Variant transcriptional regulator protein and citrulline production method using same

Abstract

The present application relates to a variant transcriptional regulator protein, a microorganism having same, and a citrulline production method using the microorganism. The microorganism having the variant transcriptional regulator protein can produce a higher yield of citrulline than a microorganism having an existing wild-type transcriptional regulator protein.

Description

Mutant transcription regulator protein and method for producing citrulline using the same

[0001] The present application relates to a mutant transcription regulator protein and a method for producing citrulline using the same.

[0002] Microorganisms of the genus Corynebacterium, particularly Corynebacterium glutamicum, are Gram-positive microorganisms widely used for amino acid production. For amino acid production, target-substance-specific approaches are primarily used, such as increasing the expression of genes encoding enzymes primarily involved in amino acid biosynthesis in Corynebacterium strains or deleting genes unnecessary for amino acid biosynthesis (US 9644009 B2).

[0003] However, there is still a growing need for research into methods to efficiently produce amino acids.

[0004] The present application provides a mutant transcription regulator protein in which the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine.

[0005] The present application provides a polynucleotide encoding a mutant transcription regulator protein of the present application.

[0006] The present application provides a microorganism comprising at least one of a mutant transcription regulator protein of the present application; a polynucleotide encoding the protein; and a vector comprising the polynucleotide.

[0007] The present application provides a method for producing citrulline, comprising the step of culturing a microorganism comprising at least one of a mutant transcription regulator protein of the present application; a polynucleotide encoding the protein; and a vector comprising the polynucleotide in a medium.

[0008] When a microorganism producing citrulline is cultured using the mutant transcription regulator protein of the present application, high yields of citrulline production are possible compared to microorganisms having the existing wild-type transcription regulator protein.

[0009] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below. Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated into this specification in their entirety by reference to more clearly explain the level of the technical field to which this application belongs and the contents of this application.

[0010]

[0011] One aspect of the present application provides a mutant transcription regulator protein, wherein the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine.

[0012]

[0013] In the present application, the term "variant transcription regulator protein" means a variant comprising a substitution of an amino acid corresponding to position 171 from the N-terminus of SEQ ID NO: 1 into asparagine in any polypeptide or transcription regulator protein having the function of regulating the transcription of a gene. The "variant transcription regulator protein" may also be referred to as "transcription regulator protein variant", "variant transcription regulator", "transcription regulator variant', "genR variant", "variant genR", etc.

[0014]

[0015] The protein to be subjected to mutation in the present application may be a protein having the activity of regulating gene transcription. Specifically, the protein may comprise the amino acid sequence of SEQ ID NO: 1 and may have the activity of regulating gene transcription, but is not limited thereto. This does not exclude meaningless sequence additions before and after the amino acid sequence of SEQ ID NO: 1, mutations that may occur naturally, or silent mutations thereof, and if it has the same or corresponding activity as the protein comprising the amino acid sequence of SEQ ID NO: 1, it may correspond to the protein to be subjected to mutation in the present application. For example, the protein to be subjected to mutation in the present application may be a protein consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity therewith. In addition, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added is also included within the scope of the protein that is the subject of mutation in the present application, provided that the amino acid sequence has such homology or identity and exhibits an effect corresponding to the protein.

[0016]

[0017] In this application, the term "transcriptional regulator protein" refers to a protein that regulates gene transcription, and may be used interchangeably with "transcriptional regulator." The amino acid sequence of the transcriptional regulator can be obtained from a known database, such as NCBI's Genebank.

[0018] For example, the transcription regulator protein of the present application may be derived from a microorganism, specifically from a prokaryotic microorganism or a eukaryotic microorganism, and more specifically from a microorganism of the genus Corynebacterium, but is not limited thereto.

[0019] As another example, the transcription regulator protein may be BAC00418.1 or WP_004567940.1 from a microorganism of the genus Corynebacterium, but it is clear that it includes proteins having the activity of regulating transcription of genes of various origins.

[0020] In the present application, the amino acid sequence before modification of the transcription regulator protein to be mutated, i.e., the amino acid before modification corresponding to position 171 of SEQ ID NO. 1 in the sequence that can be the parent sequence, may be aspartic acid (D).

[0021]

[0022] The mutant transcription regulator protein of the present application may have an amino acid at position 171 in the amino acid sequence of SEQ ID NO: 1 substituted with asparagine.

[0023] As another example, the mutant transcription regulator protein of the present application may have, comprise, consist of, or consist essentially of the amino acid sequence set forth in SEQ ID NO: 9.

[0024]

[0025] The mutant transcription regulator protein of the present application may include an amino acid sequence in which the amino acid corresponding to the 171st position based on the amino acid sequence of SEQ ID NO: 1 is an amino acid other than aspartic acid, for example, asparagine, and has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, or 99.4%, but less than 100% homology or identity with the amino acid sequence described in SEQ ID NO: 1. In addition, it is obvious that a mutant transcription regulator protein having an amino acid sequence in which a part of the sequence is deleted, modified, substituted, conservatively substituted, or added is also included within the scope of the present application, as long as it has such homology or identity and exhibits an effect corresponding to the mutant transcription regulator protein of the present application.

