 1H), 7.65-7.63 (m, 4H), 7.57 (d, J = 8.2 Hz, 2H), 7.33 (d, J = 8.2 Hz, 2H), 7.11 (d, J = 8.5 Hz, 2H), 6.87 (s, 1H), 6.80 (d, J = 8.5 Hz, 2H), 2.30 (s, 3H)

[0439]

[0440] Example 36: Preparation of N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide

[0441]

[0442] (E)-N-(4-(3-(4-hydroxyphenyl)acrylyl)phenyl)-4-methylbenzenesulfonamide (TSAHC) (100 mg, 0.25 mmol) and hydroxyl ammonium chloride (35.3 mg, 0.51 mmol) were dissolved in ethanol (2.5 mL), heated to 70°C, and stirred for 12 hours. After the reaction was completed, water was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:2), and the obtained solution was concentrated to obtain the target compound (32 mg, 30% yield).

[0443] 1 H NMR (DMSO-d6, 800 MHz) δ 9.68 (s, 1H), 7.66 (d, J = 8.3 Hz, 2H), 7.52 (d, J = 8.7 Hz, 2H), 7.33 (d, J = 8.1 Hz, 2H), 7.16-7.12 (m, 4H), 6.73 (d, J = 8.6 Hz, 2H), 5.52 (dd, J = 10.6, 9.1 Hz, 1H), 4.67-4.65 (m, 1H), 3.22 (dd, J = 17.1, 8.9 Hz, 1H), 2.30 (s, 3H)

[0444]

[0445] Example 37: Preparation of N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide

[0446]

[0447] Step 1) Preparation of tert-butyl (4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)carbamate

[0448]

[0449] 4-Vinylstyrene (0.11 mL, 0.83 mmol), (diacetoxyiodo)benzene (266 mg, 0.83 mmol), and trifluoroacetic acid (0.015 mL) were dissolved in methanol (10 mL), and tert-butyl (E)-(4-((hydroxyimino)methyl)phenyl)carbamate (150 mg, 0.64 mmol) prepared in Example 1, Step 1) was slowly added dropwise. After stirring at room temperature for 12 hours, a saturated aqueous solution of sodium bicarbonate was added dropwise. The mixture was extracted three times with ethyl acetate, dried over anhydrous magnesium sulfate, and concentrated under reduced pressure. The obtained residue was purified by flash column chromatography (ethyl acetate: n-hexane = 1:4), and the obtained solution was concentrated to obtain the target compound (154 mg, 66% yield).

[0450] 1 H NMR (DMSO-d6, 800 MHz) δ 9.59 (s, 1H), 7.59 (d, J = 8.8 Hz, 2H), 7.53 (d, J = 8.6 Hz, 2H), 7.31 (d, J = 8.7 Hz, 2H), 6.94 (d, J = 8.7 Hz, 2H), 3.78-3.73 (m, 4H), 3.31 (m, 1H), 1.48 (s, 9H)

[0451]

[0452] Step 2) Preparation of N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide

[0453]

[0454] The procedure of Example 1, Step 3) was repeated except that tert-butyl (4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)carbamate (100 mg, 0.27 mmol) prepared in Step 1) was used instead of tert-butyl (4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)carbamate in Example 1, Step 3), to obtain 51 mg of the target compound in a yield of 70%.

[0455] The procedure of Example 10 was repeated except that the obtained 4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)aniline (50 mg, 0.186 mmol) was used instead of 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline in Example 10, to obtain the final target compound in an amount of 48 mg, a yield of 83%.

[0456] 1 H NMR (DMSO-d6, 800 MHz) δ 10.13 (s, 1H), 7.66 (d, J = 8.8 Hz, 2H), 7.63 (d, J = 8.8 Hz, 2H), 7.32 (d, J = 8.7 Hz, 2H), 6.94 (d, J = 8.7 Hz, 2H), 5.63 (dd, J = 10.6, 9.0 Hz, 1H), 3.77 (dd, J = 16.9, 10.7 Hz, 1H), 3.75 (s, 3H), 3.33 (d, J = 9.3 Hz, 1H), 2.06 (s, 3H) 13 C NMR (DMSO-d6, 200 MHz) δ 168.6, 159.1, 156.1, 140.9, 132.7, 127.7, 127.3, 123.8, 118.8, 113.9, 81.7, 55.1, 41.9, 24.1

[0457]

[0458] Experimental Example 1. Experimental Preparation

[0459]

[0460] 1.1. Cell culture

[0461]

[0462] SNU449, SNU761, or Huh7 human hepatoma cells that do not express TM4SF5 KO(Cell line in which TM4SF5 gene was deleted using CRISPR / Cas9 system) Cell line (SNU449Tp, SNU449T7, SNU449-TM4SF5, SNU761-TM4SF5, or Huh7) created by infecting cell line with retrovirus expressing TM4SF5 or transfecting cDNA KO SNU449Cp, SNU449-EV, SNU761-EV, or Huh7 cells infected with -TM4SF5) and control virus or transfected with control empty vector KO -EV cell lines were cultured in DMEM or RPMI-1640 medium (WelGene, Daegu, South Korea) containing 10% FBS and antibiotics (Invitrogen, CA, USA) at 37°C in a 5% CO2 incubator. Human natural killer (NK) cell line NK92 cell line was cultured in α-MEM (Invitrogen) medium containing 200.0 U / ml recombinant human IL-2 (Peprotech), 12.5% ​​FBS, and 12.5% ​​fetal horse serum (GenDEPOT). NK92 cells were infected with a retrovirus expressing TM4SF5-HA to generate NK92-TM4SF5-HA. HEK293FT or human Jurkat T cells were cultured in RPMI-1640 medium supplemented with 10% FBS.

[0463]

[0464] 1.2. Gene injection (transfection or infection) and expression suppression

[0465]

[0466] In some cases, wildtype (WT) or mutant cDNAs of TM4SF5, SLAMF7, or PD-L1 contained in empty vector (EV) or mammalian expression plasmids were transfected into cell lines using lipofectamine 3000 (Thermo Fisher Scientific Inc.) and PEI (Polyscience), or the genes were artificially expressed in the cell lines under study by infecting host cells with lentivirus vectors containing empty vectors or cDNAs.

[0467]

[0468] 1.3. Evaluation of cell survival / proliferation (sphere growth) inhibition in a three-dimensional aqueous culture environment

[0469]

[0470] The same number (200 cells / well or 1000 cells / well) of cells not expressing TM4SF5 (SNU449Cp) and cells expressing TM4SF5 (SNU449T7) were placed per well in a Costar Ultra-Low Attachment Multiple Well Plate (CORNING) and treated with vehicle (DMSO) or drugs at various concentrations, and then cultured in a cell culture incubator at 37 o C, cultured under 5% CO2 conditions. As suggested from the day of cell culture, the drug was repeatedly treated at the same concentration every day at regular intervals, and on the last day of observation, cell (sphere) proliferation was observed and photographed using an optical microscope.

[0471]

[0472] 1.4. Analysis of cell migration paths and migration functions

[0473]

[0474] SNU449-TM4SF5 cells, which were transduced with lentivirus to express TM4SF5 in human hepatoma SNU449 cells, and SNU449-EV cells, which were injected with a control vector (empty vector, EV) that did not express TM4SF5, were seeded at 40% confluence in 8-chamber plates (Thermo) coated with 10 μg / ml collagen type 1 (Advanced biomatrix). Three hours after seeding in a cell culture medium containing 10% FBS (GenDEPOT), DMSO and drugs were treated in the culture medium at the indicated concentrations. After drug treatment, the positions of the same cells moving every 20 minutes for 17 hours were repeatedly photographed using a microscope. Cells were photographed using an IX81-ZDC microscope (Olympus) equipped with a UPLSAPO 10X2, NA0.4 Super Apochromatic objective lens (Olympus). While filming the cells, a controller (Live Cell Instrument) was used to maintain a constant infusion of 5% CO2 at 37°C at a rate of 40–60 mL / min, creating a typical cell culture environment. The distance and path of cell migration were calculated using the “Track Object” application of MetaMorph software (Molecular Devices LLC). The migration paths of multiple cells were measured simultaneously, and the original positions of each cell were set to the origin of concentric circles, and the migration paths were marked with lines of different colors to indicate the degree of cell migration.

[0475]

[0476] 1.5. Generation of mice in which the TM4SF5 gene is overexpressed only in hepatocytes.

[0477]

[0478] Details regarding the production of the mouse described in Examples 1.5 and 1.6 are provided in Korean Patent Application Nos. 10-2022-0007048, 10-2021-0171614, and 10-2021-0150240, filed by the present inventors. However, the description of the mouse production described in the aforementioned Korean patent applications is summarized below.

[0479]

[0480] The plasmid, which was designed to express the mouse Tm4sf5 gene (NM_029360) in hepatocytes, which have high albumin expression, by linking it to the albumin promoter sequence, was microinjected into C57BL / 6 mouse embryos. After confirming the 689 bp product by PCR using 2-week-old founder mice (ALB Forward-CAGCTTGGCTTGAACTCGTTC-3', TM4SF5 Reverse-CAATTCCTGGACACAGCACCA-3'), overexpressing mice were confirmed, thereby constructing (pALB-mTm4sf5-(Flag)3-transgenic mouse:Alb-TgTm4sf5-Flag).

[0481]

[0482] 1.6. Generation of mice with TM4SF5 gene knockout (KO)

[0483]

[0484] Cas9 / RGEN KO mice were generated using C57BL / 6 mice, and mice with various 29 bp deletions were obtained using the RGEN site (sgRNA sequence for targeting mouse Tm4sf5Exon 1: sgRNA1 5'GAGGTTGCCGTCCGTCCAGGTGG3', sgRNA2 5'GCTGAGGTTGCCGTCCGTCCAGG3' [Macrogen, custom-made]. Mouse TM4SF5 primers (Forward, 5'-ACTTCCTCAGGGCCTCTCTC-3'; Reverse, 5'-CCTTTCCCACATTCCTCAGA-3') were used to confirm the result of the PCR product of 556 bp, and the mutant mouse was found by observing the heteroduplex formation between the WT / mutant PCR products through the T7E1 assay, and the precisely KO mice were used in the experiment. At this time, we used the RGEN site where the extracellular loop 2 of mouse TM4SF5 begins. 29 bp including Exon 1, where amino acid 36 Threonine is present, is deleted (Tm4sf5Exon1) - / - ) was used to conduct experiments.

[0485]

[0486] 1.7. Establishment of a mouse model of non-alcoholic steatohepatitis (NASH) disease through a methionine-choline-deficient (MCD) diet.

[0487]

[0488] Normal (WT), Alb-TG Tm4sf5-Flag , andTm4sf5 - / -(Tm4sf5 gene deficiency) KO C57BL / 6N mice were housed in a pathogen-free room with well-controlled temperature and humidity. 22-week-old mice were used for experiments establishing a steatohepatitis NASH disease model. To induce steatohepatitis in the liver through MCD (TD.90262, Teklad) diet, 6-week-old male mice were randomly divided into normal chow diet (NCD, Purina, Cat # 38057) and MCD groups and allowed to eat ad libitum for 4 weeks (7 mice per group). Drug treatment was administered intraperitoneally at a concentration of 5 mg / kg twice a week. After the experiment, liver tissues were obtained and analyzed by H&E, immunohistochemistry, Western blotting, and qRT-PCR.

[0489]

[0490] 1.8. Liver cancer development model using DEN drug

[0491]

[0492] 2-week-old male wild type (WT), Alb-TG Tm4sf5-Flag [Genetically modified animals with over-regulated Tm4sf5 expression by the promoter of the albumin gene, custom-made by Macrogen Co., Ltd.], or Tm4sf5 - / -A liver cancer model was induced in KO C57BL / 6N male animals by a single intraperitoneal injection (IP) of DEN (diethylnitrosamine, Sigma-Aldrich) at a concentration of 25 mg / kg and reared for 10 months. After DEN treatment, the animals were maintained in a pathogen-free laboratory animal room with well-controlled temperature and humidity on a normal diet for 40 weeks. For the last 6 weeks, isoxazole drug (dissolved in 40% DMSO) was administered twice a week by intraperitoneal injection at the indicated concentration. Forty-six weeks after DEN injection, the animals were sacrificed, and the liver tissues were analyzed by histological staining, Western blotting, and qRT-PCR.

[0493]

[0494] 1.9. Evaluation of the anticancer efficacy of isoxazole compounds in a subcutaneous xenograft model of TM4SF5-expressing hepatocellular carcinoma cell lines.

[0495]

[0496] Cells that do not express TM4SF5 (SNU449Cp) or express TM4SF5 (SNU449T7) were cultured in a cell culture incubator at 37°C and 5% CO2. The next day, cells were detached by treating the T / E (Trypsin / EDTA) solution, and pellets were obtained by centrifugation at 150x g for 3 min. Afterwards, the supernatant was removed, and the pellets were resuspended in phosphate-buffered saline (PBS). For hepatocarcinogenesis, 10 7Cells / 100 μl were injected subcutaneously once. At this time, animals were anesthetized with 20% isoflurane and injected. Starting on the 7th day after cell injection, drugs ST-2-001, ST-3-006, and ST-3-011 were injected intraperitoneally every 3 days at 5 mg / kg body weight each for a total of 8 times. Animal body weights were measured weekly from the day of cell injection, and tumor volume was measured every 3 days starting on the 7th day after cell injection. Tumor volume was calculated by measuring the length and width of the tumor and calculating (length X width X width) / 2 (mm 3 ) was calculated. Finally, on the 31st day after cell injection, the animals were sacrificed using a standard method, and liver tissue was obtained and analyzed for liver cancer tissue.

[0497]

[0498] 1.10. Evaluation of the anticancer efficacy of isoxazole compounds in a liver-orthotopic xenograft model of TM4SF5-expressing hepatocellular carcinoma cell lines.

[0499]

[0500] Cells that do not express TM4SF5 (SNU449Cp) or cells that express TM4SF5 (SNU449T7) were cultured in a cell culture incubator at 37°C and 5% CO2. The next day, cells were treated with T / E (Trypsin / EDTA) solution to detach them, and centrifuged at 150x g for 3 min to obtain a pellet. The supernatant was then removed, leaving only the pellet. EGF was mixed with matrigel matrix (CORNING) to a final concentration of 50 ng / μl, and the cell pellet was resuspended in the mixture of EGF and matrigel to prepare the cell pellet. Then, 5x10 5A single injection of 20 μl of cells was administered. Animals were anesthetized with 20% isoflurane and injected. One week after cell injection, the drug ST-5-002 was injected intraperitoneally twice a week at 5 mg / kg. After a total of six drug injections over three weeks, animals were sacrificed four weeks after cell injection, and liver tissue was obtained for analysis.

[0501]

[0502] 1.11. Evaluation of the anticancer efficacy of isoxazole compounds in a TM4SF5-expressing PDX (liver cancer patient tissue xenograft) animal model.

