Method of unlocking plant regeneration without callus induction

Abstract

In certain embodiments, the present invention provides methods of regenerating plants from plant tissue (e.g., an excised stem cutting or a leaf), wherein all four DRDD genes have been inhibited. In certain embodiments, the propagation medium lacks hormones, and in certain embodiments the propagation medium is shoot induction medium (SIM).

Description

[0001] METHOD OF UNLOCKING PLANT REGENERATION WITHOUT CALLUS INDUCTION

[0002] CROSS-REFERENCE TO RELATED APPLICATION

[0003] This application claims priority to United States Provisional Application Number 63 / 544,750 that was filed on October 18, 2023. The entire content of the applications referenced above is hereby incorporated by reference herein.

[0004] BACKGROUND

[0005] Cytosine methylation is a reversible epigenetic modification of DNA. In many plant species, DNA methylation is concentrated in transposable elements and other repetitive sequences, transcriptionally silencing these genomic regions. DNA methylation also accumulates in gene coding regions, where it does not induce transcriptional silencing. Methylation patterns can be highly conserved over evolutionary time but also dynamic in specific developmental contexts, such as during reproduction. These patterns are a result of methylation activity and demethylation activity, the coordination of which is required to maintain transgenerational epigenetic and phenotypic stability. Methylation is established by de novo DNA methyltransferases, which are guided to their targets by small RNAs in a process termed RNA-directed DNA methylation (RdDM). Symmetric DNA methylation is maintained by maintenance methyltransferase enzymes that copy patterns of DNA methylation after DNA replication.

[0006] In plants, removal of cytosine methylation is accomplished by the four members of the DEMETER (DME) family of 5-methylcytosine DNA glycosylases, named DME, DEMETER- LIKE2 (DML2), DML3, and REPRESSOR OF SILENCING1 (ROS1) in Arabidopsis thaliana. Demethylation by DME is critical for seed development, historically preventing experiments to determine the function of the entire gene family in somatic tissues by mutant analysis. The reproductive defects of dme mutants were bypassed to create somatic quadruple homozygous mutants of the entire DME family, dme rosl: dml2 and dml3 (drdd) leaves exhibit hypermethylated regions compared with wild-type leaves and rdd triple mutants, indicating functional redundancy among all four demethylases. Targets of demethylation included regions co-targeted by RNA-directed DNA methylation and, surprisingly, CG gene body methylation, indicating dynamic methylation at these less-understood sites. Additionally, many tissue- specific methylation differences were absent in drdd, suggesting a role for active demethylation in generating divergent epigenetic states across wild-type tissues. Active DNA demethylation was, therefore, required for proper methylation across somatic tissues and defines the epigenetic landscape of intergenic and coding regions.

[0007] Molecular and morphological phenotypes have been described for plants with mutations in one or more of the 5-mC DNA glycosylases in Arabidopsis and rice (Oryza sativd). Arabidopsis plants heterozygous for dme mutations have a visibly striking phenotype: 50% seed abortion. Seeds that inherit a mutant dme allele from the female parent abort after several days of development and thus homozygous dme mutants have only rarely been recovered. In some Arabidopsis accessions, dme is also not fully transmitted through the male parent. DME is expressed in the polar nuclei and the central cell (the female gamete that is the progenitor of the endosperm) before fertilization and is required to establish gene imprinting in the endosperm after fertilization. In the central cell, DME demethylates specific loci and this hypomethylated state is transmitted to the endosperm after fertilization, such that the maternally inherited endosperm genome is hypomethylated compared with the paternally inherited endosperm genome. DME-dependent endosperm hypomethylated sites are enriched for fragments of transposable elements that reside near genes. DME is also active in the pollen vegetative cell and similar targets are hypomethylated in a DME-dependent manner in both the vegetative cell and endosperm. Like Arabidopsis, rice central cells and vegetative cells are hypomethylated. Mutations in a rice DME homolog (termed ROSld) have a similar phenotype as Arabidopsis dme mutants — maternal null alleles disrupt endosperm development, and mutant maternal or paternal alleles are only rarely transmitted to progeny. ROSla is also responsible for DNA demethylation in the vegetative cell and likely also in the central cell. Although Arabidopsis DME is mostly highly expressed in reproductive tissues, expression is also detected in vegetative tissues. The function of DME outside of reproductive tissues is less well understood.

[0008] Arabidopsis plants with mutations in any of the other three DNA glycosylases lack visibly dramatic phenotypes under standard growth conditions and all null mutants are viable singly and in combination. However, some phenotypes have been observed. Stomatai precursor-cell density is increased in rosl leaves due to hypermethylation and transcriptional silencing of a negative regulator of precursor cells. Additionally, rosl single mutants and rosR dml2 dml3 (rdd triple mutants exhibit impaired tracheary element differentiation, resulting in a high frequency of protoxylem discontinuities. Plants with mutations in rosl and rdd exhibit enhanced susceptibility to bacterial and fungal pathogens, which is associated with decreased expression of biotic stress genes and, in a handful of examined genes, promoter hypermethylation at TE sequences. Genome-wide profiling of DNA methylation in rosl plants and rdd plants indicates DNA hypermethylation at hundreds or thousands of intergenic regions and transposable elements that are also targeted by RdDM and are enriched near genes. Most of the DNA methylation changes in rdd are not obviously associated with changes in gene transcription. Thus, it is thought that one function of the DNA demethylation in vegetative tissues is to “clean up” after a robust DNA methylation system to keep genes free from methylation.

[0009] Although genetic approaches have proved fruitful in understanding the function of 5-mC DNA glycosylases, the inability to generate homozygous mutant dme plants has stymied full understanding of this gene family. RNAi was used to knockdown DME expression in vegetative tissues of the rdd triple mutant. These plants are even more susceptible to a fungal pathogen and additional hypermethylation was shown at a few loci. These data suggest that vegetative tissue of rdd plants retain some demethylation activity from DME. Recently, homozygous mutant dme- 2 plants in the Landsberg erecta (Ler) background were isolated, which display root and shoot defects related to meristem alterations. To identify the full extent of demethylation activity, plants were created where dme was complemented only in the central cell, allowing the examination of methylation and transcription on a genome-wide scale in vegetative tissues null for all four 5-methylcytosine DNA glycosylases.

[0010] Accordingly, methods of regenerating a fully intact and morphologically normal body plant using a hormone-free process are needed.

[0011] SUMMARY

[0012] In certain aspects, provided herein is a method of propagating a plant comprising: (a) excising a leaf from a plant, (b) performing gene manipulation in the leaf, (c) placing the excised leaf abaxial surface down on propagation medium lacking hormones, and (d) incubating the excised leaf under standard growth conditions.

[0013] In certain aspects, provided herein is a method of propagating a plant comprising: (a) excising a cutting from a plant, (b) performing gene manipulation on the excised cutting, (c) placing the excised cutting on propagation medium, and (d) incubating the excised cutting under standard growth conditions. A “cutting” as used herein comprises an isolated portion of a plant and may refer to an excised stem, leaf or other plant organ. In some embodiments, a cutting comprises one or more plant organs such as a stem portion and / or a leaf.

[0014] In certain aspects, in step (d) the incubation period is until shoot organs have regenerated to form a regenerated plant.

[0015] In certain aspects, in step (d) the incubation period is until both roots and shoot organs have regenerated to form a regenerated plant.

[0016] In certain aspects, in step (d) the incubation period is for about 2-5 weeks.

[0017] In certain aspects, the method further comprises (e) transferring the regenerated plant to soil.

[0018] In certain aspects, the gene editing or genetic transformation is by gene editing or genetic transformation.

[0019] In certain aspects, the excised cutting is excised at the base of a leaf blade.

[0020] In certain aspects, the gene manipulation inhibits all four DRDD enzymes.

[0021] In certain aspects, the cutting is a leaf.

[0022] In certain aspects, the excised leaf is placed abaxial surface down on the SIM.

[0023] In certain aspects, the cutting is a stem cutting.

[0024] In certain aspects, the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

[0025] In certain aspects, the propagation medium is shoot induction medium (SIM).

[0026] In certain aspects, the propagation medium lacks hormones.

[0027] In certain aspects, the propagation medium is Gamborg’s B5 medium lacking hormones.

[0028] In certain aspects, provided herein is a method of propagating a plant comprising: (a) excising a leaf from a plant, (b) placing the excised leaf abaxial surface down on propagation medium containing chemical inhibitors for DRDD enzymes, wherein the propagation medium lacks hormones, and (c) incubating the excised leaf under standard growth conditions.

[0029] In certain aspects, provided herein is a method of propagating a plant comprising: (a) excising a cutting from a plant, (b) placing the excised cutting on propagation medium containing chemical inhibitors for DRDD enzymes, wherein the propagation medium is SIM and (c) incubating the excised cutting under standard growth conditions. In certain aspects, in step (c) the incubation period is until shoot organs have regenerated to form a regenerated plant.

[0030] In certain aspects, in step (c) the incubation period is until both roots and shoot organs have regenerated to form a regenerated plant.

[0031] In certain aspects, in step (c) the incubation period is for about 2-5 weeks.

[0032] In certain aspects, the method further comprises (d) transferring the regenerated plant to soil.

[0033] In certain aspects, the chemical inhibitor is a DNA glycosylase inhibitor, an AP endonuclease inhibitor, or a short patch repair inhibitor.

[0034] In certain aspects, the chemical inhibitor is a DNA glycosylase inhibitor.

[0035] In certain aspects, the DNA glycosylase inhibitor is juglone, 2-thioxanthine or tryptophan-p-1 (Trp-P-1).

[0036] In certain aspects, the chemical inhibitor is an AP endonuclease inhibitor.

[0037] In certain aspects, the AP endonuclease inhibitor is as 3-CCPPA, 7 nitro-indole carboxylic acid, 2-BBIDA, E3330, Lucanthone or AR03.

[0038] In certain aspects, the chemical inhibitor is a short patch repair inhibitor.

[0039] In certain aspects, the short patch repair inhibitor is oleanolic acid, Edgeworin, Myristinin A, oleanolic acid or Harbatinic acid. In certain embodiments, the chemical inhibitor is a base analog. In certain embodiments, the base analog is IdU.