[0026] For example, if the amino acid sequence has sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions that do not alter the function of the mutant transcription regulator protein of the present application at the N-terminus, C-terminus and / or within the amino acid sequence.

[0027] The term "conservative substitution" refers to the replacement of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions may generally be based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of a protein or polypeptide.

[0028]

[0029] As used herein, the term "variant protein" or "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, thereby differing from the amino acid sequence of the variant before the mutation, but retaining functions or properties. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the ability of the variant may be increased, unchanged, or decreased compared to the polypeptide before the mutation. Furthermore, some variants may include variants in which one or more portions, such as the N-terminal leader sequence or the transmembrane domain, are deleted. Other variants may include variants in which portions are deleted from the N- and / or C-terminus of the mature protein. The term "variant protein" may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited thereto as long as the term is used in the meaning of mutation. For the purpose of the present application, the variant may be a polypeptide in which the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine. For example, the variant may be a polypeptide including the amino acid sequence set forth in SEQ ID NO: 9, but is not limited thereto.

[0030] Additionally, variants may include deletions or additions of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, the N-terminus of the variant may be conjugated with a signal (or leader) sequence involved in co-translational or post-translational protein translocation. Furthermore, the variant may be conjugated to other sequences or linkers to facilitate identification, purification, or synthesis.

[0031]

[0032] In this application, the terms "homology" or "identity" refer to the degree of similarity between two given amino acid sequences or base sequences, which may be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0033] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences can generally hybridize with all or part of the sequence under moderate or high stringency conditions. It should be appreciated that hybridization also includes hybridization with polynucleotides containing common codons or codons that take codon degeneracy into account.

[0034] Whether any two polynucleotide or polypeptide sequences are homologous, similar or identical can be determined using known computer algorithms such as the "FASTA" program using default parameters, for example as in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO et al / .](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information Database.

[0035] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information, for example, using a GAP computer program such as that of Needleman et al. (1970), J Mol Biol. 48:443, as disclosed, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In brief, the GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program are (1) a unitary matrix (containing values ​​of 1 for identity and 0 for non-identity) and (2) a matrix of 1 and 0 for identity, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), Gribskov et al. (1986) Nucl. Acids Res. 14: 6745 weighted comparison matrix (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0036] As an example of the present application, the mutant transcription regulator protein of the present application may have an activity that increases amino acid production capacity compared to a wild-type polypeptide having an activity of regulating transcription of a gene.

[0037]

[0038] As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the residue listed in the polypeptide. Identifying an amino acid at a corresponding position may be determining a specific amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0039] For example, any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position at which a modification such as a substitution, insertion, or deletion occurs, by comparing it to a query sequence (also referred to as a “reference sequence”).

[0040] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but is not limited thereto, and any sequence alignment program known in the art, pairwise sequence comparison algorithm, etc. can be appropriately used.

[0041]

[0042] Another aspect of the present application provides a polynucleotide encoding a mutant transcription regulator protein of the present application.

[0043] The transcription regulator protein of the present application may be encoded by the genR gene.

[0044] For example, the genR gene may be a polynucleotide encoding BAC00418.1 or WP_004567940.1 derived from a microorganism of the genus Corynebacterium, but is not limited thereto. In another example, the genR gene may be a genR gene derived from a microorganism of the genus Corynebacterium. In another example, the genR gene may be a part of CP016335.1 or AP022856.1 derived from a microorganism of the genus Corynebacterium. However, it is obvious that the present invention includes genR genes of various origins that encode proteins having transcriptional regulator protein activity, without being limited thereto.

[0045] In this application, the term "polynucleotide" means a polymer of nucleotides in which nucleotide units (monomers) are covalently bonded to form a long chain, a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the mutant transcription regulator protein.

[0046] The polynucleotide encoding the mutant transcription regulator protein of the present application may include a base sequence encoding a mutant transcription regulator protein in which the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine. For example, the polynucleotide of the present application may include a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 9. As a more specific example of the present application, the polynucleotide of the present application may have or include the sequence of SEQ ID NO: 10. In addition, the polynucleotide of the present application may consist of, or consist essentially of, the sequence of SEQ ID NO: 10.

[0047] The polynucleotide of the present application can have various modifications made to the coding region within a range that does not change the amino acid sequence of the mutant transcription regulator protein of the present application, taking into account the degeneracy of the codon or the codon preferred in the organism that is to express the mutant transcription regulator protein of the present application. Specifically, the polynucleotide of the present application has or includes a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 10, or may consist of or consist essentially of a base sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, and less than 100% homology or identity with the sequence of SEQ ID NO: 10, but is not limited thereto. At this time, in the sequence having the homology or identity, the codon encoding the amino acid corresponding to the 171st position of SEQ ID NO: 1 may be one of the codons encoding an amino acid other than aspartic acid, for example, asparagine.