[0503]

[0504] Tumor sections from patients with liver cancer confirmed to express TM4SF5 (P0; HCC cube, 1 mm) 3 ) were obtained from Seoul National University Hospital, which passed the normal IRB approval procedure (H-2102-059-1195), and the experiment was conducted. The hair from the right thigh to the flank of 6-week-old male NOD / SCID mice was removed, and the mice were anesthetized with 20% isoflurane. Then, the tumor fragments were implanted in the right armpit of the mice. When the tumor fragments took root in the animals and grew to a certain size after 4 to 5 weeks from the tissue implantation, the animals were sacrificed to obtain the tumor fragments (P1). The tumor fragments were 1 mm in size. 3 Cut to the size of , place in a cryotube with Recovery-Cell Culture Freezing Medium (Gibco) at -80 o C was stored in a liquid nitrogen tank. After obtaining P2 and P3 cancer sections using the same method as above, 1 mm of P3 cancer section was cut into pieces per 6-week-old male NOD / SCID mouse. 3 / 1 HCC-PDX mouse model was constructed using the implantation of tumor sections. Starting on the 8th day after implantation, vehicle, ST-5-001, or ST-5-002 were injected intraperitoneally twice a week at 5 mg / kg for a total of 6 times. On the 28th day after implantation, the animals were sacrificed, and liver cancer tissues were obtained and used for analysis.

[0505]

[0506] 1.12. Evaluation of the anticancer efficacy of isoxazole compounds in subcutaneous xenografts of TM4SF5-expressing hepatoma cell lines using severely immunodeficient animals.

[0507]

[0508] TM4SF5-expressing cells (SNU449T7) were cultured in a cell incubator at 37°C and 5% CO2. The next day, cells were detached by treating the T / E (Trypsin / EDTA) solution, and centrifuged at 150Xg for 3 min to obtain a cell pellet. After that, the supernatant was removed, and the pellet was resuspended in phosphate-buffered saline (PBS) for preparation. For tumor tissue generation, 5x10 5 Cells / 100 μl were injected subcutaneously once. At this time, animals were anesthetized with 20% isoflurane and injected. From the 15th day after cell injection, the drug ST-5-002 was injected intraperitoneally every 3 days at 2.5 mg / kg body weight, 100 μl per injection, for a total of 8 times. From the 12th day after cell injection, the body weight of animals and tumor volume were measured every 3 days. Tumor volume was calculated by measuring the length and width of the tumor and calculating the ratio of (length X width X width) / 2 (mm 3 ) was calculated. On the 36th day after injection of cells (SNU449T7), the animals were sacrificed and cancer tissues were obtained and analyzed.

[0509]

[0510] 1.13. Western blotting of cell and tissue extracts

[0511]

[0512] Cell extracts were obtained from cells grown to 70-80% confluency without any treatment, or from cells treated with vehicle DMSO or drugs at given concentrations for 24 hours. For extracts of hepatic epithelial cells or hepatocarcinoma cells, lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl, 0.25% sodium deoxycholate, pH 7.4) containing a protease inhibitor cocktail (GenDEPOT) was used. In addition, animal liver tissues were washed twice with PBS and then lysed in lysis buffer [50 mM Tris-HCl, pH 7.4, 1% NP40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA (per 500 ml)] containing SDS, Na3O4V, and protease inhibitor cocktails (GenDepot) at 4°C for 15 minutes. After centrifugation at 4℃, 13000 rpm for 30 minutes, only the supernatant was transferred to a new microcentrifuge tube. After quantification using BCA reagent (Thermo Scientifics), 4Х sample buffer [100% glycerol 4 ml, Tris-HCl, pH 6.8, 2.4 ml, SDS 0.8 g, Bromophenol blue 4 mg, beta-mercaptoethaol 0.4 ml, H2O 3.1 ml (based on 10 ml)] was added and boiled at 100℃ for 5 minutes. After performing SDS-PAGE electrophoresis with the above sample, Nitrocellulose Membranes Protran TMAfter transfer to nitrocellulose membrane (Whatman), pretreatment was performed with 5% skim milk for 1 hour, and after pretreatment, p-FAK (Y861) (SC-16663), p-FAK (Y577) (SC-16665), c-Src (SC-8056), STAT3 (SC-8019), p-AKT 1 / 2 / 3 (S473) (SC-7985), STAT5 (SC-835), Laminin γ2 (SC-393225), COL1A1 (SC-28657), CCL5 (RANTES) (SC-514019), CCL20 (MIP-3α) (SC-517441), SIRT1 (SC-74465), ChREBP (SC-515922), SREBP1 (SC-366513), DGAT1 (SC-271934), DGAT2 (SC-293211), MICA / B (SC-137242), SLAMF7 (SC-390840), α-tublin (SC-5286), β-actin (SC-47778), FUCA (SC-365496) (the above is Santa Cruz Biotech, USA), p-FAK(Y397) (cat # 611723), FAK (cat # 610088), p27 (cat # 610242) (BD Transduction, USA), p-FAK(Y925) (#3284) pc-Src(Y416) (#2101), p-STAT3(Y705) (#9145), p70S6K1 (#9202), p-p70S6K1(T389) (#9205), p-STAT5(Y694) (#9314), ACC (#3676), FASN (#3189), CPT1A (#12252), p-ACC(S79) (#11818), HA (#3724), PD-L1 (#13684), PD-1 (#86163), p-ERK1 / 2(T202 / Y204) (#9101s), ERK1 / 2 (#9102s) (The above is Cell Signaling Tech., USA), pS10p27(S10) (ab62364), human SLAMF6 (ab224201), TIGIT (ab233404), CD34 (ab81289) (Abcam, UK), mouse SLAMF6 (PA5-87823), NKG2D (PA5-102038) (Thermofisher, USA), α-SMA (Sigma Aldrich, A5228), CCL2 (Invitrogen, MA5-17040), and CD155(PVR) (Biolegend, 337601), HA (Biolegend, USA), Strep-HRP(horse-radish peroxidase), StrepMAB-HRP (IBA, USA), AFP (FineTest, FNab00203) were used and reacted at 4℃ for 15 hours. The next day, the secondary antibody was reacted and developed on X-ray film using ECL (Pierce, USA). Anti-TM4SF5. C-ter (epitope region of RKKQDTPH 197 ) and anti-TM4SF5 EC2 (CLMNGEWGYHFEDTAGA 130 ) was custom-made by a specialized antibody manufacturing company (Pro-Sci, Poway, CA, USA).

[0513]

[0514] 1.14. Immunofluorescence microscopy for quantitative analysis of localization changes

[0515]

[0516] A cover glass was placed in each well of a 12-well plate, and 10 μg / ml fibronectin (35600, BD Biosciences) diluted in PBS was added and coated at room temperature for 1 hour. After washing three times with PBS, 20,000 cells were seeded on each cover glass and cultured in a cell incubator at 37°C for 16 hours. After incubation, the above-mentioned various expression vectors were transfected using Lipofectamine 3000 (L3000015, Invitrogen) and cultured for 24 hours. After treatment with or without isoxazole for 24 hours, the cells were fixed with cold 99% methanol for 15 minutes at room temperature and blocked with 1% BSA in PBS for 1 hour. Primary antibodies were anti-FLAG (NB600-344, Novus Biologicals), anti-LAMP1 (#9091, Cell Signaling Tech.), anti-ZO-1 (402200, Invitrogen), anti-HA (901515, BioLegend), and anti-SLAMF7 (sc-390840, Santa Cruz Biotech.) diluted 1:500 in 1% BSA in PBS and reacted at 4°C for 16 hours. The next day, the cover glasses were washed three times with PBS, and then fluorescently conjugated secondary antibodies (Alexa Fluor 488 [goat: A11055 and mouse: A21202] and 555 [goat: A21432 and mouse: A31570] from Invitrogen) were diluted 1:500 in 1% BSA in PBS and reacted at room temperature for 1 hour. After washing three times with PBS, the cells were mounted using ProLongTM Gold Antifade (P36930, Invitrogen).Cells were randomly photographed using a Nikon Eclipse Ti microscope with a C2 confocal system, and the images were analyzed using NIS-Elements software (Nikon, Melville, NY, USA). Colocalization between SLAMF7 and LAMP1 or ZO-1 was calculated using Pearson's correlation coefficients. All images were taken under identical software settings and were identically corrected using Adobe Photoshop. Each dot in the graph represents the results measured from a single cell.

[0517]

[0518] 1.15. Cell immunoprecipitation assay

[0519]

[0520] Cells were cultured at ~60% confluency in a cell culture incubator at 37°C and 5% CO2, transfected with PEI, and cultured in a cell culture incubator at 37°C for two days. After culture, cell extracts were obtained by the above method. The desired protein was precipitated from the cell extracts using the immunoprecipitation method, and the bound proteins were identified using the Western blot technique described above. Specifically, cells cultured for two days in a 100 mm cell culture dish were washed twice with PBS, and 500 ㎕ of immunoprecipitation lysis buffer (0.5% Triton X-100 or Brij 58, 40 mM HEPES, 150 mM NaCl, 1 mM EDTA, pH 7.4) containing a protease inhibitor cocktail (protease inhibitor cocktails, GenDepot, USA) was added and treated at 4°C for 15 minutes. After collecting the cells, centrifuge them at 4℃, 12,000xg for 15 minutes, and transfer the supernatant to a new microcentrifuge tube to obtain a cell extract. The protein was quantified using BCA reagent (BCA reagent, Thermo Scientifics, USA). 4x Laemmli sample buffer was added to some of the quantified sample and boiled at 100℃ for 5 minutes to prepare an electrophoresis sample. For immunoprecipitation, Streptavidin Agarose Resin (Thermo Fisher Scientific) or Sepharose beads coated with anti-HA antibody were added in proportion to the quantified protein amount, and then rotated at 4℃ for 4 hours, centrifuged at 4℃, 7,000xg for 5 minutes, and the supernatant was discarded. Add a sufficient amount of clean lysis buffer, mix gently, then centrifuge again at 4℃, 7,000xg for 5 minutes and discard the supernatant.Repeat this process twice more with lysis buffer and twice more with cold PBS, then add 2x sample buffer and boil at 100°C for 5 minutes. Western blot was performed using the samples prepared in this way using the various primary antibodies described above. The primary antibodies used were EGFR (SC-03), CD44 (SC-7287), IL-6Rα (SC-661), MICA / B (SC-137242), SLAMF7 (SC-390840) (all Santa Cruz Biotech, USA), CD133 (#5860), mTOR (#2983), GLUT1 (#12939), GLUT4 (#2213), FLAG (#2368), PD-L1 (#13684) (Cell Signaling Technology, USA), SLAMF6 (ab224201), TIGIT (ab233404), PD-L1 (#205921) (Abcam, UK), or Integrin α5 (Merck Millipore, MAB1956Z). Afterwards, Western blot was performed by reacting with an appropriate secondary antibody solution.

[0521]

[0522] 1.16. Real-time reverse transcription-PCR (qRT-OCR)

[0523]

[0524] After disrupting the cells or tissues using Qiazol (Qiagen, USA), chloroform was added and centrifuged at 12,000xg, 4 oAfter centrifugation for 15 minutes at C, the upper organic layer was separated. Isopropanol was added to the separated organic layer to precipitate RNA, and then washed with 70% ethanol. The RNA pellet was isolated by centrifugation at 7,500 × g for 5 minutes, ethanol was evaporated for 10 minutes, and dissolved in 30 μl DEPC-water. The dissolved RNA was reverse transcribed to obtain cDNA after removing gDNA using a reverse transcription kit (Toyobo, Japan). The obtained cDNA was expressed using real-time PCR (BiRaOd, USA) using 2x Eva green master mix (Labopass, South Korea) and 0.4 μM forward / reverse primers. The expression level was calculated using the modified delta-delta Ct method of Pfaffl. The sequences of the primers for qRT-PCR are listed in Table 1.

[0525]

[0526] 1.17. H&E staining

[0527]

[0528] Paraffin blocks were finely cut, placed on slides, and fixed at 60℃ for about 20 minutes. The tissue was then soaked in xylene three times for 5 minutes each to separate it from the paraffin. Then, the tissue was placed in the order of 100%→90%→80%→70% ethanol→distilled water for 3 minutes each, and then soaked in hematoxylin solution for 5 minutes to react. After washing thoroughly with tap water, the tissue was placed in the eosin solution for about 5 minutes and washed again with tap water. After that, the slides were mounted after going through a dehydration process of soaking in the order of 70%→80%→90%→100% ethanol→xylene for 3 minutes each.

[0529]

[0530] 1.18. Masson's Trichrome staining

[0531]

[0532] Liver tissue was stained using the Trichrome Stain Kit (Connective Tissue Stain) (ab150686, Abcam, UK). The tissue was first separated from paraffin and reacted with preheated Bouin's solution for 1 hour. Then, the tissue was rinsed in tap water until the solution was completely drained, reacted with hematoxylin solution for 10 minutes, and rinsed again in tap water. After reacting with Biebrich scarlet-acid fuchsin solution for 5 minutes, the tissue was soaked in distilled water, and then reacted with phosphotungstic / phosphomolybdic acid solution for 15 minutes. The tissue was soaked in aniline blue solution for 10 minutes and 1% acetic acid for 1 minute. The tissue was dehydrated, soaked in xylene, and mounted on slides.

[0533]

[0534] 1.19. Immunohistochemistry

[0535]

[0536] After conducting experiments approved by the Institutional Review Board (IRB), animal liver tissues were stained with various primary antibodies using immunohistochemical methods. Paraffin blocks and liver sections were obtained through a service provided by Abion Inc. (Seoul, Korea) or stained directly using the standard methods described above. Antibodies were COL1A1 (SC-28657), Laminin γ2 (SC-393225), p-STAT3 (Y705) (9145), Ki67 (SC-23900), CCL20 (MIP-3α) (SC-517441), CCL5 (RANTES) (SC-514019), human / mouse SLAMF7 (CS1) (sc-390840) (all Santa Cruz Biotech, USA), ACC (#3676), FASN (#3189), F4 / 80 (#70076), PD-L1 (#13684), PD-1 (#86163), human TIGIT (#99567) (all Cell Signaling Technology, USA), human / mouse NKG2D (PA5-102038, Thermo Fisher, USA), mouse Tigit (ab233404, Abcam, UK), AFP (FineTest, FNab00203), CCL2 (Invitrogen, MA5-17040), and human TM4SF5-EC2 (Commercial product, Pro-Sci, USA) were used.