[0040] In certain aspects, the chemical inhibitor inhibits all four DRDD enzymes.

[0041] In certain aspects, the cutting is a leaf.

[0042] In certain aspects, the excised leaf is placed abaxial surface down on the SIM.

[0043] In certain aspects, the cutting is a stem cutting.

[0044] In certain aspects, the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

[0045] In certain aspects, provided herein is a method of propagating a plant comprising: (a) excising a cutting from a plant, (b) delivering an RNAi molecule to the excised cutting, (c) placing the excised cutting on propagation medium, and (d) incubating the excised cutting under standard growth conditions.

[0046] In certain aspects, in step (c) the incubation period is until shoot organs have regenerated to form a regenerated plant. In certain aspects, in step (d) the incubation period is until both roots and shoot organs have regenerated to form a regenerated plant.

[0047] In certain aspects, in step (d) the incubation period is for about 2-5 weeks.

[0048] In certain aspects, the propagation medium is shoot induction medium (SIM).

[0049] In certain aspect, the propagation medium lacks hormones.

[0050] In certain aspects, the propagation medium is Gamborg’s B5 medium lacking hormones.

[0051] In certain aspects, the method further comprises (e) transferring the regenerated plant to soil.

[0052] In certain aspects, the RNAi molecule is an siRNA molecule that inhibits transcripts encoding a DRDD enzyme.

[0053] In certain aspects, the siRNA molecule is an inverted repeat RNA targeting DRDD genes for transcriptional silencing.

[0054] In certain embodiments, the siRNA molecule is an inverted repeat hairpin RNA targeting the first exon of DRDD genes.

[0055] In certain embodiments, the inverted repeat hairpin RNA is selected from the following:

[0056] Rice:

[0057] UCGGUAGUUUAUAUUUGUUUUUACGCAUUCUUCAUUGACUGUAUGUAUUUGAUG UUGAUACCCUGGGCUGUCUUAUUUUAUAGGUGGAUGCUGGGAGGCCACAUAGGA GGCCUGUGUGAUCCAAGUGUGCUGCUCCUGAGUUGAAAUUGCAUAGCCAUAUAG CAACUACUGGUGUAAACUUGAGAGAUGAAGUAGUGAAAGGAAAUAUGCAGGAUU UUGGACAAUGGCUGCCUCAAUCUCAGACCACUGCCGAUCUAUAUUUCUCCAGUA UUCCAAUACCAUCACAGUUCGAUACUUCCAUAGAGACGCAGACUAGAACUUCUG CAGUUGUAUCGUCAGAGAAAGAAUCUGCUAAUUCGUUCGUCCCUCAUAAUGGUA CUGGGCUUGUUGAACGCAUUAGCAAUGAUGCUGGGCUAACUGAAGUAGUUGGAA GUAGUGCUGGACCAACUGAAUGUAUUGACUUGAACAAGACACCAGCACGGAAAC CCAAGAAGAAAAAGCACAGGCCAAAGGUGCUAAAGGACGAUAAACCAUCGAAGA CACCUAAAUCUGCUACUCCAAUACCUUCAACAGAAAAGGUAGAAAAACCAUCUG GAAAGAGAAAAUAUGUCCGCAAGAAAUAUCUACCCGCUUCGCGUCGGCAUCCGG UCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUU ACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAAC GUGCUGAUGGUGCACGACCACGCAUUAAUUUCUUGCGGACAUAUUUUCUCUUUC CAGAUGGUUUUUCUACCUUUUCUGUUGAAGGUAUUGGAGUAGCAGAUUUAGGUG UCUUCGAUGGUUUAUCGUCCUUUAGCACCUUUGGCCUGUGCUUUUUCUUCUUGG

[0058] GUUUCCGUGCUGGUGUCUUGUUCAAGUCAAUACAUUCAGUUGGUCCAGCACUAC

[0059] UUCCAACUACUUCAGUUAGCCCAGCAUCAUUGCUAAUGCGUUCAACAAGCCCAGU

[0060] ACCAUUAUGAGGGACGAACGAAUUAGCAGAUUCUUUCUCUGACGAUACAACUGC

[0061] AGAAGUUCUAGUCUGCGUCUCUAUGGAAGUAUCGAACUGUGAUGGUAUUGGAAU

[0062] ACUGGAGAAAUAUAGAUCGGCAGUGGUCUGAGAUUGAGGCAGCCAUUGUCCAAA

[0063] AUCCUGCAUAUUUCCUUUCACUACUUCAUCUCUCAAGUUUACACCAGUAGUUGC

[0064] UAUAUGGCUAUGCAAUUUCAACUCAGGAGCAGCACACUUGGAUCACACAGGCCU CCUAUGUGGCCUCCCAGCAUCCACCUAUAAAAUAAGACAGCCCAGGGUAUCAACA

[0065] UCAAAUACAUACAGUCAAUGAAGAAUGCGUAAAAACAAAUAUAAACUACCGA (SEQ ID NO: 1).

[0066] Soybean:

[0067] UUAAAAAACAUAAACCAAGGCCUAAAGUGGAUCUUGAUGCAGAAACAGAGAGAA

[0068] CCUGGAAACUAUUGAUGGGCAAAGGAGGAAGUGAAGGCCUUGAAGGAACUGACA

[0069] AGGAAAAAGAGAAGUGGUGGGACGAAGAAAGAAAUGUUUUUCACGGACGAGUUG

[0070] AUUCCUUCAUUGCACGGAUGCAUCUUAUUCAAGGAGAUAGACGCUUUUCAAAGU

[0071] GGAAAGGAUCUGUUGUUGACUCGGUGAUAGGUGUUUUCCUCACUCAGAAUGUUU

[0072] CAGACCAUCUUUCAAGCUCUGCCUUUAUGUCUCUAGCAUCAAGGUUUCCUCUUCA

[0073] GUCAAAAAGCAGCAAGAAAUCAUAUGAUGUUGACACAAACACAUUGCUUAAAGA

[0074] AGCAGAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGA

[0075] ACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGA

[0076] AGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCA

[0077] CGCAUUAAUCUGCUUCUUUAAGCAAUGUGUUUGUGUCAACAUCAUAUGAUUUCU

[0078] UGCUGCUUUUUGACUGAAGAGGAAACCUUGAUGCUAGAGACAUAAAGGCAGAGC

[0079] UUGAAAGAUGGUCUGAAACAUUCUGAGUGAGGAAAACACCUAUCACCGAGUCAA

[0080] CAACAGAUCCUUUCCACUUUGAAAAGCGUCUAUCUCCUUGAAUAAGAUGCAUCC

[0081] GUGCAAUGAAGGAAUCAACUCGUCCGUGAAAAACAUUUCUUUCUUCGUCCCACC ACUUCUCUUUUUCCUUGUCAGUUCCUUCAAGGCCUUCACUUCCUCCUUUGCCCAU

[0082] CAAUAGUUUCCAGGUUCUCUCUGUUUCUGCAUCAAGAUCCACUUUAGGCCUUGG UUUAUGUUUUUUAA (SEQ ID NO: 2). Maize:

[0083] AAGAAAGAAGAGUGUUCAGAGGACGGGUUGAUUCAUUCAUUGCUCGUAUGCAUC

[0084] UAGUUCAGGGGGAUAGGCGUUUCUCUCGAUGGAAAGGAUCAGUCGUGGAUUCAG

[0085] UCGUGGGUGUAUUUCUUACCCAGAAUGUUUCAGAUCAUCUUUCUAGUUCUGCUU

[0086] UCAUGGCGGUUGCUGCCAAAUUUCCUGUUAAGAUAGAGGUCCCUAAAAAACCUG

[0087] UGGCUGAGAUGUCUCAUACUCCUGAACAGAAGGAUAGUUGUUCUGGACUGUUUG

[0088] GUGAUUCUAUCAAAUUGCAGGGCAAUAUAUACAUUGAAGAGAUAAGUGACAUUA

[0089] AAUCGUUAAUUACUACAGAAGAUAAUGAAGAAAGUAAUAAAUAUCUACCCGCUU

[0090] CGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCAC

[0091] AAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGC

[0092] AAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUUAUUACUUU

[0093] CUUCAUUAUCUUCUGUAGUAAUUAACGAUUUAAUGUCACUUAUCUCUUCAAUGU

[0094] AUAUAUUGCCCUGCAAUUUGAUAGAAUCACCAAACAGUCCAGAACAACUAUCCU

[0095] UCUGUUCAGGAGUAUGAGACAUCUCAGCCACAGGUUUUUUAGGGACCUCUAUCU

[0096] UAACAGGAAAUUUGGCAGCAACCGCCAUGAAAGCAGAACUAGAAAGAUGAUCUG

[0097] AAACAUUCUGGGUAAGAAAUACACCCACGACUGAAUCCACGACUGAUCCUUUCC

[0098] AUCGAGAGAAACGCCUAUCCCCCUGAACUAGAUGCAUACGAGCAAUGAAUGAAU

[0099] CAACCCGUCCUCUGAACACUCUUCUUUCUU (SEQ ID NO: 3).

[0100] Sorghum:

[0101] CCACUAUGAUGUGGAACUUAUUAAUGGGGCCAGAUAUGGGUGAUGGUGCUGAAG

[0102] GGUUGGACAAGGAUAAAGAGAAGUGGCUUGACGAAGAAAGAAGAGUGUUCAGAG

[0103] GACGGGUUGAUUCAUUCAUUGCUCGUAUGCAUCUAGUUCAGGGGGACAGGCGUU

[0104] UCUCUCGAUGGAAAGGAUCAGUUGUGGACUCAGUUGUGGGUGUAUUUCUUACCC

[0105] AGAAUGUUUCAGAUCAUCUUUCUAGUUCUGCUUUCAUGGGGGUUGCUGCCAAAU

[0106] UUCCAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAAC

[0107] AGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAG

[0108] AUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACG

[0109] CAUUAAUGGAAAUUUGGCAGCAACCCCCAUGAAAGCAGAACUAGAAAGAUGAUC

[0110] UGAAACAUUCUGGGUAAGAAAUACACCCACAACUGAGUCCACAACUGAUCCUUU

[0111] CCAUCGAGAGAAACGCCUGUCCCCCUGAACUAGAUGCAUACGAGCAAUGAAUGA

[0112] AUCAACCCGUCCUCUGAACACUCUUCUUUCUUCGUCAAGCCACUUCUCUUUAUCC UUGUCCAACCCUUCAGCACCAUCACCCAUAUCUGGCCCCAUUAAUAAGUUCCACA

[0113] UCAUAGUGG (SEQ ID NO: 4).