[0048] In addition, the polynucleotide of the present application may include, without limitation, a probe that can be prepared from a known genetic sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions in which polynucleotides having high homology or identity hybridize with each other, polynucleotides having 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity hybridize with each other, and polynucleotides having lower homology or identity do not hybridize with each other, or conditions in which washing is performed once, specifically twice or three times, at a salt concentration and temperature equivalent to 60°C, 1ХSSC, 0.1% SDS, specifically 60°C, 0.1ХSSC, 0.1% SDS, and more specifically 68°C, 0.1ХSSC, 0.1% SDS, which are washing conditions of typical southern hybridization, are performed.

[0049] Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present application may also include isolated nucleic acid fragments that are complementary in their entirety, as well as substantially similar nucleic acid sequences.

[0050] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be, but is not limited to, 60°C, 63°C, or 65°C, and can be appropriately adjusted by a person skilled in the art depending on the purpose.

[0051] The appropriate stringency for hybridizing the polynucleotides depends on the length and degree of complementarity of the polynucleotides, variables which are well known in the art (e.g., J. Sambrook et al., supra).

[0052]

[0053] Another aspect of the present application provides a vector comprising the polynucleotide of the present application.

[0054] The above vector may be an expression vector for expressing the above polynucleotide in a host cell, but is not limited thereto.

[0055] The vector of the present application may comprise a DNA construct comprising a base sequence of a polynucleotide encoding a target polypeptide operably linked to a suitable expression control region (or expression control sequence) so as to enable expression of the target polypeptide in a suitable host. The expression control region may comprise a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences regulating the termination of transcription and translation. The vector may be capable of replicating or functioning independently of the host genome after being transformed into a suitable host cell, or may be integrated into the genome itself.

[0056] The vector used in the present application is not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ series, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used as plasmid vectors. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors can be used.

[0057] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for intracellular chromosomal insertion. The insertion of the polynucleotide into the chromosome can be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming the chromosomal insertion can be additionally included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the insertion of the target nucleic acid molecule. Markers that confer a selectable phenotype, such as drug resistance, nutrient requirement, cytotoxic agent resistance, or expression of a surface polypeptide, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, so that transformed cells can be selected.

[0058] The term "transformation" in this application refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may be located within the chromosome of the host cell or located extrachromosomally, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form as long as it can be introduced into the host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct containing all elements necessary for autonomous expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal, all of which are operably linked to the polynucleotide. The above expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.

[0059] Additionally, the term "operably linked" as used herein means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target mutant transcription regulator protein of the present application.

[0060]

[0061] Another aspect of the present application provides a microorganism comprising a mutant transcription regulator protein of the present application or a polynucleotide of the present application.

[0062] The strain of the present application may comprise a mutant transcription regulator protein of the present application, a polynucleotide encoding the polypeptide, or a vector comprising the polynucleotide of the present application.

[0063] In this application, the term "microorganism (or strain)" includes both wild-type microorganisms and microorganisms that have undergone genetic modification naturally or artificially, and may be a microorganism that has a specific mechanism weakened or strengthened due to causes such as insertion of an external gene or enhanced or inactivated activity of an endogenous gene, and may be a microorganism that includes genetic modification for the production of a desired polypeptide, protein or product.

[0064] The strain of the present application may be a strain that naturally possesses citrulline production ability, or a microorganism in which citrulline production ability has been conferred on a strain that lacks citrulline production ability. For example, the strain may be a microorganism in which citrulline production ability has been increased by introducing the mutant transcriptional regulator protein of the present application or a polynucleotide encoding the same, but is not limited thereto.

[0065]

[0066] The strain of the present application may be a microorganism having increased citrulline production capacity compared to a parent strain or a wild-type Corynebacterium strain that does not contain the variant of the present application. The microorganism may have improved citrulline production capacity due to the introduction of the variant of the present application.

[0067] For example, the target strain for comparing whether the citrulline production ability is increased, the transcription regulator protein-unmodified microorganism may be a citrulline-producing strain (ATCC 13869), but is not limited thereto.

[0068] For example, the recombinant strain with increased productivity may have an increased citrulline productivity of about 1% or more, specifically, about 2% or more, about 3% or more, about 4% or more, about 5% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, about 10% or more, about 11% or more, about 12% or more, about 13% or more, about 14% or more, about 15% or more, about 16% or more, about 17% or more, or about 18% or more (the upper limit is not particularly limited and may be, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less) compared to the parent strain before mutation, the non-modified microorganism, or As long as the amount of increase is positive compared to the production ability of the unmodified microorganism of the transcription regulator protein, it is not limited thereto. In another example, the recombinant strain with increased citrulline production ability has a citrulline production ability of about 1.01 times or more, about 1.02 times or more, about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.06 times or more, about 1.07 times or more, about 1.08 times or more, about 1.09 times or more, about 1.10 times or more, about 1.11 times or more, about 1.12 times or more, about 1.13 times or more, about 1.14 times or more, about 1.15 times or more, about 1.16 times or more, about 1.17 times or more, or about 1.18 times or more (the upper limit is not particularly limited, and for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or more) compared to the parent strain before mutation, the unmodified microorganism, or the unmodified microorganism of the transcription regulator protein. (which may be less than or equal to) may be increased, but is not limited thereto.