[0537]

[0538] 1.20. Flow cytometry analysis of NK92 cell line

[0539]

[0540] NK92-TM4SF5, which stably expresses TM4SF5-HA, was constructed by infecting human NK92 cell lines with a control expression vector (empty vector, EV) or a lentivirus expressing TM4SF5-HA. NK cells were isolated by centrifugation of NK92-EV and NK92-TM4SF5 cell lines in cell culture at 150 Хg for 5 min. For drug treatment, the vehicle or drug-containing medium was prepared by mixing DMSO or drugs at a given concentration in cell culture medium (α-Minimum Essential Medium (MEM) (Invitrogen, Grand Island, NY, USA) containing 200 U / mL recombinant human interleukin (IL)-2 (PeproTech, Rocky Hill, NJ, USA), 12.5% ​​FBS, and 12.5% ​​fetal horse serum (GenDEPOT Inc.). After centrifugation, the cell culture medium was removed using an aspirator, and the isolated NK cells were suspended in the vehicle or drug-containing medium, and the same number of cells were placed in each culture vessel to start normal culture.

[0541] After 24 hours of drug treatment, NK cells were separated by centrifugation at 150Xg for 5 min. The supernatant was removed and washed twice with PBS. 1x10 NK cells from each experimental group were isolated. 6 Cells were obtained and stained with SLAMF7 antibody (PE / Cyanine7 anti-human CD319, Cat: 331816) conjugated with fluorescent dye PE-Cy7 for 20 min at room temperature in a darkroom. MACSQuant Analyzer10 (Miltenyi Biotec) was used to confirm changes in SLAMF7 expression when NK92-EV or NK92-TM4SF5 cells were treated with DMSO or drugs.

[0542]

[0543] 1.21. Evaluation of the natural killing efficacy of NK cells

[0544]

[0545] When human hepatoma Huh7 cells were 60-70% confluent in the culture dish, the Cas9 gene was introduced into the cells using pSpCas9(BB)-2A-Puro (PX459) V2.0 (Plasmid #62988, Addgene) and polyethylenimine (408727, Sigma-Aldrich). 5'-GGGCCACTAGGGACAGGAT-3' was used as the control gRNA sequence for AAVS1 (adeno-associated virus integration site 1), and 5'-TCCGGGGATTGCAGCCGTT-3' (#1), 5'-ATTGCAGCCGTTCGGGCAG-3' (#2), and 5'-GATTGCAGCCGTTCGGGCA-3' (#3) were used as the gRNA sequence for TM4SF5 (exon 2) to knockout (KO) the TM4SF5 gene. After 24 hours, the KO cells were selected by treating the cell culture medium with puromycin at a concentration of 2 μg / ml for 3 days. Then, stable cell lines were established by infecting Huh7KO cells in which the TM4SF5 gene was KO with retroviruses that induce the expression of pBabe-HA-EV or pBabe-HA-TM4SF5. After that, Huh7KO-EV cells or Huh7KO-TM4SF5 cells (target cells, T) were suspended in 50 μl of 1% FBS DMEM, and NK92-EV or NK92-TM4SF5 cells (effector cells, E) were suspended in 1% FBS in MEM-α to adjust the cell number (0.015625 x 10 5 , 0.03125 x 10 5 , 0.0625 x 10 5 , and 0.125 x 10 5cells / mL) E:T ratios of 1.25:1, 2.5:1, 5:1, and 10:1 were mixed in triplicate in a 96-well plate and cultured for 16 hours at 37°C and 5% CO2. After that, the lactate dehydrogenase (LDH) cytotoxicity assay kit (Cytotoxicity Detection Kit Plus, Roche) was used to evaluate the natural killing efficacy of NK cells. The LDH activity level was measured at wavelengths of 492 and 690 nm using a microplate reader (spectramax i3x, molecular device). The killing efficacy value was calculated as follows according to the manufacturer's instructions: [LDH (effector-target cell mix) LDH (effector cell) LDH (target cell low control)] / [LDH (target cell high control) LDH (target cell low control)] × 100.

[0546]

[0547] 1.22. Adoptive transfer model

[0548]

[0549] Severely immunodeficient NOD-SCID mice (NOD.CB17-Prkdcscid / J, Orient Bio Inc., Seongnam-si, Korea) were used for adoptive transfer with NK92 cells. 5 Х 10 mice were used at 6 weeks of age. 5 SNU449T7 cells were injected subcutaneously. 7 days after SNU449T7 cell injection, NK92-EV cells and NK92-TM4SF5 cells were injected at a dose of 5 X 10 6NK cells were injected into the tail vein. NK cells were injected once a week for a total of five times, and tumor size was measured every three days. NK92 cells were injected five times, and the mice were sacrificed one day later, and liver tissue was analyzed by immunohistochemical staining.

[0550]

[0551] 1.23. Binding analysis of radioisotope-labeled cholesterol and isoxazole ST-5-002 to TM4SF5 or PD-L1

[0552]

[0553] Strep-EV, Strep-TM4SF1, TM4SF5, or mutants of TM4SF5 were transfected into SNU761 cells and HEK293FT cells that do not express TM4SF5, or Strep-PD-L1 or mutants of PD-L1 were transfected into Huh7 cells. Huh7 KO Stable cell lines were established by infecting cells with retroviruses that induce expression of pBabe-HA-EV or pBabe-HA-TM4SF5. Cell extracts were prepared, and Strep-PD-L1 or Sterp-TM4SF5 was pulled down by reacting anti-HA antibody and HA-tagged TM4SF5 or streptavidin agarose resin at 4°C for 2 hours in the extracts containing 0.2 or 0.25 mg of protein, and then cold ST-5-002 (400 μM) was present or absent. 14 After treatment with C-labeled ST-5-002 (10 or 25 μM) and incubation at 4°C for 1 hour, the radioisotope value was repeatedly measured using a TriCarb scintillation counter (PerkinElmer, Waltham, MA).

[0554] Transfecting HEK293FT cells with Strep-EV or Sterp-TM4SF5 expression vectors or Huh7 cells stably expressing pBabe-HA-EV or pBabe-HA-TM4SF5 KO After culturing the cells, cell extracts were obtained, and each extract containing 1 mg of protein was subjected to pulldown by reacting Strep-tagged TM4SF5 with streptavidin agarose resin or HA-tagged TM4SF5 with anti-HA antibody at 4°C for 4 hours. The pulled-down proteins were 14 C-labeled ST-5-002 was treated at various concentrations (10 nM, 100 nM, 1 μM, 5 μM, 10 μM, 50 μM) and reacted at 4°C for 1 hour. The radioisotope values ​​were repeatedly measured using a TriCarb scintillation counter (PerkinElmer, Waltham, MA). The EC was normalized by dividing the average value of the radioisotope of TM4SF5 obtained through the measurement by the average value of EV. 50 was calculated.

[0555]

[0556] 1.24. Cell immunofluorescence microscopy

[0557]

[0558] SNU449-TM4SF5 cells overexpressing TM4SF5 were seeded on cover glasses pre-coated with collagen Type I (10 μg / ml), and after 15 h, PD-L1-HA cDNA was transfected using transfectamine 3000 (Thermo Fisher). SNU761-HA-EV or SNU761-HA-TM4SF5 cells were transfected with FLAG-SLAMF7 wildtype, N-glycosylated amino acid mutants (1NQ; N204Q, or 3NQ; N172 / 176 / 204Q), or deletion mutants (△ECD). 1-225 ; A mutant with the extracellular region of amino acids 1-225 removed, △TM 226-247 : cDNA was transfected with a mutant that deleted amino acids 226-247 that penetrate the cell membrane. After one to two days, DMSO, ST-5-001, or ST-5-002 were treated at 2.5 μM for 24 hours. Cells were fixed with cold methanol for 10 minutes and permeabilized with 0.5% Triton X-100 for 10 minutes at room temperature. After washing twice with cold PBS, they were incubated with primary antibody (TM4SF5) and DAPI treatment. EC2, After reacting with primary antibodies (PD-L1, LAMP1, or SLAMF7 antibodies) for 15 hours at 4°C, the cells were washed three times with PBS. After reacting with secondary antibodies (TRITC fluorescence for LAMP1, TRITC or Alexa Fluor® 488 fluorescence for TM4SF5, FITC fluorescence for PD-L1 or SLAMF7) for 30 minutes at room temperature, the expression level and location of fluorescently stained factors and their colocalization (indicated in yellow) were observed using a confocal fluorescence microscope.

[0559]

[0560] Experimental Example 2. Experimental Results

[0561]

[0562] 2.1. Confirmation of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation by isoxazole compounds (Figure 2)

[0563]

[0564] Cell extracts were obtained before and after treatment of cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) with ST-1-024 or ST-1-025 at given concentrations for 24 hours, and Western blot was performed on various signaling factors whose phosphorylation and activity are increased in a TM4SF5 expression-dependent manner.

[0565] As a result, compared to (ab) SNU449Cp, phosphorylation of FAK, c-Src, STAT3, and p27 in SNU449T7 cells was increased, but it was confirmed that these were decreased when treated with the drug ST-1-025, similar to the positive control [4-(p-toluenesulfonyl- amido)-4-hydroxychalcone, 4'-(p-toluenesulfonylamino)-4-hydroxychalcone TM4SF5-specific inhibitor and chalcone-based positive control drug] TSAHC [see Korean Patent Document No. 10-0934706].

[0566] Therefore, the potential of isoxazole compounds as TM4SF5-specific inhibitors was confirmed by demonstrating some efficacy in inhibiting the phosphorylation of TM4SF5 expression-dependent signaling factors.

[0567]

[0568] 2.2. Confirmation of TM4SF5-expression-dependent inhibition of two-dimensional and three-dimensional cell growth / proliferation by isoxazole compounds (Fig. 3)

[0569]

[0570] The same number of cells that do not express TM4SF5 (SNU449Cp) and express TM4SF5 (SNU449T7) were cultured two-dimensionally in a normal cell culture dish or in a three-dimensional culture medium, and the changes in the number of cells or the degree of sphere proliferation were observed using an optical microscope. Drugs were treated with a positive control drug, TSAHC, or the ST-1-025 isoxazole compound at a given concentration. From the start of the culture (day 0), (Fig. 3a) in the case of the two-dimensional culture, the number of cells was measured after drug treatment every 24 hours, or (Fig. 3b) in the three-dimensional environment, after treating the drug once at the start of the culture, the proliferation of cells (spheres) was observed and photographed using an optical microscope on days 5 and 7. Meanwhile, (Fig. 3c) in the three-dimensional environment, the degree of sphere proliferation was observed using an optical microscope on day 7 after repeated drug treatment on days 0, 3, and 6.

[0571] As a result, (a) when SNU449T7 cells grown in a two-dimensional environment were treated with the drug ST-1-025, growth or proliferation was confirmed to be inhibited like the positive control drug TSAHC. It was confirmed that there was no significant difference when SNU449Cp was treated with the drug. (b) When cells under a three-dimensional culture environment were treated with the drugs once at 5 μM at the start of culture and the degree of sphere proliferation was observed on days 5 and 7, it was confirmed that TSAHC and ST-1-025 slightly inhibited the degree of SNU449T7 proliferation. It was confirmed that SNU449Cp did not form a sphere shape. (c) When cells under a three-dimensional culture environment were treated repeatedly with drugs at given concentrations on days 0, 5, and 6, and the degree of sphere proliferation was observed on day 7, it was confirmed that ST-1-025 slightly inhibited the degree of SNU449T7 proliferation in a concentration-dependent manner, although the effect was less than that of TSAHC. It was confirmed that SNU449Cp did not form a sphere shape.

[0572] Therefore, the potential of isoxazole compounds as TM4SF5-specific inhibitors was confirmed by their weak efficacy in inhibiting TM4SF5 expression-dependent two- and three-dimensional cell and sphere survival / proliferation. However, it also suggests the need for structure-activity relationship (SAR) studies to identify compounds with higher TM4SF5-specific efficacy.

[0573]

[0574] 2.3. Confirmation of inhibition of TM4SF5 binding to various cell membrane receptors by treatment with isoxazole compounds (Figure 4)

[0575]

[0576] SNU449 hepatic epithelial cells stably transfected with a control expression vector (empty vector, EV) or TM4SF5 expression vector (TM) were treated with vehicle (DMSO) or ST-1-025 drug at 3 μM for 24 hours in a normal culture medium containing serum. Cell extracts were obtained, pulled down with Streptavidin agarose resin (Thermo, XA335631), and Western blotting was performed using the given antibodies.

[0577] As a result, compared to the SNU449 control cell group that does not express TM4SF5, cells expressing TM4SF5 bound to EGFR, CD44, and GLUT4. Compared to vehicle treatment, treatment with the drug ST-1-025 slightly inhibited the binding of TM4SF5 to EGFR, CD44, and GLUT4.

[0578] Therefore, the weak inhibition of the binding ability of TM4SF5 to membrane receptors important for cell survival / proliferation and metastatic ability was shown, suggesting that structure-activity relationship (SAR) studies toward compounds with higher TM4SF5-specific efficacy are necessary to increase the potential of isoxazole compounds as TM4SF5-specific inhibitors.

[0579]

[0580] 2.4. Confirmation of inhibition of TM4SF5-dependent signal transduction factor phosphorylation and three-dimensional sphere proliferation by isoxazole compounds (Fig. 5)

[0581]

[0582] (a) Cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) were treated with vehicle (DMSO), TSAHC, or isoxazole compounds ST-2-001, ST-2-002, ST-2-003, ST-2-004, ST-2-005, ST-2-006, ST-2-007, ST-2-008, ST-2-009, ST-2-010, or ST-2-011 at 5 μM for 24 h, and then cell extracts were collected. Western blotting was performed on signal transduction factors whose phosphorylation and activity increased in a TM4SF5 expression-dependent manner using these extracts. (b) The proliferation of spheres was observed using an optical microscope while 3D culturing cells that do not express TM4SF5 (SNU449Cp) or cells that express TM4SF5 (SNU449T7) in the same number in a normal cell culture dish. On days 0 and 3 of culturing, DMSO (vehicle), TSAHC, or the drug ST-2-001 were treated at a concentration of 2.5 μM, and on day 6, the proliferation of cells (spheres) was observed using an optical microscope. (c) (After treating SNU449Cp cells and SNU449T7 cells with DMSO (vehicle), TSAHC as a positive control, or ST-2-001 drug at a given concentration (24 hours), cell extracts were obtained, and then Western blotting was performed.

[0583] As a result, (a) compared to SNU449Cp, the phosphorylation of FAK, c-Src, STAT3, and p27 increased in SNU449T7 cells, but when treated with the drug ST-2-001, the phosphorylation of these signaling factors decreased to a similar degree as when treated with TSAHC, the positive control. (b) In the case of SNU449Cp, it was confirmed that the cells did not form a sphere shape. However, in the case of SNU449T7, it was confirmed that when treated with the drug ST-2-001, cell proliferation was inhibited similarly to when treated with TSAHC compared to the control group. (c) Compared to SNU449Cp, the phosphorylation of FAK, c-Src, STAT3, p27, S6K1, and AKT increased in SNU449T7 cells, but when treated with TSAHC or ST-2-001, the phosphorylation of these cells decreased in a drug concentration-dependent manner. Through this, it was confirmed that the drug ST-2-001 has the effect of inhibiting the phosphorylation of various signal transduction factors that increase in a dependent manner on TM4SF5 expression, similar to TSAHC.