[0114] Brassica:

[0115] GCAAAGGUUCAUAUAGAUAAUGAGACGGAUAGAGUCUGGAAGCUUUUGAUGGAG

[0116] AGUAUCGAUAGCGAAGGUGUUGACGGAUCAGACGAGAAGAAGGCCAAAUGGUGG

[0117] GAGGAAGAACGUAAUGUGUUUAGAGGAAGAGCUGACUCAUUCAUAGCACGAAUG

[0118] CAUCUUGUUCAAGGUGAUAGACGCUUUACACCUUGGAAAGGAUCAGUUGUUGAU

[0119] UCUGUGGUUGGAGUGUUUCUCACUCAAAACGUUUCUGAUCAUCUCUCAAGCUCU

[0120] GCGUUUAUGUCACUAGCUGCGGAGUAUCCAGUACCUUUUGUACCCAGCAGUGAC

[0121] UUUGAAGUAGGAGAAAGUAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGG

[0122] CAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCU

[0123] UUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGA

[0124] UGGUGCACGACCACGCAUUAAUCACUUUCUCCUACUUCAAAGUCACUGCUGGGU

[0125] ACAAAAGGUACUGGAUACUCCGCAGCUAGUGACAUAAACGCAGAGCUUGAGAGA

[0126] UGAUCAGAAACGUUUUGAGUGAGAAACACUCCAACCACAGAAUCAACAACUGAU

[0127] CCUUUCCAAGGUGUAAAGCGUCUAUCACCUUGAACAAGAUGCAUUCGUGCUAUG

[0128] AAUGAGUCAGCUCUUCCUCUAAACACAUUACGUUCUUCCUCCCACCAUUUGGCCU

[0129] UCUUCUCGUCUGAUCCGUCAACACCUUCGCUAUCGAUACUCUCCAUCAAAAGCUU

[0130] CCAGACUCUAUCCGUCUCAUUAUCUAUAUGAACCUUUGC (SEQ ID NO: 5).

[0131] Citrus:

[0132] AACAGAUAAGGGAAAGGAGAAGUGGUGGGAAGAGGAAAGGAGGAUAUUCAAAG

[0133] GACGAGCUGAUUCAUUCAUUGCACGGAUGCAUCUUGUACAAGGAGAUAGACGCU

[0134] UCUCAAAAUGGAAGGGAUCAGUUGUUGACUCAGUGAUAGGAGUUUUCCUGACCC

[0135] AGAAUGUUUCAGACCAUCUCUCAAGCUCUGCAUUCAUGUCCUUGGCAGCACGAU

[0136] UUCCUCUUAAGUCAAACAAGAGAACAUGUAACAUAGAUGGUACAAACAUAUUGG

[0137] UUGAAGAACCAGAAGUGUGUAUACGUGCAAAUGAAAGCAUCCAAUGGCAUGAAC

[0138] UUUUGAGGCAUCCAGGAAGCAGCCAAAGCUCUAUUACAAUAUCUACCCGCUUCG

[0139] CGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAA

[0140] ACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAA

[0141] AGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUGUAAUAGAGCU

[0142] UUGGCUGCUUCCUGGAUGCCUCAAAAGUUCAUGCCAUUGGAUGCUUUCAUUUGC

[0143] ACGUAUACACACUUCUGGUUCUUCAACCAAUAUGUUUGUACCAUCUAUGUUACA UGUUCUCUUGUUUGACUUAAGAGGAAAUCGUGCUGCCAAGGACAUGAAUGCAGA

[0144] GCUUGAGAGAUGGUCUGAAACAUUCUGGGUCAGGAAAACUCCUAUCACUGAGUC

[0145] AACAACUGAUCCCUUCCAUUUUGAGAAGCGUCUAUCUCCUUGUACAAGAUGCAU

[0146] CCGUGCAAUGAAUGAAUCAGCUCGUCCUUUGAAUAUCCUCCUUUCCUCUUCCCAC

[0147] CACUUCUCCUUUCCCUUAUCUGUU (SEQ ID NO: 6).

[0148] Sunflower:

[0149] UUUGAGCCAAUCAGGAAACGAAACCAACGUCCUAAAGUAGACCUAGAUCCGGAA

[0150] UCAGAAAGAUUGUGGAACCUGUUGAUGGGUGAUGAAGGAAGUAAGGGCGCUGAA

[0151] AACAUGGAUAAUGAAAAAGAAAAAUGGUGGGAAAAUGAAAGGCGAGUGUUUCG

[0152] UGGGCGAACAGACUCAUUCAUUGCCCGUAUGCAUCUUGUUCAAGGGGAUAGAAG

[0153] AUUCUCACGAUGGAAAGGAUCCGUAGUUGACUCGGUGAUUGGUGUCUUUCUCAC

[0154] ACAGAAUGUUUCUGAUCAUCUUUCAAGUUCUGCCUUCAUGGCACUGGCAGCAAA

[0155] AUUCCCCGUUAAGUCAACAACCGCCGACAAAACAUGCUGCCAAGAAUAUCUACCC

[0156] GCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAA

[0157] CCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCG

[0158] UGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUCUUGG

[0159] CAGCAUGUUUUGUCGGCGGUUGUUGACUUAACGGGGAAUUUUGCUGCCAGUGCC

[0160] AUGAAGGCAGAACUUGAAAGAUGAUCAGAAACAUUCUGUGUGAGAAAGACACCA

[0161] AUCACCGAGUCAACUACGGAUCCUUUCCAUCGUGAGAAUCUUCUAUCCCCUUGAA

[0162] CAAGAUGCAUACGGGCAAUGAAUGAGUCUGUUCGCCCACGAAACACUCGCCUUU

[0163] CAUUUUCCCACCAUUUUUCUUUUUCAUUAUCCAUGUUUUCAGCGCCCUUACUUCC

[0164] UUCAUCACCCAUCAACAGGUUCCACAAUCUUUCUGAUUCCGGAUCUAGGUCUACU

[0165] UUAGGACGUUGGUUUCGUUUCCUGAUUGGCUCAAA (SEQ ID NO: 7).

[0166] In certain embodiments, inverted repeat double stranded RNAs target the DRDD family of additional plant species using homologous DRDD sequences.

[0167] In certain embodiments, the siRNA is a short double stranded RNA comprised of sense and antisense RNA molecules.

[0168] In certain embodiments, the siRNA is selected from the following:

[0169] Rice'. sense: 5 '-GGCGCUUUUCUCCUUGGAAAGGAUC AGUAGUGGACUCUGUAGU-3 '

[0170] (SEQ ID NO: 8) and antisense: 5'-

[0171] ACUACAGAGUCCACUACUGAUCCUUUCCAAGGAGAAAAGCGCC-3' (SEQ ID NO: 9). Soybean'. sense: 5'-

[0172] UGUUUUCCUCACUCAGAAUGUUUCAGACCAUCUUUCAAGCUCUGCCUUUAUGU-3' (SEQ ID NO: 10) and antisense: 5'- ACAUAAAGGCAGAGCUUGAAAGAUGGUCUGAAACAUUCUGAGUGAGGAAAACA- 3' (SEQ ID NO: 11).

[0173] Maize'. sense: 5'- CAGAUCAUCUUUCUAGUUCUGCUUUCAUGGCGGUUGC-3' (SEQ ID NO: 12) and antisense: 5'- GCAACCGCCAUGAAAGCAGAACUAGAAAGAUGAUCUG-3' (SEQ ID NO: 13).

[0174] Sorghum'. sense: 5'-

[0175] CUCGAUGGAAAGGAUCAGUUGUGGACUCAGUUGUGGGUGUAUUUC-3' (SEQ ID NO: 14) and antisense: 5'- GAAAUACACCCACAACUGAGUCCACAACUGAUCCUUUCCAUCGAG-3' (SEQ ID

[0176] NO:15).

[0177] Brassica'. sense: 5'-

[0178] UGGAAAGGAUCAGUUGUUGAUUCUGUGGUUGGAGUGUUUCUCACUCAAAA-3'

[0179] (SEQ ID NO: 16) and antisense: 5'-

[0180] UUUUGAGUGAGAAACACUCCAACCACAGAAUCAACAACUGAUCCUUUCC A -3 ' (SEQ ID NO: 17).

[0181] Citrus'. sense: 5'-

[0182] UGGAAGGGAUCAGUUGUUGACUCAGUGAUAGGAGUUUUCCUGACCCAGAAUGU- 3' (SEQ ID NO: 18) and antisense: 5'- ACAUUCUGGGUCAGGAAAACUCCUAUCACUGAGUCAACAACUGAUCCCUUCCA-3' (SEQ ID NO: 19).

[0183] Sunflower'. sense: 5'-

[0184] AUGCAUCUUGUUCAAGGGGAUAGAAGAUUCUCACGAUGGAAAGGAUC-3' (SEQ ID NO: 20) and antisense: 5'- GAUCCUUUCCAUCGUGAGAAUCUUCUAUCCCCUUGAACAAGAUGCAU-3' (SEQ ID NO: 21).

[0185] In certain aspects, the cutting is a leaf.

[0186] In certain aspects, the excised leaf is placed abaxial surface down on the SIM.

[0187] In certain aspects, the cutting is a stem cutting.

[0188] In certain aspects, the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

[0189] In certain aspects, a plurality of RNAi molecules are delivered to the excised cutting (e.g., stem cutting or leaf), wherein all four DRDD enzyme genes are inhibited.

[0190] In certain aspects, provided herein is a plant regenerated according to any of the methods described herein.