[0069] In this application, the term "unmodified microorganism" does not exclude a strain that contains a mutation that can occur naturally in a microorganism, and may refer to a wild-type strain or a natural strain itself, or a strain before its characteristics are changed by genetic mutation caused by natural or artificial factors. In addition, the term "unmodified microorganism containing a transcription regulator protein" in this application may refer to a strain that is not introduced or before the transcription regulator protein variant described herein is introduced. The unmodified microorganism containing a transcription regulator protein in this application does not exclude a strain that contains a modification of a protein or another gene other than a modification of a transcription regulator protein or a polynucleotide encoding the same.

[0070] In this application, the term “unmodified microorganism” may be used interchangeably with “pre-modified strain”, “pre-modified microorganism”, “unmodified strain”, “unmodified microorganism”, or “reference microorganism”.

[0071] The microorganism of the present application may be, but is not limited to, a microorganism comprising a mutant transcription regulator protein or a polynucleotide encoding the same; or a microorganism genetically modified to include a mutant transcription regulator protein or a polynucleotide encoding the same (e.g., a recombinant microorganism). The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by a parent strain, wild type, or unmodified microorganism before a change in phenotype, when the phenotype is changed due to genetic mutation caused by natural or artificial factors. This may be used interchangeably with "activity before modification."

[0072]

[0073] In another example of the present application, the microorganism of the present application is Corynebacterium glutamicum, Corynebacterium stationis, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium It may be Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris or Corynebacterium flavescens, and specifically, but not limited to, Corynebacterium glutamicum.

[0074]

[0075] As another example of the present application, the recombinant microorganism of the present application may be a microorganism with enhanced citrulline production ability by additionally enhancing the activity of a portion of a protein in the citrulline biosynthesis pathway or by weakening the activity of a portion of a protein in the citrulline degradation pathway.

[0076] For example, the microorganism may be a microorganism in which the activity of argR and / or argG is weakened or defective.

[0077]

[0078] In this application, the term "enhancement" of the activity of a polypeptide means that the activity of the polypeptide is increased compared to the intrinsic activity. The term "enhancement" may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may all include exhibiting an activity that was not originally present, or exhibiting an activity that is enhanced compared to the intrinsic activity or the activity before modification. "Enhancement," "up-regulation," "overexpression," or "increase" of the activity of a polypeptide compared to the intrinsic activity means that the activity and / or concentration (expression amount) of a specific polypeptide is enhanced compared to the activity and / or concentration (expression amount) that the parent strain or unmodified microorganism originally had before the transformation.

[0079] The above enhancement can be achieved by introducing an exogenous polypeptide, or by enhancing the activity and / or concentration (expression level) of an endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be determined by an increase in the level of activity, expression level, or amount of product excreted from the polypeptide.

[0080] Enhancement of the activity of the above polypeptide can be achieved by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may be achieved by using genetic engineering and / or protein engineering, which are routine methods of molecular biology and are well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0081] Specifically, the enhancement of the activity of the polypeptide of the present application is

[0082] 1) Increase in the intracellular copy number of a polynucleotide encoding a polypeptide;

[0083] 2) Replacing the gene expression control region on the chromosome encoding the polypeptide with a highly active sequence;

[0084] 3) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0085] 4) Modification of the amino acid sequence of the polypeptide so as to enhance polypeptide activity;

[0086] 5) Modification of the polynucleotide sequence encoding the polypeptide so as to enhance the activity of the polypeptide (e.g., modification of the polynucleotide sequence of the polypeptide gene so as to encode a polypeptide modified so as to enhance the activity of the polypeptide);

[0087] 6) Introduction of a foreign polypeptide exhibiting the activity of the polypeptide or a foreign polynucleotide encoding the same;

[0088] 7) Codon optimization of a polynucleotide encoding a polypeptide;

[0089] 8) Analysis of the tertiary structure of the polypeptide to select the exposed portion and modify or chemically modify it;

[0090] 9) Control of cellular localization of proteins (polypeptides); or

[0091] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0092] for example,

[0093] The increase in the intracellular copy number of the polynucleotide encoding the polypeptide described above may be achieved by introducing into the host cell a vector capable of replicating and functioning independently of the host, to which the polynucleotide encoding the polypeptide is operably linked. Alternatively, the polynucleotide encoding the polypeptide may be achieved by introducing one copy or two or more copies into the chromosome of the host cell. The introduction into the chromosome may be performed by introducing into the host cell a vector capable of inserting the polynucleotide into the chromosome of the host cell, but is not limited thereto. The vector is as described above.

[0094] 2) Replacing the gene expression control region (or expression control sequence) on the chromosome encoding the polypeptide with a sequence having strong activity may be, for example, a mutation in the sequence such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof to further enhance the activity of the expression control region, or replacement with a sequence having stronger activity. The expression control region may include, but is not particularly limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, it may be, but is not limited to, replacing the original promoter with a strong promoter.

[0095] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent No. US 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the lambda phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13 (sm3) promoter (US Patent No. US 10584338 B2), the O2 promoter (US Patent No. US 10273491 B2), the tkt promoter, and the yccA promoter.