[0584] Therefore, when additional isoxazole compounds that underwent SAR were analyzed in terms of their efficacy in inhibiting phosphorylation of TM4SF5 expression-dependent signaling factors and three-dimensional cell survival / proliferation, the drug ST-2-001 showed an inhibitory efficacy similar to that of the chalcone-based TM4SF5-specific inhibitor TSAHC, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors.

[0585]

[0586] 2.5. Confirmation of inhibition of TM4SF5 binding to various cell membrane receptors and signaling factors by treatment with isoxazole compounds (Figure 6)

[0587]

[0588] SNU449 hepatic epithelial cells stably transfected with the empty vector (EV) or the TM4SF5 expression vector (TM) were treated with vehicle (DMSO) or the drug ST-2-001 at 5 μM for 24 hours in a normal culture medium containing serum. Cell extracts were obtained, and pulldown was performed with Streptavidin agarose resin (Thermo, XA335631). Western blotting for various membrane receptors was performed using the given antibodies.

[0589] As a result, compared to the SNU449 control cell group that does not express TM4SF5, cells expressing TM4SF5 bound to EGFR, integrin α5, CD133, CD44, mTOR, IL-6Rα, GLUT1, and GLUT4. However, compared to vehicle treatment, treatment with the drug ST-2-001 inhibited the binding of TM4SF5 to these factors.

[0590] Therefore, when additional isoxazole compounds that underwent SAR were analyzed in terms of their efficacy in inhibiting the binding of TM4SF5 to membrane receptors and signaling factors important for cell survival / proliferation / migration, the drug ST-2-001 showed a similar efficacy in inhibiting protein-protein binding to the chalcone-based TM4SF5-specific inhibitor TSAHC, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors.

[0591]

[0592] 2.6. Confirmation of TM4SF5-expression-dependent cell migration inhibition by isoxazole compounds (Figure 7)

[0593]

[0594] SNU449-EV cells, which were injected with a control vector (EV) that did not express TM4SF5, and SNU449-TM4SF5 cells, which were stably injected with the TM4SF5 expression vector, were seeded at 40% confluence in an 8-chamber plate pre-coated with collagen type 1 (10 μg / ml). Three hours after seeding in a normal culture medium containing serum, the cells were treated once with DMSO and the drug ST-2-001 at concentrations of 2.5, 5.0, or 10.0 μM. After drug treatment, the positions of the same cells were repeatedly photographed under a microscope every 20 minutes for 17 hours, and analysis was performed to track the distance and path of cell movement (cellular trafficking). The original position of each cell was moved to the origin of concentric circles, and the migration path (track) of each cell was indicated with a different colored line.

[0595] As a result, cell migration was significantly increased in SNU449-TM4SF5 cells treated with DMSO vehicle compared to SNU449-EV. Meanwhile, cell migration of SNU449-EV cells was not changed by treatment with the drug ST-2-001, but in SNU449-TM4SF5 cells, cell migration was confirmed to decrease in a concentration-dependent manner depending on the treatment with ST-2-001.

[0596] Therefore, when additional isoxazole compounds that underwent SAR were analyzed in terms of their efficacy in inhibiting TM4SF5 expression-dependent cell migration, the drug ST-2-001 showed a concentration-dependent inhibitory efficacy, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors.

[0597]

[0598] 2.7. Confirmation of TM4SF5-expression-dependent NASH-induced inhibition of isoxazole compounds (Figure 8)

[0599]

[0600] Twenty-two-week-old normal C57BL / 6 mice were randomly divided into two groups: a normal chow diet (NCD) group and a non-alcoholic steatohepatitis (NASH)-inducing Methionine-Choline Deficient (MCD) diet group (n = 3–6 per group) and allowed to eat ad libitum for 4 weeks. Simultaneously, the animals were treated twice a week with vehicle (DMSO) or ST-2-001 at a concentration of 5 mg / kg via intraperitoneal injection (IP). After 4 weeks, liver tissues were obtained and Masson's Trichrome staining, which shows the accumulation of collagen I in the liver tissue (the degree of fibrosis), and immunohistochemistry was performed using antibodies to the given factors. The stained liver tissue sections were randomly scanned using a digital slide scanner (MoticEasyScan, Motic, British Columbia, Canada) to obtain representative images. Additionally, tissue extracts were obtained from some liver tissues, and Western blot or qRT-PCR was performed for given factors to determine the mRNA and protein expression levels and phosphorylation levels of signaling factors related to the induction of NASH-fibrosis symptoms and regulation of T or NK cell activity. Meanwhile, in addition to the animal model, we also sought to determine whether the expression of TM4SF5, laminin γ2, and AFP were interrelated at the level of hepatic epithelial cells and regulated by the TM4SF5-specific inhibitor isoxazole compound. Among hepatic epithelial cells, SNU449-EV and Huh7-KO (cells in which TM4SF5 expression was knocked out) that do not express TM4SF5, and SNU449-TM4SF5 and Huh7-Con cells that express TM4SF5 were cultured in a normal cell culture environment with DMSO or ST-5-002 for 2.After treatment with 5 μM for 24 hours, qRT-PCR was performed or cell extracts were obtained and Western blots were performed with the given antibodies.

[0601] As a result, (a) no abnormalities in liver tissue were found in animals fed NCD, and NASH did not develop, and treatment with DMSO and the drug ST-2-001 had no effect on liver tissue or the expression of stained factors. Masson's Trichrome staining showing liver tissue morphology and collagen accumulation, expression of collagen I α1 (COL1A1) or laminin γ2 (LAMC2), Acetyl-CoA Carboxylase (ACC), Fatty Acid Synthase (FASN), phosphorylation of STAT3, and F4 / 80 staining indicating the activity and distribution of macrophages did not change. However, compared to the NCD control group, the MCD diet-treated group showed fibrosis symptoms with aggravated accumulation of Collagen I, and the expression of collagen I or laminin γ2, Acetyl-CoA Carboxylase (ACC), Fatty Acid Synthase (FASN), phosphorylation of STAT3, and F4 / 80 staining were significantly more severe, indicating that the MCD diet clearly induces steatohepatitis (NASH) and liver fibrosis. It was confirmed that these NASH-fibrosis symptoms were clearly suppressed by treatment with the drug ST-2-001. (b) As a result of obtaining liver tissue extracts and performing Western blotting, the expression of alpha-smooth muscle actin (α-Sma), an important marker for fibrosis, alpha-fetoprotein (Afp), a well-known clinical biomarker of liver cancer, and Programmed death-ligand 1 (Pd-11), known to suppress the activity of immune cells such as T cells and NK cells, was increased in animals treated with the MCD diet compared to the NCD. In the case of NCD, treatment with the drug ST-2-001 slightly decreased the expression of those factors compared to DMSO treatment.Meanwhile, in cases where NASH-fibrosis was induced by MCD diet treatment and many factors were significantly improved, α-Sma, Afp, and Pd-11 were reduced by drug ST-2-001 treatment. (c) When the expression and levels of fibrosis-related factors (collagen I α1, laminin γ2, and α-SMA expression, and STAT3 phosphorylation), lipogenesis and steatosis-related factors [SIRT1 (Sirtuin 1), FASN, chREBP (Carbohydrate response element binding protein), SREBP1 (Sterol regulatory element-binding protein 1), DGAT2 (Diacylglycerol O-Acyltransferase 2), DGAT1 (Diacylglycerol O-Acyltransferase 1), ACC (Acetyl-CoA carboxylase), and ACC phosphorylation], and inflammation-related cytokines / chemokines CCL2 (CC Motif Chemokine Ligand 2), CCL5, and CCL20 were confirmed using liver tissue extracts, they were increased in MCD compared to NCD, and this increase was reduced and inhibited by treatment with the drug ST-2-001. However, CPT1 (carnitine palmitoyltransferase 1), a factor related to lipolysis, was rather increased by drug treatment in the case of the MCD diet, showing that it could suppress fat accumulation. (d) qRT-PCR was performed using liver tissue. The mRNA levels of lipogenesis (Acc, Dgat2, Fasn) and activation of Kupffer cells, which are macrophages in the liver tissue (Trem2, Tim4, Clec4f) were increased in the MCD compared to the NCD, and these increases were suppressed by treatment with the drug ST-2-001. (eg) SNU449-EV or SNU449-TM4SF5 cells treated with vehicle or ST-2-001 2.After treatment with 5 μM for 24 h, qRT-PCR was performed. The mRNA levels of inflammation-related cytokines / chemokines, C-X-C motif chemokine ligands (CXCL1, CXCL2, CXCL3, CXCL5, CXCL6, CXCL10), C-C motif chemokine ligands (CCL20, CCL2, CCL5), tumor necrosis factor alpha (TNF-α), interleukin-8 (IL-8), liver fibrosis (Lmac2, Col1A1), and T cell or NK cell natural killer activation-related factors (VCAM1, AFP, PD-L1, TIGIT, MICA, MICB, CADM1, ULBP1), were enhanced in SNU449-TM4SF5 cells compared to SNU449-EV cells, and these were suppressed by treatment with the drug ST-2-001. (hi) Meanwhile, in an in vitro cell line model, the mRNA and protein expression of laminin γ2 and AFP (α-fetoprotein) were higher in cells expressing TM4SF5 compared to hepatic epithelial cells that did not express TM4SF5. At the protein level, in addition to laminin γ2 and AFP, which are known to be biomarkers of liver cancer or are highly expressed in liver cancer, the phosphorylation of STAT3 and the expression of FUCA (Alpha-L-Fucosidase 1) and CD34 were also high. However, it was confirmed that the expression of these increased factors was suppressed by treatment with ST-5-002.

[0602] Therefore, when additional isoxazole compounds that underwent SAR were analyzed in terms of their efficacy in inhibiting the induction of NASH disease induced by the MCD diet, which is dependent on TM4SF5 expression, the drug ST-2-001 showed that NASH-related activities and phenotypes were suppressed, confirming the potential of isoxazole compounds as NASH inhibitors or anti-hepatic agents as TM4SF5-specific inhibitors. In addition, laminin γ2 and AFP are increased in expression by TM4SF5 even in the precancerous stage of NASH-fibrosis disease, which is a previous stage of liver cancer, and this can be inhibited by treatment with the TM4SF5-specific inhibitor isoxazole. Therefore, it is presumed that the efficacy of these isoxazole compounds can suppress and regulate the metastasis and progression of NASH-fibrosis liver disease to liver cancer.

[0603]

[0604] 2.8. Confirmation of inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation by isoxazole compounds (Figure 9)

[0605]

[0606] (a) Cell extracts were obtained after treating cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) with vehicle (DMSO), ST-2-001, or ST-2-001-based derivatives at a concentration of 5 μM for 24 h. (b) Cell extracts were obtained after treating SNU449Cp and SNU449T7 with DMSO, ST-2-001, ST-3-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011 at a concentration of 5 μM for 24 h. (c) Cell extracts were obtained after treating SNU449Cp and SNU449T7 with DMSO, ST-2-001, ST-3-006, and ST-3-011 at the given concentrations for 24 h. (ac) After drug treatment, Western blot was performed on cell extracts for signal transduction factors whose phosphorylation and activity increased in a TM4SF5 expression-dependent manner.

[0607] As a result, compared to (ab) SNU449Cp, phosphorylation of FAK, c-Src, STAT3, p27, S6K1, AKT, and STAT5 increased in SNU449T7 cells, but decreased when treated with drugs ST-2-001 and ST-3-01~012. In particular, when SNU449T7 cells expressing TM4SF5 were treated with drugs ST-3-006, ST-3-007, ST-3-010, or ST-3-011, similar to ST-2-001, phosphorylation of various signaling factors was decreased, as indicated by the red box. However, in SNU449Cp cells that do not express TM4SF5, phosphorylation of some signaling factors indicated by the blue box was increased. (c) Compared to SNU449Cp, phosphorylation of FAK, c-Src, STAT3, p27, S6K1, and AKT was increased in SNU449T7 cells, but these levels were dose-dependently decreased by drug treatment [ST-2-001, ST-3-006, and ST-3-011]. Similarly, increased phosphorylation of some signal transduction factors was observed in SNU449Cp cells that do not express TM4SF5.

[0608] Therefore, when isoxazole compounds (ST-3-00X) that underwent additional SAR to improve the properties of isoxazole were analyzed in terms of their efficacy in inhibiting the phosphorylation of TM4SF5 expression-dependent signal transduction factors, drugs ST-3-006, ST-3-007, ST-3-010, and ST-3-011 showed inhibitory efficacy similar to that of ST-2-001, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors. However, they showed a tendency to enhance the phosphorylation of some factors (indicated by the blue box) in cells that do not express TM4SF5.

[0609]

[0610] 2.9. Confirmation of TM4SF5-expression-dependent three-dimensional cell growth / proliferation inhibition by isoxazole compounds (Figure 10)

[0611]

[0612] The proliferation of spheres was observed using an optical microscope while 3D culturing cells that do not express TM4SF5 (SNU449Cp) or express TM4SF5 (SNU449T7) in the same number in a normal cell culture dish. (a) On days 0 and 3 of culture, DMSO (vehicle) or drugs ST-2-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011 were treated at a concentration of 0.5 or 2.5 μM, and on day 6, cell (sphere) proliferation was observed using an optical microscope. (b) On day 0, DMSO (vehicle) or drugs were treated at a concentration of 0.5 or 2.5 μM, and on days 3 and 6 of culture, cell (sphere) proliferation was observed using an optical microscope on day 10. (c) After the start of culture (day 0) and on the 3rd and 6th days of culture, DMSO (vehicle) or drugs ST-3-006, ST-3-010, or ST-3-011 were treated at a concentration of 0.1 or 1.0 μM, and on the 10th day, cell (sphere) proliferation was observed using an optical microscope.

[0613] As a result, (a, b) SNU449Cp did not form a sphere shape, but SNU449T7 showed clear sphere proliferation. However, when treated with drugs ST-2-001, ST-3-006, ST-3-007, ST-3-010, or ST-3-011, the degree of three-dimensional cell proliferation was suppressed compared to the vehicle-treated group. Among them, the cell proliferation inhibitory effect of drugs ST-2-001, ST-3-006, and ST-3-010 was confirmed to be strong. (c) SNU449T7 had a superior sphere-forming ability compared to SNU449Cp, but the degree of three-dimensional cell proliferation was reduced by treatment with drugs ST-3-006, ST-3-010, and ST-3-011.

[0614] Therefore, when isoxazole compounds (ST-3-00X) that underwent additional SAR to improve the pharmacological properties of ST-2-001 isoxazole were analyzed in terms of their efficacy in inhibiting TM4SF5 expression-dependent three-dimensional cell survival / proliferation, drugs ST-3-006, ST-3-007, ST-3-010, and ST-3-011 showed inhibitory effects similar to those of ST-2-001, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors to inhibit cancer metastasis.