[0191] BRIEF DESCRIPTION OF DRAWINGS

[0192] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0193] Figures 1A-1G. drdd mutants exhibit hormone-free organ regeneration. Fig. 1A. qRT-PCR quantification of root identity gene expression in mature (30 days old) leaves of WT and drdd mutants. Fig. IB. Enhanced root regeneration in drdd leaves relative to WT. Fig. 1C. Frequency of shoot regeneration in WT and drdd plantlets. N experiments = 7. Fig. ID. Representative image of WT and tZraWleaf explants 7 days after cutting). Fig. IE. After root regeneration, drdd explants regenerate shoot meristems and entire body plans (representative images from 1 of 5 biological replicates shown). Fig. IE. drdd mutants exhibit enhanced shoot regeneration under industry-standard tissue culture conditions (etiolated hypocotyls (stem cuttings) incubated on callus induction medium (CIM) followed by cytokinin-rich shoot induction medium (SIM)). Fig. IF. drdd mutants exhibit shoot regeneration on SIM without prior incubation on CIM (representative images shown). Fig. 1G. Quantified rates of shoot regeneration on SIM without prior incubation on CIM. dme and rdd are single and triple mutants of the drdd family.

[0194] Figure 2. A summary of the enzymatic steps of the base excision repair pathway. Diagram adapted from Li et al, 2015, PloS Genet, (doi.org / 10.1371 / joumal.pgen.1004905). DETAILED DESCRIPTION

[0195] The ability to regenerate organs and tissues is one of the most compelling processes in biology. Within the plant kingdom, a wide variety of species possess an extraordinary ability to regenerate whole organs and tissues naturally. Invasive weeds such as Japanese knotweed can regenerate from tiny root fragments in the soil, and many gardeners’ favorites can be propagated by taking cuttings from fully-grown plants. However, this flexible ability to regenerate organs is missing from most economically important crop species, and is currently the single biggest bottleneck for plant biotechnology. While there is an increasingly impressive array of tools to edit the genes of a plant cell, regenerating whole organs and body plans from edited cells via labor-intensive tissue culture remains a painstaking process - often requiring a year or more - and resulting in undesirable mutations and chromosome instability. As the gene editing and genetic engineering of crops will be essential in safeguarding food security in the face of population growth and climate change, unlocking the mechanism underpinning plant regeneration would be both timely and hugely impactful for humanity.

[0196] The roles and regulation of epigenetic information in plants have been studied by the inventors. Epigenetic marks, such as DNA methylation, perform many important functions within the genome, including altering the expression of genes to ensure their transcriptional silencing, robust expression, or increase their dynamic range of expression states. For example, in the mature tissues of wildtype (WT) plants, epigenetic mechanisms strongly silence the genes conferring cell-type identity to the “wrong” cell type (e.g., root cell identity genes are silenced in leaf cells and vice versa). Recently, research has focused on how the activities of DNA methylation writers and erasers combine to shape DNA methylation patterns across the genome. The four enzymes that erase DNA methylation (abbreviated to DRDD) are a family of DNA glycosylases that remove methylated cytosine bases by DNA repair.

[0197] Previously, a complete quadruple mutant knockout of the DRDD pathway (termed drdd mutants) was generated (Williams, B. P., Bechen, L. L., Pohlmann, D. A. & Gehring, M. Somatic DNA demethylation generates tissue-specific methylation states and impacts flowering time. Plant Cell 34, 1189-1206 (2022)). Mature leaves of drdd mutants exhibit an unusual pattern of gene expression. Compared to WT controls, root cell identity genes are expressed to low levels within mature leaves - the “wrong” tissue type (Fig. 1 A). As root cell identity factors are also required for root regeneration from wounded shoot tissues, hormone-free root regeneration assays were performed on leaf cuttings from WT and drdd mutants. Young leaves of drdd mutants regenerated roots faster and more efficiently than WT controls (Fig. 1B-C). Surprisingly, mature (30 days post-germination) leaves of drdd also regenerated roots (Figs. IB, ID). Regeneration is strongly age-dependent in plants, and the organogenesis of roots from mature tissues without callus induction or exogenous hormones is highly unusual.

[0198] After observing capable root regeneration without hormones, drdd explants were further observed. Unexpectedly, these cuttings also spontaneously regenerated shoots, leading to a fully intact and morphologically normal body plant (Fig. ID). While some plants can propagate entire body plants through vegetative cuttings, this ability is missing from wild-type Arabidopsis and most important crop species. These data are the first example of a loss of function mutation enabling complete vegetative propagation in plants. The discovery that full body plant regeneration can be unlocked by mutation to a base excision repair pathway represents an exciting new insight that could enable important new discoveries into the mechanisms underpinning regeneration.

[0199] By demonstrating that drdd mutants gain the ability to naturally regenerate (without hormones or invasive tissue culture methods), it has been shown for the first time that this highly desirable trait can be unlocked by genetic or epigenetic manipulation. This discovery has significant value in the plant biotechnology industry with respect to crop species. There are two immediate paths forward toward commercialization:

[0200] 1) Generating drdd knockouts in crop species with CRISPR-Cas9.

[0201] The initial discovery was made using the model species Arabidopsis. In certain embodiments, this approach is performed using commercially important crop species. Knockout mutations of the DRDD enzymes are achieved in diverse species with CRISPR-Cas9.

[0202] 2) Small molecule inhibition of DRDD enzymes.

[0203] In plants, the DRDD enzymes act on DNA by base excision repair (BER). The BER pathway is a DNA repair pathway that is highly conserved across eukaryotes. While only plants possess the DRDD enzymes, which excise methylcytosine, all of the down-stream machinery for completing the DNA repair process is shared across eukaryotes. In certain embodiments, known chemical inhibitors for each step of the BER pathway (see Figure 2 and Table 1) are used to disrupt DRDD and unlock hormone-free regeneration in the same manner as genetic mutation. In certain embodiments, small molecule inhibitors are used on any species or strain of plant, such as commercial crops. Table 1

[0204] Chemical base excision repair inhibitors In certain embodiments, RNA inhibition of DRDD leads to enhanced regeneration.

[0205] Many small RNAs are cell-to-cell mobile in plants, and exogenous supply of RNA has been shown to lead to down-regulation of target genes within plant tissues. In certain embodiments, adding RNAs that target the DRDD genes / transcripts to plant growth medium offer an attractive approach to suppress the activity of this pathway during the regeneration process. The present disclosure relates to hormone-free methods of regenerating fully intact and morphologically normal body plant.

[0206] Plant Material

[0207] The DRDD family of DNA glycosylases is strongly conserved across all flowering plants, which includes the vast majority of major crop species consumed by humans with only a couple of exceptions. The biochemical function of the DRDD enzymes is known to be the same in all major crops in which it has been studied, including rice, maize, sorghum, tomato, soybean, and Brassica crops such as canola and cabbage. Additionally, the role of DRDD enzymes in plant reproductive development is known to be conserved across flowering plants. In certain embodiments, inhibition of DRDD enzymes improve plant regeneration in the majority of crop species, including (but not limited to) maize, rice, wheat, sorghum, potato, tomato, soybean, carrot, brassica crops, fruit trees (such as citrus, apple, banana), berries and sunflower.

[0208] In certain embodiments, the present technology is especially applicable to different species as directly proportional to the evolutionary distance to Arabidopsis. In certain embodiments, this technology is applicable to brassica crops, followed by other dicot crops such as tomato, potato, soybean and carrot.

[0209] In one embodiment, triple homozygous mutant thaliana rosl-3; dml2-l; dml3-l plants in the Col-0 background were transformed with pAGL61:DME via floral dipping (Wiliams et al., THE PLANT CELL 2022: 34: 1189-1206, which is incorporated by reference herein in its entirety). Twelve single-insertion transformants were selected and pollinated with dme-2 (Col-g / background) heterozygote mutant pollen to generate Fi progeny heterozygous for all four DRDD demethylase genes. Two of these Ti lines exhibited a complete rescue of seed abortion. Quadruple heterozygous plants from one of these lines were self-fertilized, and over two subsequent generations of segregation the following genotypes were isolated, each homozygous for the pAGL61:DME transgene: dme, rdd, drdd. and DRDD WT segregants (to serve as a closely related WT control). The selfed progeny of the initial plant of each genotype was used for all subsequent experiments. These quadruple heterozygous plants have complete genetic knockout (i.e., loss of function mutations to all four DNA demethylase enzymes) of the DNA demethylation pathway in the plant.

[0210] As used herein, a “transgenic plant” is one whose genome has been altered by the incorporation of exogenous genetic material, e.g., by transformation as described herein. The term “transgenic plant' is used to refer to the plant produced from an original transformation event, or progeny from later generations or crosses of a plant so transformed, so long as the progeny contains the exogenous genetic material in its genome. By “exogenous” is meant that a nucleic acid molecule, for example, a recombinant polynucleotide, originates from outside the plant into which it is introduced. An exogenous nucleic acid molecule may comprise naturally or non-naturally occurring polynucleotides, and may be derived from any organism, including the same or a different plant species than that into which it is introduced. A “control plant” as used in the present invention is a plant used to compare against a transgenic plant. A suitable control plant may be a non-transgenic plant of the parental line used to generate a transgenic plant herein. A control plant may in some cases be a transgenic plant line that comprises an empty vector or marker gene, but does not contain the recombinant polynucleotide of the present invention that is expressed in the transgenic plant being evaluated. In general, a control plant is a plant of the same line or variety as the transgenic plant being tested.

[0211] As disclosed herein, a broad range of plant types may be modified to incorporate recombinant polypeptides and / or polynucleotides of the present disclosure. Suitable plants that may be modified include both monocotyledonous (monocot) plants and dicotyledonous (dicot) plants. Examples of suitable plants may include, for example, species of the Family Gramineae, including Sorghum bicolor and Zea mays; species of the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale, and Triticum.

[0212] In some embodiments, plant cells may include, for example, those from corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panieum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), duckweed (Lemna), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nueijra), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia spp.), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.

[0213] Examples of suitable vegetables plants may include, for example, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).

[0214] Examples of suitable ornamental plants may include, for example, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbiapulcherrima), and chrysanthemum.