[0096] The above 3) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a higher polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0097] The modification of the amino acid sequence or polynucleotide sequence of the above 4) and 5) may be, but is not limited to, a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution or a combination thereof in the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity or an amino acid sequence or polynucleotide sequence improved to have increased activity. The replacement may be specifically performed by inserting the polynucleotide into a chromosome by homologous recombination, but is not limited thereto. The vector used at this time may additionally include a selection marker to confirm whether or not chromosomal insertion has occurred.

[0098] The introduction of the foreign polynucleotide exhibiting the activity of the polypeptide as described above 6) may be the introduction into the host cell of a foreign polynucleotide encoding a polypeptide exhibiting the same / similar activity as the polypeptide. The foreign polynucleotide is not limited in its origin or sequence as long as it exhibits the same / similar activity as the polypeptide. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the polypeptide may be produced by expressing the introduced polynucleotide in the host cell, thereby increasing its activity.

[0099] The above 7) codon optimization of a polynucleotide encoding a polypeptide may be codon optimization of an endogenous polynucleotide to increase transcription or translation within a host cell, or codon optimization of a foreign polynucleotide to achieve optimized transcription or translation within a host cell.

[0100] The above 8) analyzing the tertiary structure of a polypeptide and selecting an exposed portion to modify or chemically modify may be done by, for example, comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins, determining a template protein candidate based on the degree of sequence similarity, confirming the structure based on this, and selecting an exposed portion to modify or chemically modify, and modifying or modifying it.

[0101] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0102] In one embodiment, the enhancement of the activity of the transcription regulator protein of the present application may be achieved by modifying the gene expression control region on the chromosome encoding the polypeptide of 2), by modifying the amino acid sequence or polynucleotide sequence of 4) and 5), or by a combination thereof.

[0103] In any one of the embodiments described above, the enhancement of the activity of the transcription regulator protein of the present application may be achieved by modifying the amino acid sequence of the transcription regulator protein or the polynucleotide sequence encoding the same. Modifications to the amino acid sequence or polynucleotide sequence may include deletions, substitutions, insertions, and the like. The modifications to the sequence are as described above.

[0104] Such enhancement of polypeptide activity may be, but is not limited to, an increase in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or an increase in the amount of a product produced from the polypeptide.

[0105]

[0106] In the microorganism of the present application, modification of part or all of the polynucleotide may be induced by, but is not limited to, (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nucleases (e.g., CRISPR-Cas9) and / or (b) treatment with light and / or chemicals such as ultraviolet rays and radiation. The method for modifying part or all of the gene may include a method using DNA recombination technology. For example, a nucleotide sequence or vector containing a nucleotide sequence homologous to a target gene may be injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene. The injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.

[0107]

[0108] In this application, the term "attenuation" of the activity of a polypeptide (including, for example, proteins specified by the name of each enzyme) includes both a decrease in activity or absence of activity compared to the intrinsic activity. The term "attenuation" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

[0109] The above weakening may also include cases where the activity of the polypeptide itself is reduced or eliminated compared to the activity of the polypeptide originally possessed by the microorganism due to mutation of the polynucleotide encoding the polypeptide, etc., cases where the overall polypeptide activity level and / or concentration (expression amount) within the cell is lower than that of the natural strain due to inhibition of expression of the gene of the polynucleotide encoding the polypeptide or inhibition of translation into a polypeptide, cases where the polynucleotide is not expressed at all, and / or cases where the polypeptide has no activity even if the polynucleotide is expressed. The fact that the activity of the polypeptide is “inactivated, deficient, reduced, downregulated, reduced, attenuated” compared to the intrinsic activity means that the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation is lowered.

[0110] Attenuation of the activity of such polypeptides can be accomplished by any method known in the art, including but not limited to, and can be achieved by application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0111]

[0112] Specifically, the weakening of the activity of the polypeptide of the present application is

[0113] 1) Deletion of all or part of a gene encoding a polypeptide;

[0114] 2) Modification of the expression control region (or expression control sequence) so as to reduce the expression of the gene encoding the polypeptide;

[0115] 3) Modification of the amino acid sequence constituting the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence) so as to eliminate or weaken the activity of the polypeptide;

[0116] 4) Modification of the gene sequence encoding the polypeptide such that the activity of the polypeptide is eliminated or weakened (e.g., deletion / substitution / addition of one or more nucleotide bases in the nucleotide sequence of the polypeptide gene such that the polypeptide is modified such that the activity of the polypeptide is eliminated or weakened);

[0117] 5) Modification of the base sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide;

[0118] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to a transcript of the gene encoding the polypeptide;

[0119] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible;

[0120] 8) Addition of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE);

[0121] 9) Control of cellular localization of proteins (polypeptides); or

[0122] 10) It may be a combination of two or more of the above 1) to 9), but is not particularly limited thereto.

[0123] for example,

[0124] The above 1) deletion of part or all of the gene encoding the polypeptide may be the removal of the entire polynucleotide encoding the endogenous target polypeptide in the chromosome, replacement with a polynucleotide having some nucleotides deleted, or replacement with a marker gene.

[0125] In addition, the above 2) modification of the expression control region (or expression control sequence) may be a mutation in the expression control region (or expression control sequence) by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, or replacement with a sequence having weaker activity. The expression control region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.