[0615]

[0616] 2.10. Confirmation of inhibition of TM4SF5-expression-dependent xenograft hepatocarcinogenesis by isoxazole compounds (Fig. 11)

[0617]

[0618] Eight-week-old male BALB / c-Nude mice (n=8, Orient, Seongnam, South Korea) were allowed free access to a normal diet and were injected with 10 cells per mouse that did not express TM4SF5 (SNU449Cp) and expressed TM4SF5 (SNU449T7). 7The number of cells was injected subcutaneously once. Starting on the 7th day after cell injection, the drug ST-2-001, ST-3-006, or ST-3-011 was injected intraperitoneally every 3 days at a dose of 5 mg / kg body weight, for a total of 8 injections. Body weight and tumor volume were measured weekly, and on the 31st day after cell injection, the animals were anesthetized using a standard method, and liver tissue was obtained and photographed to determine the size of the liver cancer tissue. Afterwards, the tissue was randomly divided into several sets and analyzed by tissue immunostaining, Western blotting, and qRT-PCR.

[0619] As a result, (a) Schematic diagram of the subcutaneous xenograft experiment method of TM4SF5 non-expressing and expressing cell lines. (b) After the experiment, when the images of the recovered cancer tissues were checked, it was confirmed that ST-2-001 had the greatest effect of inhibiting liver cancer development compared to the tumor tissues of the vehicle-injected control group, and the inhibitory effects of ST-3-006 and ST-3-011 were relatively less than those of ST-2-001. (c) The body weight and tumor volume measured weekly while the drugs were injected intraperitoneally every 3 days after subcutaneous cell injection are shown. It was confirmed that the tumor volume was inhibited statistically significantly when each drug was injected compared to the vehicle. (d) Three days after the last drug injection, some tissue extracts were obtained from liver cancer tissues, and Western blotting was performed to measure the phosphorylation of signaling factors related to tumor formation (FAK, STAT3, c-Src, Akt) and TM4SF5-related factor (p27). It was confirmed that the phosphorylation of each factor was significantly suppressed in the case of drug injection compared to the vehicle-treated control group. (e) It was confirmed that the expression of factors related to fibrosis (collagen I, laminin γ2, α-SMA, STAT3 phosphorylation), inflammation-related cytokines / chemokines (CCL2, CCL5, or CCL20), and AFP as a liver cancer biomarker was decreased in the case of drug treatment compared to the vehicle.

[0620] Therefore, when isoxazole compounds ST-3-006 and ST-3-011, which underwent additional SAR to improve the properties of isoxazole, were compared with ST-2-001 to analyze their efficacy in inhibiting hepatocarcinogenesis by subcutaneous xenograft injection of TM4SF5 expression-dependent hepatocarcinoma cell lines, the drugs ST-3-006 and ST-3-011 showed the same inhibitory effect on hepatocarcinogenesis as ST-2-001, confirming the potential of isoxazole compounds as anti-hepatocarcinogenic inhibitors as TM4SF5-specific inhibitors.

[0621]

[0622] 2.11. Confirmation of the inhibition of TM4SF5-expression-dependent signal transduction factor phosphorylation and three-dimensional cell growth / proliferation by isoxazole compounds (Figure 12)

[0623]

[0624] Cell extracts were collected before and after treatment of cells that do not express TM4SF5 (SNU449Cp) and cells that express TM4SF5 (SNU449T7) with ST-2-001, ST-4-005, ST-5-001, or ST-5-002 at given concentrations for 24 hours, and Western blotting was performed on various signaling factors whose phosphorylation and activity are increased in a TM4SF5 expression-dependent manner. Meanwhile, the same number of SNU449Cp and SNU449T7 cells were cultured in a three-dimensional culture medium environment and treated with vehicle or the above drugs at given concentrations on days 0, 3, 6, and 9, and the survival and proliferation of spheres were observed under a light microscope on day 10.

[0625] As a result, (a) compared to vehicle-treated SNU449Cp cells, phosphorylation of FAK, STAT3, c-Src, S6K1, Akt, and p27 increased in vehicle-treated SNU449T7 cells. However, these increases were confirmed to be inhibited in many cases, including STAT3, S6K1, and FAK, by several drugs, including ST-2-001 and ST-4-005. (bc) When sphere survival / proliferation in a three-dimensional culture medium environment was confirmed, sphere formation did not occur in SNU449Cp cells, but in SNU449T7 cells, survival / proliferation was confirmed to be inhibited by treatment with drugs ST-2-001, ST-4-005, ST-5-001, or ST-5-002. (d) Compared to vehicle-treated SNU449Cp cells, phosphorylation of FAK, STAT3, c-Src, S6K1, Akt, and p27 increased in vehicle-treated SNU449T7 cells. However, these increases were confirmed to be inhibited by treatment with various drugs, including ST-2-001, ST-4-005, ST-5-001, or ST-5-002. In particular, in the case of ST-5-002, when a drug with improved purity was treated in the same manner, the phosphorylation inhibition effect was maintained and even improved.

[0626] Therefore, when isoxazole compounds ST-4-001 to ST-4-007, which underwent additional SAR to improve the physical properties of isoxazole ST-3-006 and ST-3-011 into solid form, were compared with ST-2-001 to analyze their efficacy in inhibiting signal transduction factor phosphorylation and three-dimensional cell survival / proliferation of TM4SF5 expression-dependent hepatoma cell lines, the drug ST-4-005 showed an inhibitory effect similar to that of ST-2-001, confirming the potential of isoxazole compounds as TM4SF5-specific inhibitors.

[0627]

[0628] 2.12. Confirmation of decreased expression of ligands related to the natural killing function of NK cells dependent on TM4SF5 expression by isoxazole compounds and inhibition of binding to TM4SF5 (Fig. 13)

[0629]

[0630] (ad) SNU449 or SNU761 cells, which do not originally (endogenously) express TM4SF5, were transfected with a control expression vector (empty vector, EV) or TM4SF5 vector to transiently or stably express them, and the same number of cells were prepared in culture dishes. After 24 hours, the cells were treated with the vehicle DMSO, drug ST-1-025, or ST-5-002 at the given concentrations. After drug treatment for 16 hours (overnight, O / N) or 24 hours, cell extracts were collected and subjected to Western blotting. (e) In the case of mouse xenograft experiments, liver tissues were obtained after treatment with DMSO or ST-5-002, and tissue extracts were collected and subjected to Western blotting. (f) After NK92-EV or NK92-TM4SF5 cells were treated with DMSO or drugs ST-2-001 (1 nM), ST-3-005 (10 nM or 1 μM), ST-5-001, or ST-5-002 (100 nM or 1 μM) for 24 hours, the expression of SLAMF7 expressed on the cell surface was analyzed through immunostaining using flow cytometry. The level of SLAMF7 expression was confirmed by adding SLAMF7 antibody to bind to SLAMF7, and then measuring the fluorescence linked to the SLAMF7 antibody using flow cytometry. (gj) After immunostaining of SNU761-EV or SNU761-TM4SF5 cells, co-localization (yellow stain) of TM4SF5 (red fluorescence) and SLAMF7 (green fluorescence) on the cell membrane was confirmed through fluorescence microscopy analysis (g). Another set of cells was left untreated (hi), treated with DMSO or ST-5-001 (2.After treating with 5 μM) for 24 hours (j), cell extracts were obtained, and Strep-TM4SF5 present in the extracts was pulled down with Streptavidin agarose resin (Thermo, XA335631). Then, Western blotting was performed using antibodies to coexisting SLAMF7, SLAMF6, MICA, MICB, or CD155 (a protein interacting with TIGIT), confirming that the binding of TM4SF5 to them was inhibited by isoxazole treatment.

[0631] As a result, (a) in SNU449-TM4SF5 cells expressing TM4SF5, compared to SNU449-EV cells that do not express TM4SF5, the expression of MICA / B, SLAMF6, and SMAMF7, which are stimulatory ligands that activate the natural killing ability of NK cells, was decreased. (c) Unlike in SNU449-EV cells, in SNU449-TM4SF5 cells, when treated with the drug ST-1-025 at a given concentration for 24 hours, the expression of the stimulatory ligands was increased again compared to when the expression was decreased due to non-treatment with the drug. (d) In SNU761-TM4SF5 cells, the expression of SLAMF7 was also decreased when treated with vehicle compared to SNU761-EV cells. However, when treated with the drug ST-5-002, the expression of SLAMF7 was reduced in SNU761-EV cells, but in the case of SNU761-TM4SF5, the expression level of SLAMF7, which was reduced before drug treatment, was less reduced or remained high after treatment. (e) In the liver tissue of animals, it was confirmed that SLAMF6, an activator of NK cell natural killer function, was increased by treatment with the drug ST-5-002, but the expression level of TIGIT, an inhibitor of NK cell natural killer function, was reduced. (f) Compared to NK92-EV cells that were not treated with drugs, in the case of NK92-TM4SF5 cells, the expression level of SLAMF7 on the cell surface was reduced through measurement of the median fluorescence intensity (Median FI), but when treated with each drug, the level increased again. However, in the case of NK92-EV cells, the change according to drug treatment was very minimal. (g) Co-localization of TM4SF5 and SLAMF7 was confirmed by fluorescence microscopy, confirming that they are co-localized in the cell membrane region, thereby confirming that they can bind.(hj) When TM4SF5 was pulled down using cell extracts, it was confirmed that SLAMF7, SLAMF6, MICA, MICB, or CD155 (TIGIT) were pulled down together when TM4SF5 was present, confirming that they can bind to TM4SF5. Meanwhile, it was confirmed that the binding of TM4SF5 and SLAMF7 was inhibited after treatment with ST-5-001 (j). It was confirmed that this binding was inhibited by treatment with the TM4SF5-specific inhibitor isoxazole. In other words, it was ultimately assumed that it was correlated with a decrease in the expression of those factors.

[0632] Therefore, when the effect of treatment with isoxazole compounds on the expression patterns of NK cell activation regulatory membrane proteins or factors in hepatoma cells and liver tissues dependent on TM4SF5 expression was analyzed, ST-5-002, an additional SAR product of drugs ST-1-025 and ST-3-005, showed an effect of increasing the expression of NK cell activation ligand / receptors SLAMF6, SLAMF7, MICA, MICB, and NKG2D (at a level reduced by TM4SF5 expression), suggesting the possibility of the efficacy of isoxazole compounds as TM4SF5-specific inhibitors as NK cell immune checkpoint inhibitors.

[0633]

[0634] 2.13. Confirmation of the inhibition of TM4SF5 binding and the expression of ligands related to the natural killing function of NK cells by the Isoxazole compound in an environment of indirect interaction between NK92 cells and hepatic epithelial cells (Fig. 13b).

[0635]

[0636] Stable NK92 cell lines were obtained by infecting NK92 human NK cells with retroviruses that induce expression of pBabe-HA-EV or pBabe-HA-TM4SF5. To create an environment for indirect interaction between NK92 cells and hepatic epithelial cells, conditioned media (CM) of NK cells was treated with hepatic epithelial cells or vice versa. Cell extracts were obtained and analyzed under conditions where indirect interaction between the two cells occurred. (b, left) Stable NK92 cell lines were cultured under normal conditions for two days to obtain CM. Meanwhile, a cell line (Huh7) in which TM4SF5 was knocked out using the Crispr / Cas9 strategy was obtained. KO ) When the cell line (TM) re-expressing the control expression vector (empty vector, EV) or the TM4SF5 expression vector reached 70-80% confluency, Huh7 CM was added to 20% KO The cells were diluted with the culture solution and treated. After 24 hours, cell extracts were obtained and Western blotting using the given antibodies was performed. (b, right) Huh7 KO -EV or Huh7 KO -CM obtained after culturing the TM4SF5 (TM) cell line for two days was diluted with NK92 culture solution to a concentration of 20% and treated with NK92-EV or NK92-TM4SF5 cells. After 24 hours, NK92 cell extracts were obtained and Western blotting was performed.

[0637] As a result, (b) in the case of SLAMF7 and MICA / B, Huh7 cells treated with CM of NK92-EV or NK92-TM4SF5 (TM) cells KO -Huh7 than EV cell line KO-Tendency to appear lower in the TM4SF5 cell line, and especially when treated with CM of NK92-TM4SF5 (TM) (left). Meanwhile, Huh7 KO -EV or Huh7 KO - Expression of SLAMF7, SLAMF6, NKG2D, and perforin was lower in NK92-TM4SF5 cells treated with CM than in NK92-EV cells treated with CM from the TM4SF5 cell line (right).

[0638] Therefore, (b) when NK92 cells and liver (cancer) epithelial cells indirectly meet each other through CM treatment, the killing efficacy of NK92 cells may be lower when TM4SF5 is expressed in each cell than when it is not, and in particular, when both cells express TM4SF5, the killing efficacy of NK92 cells was confirmed to be even lower.

[0639]

[0640] 2.14. The importance of N-glycosylation of Slamf7s in the reduction of expression and binding to TM4SF5 in the natural killing function of NK cells dependent on TM4SF5 expression (Figure 14).

[0641]

[0642] SNU761 hepatic epithelial cells were transfected with control vector (Strep-EV), Strep-TM4SF5 WT, or Gly- (N-linked glycosylation defective N138A / N155Q mutant) expression vectors, or additionally transfected with FLAG-SLAMF7 WT, △ECD1-225 (a mutant in which the extracellular domain of amino acids 1-225 is deleted), △TM226-247 (a mutant in which the transmembrane domain of amino acids 226-247 is deleted), 1NQ (N204Q), 2NQ (N172 / N176Q), or 3NQ (N172 / 176 / 204Q) expression vectors, and cultured for 48 h. (a-c) Whole cell lysates were collected and pulled down using streptavidin-agarose (20353, Thermo Fisher Scientific). Western blotting was performed on the pulled-down samples along with cell extracts. (d) SNU761 cells were adhered to coverslips coated with fibronectin (10 μg / ml, 35600, BD Biosciences) for 16 h. Subsequently, HA-TM4SF5 expression vector and FLAG-SLAMF7 WT or FLAG-SLAMF7-1NQ or 3NQ (1NQ; N204Q, 3NQ; N172 / 176 / 204Q) N-glycosylation mutant expression vectors were transfected and cultured for 48 h to allow expression. Cells were fixed with ice-cold 99% methanol for 15 min, blocked with 1% BSA solution, and immunofluorescently stained with anti-HA (blue), anti-SLAMF7 (green), and anti-LAMP1 (red) antibodies. The cells were observed under a confocal fluorescence microscope (Nikon Eclipse Ti microscope with a C2 confocal system). Representative images for each experimental condition are shown.