[0215] Examples of suitable conifer plants may include, for example, loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii), Western hemlock (Isuga canadensis), Sitka spruce (Picea glauca), redwood (Sequoia sempervirens), silver fir (Abies amabilis), balsam fir (Abies balsamea), Western red cedar (Thuja plicata), and Alaska yellow-cedar (Chamaecyparis nootkatensis).

[0216] Examples of suitable leguminous plants may include, for example, guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, peanuts (Arachis sp.), crown vetch (Vicia sp.), hairy vetch, adzuki bean, lupine (Lupinus sp.), trifolium, common bean (Phaseolus sp.), field bean (Pisum sp.), clover (Melilotus sp.) Lotus, trefoil, lens, and false indigo.

[0217] Examples of suitable forage and turf grass may include, for example, alfalfa (Medicago s sp.), orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.

[0218] Examples of suitable crop plants and model plants may include, for example, Arabidopsis, corn, rice, alfalfa, sunflower, canola, soybean, cotton, peanut, sorghum, wheat, tobacco, and lemna.

[0219] Regeneration Methods

[0220] For many species, a typical industry-standard tissue culture protocol involves cutting small pieces of plant tissue, placing this tissue on an auxin-rich medium known as callusinduction medium (CIM). CIM typically contains multiple auxin compounds at concentrations orders of magnitude higher than those that occur naturally within plant cells. In addition CIM typically contains high concentrations of glucose or sucrose.

[0221] In certain aspects, different propagation media can be used. Shoot induction medium (SIM) is a commonly used plant tissue culture medium containing cytokinin and minimal quantities of auxin. Specific formulations may vary, but a typical SIM, such as that used in generating the data present in this application, is comprised of Gamborg B5 medium with the addition of 0.25% (w / v) agar (such as Gelzan), 2% (w / v) glucose, Auxin (indole-3 -acetic acid, 0.85 pM), Cytokinin (e.g. zeatin, 2.5 pM). In certain aspects, cytokinin is present at a concentration of 0.5 pM to 5 pM (or any value there-between) of cytokinins benzylaminopurine (BAP), kinetin, and zeatin. In certain embodiments cytokinin is present at a concentration of 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, or 5.0 pM. In certain aspects, auxin (IAA) is present at a concentration of 0.01 to 1 pM (or any value there-between). In certain aspects, IAA is present at a concentration of 0.01, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 pM.

[0222] Callus induction medium is designed to induce the formation of callus, an extreme growth state in which undifferentiated tissue grows quickly without structure or formation of specialized organs. In nature, callus only occurs in response to wounding or certain infections. Once callus has been formed, explants will be placed on additional growth media containing different cocktails of plant hormones such as auxins and cytokinins to induce the formation of differentiated cell types and organs.

[0223] In certain aspects, a propagation medium lacking hormones is used. In certain aspects, Gamborg’ s B5 medium is used.

[0224] There are a number of serious challenges to plant biotechnology that tissue culture approaches cause. First, plant tissue culture is labor-intensive and time consuming, typically taking 6-12 months to regenerate whole plants and requiring highly trained experts using specialized equipment and facilities. Second, the success rates of tissue culture are variable. Some strains and species may not regenerate at all, and troubleshooting requires extensive experience. Third, the unnatural growth conditions plants are subjected to in tissue culture cause a large amount of cellular and genetic stress. Consequently, plants regenerated from tissue culture will often display an array of genetic and phenotypic abnormalities (known as somaclonal variation), some of which can have disastrous consequences in the field. Modem gene editing aims to provide precise engineering of phenotypes in plants, yet the high mutation rates induced by tissue culture currently undermines this. As described herein, plants with loss-of-function mutations to genes encoding DRDD enzymes regenerate simply by cutting leaves at the base of the leaf blade and placing them abaxial-surface-facing-down on minimal Gamborg BS medium. Once on the BS medium, plants are placed under standard (22°C, 8h, dark) growth chamber conditions. Complete vegetative propagation has been accomplished using this method without addition of any plant hormones, sucrose, or even changes to fresh medium. Once full shoot architecture is growing in propagated plants, a high success rate has been accomplished in transferring newly propagated plants to soil, where they grow normally.

[0225] Compared to plants propagated by current industry-standard tissue culture protocols, lower levels of DNA damage are observed. DNA damage in tissue culture is known to be associated with stress caused by high levels of plant hormones supplied in growth media. By unlocking regeneration in a hormone-free manner, regenerated plants are produced with substantially lower mutation rates and chromosomal abnormalities.

[0226] Additionally, in certain embodiments, drdd mutant plants regenerate entire shoots by placing cuttings on SIM. It has been observed that high levels of shoot regeneration can be achieved from hypocotyls placed on a medium supplemented with cytokinin. This is also observed in weaker combinations of mutant alleles (such as dme or rdd) suggesting that enhanced regeneration can be achieved without full suppression of the DRDD enzyme family.

[0227] Methods of Manipulation of Plants

[0228] “Gene inhibition” or “gene suppression” is used herein to refer to reduction or suppression of expression of a target protein in a host cell as the result of transcription of a recombinant polynucleotide, the manipulation of a target gene, or the introduction of an inhibitory chemical, resulting in a silencing effect.

[0229] In certain embodiments, technological approaches to inhibit DRDD enzymes include:

[0230] (1) Known chemical inhibitors of the base excision repair pathway. The biochemical function of DRDD enzymes is highly conserved, so small molecule chemical inhibition of DRDD is likely to work across the majority of plant tissues.

[0231] (2) Double-stranded or single-stranded RNA complementary to the mRNA sequence of DRDD genes. Both forms of RNA are potent inhibitors of gene expression in plants by the RNAi and RNA-directed DNA methylation pathways. (3) Synthetic microRNAs that target DRDD enzyme transcripts for post-transcriptional gene silencing.

[0232] Chemical Inhibitors

[0233] In certain embodiments, the chemical inhibitor is a DNA glycosylase inhibitor, such as juglone, 2-thioxanthine or tryptophan-p-1 (Trp-P-1). In certain embodiments, the chemical inhibitor is an AP endonuclease inhibitor, such as 3-CCPPA, 7 nitro-indole carboxylic acid, 2- BBIDA, E3330, Lucanthone or AR03. In certain embodiments, the chemical inhibitor is short patch repair inhibitor, such as oleanolic acid, Edgeworin, Myristinin A, oleanolic acid or Harbatinic acid. In certain embodiments, the chemical inhibitor is a base analog, such as IdU.

[0234] RNA Interference (RNAi) Molecules

[0235] In certain embodiments RNA-mediated suppression of DRDD methods are used in young or embryonic tissues, or roots, which are more likely to uptake larger biomolecules from growth medium. In certain embodiments, the methods are used in mature tissues, though the effectiveness may be lower because the mature tissues have stronger barriers to biomolecule transport. Certain species, such as potato, tomato and soybean readily take up exogenous RNA. However, the effectiveness of grass crops like maize to uptake exogenous RNA may be at lower levels.

[0236] Double-stranded RNA (dsRNA) can induce sequence-specific posttranscriptional gene silencing in many organisms by a process known as RNA interference (RNAi). However, in certain cells, dsRNA that is 30 base pairs or longer can induce sequence-nonspecific responses that trigger a shut-down of protein synthesis. Interference of gene expression by RNAi molecules is now recognized as a naturally occurring strategy for silencing genes in the cells of many organisms. In plants, dsRNA can also direct transcriptional silencing via the RNA- directed DNA methylation pathway.

[0237] Cells can contain various small dsRNAs (-21-25 bp). Two types of small RNA molecules have a post-transcriptional effect: (1) siRNA molecules that induce mRNA degradation, and (2) miRNAs, also called microRNAs, that induce translational inhibition. Other small RNAs work at the transcriptional level by affecting DNA and histone methylation. RNAi molecules can be generated exogenously (e.g., siRNA molecules), and induce transient gene silencing. Alternatively, RNAi molecules can be introduced via a vector that expresses short-hairpin RNAs (shRNA) in order to exhibit persistent gene silencing.

[0238] An “RNA interference,” “RNAi,” “small interfering RNA” or “short interfering RNA” or “siRNA” or “short hairpin RNA” or “shRNA” molecule, or “miRNA” is an RNA duplex of nucleotides that is targeted to a nucleic acid sequence of interest, for example, a transcript encoding DRDD enzymes. As used herein, the term “siRNA” is a generic term that encompasses the subset of shRNAs and miRNAs. An "RNA duplex" refers to the structure formed by the complementary pairing between two regions of an RNA molecule. siRNA is "targeted" to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to a nucleotide sequence of the targeted gene. In certain embodiments, the siRNAs are targeted to the sequence encoding a DRDD enzyme. In some embodiments, the length of the duplex of siRNAs is less than 30 base pairs. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 base pairs in length. In some embodiments, the length of the duplex is 19 to 25 base pairs in length. In certain embodiment, the length of the duplex is 19 or 21 base pairs in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. In certain embodiments, the loop is 18 nucleotides in length. The hairpin structure can also contain 3' and / or 5' overhang portions. In some embodiments, the overhang is a 3' and / or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.

[0239] The transcriptional unit of a “shRNA” is comprised of sense and antisense sequences connected by a loop of unpaired nucleotides. “miRNAs” stem-loops are comprised of sense and antisense sequences connected by a loop of unpaired nucleotides typically expressed as part of larger primary transcripts (pre-miRNAs). “Artificial miRNA” or an “artificial miRNA shuttle vector”, as used herein interchangably, refers to a primary miRNA transcript that has had a region of the duplex stem loop (at least about 9-20 nucleotides) which is excised via Dicer processing, replaced with the siRNA sequences for the target gene while retaining the structural elements within the stem loop necessary for effective miRNA silencing. The term “artificial” arises from the fact the flanking sequences (~35 nucleotides upstream and ~40 nucleotides downstream) arise from restriction enzyme sites within the multiple cloning site of the siRNA. As used herein the term “miRNA” encompasses both the naturally occurring miRNA sequences as well as artificially generated miRNA shuttle vectors.

[0240] The siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter. The nucleic acid sequence can also include a polyadenylation signal. In some embodiments, the polyadenylation signal is a synthetic minimal polyadenylation signal or a sequence of six Ts.