[0126] The modification of the amino acid sequence or polynucleotide sequence of the above 3) and 4) may be, but is not limited to, a mutation in the sequence of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide, such as deletion, insertion, non-conservative or conservative substitution, or a combination thereof, so as to weaken the activity of the polypeptide, or replacement with an amino acid sequence or polynucleotide sequence improved to have weaker activity, or an amino acid sequence or polynucleotide sequence improved to have no activity. For example, the expression of the gene may be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but is not limited thereto.

[0127] The above 5) modification of the base sequence encoding the initiation codon or 5'-UTR region of the gene transcript encoding the polypeptide may be, for example, a substitution with a base sequence encoding another initiation codon having a lower polypeptide expression rate than the endogenous initiation codon, but is not limited thereto.

[0128] The introduction of an antisense oligonucleotide (e.g., antisense RNA) that complementarily binds to the transcript of the gene encoding the polypeptide 6) above can be described, for example, with reference to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0129] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence in front of the Shine-Dalgarno sequence of a gene encoding a polypeptide to form a secondary structure to which ribosome attachment is impossible may render mRNA translation impossible or slow it down.

[0130] In addition, the addition of a promoter transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide (Reverse transcription engineering, RTE) may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.

[0131] The above 9) regulation of the intracellular location of a protein (polypeptide) may target the protein (polypeptide) to a specific organelle or specific intracellular space within the cell. For example, targeting to the periplasm or cytoplasm may be achieved by adding or removing a leader sequence that functions in targeting the protein (polypeptide), but is not limited thereto.

[0132] Such attenuation of polypeptide activity may include, but is not limited to, a decrease in the activity or concentration or expression level of the corresponding polypeptide relative to the activity or concentration of the polypeptide expressed in the wild type or pre-transformed microbial strain, or a decrease in the amount of a product produced from the polypeptide.

[0133]

[0134] In the microorganism of the present application, the mutant transcription regulator protein, polynucleotide, etc. are as described in the other aspects above.

[0135]

[0136] Another aspect of the present application provides a method for producing citrulline, comprising the step of culturing a microorganism comprising a mutant transcription regulator protein of the present application or a polynucleotide of the present application in a medium.

[0137] The method for producing citrulline of the present application may include a step of culturing a microorganism comprising the mutant transcription regulator protein of the present application, the polynucleotide of the present application, or the vector of the present application in a medium.

[0138] In this application, the term "cultivation" refers to growing the microorganism of this application under appropriately controlled environmental conditions. The culturing process of this application can be performed using any suitable medium and culture conditions known in the art. This culturing process can be easily adjusted and used by those skilled in the art depending on the selected microorganism. Specifically, the culturing process may be batch, continuous, and / or fed-batch, but is not limited thereto.

[0139] In this application, the term "medium" refers to a material containing nutrients as a main component necessary for culturing the microorganism of this application, and supplies nutrients and growth factors, including water, which is essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing general microorganisms without particular limitation, but the microorganism of this application may be cultured under aerobic conditions while controlling temperature, pH, etc. in a general medium containing an appropriate carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin.

[0140] Specifically, culture media for microorganisms of the genus Corynebacterium can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0141] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; amino acids such as glutamic acid, methionine, lysine, etc. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugar) may be used, and other appropriate amounts of carbon sources may be used in various ways without limitation. These carbon sources may be used alone or in combination of two or more, but are not limited thereto.

[0142] The nitrogen source may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc.; peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean cake or its decomposition product, etc. These nitrogen sources may be used alone or in combination of two or more, but are not limited thereto.

[0143] The above-mentioned components may include potassium phosphate monobasic, potassium phosphate dibasic, or their corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the medium in batch or continuous manner, but are not limited thereto.

[0144] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during the cultivation, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. In addition, in order to maintain the aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or in order to maintain the anaerobic and microaerobic state, nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection, but is not limited thereto.

[0145] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited thereto.

[0146] Citrulline produced by the culture of the present invention may be secreted into the medium or remain within the cells.

[0147]

[0148] The method for producing citrulline of the present application may additionally include a step of preparing a microorganism of the present application, a step of preparing a medium for culturing the microorganism, or a combination thereof (in any order), for example, prior to the culturing step.

[0149] The citrulline production method of the present application may additionally include a step of recovering citrulline from the culture medium (medium in which culture is performed) or microorganism according to the above-mentioned cultivation. The recovering step may be additionally included after the culturing step.

[0150] The above recovery may be performed by collecting the desired amino acid using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous or fed-batch culture method. For example, various chromatographies such as centrifugation, filtration, treatment with a crystallized protein precipitant (salting out method), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC or a combination thereof may be used, and the desired citrulline may be recovered from the medium or microorganism using a suitable method known in the art.

[0151] Additionally, the citrulline production method of the present application may additionally include a purification step. The purification may be performed using any suitable method known in the art. In one example, if the citrulline production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, regardless of order, or may be performed simultaneously or integrated into a single step, but is not limited thereto.