[0643] As a result, (a) SLAMF7 was pulled down together with the samples pulled down with strep-TM4SF5 compared to the control EV, confirming that TM4SF5 WT binds to SLAMF7. However, TM4SF5N-linked glycosylation-deficient mutant (Gly-) did not bind. (b) On the other hand, △ECD without the extracellular domain 1-225 SLAMF7 binds to △TM, but lacks the transmembrane domain (amino acids 226-247) 226-247 It was confirmed that SLAMF7 does not bind to TM4SF5. (c) When the N-linked glycosylation amino acid residues of SLAMF7 were mutated, the expression level of SLAMF7 did not decrease when 1NQ, 2NQ, or 3NQ were expressed, but the binding to TM4SF5 WT was reduced in cases where expression was reduced in the case of WT. (d) SLAMF7 WT appeared to colocalize with TM4SF5 WT in the endosomal membrane region around the cell nucleus, but in the case of SLAMF7 N-linked glycosylation mutants (1NQ and 3NQ), the colocalization was not clearly observed. On the other hand, 3NQ showed that it was expressed and located uniquely in the intracellular liquid-liquid phase separation forming an isolated circle, unlike WT or 1NQ.

[0644] Therefore, (ac) the binding of TM4SF5 to SLAMF7 is suggested to be significantly influenced by the N138 / N155N-linked glycosylation of TM4SF5 and its surrounding structural aspects, and the N-linked glycosylation and transmembrane domain of SLAMF7. (d) It is presumed that TM4SF5 colocalizes with SLAMF7 and LAMP1 in the endosomal membrane or lysosome in hepatoma cells, thereby enabling TM4SF5-mediated degradation of SLAMF7.

[0645]

[0646] 2.15. Isoxazole compounds inhibit the expression, degradation, and intracellular localization of ligands related to the natural killing function of NK cells, dependent on TM4SF5 expression (Figure 15).

[0647]

[0648] (a) SNU761 cells expressing HA-EV or HA-TM4SF5 and FLAG-SLAMF7 were stored at 4°C and then cultured at 37°C for the indicated time. Cell extracts were then collected and subjected to Western blotting with the indicated antibodies. (bc) SNU761 cells expressing HA-TM4SF5 and FLAG-SLAMF7 were immunostained with HA, FLAG, and LAMP1 or ZO-1 antibodies. Colocalization coefficients were calculated using Pearson's correlation (b). Each dot represents the values ​​of cells obtained from three independent experiments, and the figure shows representative images (c). (d) SNU761 cells expressing HA-EV / TM4SF5 and FLAG-SLAM7 were treated or not with ST-5-002 and chloroquine (CQ, 10 μM) for 24 h. Cell extracts were then collected and subjected to Western blotting with the indicated antibodies. (ef) SNU761 cells expressing TM4SF5-Strep and FLAG-SLAMF7 were treated with ST-5-002 (e) or ST-3-001 (f) for 24 h, and cell extracts were collected with brij58 lysis buffer. Whole-cell lysates were then used for streptavidin pulldown and immunoprecipitation. (gh) SNU761 cells expressing HA-TM4SF5 and FLAG-SLAMF7 were treated with ST-5-001 or ST-5-002 (2.5 μM, 24 h). Cells were then fixed with ice-cold methanol and immunostained with the indicated antibodies. Representative images are shown in (g). Colocalization coefficients were calculated using Pearson's correlation coefficient (h). Each dot represents the mean of cells obtained from three independent experiments.

[0649] As a result, (a) when SNU761 cells expressing or not expressing TM4SF5 were stored at 4℃ and then transferred to 37℃, the expression pattern of SLAMF7 increased over time in cases where TM4SF5 was not expressed, but did not increase but rather decreased in cases where TM4SF5 was expressed. (bc) In the control group where TM4SF5 was not expressed, SLAMF7 was expressed and localized in large quantities in the plasma membrane (PM), but as TM4SF5 was expressed, the amount of expression / localization in the PM decreased, while the amount localized in the lysosomal membrane where LAMP1 is stained increased. (d) SNU761 cells were injected with FLAG-SLAMF7 and HA-TM4SF5 or a control HA expression vector, and treated with ST-5-002 or not simultaneously with chloroquine (CQ) at a given concentration for 24 hours. Cell extracts were obtained and the expression patterns of SLAMF7 and LC3B, a marker of autophagy, were confirmed. At this time, SLAMF7, which had decreased due to the expression of TM4SF5, showed a pattern of being restored by the treatment with ST-5-002, and in particular, the decrease in the expression of SLAMF7 was not clearly observed in cases treated with CQ. (ef) The binding of TM4SF5 and SLAMF7 decreased by the treatment with ST-5-002, and at this time, the expression level of SLAMF7, which had decreased (in the case of WCL) due to the expression of TM4SF5, showed a pattern of increasing again by the drug treatment (e). However, in the case of treatment with the control drug, ST-3-001, the binding of TM4SF5 and SLAMF7 did not decrease but rather showed a trend of increasing, and in the case of WCL, the expression of SLAMF7 only decreased and did not show a case of being restored again by the treatment with ST-3-001 (f).(gh) SNU761 cells were transfected with FLAG-SLAMF7 and HA-TM4SF5 or a control HA expression vector, and treated with DMSO or ST-5-001 or ST-5-002 as a control. SLAMF7-FLAG (green), LAMP1 (red), and HA-TM4SF5 (blue) were fluorescently stained, and the degree of localization or co-localization of FLAG-SLAMF7 and HA-TM4SF5 was quantified. Compared to the DMSO treatment condition, SLAMF7, which was strongly co-localized in the lysosomal membrane, was confirmed to decrease upon drug treatment, and instead, its expression / localization in the plasma membrane (PM) was increased.

[0650] Therefore, (ac) it was confirmed that SLAMF7 is degraded in the lysosome, as the binding of TM4SF5 and SLAMF7 leads to the translocation of TM4SF5 to the lysosomal membrane and the decrease in the expression level of SLAMF7, and this phenomenon can be blocked by CQ. At this time, the TM4SF5-specific inhibitor ST-5-002 was able to inhibit the degradation of SLAMF7 by inhibiting this TM4SF5-mediated phenomenon, unlike the control drug ST-3-001. Meanwhile, it was found that when treated with ST-5-001 or ST-5-002, SLAMF7 moves from the lysosomal membrane to the cell membrane as the binding with TM4SF5 is disrupted, thereby avoiding the degradation process.

[0651]

[0652] 2.16. Decreased natural killing function of NK cells due to TM4SF5 expression (Figure 16)

[0653]

[0654] Stable NK92 cell lines were obtained by infecting NK92 cells with retroviruses that induce expression of pBabe-HA-EV or pBabe-HA-TM4SF5. In addition, Huh7 KO -EV or Huh7 KO- Overexpression (O / E) of SLAMF7 was achieved by injecting the expression vector into the TM4SF5 cell line. (a-b) NK92-EV or NK92-TM4SF5 cells (effector cells, E) and Huh7 KO -EV or Huh7 KO -TM4SF5 cell line (Target cells: T) were mixed in triplicate in a 96-well plate at a given E:T ratio and cultured for 4 hours. Afterwards, cytotoxicity of NK92 cells was measured according to the protocol using a lactate dehydrogenase (LDH) cytotoxicity assay kit (Cytotoxicity Detection Kit Plus, Roche). (c) NK92 (e) cells and Huh7 KO - Natural cell killing function / efficacy was measured using EV-SLAMF7(O / E) or Huh7KO-TM4SF5-SLAMF7(O / E) cells. (d) Perforin production in NK92-EV or NK92-TM4SF5 cells was analyzed by flow cytometry after staining with anti-Perforin antibody. (e.g.) SNU449 expressing TM4SF5 was injected into 6-week-old male NOD-SCID mice. T7 Cells (5 Х 10 5 cells / mice) were injected subcutaneously, and then NK92-EV or NK92-TM4SF5 cells (5 Х 10) were injected once a week for 5 times until 11 weeks. 6 cells / mice) were injected intravenously. After the fifth and final injection of NK92 cells, the mice were sacrificed 24 hours later, and the tumors that had formed in the liver were analyzed and immunohistochemistry was performed.

[0655] As a result, the natural killing efficacy of (ab) NK92 cells was higher than that of Huh7 KO -Huh7 rather than EV KO-The lower level was confirmed in the TM4SF5 cell line. NK92-TM4SF5 cells also showed the same phenomenon. NK92-TM4SF5 and Huh7 KO - The natural killing efficacy was the lowest when it was exposed to TM4SF5. (c) However, the natural killing efficacy of NK92 cells against liver cancer cells increased when the liver cancer cells overexpressed SLAMF7. (d) It was confirmed that NK92-TM4SF5 cells had lower expression / production of Perforin than NK92-EV cells. (eg) In a carcinogenesis model induced by subcutaneous injection of TM4SF5-expressing liver cancer cells, the volume and weight of the tumor were higher when the NK92-TM4SF5 cell line was injected than when NK92-EV cells were injected. In addition, immunohistochemical staining of SLAMF7 was similar in the liver tissue of NOD-SCID mice deficient in NK cells when NK92-EV or NK92-TM4SF5 cell line was injected.

[0656] Therefore, the results suggest that the efficacy of (ad) NK92 cells to kill liver cancer cells is lower when TM4SF5 is expressed in NK92 cells or liver cancer (epithelial) cells than when it is not expressed. This suggests that the expression of TM4SF5 can inhibit the SLAMF7-mediated natural killing function of NK cells, whether liver cancer cells or NK cells. In addition, in a cancer animal model induced by subcutaneous injection of TM4SF5-expressing liver epithelial cells, the injection of NK92-TM4SF5 cells stimulated cancer development more actively than the intravenous injection of NK92-EV cells, which also indicates that NK cells expressing TM4SF5 have lower anticancer natural killing efficacy.

[0657]

[0658] 2.17. Confirmation of TM4SF5 expression-dependent inhibition of PD-L1 expression and binding by isoxazole compounds (Figure 17)

[0659]

[0660] (ab) Equal numbers of SNU449-EV or SNU449-TM4SF5 cells were transferred to culture vessels and cultured overnight. After replacing the cell culture medium with fresh normal culture medium, the cells were treated with vehicle, CCL2, CCL5, CCL20, TNFα, or IFNγ at a concentration of 15 ng / ml for 24 hours. Cell extracts were collected and Western blotting was performed with the given antibodies, or TM4SF5-strep was pulled down with streptavidin agarose resin, and then co-expressed PD-L1 was subjected to Western blotting using its antibody to confirm the binding of TM4SF5 to PD-L1. (cd) PD-L1-HA cDNA was additionally injected into SNU449 cells stably expressing EV or TM4SF5. After one day, DMSO or TSAHC (chalcone-based positive control), ST-5-001, or ST-5-002 were treated at 2.5 μM for 24 hours, and then cell extracts were collected. Strep-TM4SF5 was pulled down from the cell extracts using strep-agarose beads, and Western blotting was performed using antibodies against the indicated proteins, or TM4SF5 (red fluorescence) and PD-L1 (green fluorescence) were immunostained, and the intracellular localization and expression levels were confirmed under a fluorescence microscope along with DNA staining with DAPI.

[0661] As a result, (a) compared to SNU449-EV cells treated only with DMSO vehicle as a control without drug treatment, it was confirmed that the expression of PD-L1 increased in SNU449-TM4SF5 cells. However, when additionally treated with various cytokines / chemokines, the increase in PD-L1 expression due to their treatment was minimal in SNU449-EV, but in SNU449-TM4SF5 cells, the degree of increase was confirmed to be even greater when treated with CCL5, CCL20, TNFα, or IFNγ. (b) SNU449 cells were transfected with Strep-EV, HA-EV, Strep-TM4SF5 (TM5), HA-PD-L1, Strep-PD-L1, or HA-TM4SF5 (TM5), individually or together. After 48 hours, cell extracts were obtained, and Strep-TM4SF5 or Strep-PD-L1 was pulled down from the cell extracts. Strep-TM4SF5 and Strep-PD-L1 were pulled down respectively, and it was confirmed that PD-L1 and TM4SF5 were pulled down together at the same time in each experiment. This confirmed that TM4SF5 binds to PD-L1. (c) As inhibited by TSAHC treatment compared to the DMSO-treated control, the binding of TM4SF5 to PD-L1 was reduced and inhibited by treatment with drugs ST-5-001 or ST-5-002. (d) When observed under a fluorescence microscope through immunostaining, the control group cells treated with DMSO showed higher expression of PD-L1 in cells expressing TM4SF5, and colocalization was confirmed in the cell membrane region. However, when treated with the drug isoxazole, the expression of PD-L1 in cells expressing TM4SF5 was confirmed to be lower, and the degree of colocalization was confirmed to be slightly suppressed.

[0662] SLAMF7 is known to be a membrane protein that can suppress the immune activity of NK cells and T cells by inducing activation and PD-L1 inhibiting activation. It can bind to TM4SF5, and the expression of SLAMF7 (along with SLAMF6, MICA, MICB, etc.) will be reduced in liver cancer cells / tissues that express TM4SF5. However, PD-L1 is an immune checkpoint that suppresses the activity of T and NK immune cells, and its expression will be increased in liver cancer cells / tissues that express TM4SF5. Therefore, we investigated whether the expression pattern of PD-L1, which is known to be expressed not only in hepatic epithelial cells (representative parenchymal cells) but also in non-parenchymal cells [endothelial cells, fibroblasts, and hepatic stellate cells] and immune cells (immune cells such as T cells, B cells, NK cells, and macrophages) in liver tissue, is correlated with the expression of TM4SF5 or whether it binds to TM4SF5. In addition, the fact that the binding of PD-L1 and TM4SF5 is inhibited by treatment with the TM4SF5-specific inhibitor isoxazole may be significantly related to the regulation of PD-L1 expression or intracellular location / distribution in hepatic epithelial cells. The fact that isoxazole compounds can control the signaling function and protein-protein binding ability of TM4SF5, which are correlated with the regulation of PD-L1 expression, suggests the potential of isoxazole compounds as TM4SF5-specific inhibitors and as NK cell and T cell immune checkpoint inhibitors.

[0663]

[0664] 2.18. Isoxazole compound inhibits PD-1 expression and T cell activation in a TM4SF5-dependent manner (Figure 18).

[0665]

[0666] (a) Human Jurkat T cells were activated by treating them with PMA (10 ng / ml) and INO (1 μg / ml) for 24 hours. An untreated control was also included. Meanwhile, it was confirmed that the production of Granzyme B (especially the intensity of the band with a higher molecular weight of the activated N-glycosylated form) gradually increased through PMA / INO treatment. Even when the activation time through PMA / INO treatment preceded or coincided with the time of treatment with DMSO or ST-5-002, the activation by PMA / INO was confirmed to be further increased by treatment with ST-5-001 or ST-5-002. (b) Human Jurkat T cells were not treated or treated with PMA (25 ng / ml) and INO (1 μg / ml) for 24 hours, and IL-21 was also treated at a level of 50 ng / ml for the last 6 hours. Simultaneous treatment with PMA / INO and ST-5-002 at 2.5 μM or not was performed. At this time, the expression levels of Granzyme B, PD-1, and phosphorylation of Ser473 of AKTs and Thr202 / Tyr204 of ERKs were enhanced by PMA / INO. When PMA / INO was treated, additional treatment with IL-21 or ST-5-002 alone further increased the expression of Granzyme B and PD-1, and when ST-5-002 and IL-21 were additionally treated simultaneously, the level of Granzyme B was confirmed to be even higher.