[0241] "Knock-down," "knock-down technology" refers to a technique of gene silencing in which the expression of a target gene is reduced as compared to the gene expression prior to the introduction of the siRNA, which can lead to the inhibition of production of the target gene product. The term “reduced” is used herein to indicate that the target gene expression is lowered by 1-100%. In other words, the amount of RNA available for translation into a polypeptide or protein is minimized. For example, the amount of protein may be reduced by 10, 20, 30, 40, 50, 60, 70, 80, 90, 95, or 99%. In some embodiments, the expression is reduced by about 90% (z.e., only about 10% of the amount of protein is observed a cell as compared to a cell where siRNA molecules have not been administered). Knock-down of gene expression can be directed by the use of dsRNAs or siRNAs.

[0242] “RNA interference (RNAi)” is the process of sequence-specific, post-transcriptional gene silencing initiated by siRNA. During RNAi, siRNA induces degradation of target mRNA with consequent sequence-specific inhibition of gene expression.

[0243] According to a method of the present invention, the expression of a DRDD enzyme can be modified via RNAi. For example, the accumulation of a DRDD enzyme can be suppressed in a cell. The term “suppressing” refers to the diminution, reduction or elimination in the number or amount of transcripts present in a particular cell. For example, the accumulation of mRNA encoding a DRDD enzyme can be suppressed in a cell by RNA interference (RNAi), e.g., the gene is silenced by sequence-specific double-stranded RNA (dsRNA), which is also called short interfering RNA (siRNA). These siRNAs can be two separate RNA molecules that have hybridized together, or they may be a single hairpin wherein two portions of a RNA molecule have hybridized together to form a duplex.

[0244] A mutant protein refers to the protein encoded by a gene having a mutation, e.g., a missense or nonsense mutation in one or both alleles of a DRDD enzyme.

[0245] The term “gene” is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and / or the regulatory sequences required for their expression. For example, “gene” refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences. “Genes” also include non-expressed DNA segments that, for example, form recognition sequences for other proteins. “Genes” can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters. An “allele” is one of several alternative forms of a gene occupying a given locus on a chromosome.

[0246] The term "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues. A “nucleic acid fragment” is a portion of a given nucleic acid molecule.

[0247] A “nucleotide sequence” is a polymer of DNA or RNA that can be single- stranded or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.

[0248] The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid fragment,” “nucleic acid sequence or segment,” or “polynucleotide” are used interchangeably and may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.

[0249] The invention encompasses isolated or substantially purified nucleic acid nucleic acid molecules and compositions containing those molecules. In the context of the present invention, an “isolated” or “purified” DNA molecule or RNA molecule is a DNA molecule or RNA molecule that exists apart from its native environment and is therefore not a product of nature. An isolated DNA molecule or RNA molecule may exist in a purified form or may exist in a nonnative environment such as, for example, a transgenic host cell. For example, an “isolated” or “purified” nucleic acid molecule or biologically active portion thereof, is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In one embodiment, an “isolated” nucleic acid is free of sequences that naturally flank the nucleic acid (z.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Fragments and variants of the disclosed nucleotide sequences are also encompassed by the present invention. The terms “fragment” or “portion” mean a full length or less than full length of the nucleotide sequence.

[0250] “Naturally occurring,” “native,” or “wild-type” is used to describe an object that can be found in nature as distinct from being artificially produced. For example, a protein or nucleotide sequence present in an organism that can be isolated from a source in nature and that has not been intentionally modified by a person in the laboratory, is naturally occurring.

[0251] A “variant” of a molecule is a sequence that is substantially similar to the sequence of the native molecule. For nucleotide sequences, variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein. Naturally occurring allelic variants such as these can be identified with the use of molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, which encode the native protein, as well as those that encode a polypeptide having amino acid substitutions. Generally, nucleotide sequence variants of the invention will have at least 40%, 50%, 60%, to 70%, e.g, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the native (endogenous) nucleotide sequence.

[0252] The term "chimeric" refers to a gene or DNA that contains 1) DNA sequences, including regulatory and coding sequences that are not found together in nature or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may include regulatory sequences and coding sequences that are derived from different sources, or include regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature. A "transgene" refers to a gene that has been introduced into the genome by transformation. Transgenes include, for example, DNA that is either heterologous or homologous to the DNA of a particular cell to be transformed. Additionally, transgenes may include native genes inserted into a non-native organism, or chimeric genes.

[0253] The term "endogenous gene" refers to a native gene in its natural location in the genome of an organism.

[0254] A "foreign" gene refers to a gene not normally found in the host organism that has been introduced by gene transfer.

[0255] The terms "protein," "peptide" and "polypeptide" are used interchangeably herein.

[0256] “Conservatively modified variations” of a particular nucleic acid sequence refer to those nucleic acid sequences that encode identical or essentially identical amino acid sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance, the codons CGT, CGC, CGA, CGG, AGA and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein. Such nucleic acid variations are "silent variations," which are one species of "conservatively modified variations." Every nucleic acid sequence described herein that encodes a polypeptide also describes every possible silent variation, except where otherwise noted. One of skill in the art will recognize that each codon in a nucleic acid (except ATG, which is ordinarily the only codon for methionine) can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each “silent variation” of a nucleic acid that encodes a polypeptide is implicit in each described sequence.

[0257] “Recombinant DNA molecule” is a combination of DNA sequences that are joined together using recombinant DNA technology and procedures used to join together DNA sequences.

[0258] The terms “heterologous gene”, “heterologous DNA sequence”, “exogenous DNA sequence”, “heterologous RNA sequence”, “exogenous RNA sequence” or “heterologous nucleic acid” each refer to a sequence that either originates from a source foreign to the particular host cell, or is from the same source but is modified from its original or native form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA or RNA sequence. Thus, the terms refer to a DNA or RNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.

[0259] A "homologous" DNA or RNA sequence is a sequence that is naturally associated with a host cell into which it is introduced.

[0260] "Wild-type" refers to the normal gene or organism found in nature.

[0261] “Genome” refers to the complete genetic material of an organism.

[0262] A “vector" is defined to include, inter alia, any viral vector, as well as any plasmid, cosmid, phage or binary vector in double or single stranded linear or circular form that may or may not be self-transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extra-chromosomally (e.g., autonomous replicating plasmid with an origin of replication).

[0263] “Expression cassette” as used herein means a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals. The coding region usually codes for a functional RNA of interest, for example an siRNA. The expression cassette including the nucleotide sequence of interest may be chimeric. The expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. The expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of a regulatable promoter that initiates transcription only when the host cell is exposed to some particular stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or stage of development.

[0264] Such expression cassettes can include a transcriptional initiation region linked to a nucleotide sequence of interest. Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[0265] "Coding sequence" refers to a DNA or RNA sequence that codes for a specific amino acid sequence. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA, or it may include one or more introns bounded by appropriate splice junctions. An "intron" is a sequence of RNA that is contained in the primary transcript but is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.

[0266] The term "open reading frame" (ORF) refers to the sequence between translation initiation and termination codons of a coding sequence. The terms "initiation codon" and "termination codon" refer to a unit of three adjacent nucleotides (a 'codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).

[0267] “Functional RNA” refers to sense RNA, antisense RNA, ribozyme RNA, siRNA, or other RNA that may not be translated but yet has an effect on at least one cellular process.

[0268] The term “RNA transcript” or “transcript” refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence. When the RNA transcript is a perfect complimentary copy of the DNA sequence, it is referred to as the primary transcript or it may be an RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA. “Messenger RNA” (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell.

[0269] “cDNA” refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.

[0270] “Regulatory sequences” are nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences. As is noted herein, the term “suitable regulatory sequences” is not limited to promoters. However, some suitable regulatory sequences useful in the present invention will include, but are not limited to constitutive promoters, tissue-specific promoters, development-specific promoters, regulatable promoters and viral promoters.

[0271] “5' non-coding sequence” refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. “3' non-coding sequence” refers to nucleotide sequences located 3' (downstream) to a coding sequence and may include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression. The polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3 ' end of the mRNA precursor.

[0272] The term "translation leader sequence" refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') of the translation start codon. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.

[0273] The term "mature" protein refers to a post-translationally processed polypeptide without its signal peptide. "Precursor" protein refers to the primary product of translation of an mRNA. "Signal peptide" refers to the amino terminal extension of a polypeptide, which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its entrance into the secretory pathway. The term "signal sequence" refers to a nucleotide sequence that encodes the signal peptide.

[0274] “Promoter” refers to a nucleotide sequence, usually upstream (5') to its coding sequence, which directs and / or controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription. “Promoter” includes a minimal promoter that is a short DNA sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression. “Promoter” also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. Accordingly, an “enhancer” is a DNA sequence that can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors that control the effectiveness of transcription initiation in response to physiological or developmental conditions. Examples of promoters that may be used in the present invention include the mouse U6 RNA promoters, synthetic human H1RNA promoters, SV40, CMV, RSV, RNA polymerase II and RNA polymerase III promoters.

[0275] The "initiation site" is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (z.e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.

[0276] Promoter elements, particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters." In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription. A “minimal or core promoter” thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and / or an initiator.

[0277] “Constitutive expression” refers to expression using a constitutive or regulated promoter. “Conditional” and “regulated expression” refer to expression controlled by a regulated promoter.

[0278] “Operably-linked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one of the sequences is affected by another. For example, a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (z.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.

[0279] “Expression” refers to the transcription and / or translation of an endogenous gene, heterologous gene or nucleic acid segment, or a transgene in cells. For example, in the case of siRNA constructs, expression may refer to the transcription of the siRNA only. In addition, expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein.

[0280] "Altered levels" refers to the level of expression in transgenic cells or organisms that differs from that of normal or untransformed cells or organisms. "Overexpression" refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in normal or untransformed cells or organisms.

[0281] "Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene.

[0282] "Transcription stop fragment" refers to nucleotide sequences that contain one or more regulatory signals, such as polyadenylation signal sequences, capable of terminating transcription. Examples include the 3' non-regulatory regions of genes encoding nopaline synthase and the small subunit of ribulose bisphosphate carboxylase.