[0152] In the method of the present application, the mutant transcription regulator protein, polynucleotide, vector, strain, etc. are as described in the other embodiments above.

[0153]

[0154] Another aspect of the present application provides a composition for producing citrulline, comprising a mutant transcription regulator protein of the present application, a polynucleotide encoding the same, a vector comprising the polynucleotide, or a microorganism comprising the polynucleotide of the present application; a medium in which the same is cultured; or a combination of two or more thereof.

[0155] The composition of the present application may further comprise any suitable excipient commonly used in compositions for producing citrulline, including but not limited to preservatives, wetting agents, dispersing agents, suspending agents, buffering agents, stabilizers, or isotonic agents.

[0156]

[0157] Another aspect of the present application provides a use of the mutant transcription regulator protein of the present application for producing citrulline.

[0158]

[0159] Another aspect of the present application provides a use of a mutant transcription regulator protein of the present application, a polynucleotide encoding the same, a vector comprising the polynucleotide, or a microorganism comprising the polynucleotide of the present application for producing citrulline.

[0160]

[0161] The above transcription regulator protein, mutant transcription regulator protein, polynucleotide, vector, strain, medium, etc. are as described in the other aspects above.

[0162]

[0163] The present application will be described in more detail below through examples. However, the following examples are merely preferred embodiments intended to illustrate the present application and are therefore not intended to limit the scope of the present application. Furthermore, technical details not described herein can be readily understood and implemented by those skilled in the technical field of the present application or similar fields.

[0164]

[0165] Example 1: Construction of a vector introducing genR mutations

[0166]

[0167] To construct a vector introducing the D171N mutation into the genR gene encoding the transcriptional regulator protein from Corynebacterium glutamicum, the genome of wild-type Corynebacterium glutamicum ATCC 13869 (GenBank: CP016335.1) was used as a template to amplify the homologous recombinant A arm using the primer pairs of SEQ ID NOs: 3 and 4, and the homologous recombinant B arm using the primer pairs of SEQ ID NOs: 5 and 6. The PCR conditions were denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and polymerization at 72°C for 1 min, followed by polymerization at 72°C for 5 min. The amplified PCR fragment was then extracted using a gel purification kit (QIAGEN). The homologous recombinant A arm and B arm gene fragments obtained above were ligated with vector pDCM2 (US Patent Publication No. 2023-0134555 A1) digested with BamHI and XbaI restriction enzymes using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL.6 NO.5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), and then transformed into E. coli DH5α, which was then plated on LB solid medium containing kanamycin (25 mg / L).

[0168] To select transformed colonies, PCR was performed using the primer pair of SEQ ID NOs: 7 and 8. A plasmid was obtained from the selected colonies using a conventional plasmid extraction method and named pDCM2-genR (D171N).

[0169] The primer sequences used here are as shown in Table 1 below.

[0170] SEQ ID NO Sequence Name Sequence (5' -> 3')3D171N_AFtcggtacccggggatccCCGCTGATGCCCAAGAT4D171N_ARTTCTCAAATTCCTCATtGCCCAGGCTGGAATACA5D171N-BFaATGAGGAATTTGAGAA TTTAAGAAAGCGTCTTC6D171N-BRtgcaggtcgactctagaCGAGCTTCAGGAGTTCC7pDCM2_FTATTACGCCAGCTGGCGAAA8pDCM2_RGCTTTACACTTTATGCTTCC

[0171]

[0172] Example 2-1. Production of control group

[0173] To construct a control strain for the L-citrulline production ability evaluation experiment, a vector was constructed in which glutamic acid located at position 47 of the protein sequence of argR (ANU33619.1) was substituted with a stop codon. Using the genome of wild-type C. glutamicum ATCC 13869 as a template, the homologous recombinant A arm was amplified using the primer pair of SEQ ID NOs: 11 and 12, and the homologous recombinant B arm was amplified using the primer pair of SEQ ID NOs: 13 and 14. Thereafter, a plasmid was obtained using the same method as in Example 1, and this plasmid was named pDCM2-argR (E47*).

[0174] In addition, in order to produce a microorganism with improved L-citrulline production ability, a vector was produced in which phenylalanine located at position 68 of the protein sequence of argG (ANU33620.1) was substituted with a stop codon. Using the genome of C. glutamicum ATCC13869 as a template, the homologous recombinant A arm was amplified using primers of SEQ ID NOs: 15 and 16, and the homologous recombinant B arm was amplified using primers of SEQ ID NOs: 17 and 18. Thereafter, a plasmid was obtained by the method described in Example 1, and this plasmid was named pDCM2-argG(F68*).

[0175] The primer sequences used here are as shown in Table 2 below.