[0667] Therefore, in the case of human Jurkat T cells, when activated by treatment with PMA / INO, additional treatment with ST-5-002, a TM4SF5-specific inhibitor, suggests that T cell activation is further achieved in terms of granzyme B expression. In other words, the fact that isoxazole compounds can enhance T cell proliferation / survival signaling function and cell killing ability for the expression of PD-1 and granzyme B, which increase during the activation process in T cells, suggests the possibility of isoxazole compounds as T cell immune checkpoint inhibitors as TM4SF5-specific inhibitors.

[0668]

[0669] 2.19. Inhibition of TM4SF5 binding by isoxazole compounds and the cholesterol binding ability of TM4SF5 and PD-L1 following isoxazole treatment (Figure 19)

[0670]

[0671] (a) Control vector, TM4SF1, TM4SF5 WT, and TM4SF5 R113Q, C118 / 145A, H127A, N138A mutant expression vectors were transfected into HEK293FT cell lines that were confirmed not to express TM4SF5, and expression was allowed for 48 hours. (b) Huh7 cells in which TM4SF5 was knocked out KO The cell lines were stably infected with retroviruses encoding pBabe-EV or pBabe-TM4SF5-HA. (c) Strep-EV, Strep-TM4SF5 WT, or N138A mutant expression vectors were injected into the SNU761 cell line, which does not express TM4SF5, to induce expression. (d) Strep-EV, Strep-PD-L1 WT, 3NQ (N192 / 200 / 219Q), and 4NQ (N35 / 192 / 200 / 219Q) N-linked glycosylation mutants were injected into Huh7 cells to induce expression. (e) Huh7 KOStrep-EV and Strep-TM4SF5 expression vectors were injected into cells and expressed for 48 hours. (ae) After obtaining cell extracts, TM4SF5-strep, TM4SF5-HA, or PD-L1-strep was pulled down using streptavidin agarose resin or anti-HA antibody from extracts containing 0.2, 0.25, or 1.0 mg of protein for each experimental condition. Each pulled-down bead 14 C-labeled ST-5-002 (10, 25, or various concentrations as indicated, μM) was treated for 1 h in the presence or absence of 400 μM cold ST-5-002 (ab). Or [1,2- 3 [H]-Cholesterol (50 μM) was treated alone or in combination with ST-3-001 (negative control compound), ST-5-001, or ST-5-002 (each 2.5 μM) for 1 h (ce). Experimental samples under each condition were repeatedly measured for radioisotope values ​​using a TriCarb scintillation counter (PerkinElmer, Waltham, MA).

[0672] As a result, (a) Strep-TM4SF5 obtained from HEK293FT compared to the control and TM4SF1 14 It bound to C-labeled ST-5-002. In particular, amino acids R113 and N138 of TM4SF5 were identified as important for the binding. Meanwhile, various concentrations of 14 When reacted with C-labeled ST-5-002, EC of binding to TM4SF5 50 (Binding to 50% of TM4SF5 14 (C-labeled ST-5-002 concentration) showed a value of 8.874 μM. (b) Huh7 KO -HA-TM4SF5 obtained from HA-TM4SF514 We confirmed that the binding of C-labeled ST-5-002 was reduced by simultaneous treatment with cold ST-5-002. In addition, various 14 When reacted with C-labeled ST-5-002, EC of binding to TM4SF5 50 showed a value of 849.6 nM. (c) The wild-type and N138A mutant forms of TM4SF5 were also able to effectively bind to cholesterol. Meanwhile, the binding of TM4SF5 to cholesterol was not affected by the control drug ST-3-001, but was inhibited by treatment with ST-5-001 and ST-5-002. (d) Like TM4SF5, PD-L1 WT also binds to cholesterol, and in particular, the binding to cholesterol was inhibited by the N-linked glycosylation mutation and the phosphorylation mutation Y112F. (e) It was confirmed that the degree of binding of TM4SF5 to cholesterol decreased as the concentration of ST-5-001 or ST-5-002 treated simultaneously increased. It was confirmed that the degree of binding of TM4SF5 to cholesterol decreased by 50% at 6.145 μM for ST-5-001 and 786.6 nM for ST-5-002.

[0673] Therefore, the TM4SF5-specific inhibitors isoxazole ST-5-001 and ST-5-002 bind to TM4SF5, and the EC of their binding 50 The EC values ​​were 8.874 μM for Sterp-TM4SF5 and 874.6 μM for HA-TM4SF5, indicating an EC of 0.85 to 8.8 μM depending on the cell source and tag type. 50showed the value. Meanwhile, cholesterol can also bind to TM4SF5 and PD-L1, which are known to be involved in the development of cancer, and it was confirmed that ST-5-001 and ST-5-002 inhibited the binding. However, the significance of the binding of cholesterol to TM4SF5 and PD-L1 when the cytotoxic activity of T cells and NK cells is regulated in a TM4SF5-dependent manner has not been confirmed. However, the ability of the TM4SF5-specific inhibitor isoxazole compound to inhibit the binding allows for the inference or possibility of an additional mechanism of action in anti-cancer strategies.

[0674]

[0675] 2.20. Confirmation of inhibition of hepatocarcinogenesis and expression of hepatocarcinoma markers in a liver-orthotopic xenograft model of TM4SF5-expressing cell lines by isoxazole compounds (Fig. 20)

[0676]

[0677] (ad) 5x10 directly injected into the liver of 6-week-old male BALB / c-Nude mice (n=9) that were deficient in T and B cells but still capable of activating NK cells. 5 SNU449 of the dog T7We attempted to establish a liver orthotopic xenograft model by injecting cells. One week after cell injection, the drug ST-5-002 was injected intraperitoneally twice a week at 5 mg / kg (a). After a total of six drug injections over three weeks, the animals were sacrificed four weeks after cell injection, and liver tissue was obtained and imaged (b). Body weights were measured weekly during drug injection. While multiple tumors developed in the liver tissue, these tumors were quite large. Measuring the size or volume of smaller tumors was time-consuming due to tissue sample processing. Therefore, the volume of the largest tumor mass in each liver tissue was measured. Tumor volumes calculated from n=7 liver tissues, excluding the largest and smallest values, are shown (c). (d) Some liver tissues were subjected to immunohistochemistry or H&E staining for given protein factors to determine the expression level, distribution, and location of each factor, as well as the extent of liver tumor tissue damage.

[0678] As a result, (a) Schematic diagram of the liver-orthotopic xenograft experiment of TM4SF5-expressing SNU449T7 cell line. (b) After the experiment, when the image of the recovered cancer tissue was confirmed, the inhibitory effect on liver cancer formation was clearly confirmed when ST-5-002 was treated compared to the tumor tissue of the vehicle-injected control group. (c) Body weight was measured every week after cell injection, and liver cancer tissue was obtained on the 28th day after cell injection, and the size of the largest cancer mass in each liver tissue was measured to calculate the tumor volume. It was confirmed that the tumor volume was significantly reduced when the drug was treated compared to when the vehicle was treated. (d) As a result of performing immunohistochemistry or H&E staining for protein factors given to some liver tissues, it was confirmed that cancer formation in liver tissues treated with the drug ST-5-002 was suppressed compared to when treated with vehicle, and the expression of Ki67 indicating cell proliferation, AFP as a liver cancer marker, F4 / 80 indicating the distribution of macrophages in liver tissues, CCL2 and CCL20 related to inflammation, and laminin γ2 related to fibrosis and liver cancer was significantly reduced.

[0679] Therefore, we aimed to confirm the TM4SF5 expression-dependent hepatocarcinogenesis inhibitory efficacy of isoxazole compounds that went through the SAR process of ST-1-025 → ST-2-001 → ST-3-006 / 011 → ST-4-005 → ST-5-001 or ST-5-002. By showing the efficacy of ST-5-002 in inhibiting hepatocarcinogenesis in a hepatocarcinoma animal model obtained by directly transplanting TM4SF5-expressing hepatocarcinoma cells into the liver, the potential of isoxazole compounds as anti-hepatocarcinogenic inhibitors as TM4SF5-specific inhibitors was confirmed.

[0680]

[0681] 2.21. Confirmation of inhibition of hepatocarcinogenesis and expression of hepatocarcinoma markers in a PDX model expressing TM4SF5 by isoxazole compounds (Fig. 21)

[0682]

[0683] (ad) Tumor sections from patients with hepatocellular carcinoma (HCC cube, 1 mm) confirmed to express TM4SF5 were collected from the right thigh of 6-week-old male NOD / SCID mice (n=8) deficient in T, B, and NK immune cells. 3 ) was implanted to establish a TM4SF5-expressing HCC-PDX model. Starting on the 8th day after tissue implantation, vehicle, drug ST-5-001, or ST-5-002 was injected intraperitoneally twice a week at 5 mg / kg on the indicated dates (a). After six drug injections, the animals were sacrificed on the 28th day after cancer tissue implantation, and liver tissues were obtained and images were taken (b). Body weight and tumor volume were measured on each day of drug injection starting on the 8th day after tissue implantation and are shown (c). Meanwhile, a portion of the liver tissue was stained with immunohistochemistry or H&E to confirm the expression level, distribution, and location of each factor and the degree of liver cancer tissue damage for the given protein factors (d).

[0684] As a result, (a) the following is a schematic diagram of the PDX experimental method for creating a liver cancer model by planting a tumor fragment derived from a liver cancer patient confirmed to express TM4SF5. (b) After the experiment, when the images of the recovered cancer tissues were checked, it was confirmed that the inhibition effect of liver cancer formation was clear when treated with ST-5-002 compared to the tumor tissues of the control group injected with the vehicle. (c) When the body weights were measured weekly after the injection of the cells, the body weights were not affected by drug treatment, and it was confirmed that the tumor volume was significantly reduced when treated with each drug compared to when treated with the vehicle. (d) As a result of performing immunohistochemistry or H&E staining for given protein factors using a part of liver tissue, it was confirmed that cancer formation was suppressed when treated with drugs ST-5-001 or ST-5-002 compared to when treated with vehicle, and the expression of Ki67, which indicates cell proliferation, AFP, a liver cancer marker, F4 / 80, which indicates the distribution of macrophages in liver tissue, CCL2 and CCL5 related to inflammation, and laminin γ2 related to fibrosis and liver cancer was significantly suppressed. (e) The expression of TM4SF5 was high in both vehicle and drug-treated groups, with no significant difference depending on drug treatment. When staining for PD-L1, when judged based on cell size, morphology, and staining pattern, the expression of PD-L1 in non-parenchymal cells and immune cells, as well as in parenchymal cells such as hepatocytes, was high in vehicle-treated groups, but decreased when treated with drugs.Meanwhile, in the case of SLAMF7, when treated with vehicle, the expression of SLAMF7 was higher in the non-cancerous area surrounding the cancer area than in the cancer area, but when treated with the drug, the staining of SLAMF7 showed a degree of staining that penetrated into the cancer area even though it was a small cancer mass.

[0685] Therefore, to analyze the TM4SF5 expression-dependent hepatocarcinogenesis inhibitory efficacy of isoxazole compounds that went through the SAR process of ST-1-025 → ST-2-001 → ST-3-006 / 011 → ST-4-005 → ST-5-001 or ST-5-002, a hepatocarcinoma model obtained by transplanting patient-derived hepatocarcinoma tissues was established using NOD / Scid mice with suppressed T, B, and NK immune cell functions. In the hepatocarcinoma model obtained by directly transplanting patient-derived hepatocarcinoma tissues expressing TM4SF5 into the liver, ST-5-001 or ST-5-002 showed a clear inhibitory efficacy in hepatocarcinogenesis. This is expressed not only in hepatocytes, which are the source of liver cancer, but also in various other types of cells that make up the liver tissue, and it is thought that the expression of PD-L1, which suppresses the killing function of T cells and NK cells, was maintained high before drug treatment, which could ultimately lead to immune evasion, but its expression was reduced after drug treatment, which could have led to the activation of T / NK cells. In other words, the possibility of anti-liver cancer inhibition through immune checkpoint inhibition of isoxazole compounds as TM4SF5-specific inhibitors was confirmed by suppressing the distribution and number of not only hepatic epithelial cells expressing PD-L1, but also non-parenchymal and immune cells. On the other hand, in the case of SLAMF7, it was lowered in the cancerous area, and when the drug was treated, the expression increased overall or the degree of staining was shown even within the cancerous area, which meant that the drug-induced upregulation of SLAMF7 expression in hepatic epithelial cells could be a fundamental mechanism of action that can pursue the anticancer effect by inducing the activity of immune cells such as NK cells.However, since the model animals of this experiment had no or weak T, B, and NK cells, it is possible that the anticancer effect was not entirely achieved by the activation of these immune cells when the drug was administered. Rather, it was presumed that the drug-induced inhibition of TM4SF5 signaling activity and protein-protein binding may have suppressed cancer cell proliferation, survival, and proliferation.

[0686]

[0687] 2.22. Isoxazole compounds regulate the expression of ligands related to hepatocarcinogenesis and the natural killing function of NK cells in a liver-orthotopic xenograft model of a TM4SF5-expressing cell line, and confirm the infiltration of NK cells into cancer tissues (Fig. 22).

[0688]

[0689] (ab) As in Figure 20, 5x10 were injected directly into the liver of each 6-week-old male BALB / c-Nude mice (n=9) in which T and B cells were deficient but NK cell function was still activated. 5 SNU449 of the dog T7 An orthotopic liver xenograft model was constructed by injecting cells. One week after cell injection, the drug ST-5-002 was administered intraperitoneally at a dose of 5 mg / kg twice a week. (bd) After the experiment, a portion of the liver tissue was subjected to immunohistochemistry for the given protein factors to determine the expression levels, distribution, and location of SLAMF7, SLAMF6, NKG2D, PD-L1, and PD-1, as well as the extent of liver cancer tissue.