[0283] "Translation stop fragment" refers to nucleotide sequences that contain one or more regulatory signals, such as one or more termination codons in all three frames, capable of terminating translation. Insertion of a translation stop fragment adjacent to or near the initiation codon at the 5' end of the coding sequence will result in no translation or improper translation. Excision of the translation stop fragment by site-specific recombination will leave a site-specific sequence in the coding sequence that does not interfere with proper translation using the initiation codon.

[0284] The terms "cv.s-acting sequence" and "c / .s-acting element" refer to DNA or RNA sequences whose functions require them to be on the same molecule. An example of a exacting sequence on the replicon is the viral replication origin.

[0285] The terms " / ra / / .s-acting sequence" and " / ra / / .s-acting element" refer to DNA or RNA sequences whose function does not require them to be on the same molecule.

[0286] "Chromosomally-integrated" refers to the integration of a foreign gene or nucleic acid construct into the host DNA by covalent bonds. Where genes are not "chromosomally integrated" they may be "transiently expressed." Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.

[0287] The following terms are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence,” (b) “comparison window,” (c) “sequence identity,” (d) “percentage of sequence identity,” and (e) “substantial identity.”

[0288] (a) As used herein, “reference sequence” is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.

[0289] (b) As used herein, “comparison window” makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (z.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[0290] Methods of alignment of sequences for comparison are well-known in the art. Thus, the determination of percent identity between any two sequences can be accomplished using a mathematical algorithm.

[0291] Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC / Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.

[0292] Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always < 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.

[0293] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

[0294] To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized. Alternatively, PSLBLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. When utilizing BLAST, Gapped BLAST, PSLBLAST, the default parameters of the respective programs (e.g. BLASTN for nucleotide sequences) can be used. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. Alignment may also be performed manually by inspection.

[0295] For purposes of the present invention, comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.

[0296] (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid sequences makes reference to a specified percentage of nucleotides in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.

[0297] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0298] (e) The term "substantial identity" of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one of the alignment programs described using standard parameters.

[0299] Another indication that nucleotide sequences are substantially identical is if two molecules hybridize to each other under stringent conditions. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1°C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein.

[0300] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0301] As noted herein, another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The phrase "hybridizing specifically to" refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA. “Bind(s) substantially” refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence. "Stringent hybridization conditions" and "stringent hybridization wash conditions" in the context of nucleic acid hybridization experiments such as Southern and Northern hybridizations are sequence dependent, and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (1984); Tm 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500 / L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. Tm is reduced by about 1°C for each 1% of mismatching; thus, Tm, hybridization, and / or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10°C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and / or wash at 1, 2, 3, or 4°C lower than the thermal melting point (Tm); moderately stringent conditions can utilize a hybridization and / or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and / or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired T, those of ordinary skill will understand that variations in the stringency of hybridization and / or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. Generally, highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.

[0302] An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent wash conditions is a 0.2X SSC wash at 65°C for 15 minutes (see, Sambrook and Russell 2001, for a description of SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove background probe signal. For short nucleic acid sequences (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. In general, a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Very stringent conditions are selected to be equal to the Tm for a particular nucleic acid molecule.

[0303] Very stringent conditions are selected to be equal to the Tmfor a particular probe. An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. IX SSC at 60 to 65°C. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, IM NaCl, 1% SDS (sodium dodecyl sulfate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCl / 0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.

[0304] The term “transformation” refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance. A “host cell” is a cell that has been transformed, or is capable of transformation, by an exogenous nucleic acid molecule. Host cells containing the transformed nucleic acid fragments are referred to as “transgenic” cells.

[0305] “Transformed,” “transduced,” “transgenic” and “recombinant” refer to a host cell into which a heterologous nucleic acid molecule has been introduced. As used herein the term “transfection” refers to the delivery of DNA into eukaryotic (e.g., plant) cells. The term “transformation” is used herein to refer to delivery of DNA into prokaryotic (e.g., E. coif) cells. The term “transduction” is used herein to refer to infecting cells with viral particles. The nucleic acid molecule can be stably integrated into the genome generally known in the art. Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like. For example, "transformed," "transformant," and "transgenic" cells have been through the transformation process and contain a foreign gene integrated into their chromosome. The term "untransformed" refers to normal cells that have not been through the transformation process. “Genetically altered cells” denotes cells which have been modified by the introduction of recombinant or heterologous nucleic acids (e.g., one or more DNA constructs or their RNA counterparts) and further includes the progeny of such cells which retain part or all of such genetic modification.

[0306] As used herein, the term "derived" or "directed to" with respect to a nucleotide molecule means that the molecule has complementary sequence identity to a particular molecule of interest.

[0307] The siRNAs of the present invention can be generated by any method known to the art, for example, by in vitro transcription, recombinantly, or by synthetic means. In one example, the siRNAs can be generated in vitro by using a recombinant enzyme, such as T7 RNA polymerase, and DNA oligonucleotide templates.

[0308] Nucleic Acid Molecules

[0309] The terms "isolated and / or purified" refer to in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural cellular environment, and from association with other components of the cell, such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and / or expressed. The RNA or DNA is "isolated" in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source of the RNA or DNA and is preferably substantially free of any other plant RNA or DNA. The phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a vector or plasmid.

[0310] In addition to a DNA sequence encoding a siRNA, the nucleic acid molecules of the invention include double-stranded interfering RNA molecules, which are also useful to inhibit expression of a target gene.

[0311] As used herein, the term “recombinant nucleic acid”, e.g., “recombinant DNA sequence or segment” refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from any appropriate cellular source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in a genome which has not been transformed with exogenous DNA. An example of preselected DNA “derived” from a source would be a DNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form. An example of such DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.

[0312] Thus, recovery or isolation of a given fragment of DNA from a restriction digest can employ separation of the digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal of the gel section containing the desired fragment, and separation of the gel from DNA. Therefore, "recombinant DNA" includes completely synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from RNA, as well as mixtures thereof.

[0313] Nucleic acid molecules having base substitutions (z.e., variants) are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of the nucleic acid molecule.

[0314] Oligonucleotide-mediated mutagenesis is a method for preparing substitution variants. This technique is known in the art. Briefly, nucleic acid encoding a siRNA can be altered by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native gene sequence. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the nucleic acid encoding siRNA. The oligonucleotides are readily synthesized using techniques known in the art.

[0315] The DNA template can be generated by those vectors that are either derived from bacteriophage Ml 3 vectors (the commercially available M13mpl8 and M13mpl9 vectors are suitable), or those vectors that contain a single-stranded phage origin of replication. Thus, the DNA that is to be mutated may be inserted into one of these vectors to generate single-stranded template. Production of the single-stranded template is described in Chapter 3 of Sambrook and Russell, 2001. Alternatively, single-stranded DNA template may be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques.

[0316] For alteration of the native DNA sequence (to generate amino acid sequence variants, for example), the oligonucleotide is hybridized to the single-stranded template under suitable hybridization conditions. A DNA polymerizing enzyme, usually the KI enow fragment of DNA polymerase I, is then added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis. A heteroduplex molecule is thus formed such that one strand of DNA encodes the mutated form of the DNA, and the other strand (the original template) encodes the native, unaltered sequence of the DNA. This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JM101. After the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with 32-phosphate to identify the bacterial colonies that contain the mutated DNA. The mutated region is then removed and placed in an appropriate vector, generally an expression vector of the type typically employed for transformation of an appropriate host.

[0317] The method described immediately above may be modified such that a homoduplex molecule is created wherein both strands of the plasmid contain the mutations(s). The modifications are as follows: The single-stranded oligonucleotide is annealed to the single-stranded template as described herein. A mixture of three deoxyribonucleotides, deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP), is combined with a modified thiodeoxyribocytosine called dCTP-(*S) (which can be obtained from the Amersham Corporation). This mixture is added to the template-oligonucleotide complex. Upon addition of DNA polymerase to this mixture, a strand of DNA identical to the template except for the mutated bases is generated. In addition, this new strand of DNA will contain dCTP-(*S) instead of dCTP, which serves to protect it from restriction endonuclease digestion.

[0318] After the template strand of the double-stranded heteroduplex is nicked with an appropriate restriction enzyme, the template strand can be digested with ExoIII nuclease or another appropriate nuclease past the region that contains the site(s) to be mutagenized. The reaction is then stopped to leave a molecule that is only partially single-stranded. A complete double-stranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase. This homoduplex molecule can then be transformed into a suitable host cell such as E. coli JM101. Expression Cassettes

[0319] To prepare expression cassettes, the recombinant DNA sequence or segment may be circular or linear, double-stranded or single-stranded. Generally, the DNA sequence or segment is in the form of chimeric DNA, such as plasmid DNA or a vector that can also contain coding regions flanked by control sequences that promote the expression of the recombinant DNA present in the resultant transformed cell.

[0320] A “chimeric” vector or expression cassette, as used herein, means a vector or cassette including nucleic acid sequences from at least two different species, or has a nucleic acid sequence from the same species that is linked or associated in a manner that does not occur in the “native” or wild type of the species.

[0321] Aside from recombinant DNA sequences that serve as transcription units for an RNA transcript, or portions thereof, a portion of the recombinant DNA may be untranscribed, serving a regulatory or a structural function. For example, the recombinant DNA may have a promoter that is active in plant cells.

[0322] Other elements functional in the host cells, such as introns, enhancers, polyadenylation sequences and the like, may also be a part of the recombinant DNA. Such elements may or may not be necessary for the function of the DNA, but may provide improved expression of the DNA by affecting transcription, stability of the siRNA, or the like. Such elements may be included in the DNA as desired to obtain the optimal performance of the siRNA in the cell.

[0323] Control sequences are DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotic cells, for example, include a promoter, and optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.

[0324] Operably linked nucleic acids are nucleic acids placed in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, operably linked DNA sequences are DNA sequences that are linked are contiguous. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice. The recombinant DNA to be introduced into the cells may contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells. Useful selectable markers are known in the art and include, for example, antibiotic-resistance genes, such as neo and the like.