[0176] Sequence number Sequence name Sequence (5' -> 3') 11 Primer 9CGGTACCCGGGGATCCCTCGTGCGGAATTCGTGGAG 12 Primer 10ATCCAGCAGCAATTCAGACA 13 Primer 11CTGAATTGCTGCTGGATTAAGGCATCGATATCACCCA 14 Primer 12ATGCCTGCAGGTCGACCCTTCATTTTAAGTTCCTTG 15 Primer 13CGGTACCCGGGGATCCTTCATCGATAGGGTGGG 16 Primer 14GTACTCCTCAGCTTACTCATCCTTTGCATCAACA 17 Primer 15AGTAAGCTGAGGAGTACTGCCTGCCAACCATCAA 18 Primer 16ATGCCTGCAGGTCGACCGACTGGCTTGCCACCCT

[0177] Using the constructed pDCM2-argR(E47*) vector, wild-type C. glutamicum ATCC 13869 was transformed by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and then a second crossover process was performed to obtain a strain in which the 139th base sequence of argR was substituted from guanine (g) to thymine (t), and the 47th base sequence was substituted with a stop codon. PCR and base sequence analysis were performed using a pair of primers of SEQ ID NOs: 11 and 14 that can amplify the adjacent region including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism thus obtained was named C. gl::argR*.

[0178] To create a microorganism with even improved citrulline production from the C. gl::argR* obtained above, the microorganism was obtained in the same manner using the pDCM2-argG(F68*) vector. PCR and base sequence analysis were performed using the primer pair of SEQ ID NOs: 15 and 18 capable of amplifying adjacent regions including the position where the gene was inserted, and the genetic manipulation was confirmed. The microorganism obtained in this way was named C. gl::argR*_argG*.

[0179]

[0180] Example 2-2. Production of strains introducing genR mutations

[0181] In order to produce a genR mutant strain based on the C. gl::argR*_argG* strain obtained in Example 2-1, the recombinant plasmid pDCM2-genR (D171N) produced in Example 1 was transformed into the C. gl::argR*_argG* strain by electroporation, and then a genR mutant introduction strain was produced through a second crossing process.

[0182] In order to confirm the base sequence of the genR gene of the strain, a DNA fragment including the genR gene in the chromosome was PCR amplified using the primer pair of SEQ ID NOs: 3 and 6. The PCR conditions were as follows: denaturation at 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes, followed by polymerization at 72°C for 10 minutes. As a result of analyzing the base sequence of the amplified gene, it was confirmed that the mutation introduced into the strain was a transcriptional regulator protein mutant in which a mutation was introduced into the 511 bp base sequence from the genR gene ORF start codon, and the 171st aspartic acid in the amino acid sequence was substituted with asparagine. The obtained strain was named C. gl::argR*_argG*::genR(D171N).

[0183]

[0184] Example 3: Evaluation of citrulline production ability of strains introducing genR mutations

[0185] The C. gl::argR*_argG*::genR(D171N) strain produced in Example 2-2 and the control strain C. gl::argR*_argG* were cultured in the production medium below, and the cell mass and citrulline production ability were compared.

[0186] Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium described below and cultured at 33°C for 72 hours with shaking at 200 rpm. After completion of culture, the amount of citrulline produced was measured using HPLC and is shown in Table 3 below.

[0187] <Production medium (pH 7.2)>

[0188] 50 g of raw sugar, 30 g of (NH4)2SO4, 1 g of yeast extract, 1.1 g of KH2PO4, 1.2 g of MgSO4*7H2O, 0.2 g of L-arginine, 1 mg of biotin, 5 mg of thiamine hydrochloride, 5 mg of calcium-pantothenic acid, 15 mg of nicotinamide, 10 mg of MnSO4, 10 mg of FeSO4, 0.5 mg of ZnSO4, 0.5 mg of CuSO4, 30 g of CaCO3 (based on 1 liter of distilled water)

[0189]

[0190] Strain OD562 Consumption (g / L) Citrulline production (g / L) Citrulline yield (%) C. gl::argR*_argG* 54.75 0.02.2 4.4 C. gl::argR*_argG*::genR(D171N) 56.35 0.02.6 5.2

[0191] As a result, the C. gl::argR*_argG*::genR(D171N) strain showed increased L-citrulline production and yield without significantly affecting the cell mass compared to the control strain, C. gl::argR*_argG*, and it was confirmed that the L-citrulline production ability increased by 18%.

[0192]

[0193] From the above description, those skilled in the art will understand that the present application can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of this application should be interpreted to include all changes or modifications derived from the meaning and scope of the following claims and their equivalents, rather than the detailed description above.

Claims

1. A mutant transcription regulator protein in which the amino acid corresponding to position 171 in the amino acid sequence of sequence number 1 is substituted with asparagine.

2. A polynucleotide encoding a mutant transcription regulator protein of paragraph 1.

3. A microorganism comprising at least one of a mutant transcription regulator protein in which the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine; a polynucleotide encoding the protein; and a vector comprising the polynucleotide.

4. In the third paragraph, the microorganism has increased citrulline production ability compared to a microorganism of the genus Corynebacterium comprising a wild-type transcription regulator protein having the amino acid sequence of sequence number 1 or a polynucleotide encoding the same.

5. In the third paragraph, the microorganism is a microorganism of the genus Corynebacterium.

6. A microorganism according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

7. A method for producing citrulline, comprising the step of culturing a microorganism comprising at least one of a mutant transcription regulator protein in which the amino acid corresponding to position 171 in the amino acid sequence of SEQ ID NO: 1 is substituted with asparagine; a polynucleotide encoding the protein; and a vector comprising the polynucleotide.