[0690] As a result, (a) TM4SF5-expressing SNU449 T7This is a schematic diagram of the liver orthotopic xenograft experiment of the cell line. (b) After the experiment, immunohistochemistry was performed on a portion of the recovered liver tissue for SLAMF7. When treated with vehicle, SLAMF7 expression was high in non-tumor areas and relatively low in tumor areas. On the other hand, when treated with the drug ST-5-002, SLAMF7 expression was uniformly high or low in areas where tumor formation was not proper, and when the border of a small tumor was observed, it was confirmed that cells highly expressing SLAMF7 were distributed or located by infiltrating into the tumor. It was presumed that the distribution (infiltration) of SLAMF7-expressing cells inside the tumor due to drug treatment may induce the activation of the autolytic ability of NK cells inside the tumor. (c) Meanwhile, in the case of staining of SLAMF6 or NKG2D, expression appeared to be higher in the non-tumor area than in the tumor area in the control group (vehicle treatment), but in the case of ST-5-002 treatment, expression appeared to spread overall, and in the case of small cancerous areas, the degree of staining of Slamf6 and Nkg2d was confirmed to be additionally added inside the tumor area. (d) Meanwhile, in the vehicle-treated control group, PD-1-stained cells (red arrow heads) (including NK cells) were seen in limited categories or areas (dotted circles) in the tumor area, but in the liver cancer tissues of mice treated with the drug ST-5-002, the distribution of PD-1-expressing cells was uniformly distributed throughout the cancer-free area, and even in the border area between the tumor and non-tumor area or in the tumor area, the degree of staining was shown to be distributed without restriction and not limited to a limited area.(e) When staining for PD-L1 was performed on orthotopic liver cancer tissue, the staining of cells showing PD-L1 expression was limited to a limited area (dotted red circles) within the cancer tissue. However, when the drug ST-5-002 was treated and the border of the area where the tumor was not properly formed or where a small tumor had formed was observed, it was confirmed that cells highly expressing PD-L1 (red arrow heads) were distributed at a low level within the tumor. In other words, these results suggest that when cancer is induced without drug treatment, cancer is induced by the phenomenon of suppressing the natural killing effect of NK cells by the action of hepatic epithelial cells expressing TM4SF5, but when the drug is treated and the function of TM4SF5 is suppressed, SLAMF7 cells easily infiltrate the cancer site, and NK cell activation is induced to result in cancer suppression, but cells expressing PD-L1 and PD-1 are located at low levels throughout the tissue or even inside small cancer sites, so the significance of immune evasion is weakened.

[0691] Therefore, these experimental results showed that ST-5-002 clearly inhibits liver cancer formation in a liver cancer model obtained by directly transplanting TM4SF5-expressing cell-derived liver cancer tissues into the liver (Fig. 20). In other words, these results show that in the absence of drug treatment, carcinogenesis is induced, accompanied by a phenomenon in which the natural killing effect of NK cells is suppressed (inhibition or inactivation of the expression of the killing-activating ligand / receptor) by the action of hepatic epithelial cells expressing TM4SF5, but when the drug is treated and the function of TM4SF5 is suppressed, NK cell activation is induced so that cells expressing SLAMF7, SLAMF6, and NKG2D can infiltrate into the cancer site and cause cancer suppression, but cells expressing PD-L1 and PD-1 are distributed in small numbers inside the cancer site, and it can be inferred that the significance of immune evasion is weakened.

[0692]

[0693] 2.23. Confirmation of suppression of hepatocarcinogenesis and regulation of expression of ligands related to the natural killing function of NK cells in TM4SF5 transgenic animals treated with DEN by isoxazole compounds (Fig. 23)

[0694]

[0695] When treating animals with diethylnitrosamine (DEN) to induce a liver cancer model, DEN was injected intraperitoneally (IP) once to 2-week-old animals and then raised for 46 weeks to induce liver cancer formation. 2-week-old male C57BL / 6 wildtype and Alb-TG mice Tm4sf5-Flag[Animals in which Tm4sf5-Flag is overexpressed only in hepatocytes by linking Tm4sf5-Flag to the promoter region of the hepatocyte-specific albumin gene, thereby creating genetically modified animals], or Tm4sf5 - / - Knockout (KO) mice were injected intraperitoneally once with DEN (25 mg / kg body weight). After 40 weeks, the ST-2-001 treatment group was injected intraperitoneally twice a week at a concentration of 5 mg / kg body weight (in 40% DMSO) for 6 weeks (n=5). The animals were then sacrificed, and liver tissue was collected and analyzed. Some of the tissues were subjected to immunohistochemistry for the indicated factors, and another portion was subjected to qRT-PCR to measure the mRNA levels of the indicated factors.

[0696] As a result, (a) a schematic diagram showing a liver cancer model induced by DEN treatment in animals. (b) Alb-TG Tm4sf5-Flag Or Tm4sf5 - / - Treating KO mice with DEN and some Alb-TG Tm4sf5-Flag Mice were treated with the drug ST-2-001 at a concentration of 5 mg / kg twice a week for the final 6 weeks. Liver tissue samples were obtained and confirmed to be DEN-treated Alb-TG. Tm4sf5-Flag In the case of mice, tumor formation was significantly enhanced, but in KO mice or Alb-TG Tm4sf5-FlagThe group treated with DEN and the drug ST-2-001 in mice showed little or no tumor formation. When liver cancer tissues were stained with H&E or immunohistochemistry was performed for TM4SF5, Ki67, and factors that can regulate the natural killing function of NK cells (activators SLAMF7 and NKG2D, inhibitory factors TIGIT), the expression of TM4SF5 was high in both non-tumor and tumor areas, and the expression of Ki67 and TIGIT was higher in the tumor area compared to the adjacent non-tumor area. However, the expression of SLAMF7 and NKG2D was higher in the non-tumor area compared to the tumor area. (c) When the mRNA expression level of ligand / receptor that can regulate the natural killing function of NK cells was confirmed by performing qRT-PCR using some tissues, the expression of NK cell activation receptor factors such as SLAMF7, NKG2D, CRTAM, DNAM-1, and CD27 was higher in Alb-TG compared to DEN-treated KO mice. Tm4sf5-Flag The mice showed a downward trend, but the decline was partially recovered and increased again by treatment with the TM4SF5-specific inhibitor drug ST-2-001. This phenomenon was understood to be a case in which the formation of liver cancer expressing TM4SF5 by DEN treatment resulted in the inactivation through suppression of the expression of activating ligands / receptors such as SLAMF7 and NKG2D at the tumor site, as well as the suppression of the natural killing efficacy of NK cells due to enhanced expression of TIGIT, resulting in immune evasion.

[0697] Therefore, in the C57BL / 6 liver cancer model, which induces liver cancer by treating young mice with DEN for a long period of time (46 weeks) to damage the liver, the expression of ligand factors that increase NK cell activity and induce anticancer effects was low in the tumor, which could lead to cancer development due to low NK cell activity. However, in cases treated with the isoxazole drug ST-2-001 or in mice that do not express the TM4SF5 gene, the expression of such NK cell ligands was uniformly high throughout the entire liver tissue (compared to the tumor area of ​​the untreated liver tissue) without being differentiated in the area where no tumors developed. This suggests that the drug isoxazole may inhibit liver cancer through immune checkpoint inhibition that increases the activity and uniform distribution of NK cells.

[0698]

[0699] 2.24. Confirmation of the suppression of hepatocarcinogenesis by Isoxazole compounds and the regulation of expression of ligands on cancer cells related to the natural killing function of NK cells in a subcutaneous xenograft liver cancer model in severe immunodeficient animals (NOD-SCID mice) (Fig. 24)

[0700]

[0701] 6-week-old male NOD / CB17-Prkdc scid / J mice (NOD-SCID mice lacking or having no immune cells such as T cells, B cells, and NK cells, n=10) were injected with SNU449 T7 5Х10 cells per thigh 5 A number of cells were injected subcutaneously. One week later, vehicle or the drug ST-5-002 was injected intravenously twice a week at a concentration of 2.5 mg / kg body weight (mpk). Three days after the eighth injection, animals were sacrificed, and tumor tissues were harvested for imaging, immunohistochemistry, Western blot, and qRT-PCR analysis.

[0702] As a result, (a) Schematic diagram of the establishment of a subcutaneous xenograft liver cancer model in severe immunodeficiency (NOD-SCID) animals and evaluation of drug anticancer efficacy. (b) When the size of the tumors was compared after isolation, it was confirmed that the tumor size was reduced when the drug ST-5-002 was treated alone compared to when treated with the vehicle. (c) When the size of the cancer tissues of the vehicle-treated control group and the drug-treated group was compared, the drug treatment showed a statistically significant inhibitory effect on cancer formation in terms of tumor volume and weight. (d) When H&E staining and TM4SF5 immunostaining were performed, when treated with the vehicle, not only cancer formation but also the arrangement of cells appeared disorderly in the liver tissue and characteristics of invasive fibrotic / cirrhotic scar formation were observed. However, when treated with the drug ST-5-002, the expression of TM4SF5 did not change significantly, but the composition of cells in the tissue appeared more normal and orderly. Meanwhile, the expression of AFP and laminin γ2, which are known to be highly expressed in liver cancer, was confirmed to be high, but was clearly reduced by drug treatment. The staining intensity of PD-L1 was reduced in the drug-treated group compared to the vehicle-treated group. In the case of SLAMF7, the staining intensity in the small formed cancer area showed a more distinct aspect than the surrounding area in the drug-treated group, but this aspect was weaker in the vehicle-treated group. In addition, the staining intensity of the macrophage marker F4 / 80 and the expression of the inflammation-related chemokines CCL5 and CCL20 were lower in the drug-treated group compared to the control group.

[0703] Therefore, since the subcutaneous xenograft hepatocarcinoma formation model of the TM4SF5-expressing cell line was implemented in NOD-SCID mice with deficient immune cells, it was presumed that the anticancer effect could be achieved through a mechanism that does not necessarily act on immune cells, but rather inhibits the signaling activity and survival / proliferation of TM4SF5 present solely in hepatocarcinoma cells, protein-protein binding with membrane proteins and membrane receptors for such cellular functions, and lowers the expression of PD-L1, AFP, and laminin γ2 in cancer cells, while regulating the expression level of SLAMF7 to increase.

[0704]

[0705] Meanwhile, the PCR Primer sequence information of the genes used in the present invention can be referenced below.

[0706]

[0707]

[0708]

[0709] Hereinafter, to aid understanding of the present invention, examples will be given in detail. However, the following examples are intended only to illustrate the scope of the present invention and are not intended to limit its scope. These examples are provided to more fully explain the present invention to those of average skill in the art.

Claims

1. A compound selected from the compounds of the following chemical formula 1, pharmaceutically acceptable salts, hydrates and solvates thereof: [Chemical Formula 1] In the above chemical formula 1, X1 is O or N; X2 is C or N; X3 is C or N; is a single bond or a double bond; R1 is hydrogen, R a NH- or R a O- and; R a is hydrogen, C 1-5 Alkyl, R b SO2- or R b CO- and; Each R b are independently hydrogen, C 1-5 Alkyl, C 2-5 Alkenyl or, unsubstituted or C 1-5 C substituted with alkyl 6-10 It is aryl; R2 is hydrogen, halogen, C 1-5 Alkyl, haloC 1-6 Alkyl, R c NH- or R c O- and; R c is hydrogen, C 1-5 Alkyl, R d SO2- or R d CO- and; Each R d are independently hydrogen, C 1-5 Alkyl, or, unsubstituted or C 1-5 C substituted with alkyl 6-10 Aryl, n is an integer between 1 and 2.

2. In paragraph 1, The compound represented by the above chemical formula 1 is a compound represented by any one of the following chemical formulas 2 to 4: [Chemical Formula 2] [Chemical Formula 3] [Chemical Formula 4] In the above chemical formulas 2 to 4, X1, X3, R1, R a , R b , R2, R c , R d and n are as defined in claim 1.

3. In paragraph 1, The compound of the above chemical formula 1 is a compound characterized in that it is selected from the group consisting of the following compounds: 4-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(3-methoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(2-methoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)aniline; 4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)aniline; 4-(5-(4-fluorophenyl)isoxazol-3-yl)aniline; 4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)aniline; 4-(5-(4-propoxyphenyl)isoxazol-3-yl)aniline; 3-(5-(4-methoxyphenyl)isoxazol-3-yl)aniline; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)methanesulfonamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide; N-(4-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acrylamide; N-(4-(5-(3-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(2-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(3,4-dimethoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-propoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-(trifluoromethyl)phenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-fluorophenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(4-(tert-butyl)phenyl)isoxazol-3-yl)phenyl)acetamide; N-(4-(5-(pyridin-4-yl)isoxazol-3-yl)phenyl)acetamide; N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)acetamide; N-(3-(5-(4-methoxyphenyl)isoxazol-3-yl)phenyl)-4-methylbenzamide; N-(4-(5-(4-hydroxyphenyl)isoxazol-3-yl)phenyl)acetamide; 4-(3-(4-acetamidophenyl)isoxazol-5-yl)phenyl 4-methylbenzenesulfonate; N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)acetamide; N-(4-(3-(4-methoxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)acetamide; N-(4-(3-(4-hydroxyphenyl)isoxazol-5-yl)phenyl)-4-methylbenzamide; N-(4-(1-(4-hydroxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(1-(4-methoxyphenyl)-1H-1,2,3-triazol-4-yl)phenyl)acetamide; N-(4-(5-(4-hydroxyphenyl)-1H-pyrazol-3-yl)phenyl)-4-methylbenzenesulfonamide; N-(4-(5-(4-hydroxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)-4-methylbenzenesulfonamide; and N-(4-(5-(4-methoxyphenyl)-4,5-dihydroisoxazol-3-yl)phenyl)acetamide.

4. A pharmaceutical composition for preventing or treating liver disease, comprising a compound described in any one of claims 1 to 3 or a pharmaceutically acceptable salt thereof as an active ingredient.

5. In paragraph 4, A pharmaceutical composition for preventing or treating liver disease, wherein the liver disease is characterized by liver cancer, chronic liver damage, non-alcoholic or alcoholic liver disease, fatty liver, hepatitis, liver fibrosis, or cirrhosis.

6. In paragraph 4, The pharmaceutical composition is characterized in that it is used for treating liver disease by inhibiting the expression, protein-protein binding, and signal transduction activation of TM4SF5 protein, or by activating the killing efficacy of T and NK immune cells or regulating their distribution to inhibit the immune checkpoint function.

7. A pharmaceutical preparation comprising the pharmaceutical composition of paragraph 4.

8. In paragraph 7, A pharmaceutical preparation characterized in that the pharmaceutical preparation is in the form of a patch, ointment, inhalant, nasal drop, tablet, pill, powder, capsule, syrup or emulsion.

9. In paragraph 7, A pharmaceutical preparation characterized in that the above pharmaceutical preparation additionally comprises at least one selected from the group consisting of pharmaceutically acceptable carriers, adjuvants and excipients.

10. A method for inhibiting immune checkpoint function by inhibiting the expression of TM4SF5 protein, protein-protein binding, inhibiting signal transduction activation, or activating the killing efficacy of T and NK immune cells or regulating their distribution, comprising administering to the subject a pharmaceutically effective amount of a compound described in any one of claims 1 to 3.

11. A method for preventing or treating liver disease in a subject, comprising administering to the subject a pharmaceutically effective amount of a compound described in any one of claims 1 to 3.

12. In paragraph 11, A method, wherein the liver disease is characterized by being liver cancer, chronic liver damage, non-alcoholic or alcoholic liver disease, fatty liver, hepatitis, liver fibrosis, or cirrhosis.

13. Use of a compound or a pharmaceutically acceptable salt thereof described in any one of paragraphs 1 to 3 for the prevention or treatment of liver disease.

14. In paragraph 13, The use is characterized in that the above liver disease is liver cancer, chronic liver damage, non-alcoholic or alcoholic liver disease, fatty liver, hepatitis, liver fibrosis, or cirrhosis.

Images