[0325] Reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art. In general, a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity. For example, reporter genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli and the luciferase gene from firefly Photinus pyralis. Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.

[0326] The general methods for constructing recombinant DNA that can transfect target cells are well known to those skilled in the art, and the same compositions and methods of construction may be utilized to produce the DNA useful herein.

[0327] The recombinant DNA can be readily introduced into the host cells, e.g., plant cells by transfection with an expression vector composed of DNA encoding the siRNA by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a cell having the recombinant DNA stably integrated into its genome or existing as a episomal element, so that the DNA molecules, or sequences of the present invention are expressed by the host cell. Preferably, the DNA is introduced into host cells via a vector. The host cell is preferably of eukaryotic origin, e.g., plant sources, but host cells of non-eukaryotic origin may also be employed.

[0328] Physical methods to introduce a preselected DNA into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Biological methods to introduce the DNA of interest into a host cell include the use of DNA and RNA viral vectors. As discussed herein, a “transfected”, “or “transduced” host cell or cell line is one in which the genome has been altered or augmented by the presence of at least one heterologous or recombinant nucleic acid sequence. The host cells of the present invention are typically produced by transfection with a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence. The transfected DNA can become a chromosomally integrated recombinant DNA sequence, which is composed of sequence encoding the siRNA.

[0329] To confirm the presence of the recombinant DNA sequence in the host cell, a variety of assays may be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELIS As and Western blots) or by assays described herein to identify agents falling within the scope of the invention.

[0330] To detect and quantitate RNA produced from introduced recombinant DNA segments, RT-PCR may be employed. In this application of PCR, it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PCR techniques, while useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of an RNA species.

[0331] While Southern blotting and PCR may be used to detect the recombinant DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the peptide products of the introduced recombinant DNA sequences or evaluating the phenotypic changes brought about by the expression of the introduced recombinant DNA segment in the host cell.

[0332] The instant invention provides a cell expression system for expressing exogenous nucleic acid material in a plant. The expression system, also referred to as a "genetically modified cell," comprises a cell and an expression vector for expressing the exogenous nucleic acid material. The genetically modified cells are suitable for administration to a plant recipient, where they replace the endogenous cells of the recipient. Thus, in certain embodiments, genetically modified cells are non-immortalized and are non-tumorigenic.

[0333] According to one embodiment, the cells are transfected or otherwise genetically modified ex vivo. The cells are isolated from a plant, nucleic acid introduced (z.e., transduced or transfected in vitro with a vector for expressing a heterologous (e.g., recombinant) gene encoding the therapeutic agent, and then administered to a plant recipient for delivery of the agent in situ. The cells to be modified are autologous cells, z.e., the cells are isolated from the plant recipient.

[0334] According to another embodiment, the cells are transfected or transduced or otherwise genetically modified in vivo. The cells from the plant recipient are transduced or transfected in vivo with a vector containing exogenous nucleic acid material for expressing a heterologous (e.g., recombinant) gene encoding a therapeutic agent and the therapeutic agent is delivered in situ.

[0335] As used herein, "exogenous nucleic acid material" refers to a nucleic acid or an oligonucleotide, either natural or synthetic, which is not naturally found in the cells; or if it is naturally found in the cells, is modified from its original or native form. Thus, "exogenous nucleic acid material" includes, for example, a non-naturally occurring nucleic acid that can be transcribed into an anti-sense RNA, a siRNA, as well as a "heterologous gene" (z.e., a gene encoding a protein that is not expressed or is expressed at biologically insignificant levels in a naturally-occurring cell of the same type). Still another example of "exogenous nucleic acid material" is the introduction of only part of a gene to create a recombinant gene, such as combining a regulatable promoter with an endogenous coding sequence via homologous recombination.

[0336] Methods for Introducing the Expression Cassettes of the Invention into Cells

[0337] The inhibitory nucleic acid material (e.g., an expression cassette encoding siRNA directed to a gene of interest) can be introduced into the cell ex vivo or in vivo by genetic transfer methods, such as transfection or transduction, to provide a genetically modified cell. Various expression vectors (z.e., vehicles for facilitating delivery of exogenous nucleic acid into a target cell) are known to one of ordinary skill in the art.

[0338] As used herein, "transfection of cells" refers to the acquisition by a cell of new nucleic acid material by incorporation of added DNA. Thus, transfection refers to the insertion of nucleic acid into a cell using physical or chemical methods. Several transfection techniques are known to those of ordinary skill in the art including calcium phosphate DNA co-precipitation, DEAE-dextran, electroporation, cationic liposome-mediated transfection, tungsten particle- facilitated microparticle bombardment, and strontium phosphate DNA co-precipitation.

[0339] In contrast, "transduction of cells" refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus. An RNA virus for transferring a nucleic acid into a cell is referred to herein as a transducing chimeric retrovirus. Exogenous nucleic acid material contained within the retrovirus is incorporated into the genome of the transduced cell. A cell that has been transduced with a chimeric DNA virus will not have the exogenous nucleic acid material incorporated into its genome but will be capable of expressing the exogenous nucleic acid material that is retained extrachromosomally within the cell.

[0340] The exogenous nucleic acid material can include the nucleic acid encoding the siRNA together with a promoter to control transcription. The promoter characteristically has a specific nucleotide sequence necessary to initiate transcription. The exogenous nucleic acid material may further include additional sequences (z.e., enhancers) required to obtain the desired gene transcription activity. For the purpose of this discussion an "enhancer" is simply any nontranslated DNA sequence that works with the coding sequence (in cis) to change the basal transcription level dictated by the promoter. The exogenous nucleic acid material may be introduced into the cell genome immediately downstream from the promoter so that the promoter and coding sequence are operatively linked so as to permit transcription of the coding sequence. An expression vector can include an exogenous promoter element to control transcription of the inserted exogenous gene. Such exogenous promoters include both constitutive and regulatable promoters.

[0341] Naturally-occurring constitutive promoters control the expression of essential cell functions. As a result, a nucleic acid sequence under the control of a constitutive promoter is expressed under all conditions of cell growth.

[0342] Nucleic acid sequences that are under the control of regulatable promoters are expressed only or to a greater or lesser degree in the presence of an inducing or repressing agent, (e.g., transcription under control of the metallothionein promoter is greatly increased in presence of certain metal ions). Regulatable promoters include responsive elements (REs) that stimulate transcription when their inducing factors are bound. Promoters containing a particular RE can be chosen in order to obtain a regulatable response and in some cases, the RE itself may be attached to a different promoter, thereby conferring regulatability to the encoded nucleic acid sequence. Thus, by selecting the appropriate promoter (constitutive versus regulatable; strong versus weak), it is possible to control both the existence and level of expression of a nucleic acid sequence in the genetically modified cell. If the nucleic acid sequence is under the control of a regulatable promoter, delivery of the therapeutic agent in situ is triggered by exposing the genetically modified cell in situ to conditions for permitting transcription of the nucleic acid sequence, e.g., by intraperitoneal injection of specific inducers of the regulatable promoters which control transcription of the agent. For example, in situ expression of a nucleic acid sequence under the control of the metallothionein promoter in genetically modified cells is enhanced by contacting the genetically modified cells with a solution containing the appropriate (z.e., inducing) metal ions in situ.

[0343] Accordingly, the amount of siRNA generated in situ is regulated by controlling such factors as the nature of the promoter used to direct transcription of the nucleic acid sequence, (z.e., whether the promoter is constitutive or regulatable, strong or weak) and the number of copies of the exogenous nucleic acid sequence encoding a siRNA sequence that are in the cell.

[0344] In addition to at least one promoter and at least one heterologous nucleic acid sequence encoding the siRNA, the expression vector may include a selection gene, for example, a neomycin resistance gene, for facilitating selection of cells that have been transfected or transduced with the expression vector.

[0345] Cells can also be transfected with two or more expression vectors, at least one vector containing the nucleic acid sequence(s) encoding the siRNA(s), the other vector containing a selection gene. The selection of a suitable promoter, enhancer, selection gene, and / or signal sequence is deemed to be within the scope of one of ordinary skill in the art without undue experimentation.

[0346] The following discussion is directed to various utilities of the instant invention. For example, the instant invention has utility as an expression system suitable for silencing the expression of gene(s) of interest, such as a DRDD enzyme.

[0347] The invention will now be illustrated by the following non-limiting Examples. EXAMPLE 1

[0348] Thymine-DNA glycosylase (TDG) removes thymine moieties from G / T mismatches by hydrolyzing the carbon-nitrogen bond between the sugar-phosphate backbone of DNA and the mispaired thymine. With lower activity, this enzyme also removes thymine from C / T and T / T mispairings. TDG can also remove uracil and 5-bromouracil from mispairings with guanine. Human TDG operates via a highly similar biochemical mechanism to the plant DRDD enzymes. It was recently established that a low concentration (10 pM) of the naturally-occurring compound jugl one (Mancuso, P., Tricarico, R., Bhattacharjee, V. et al. Thymine DNA glycosylase as a novel target for melanoma. Oncogene 38, 3710-3728 (2019)) is sufficient to inhibit TDG activity without impacting cell survival. Given the discovery of the role of DRDD enzymes in inhibiting plant organ regeneration, in certain embodiments, DRDD activity is inhibited by the application of known DNA glycosylase inhibitors (such as jugl one) to the plant regeneration medium.

[0349] Methodology.

[0350] (1) Young seedlings are grown in sterile conditions on 0.5 x MS medium + 1% sucrose under standard growth conditions (22°C, 16h light + 8h dark, 50% humidity).

[0351] (2) Once grown, true leaves are excised at the base of the leaf blade.

[0352] (3) Excised leaves are placed abaxial surface down on Gamborg B5 medium + phytoagar supplemented with chemical inhibition (e.g., 10 pM juglone).

[0353] (4) Leaf cuttings are incubated under standard growth conditions (as described in step 1) for 2-5 weeks until both roots and shoot organs have naturally regenerated. Without chemical inhibition of DRDD enzymes, plants only regenerate roots, and lack shoot regeneration. Inhibition of DRDD activity results in spontaneous shoot regeneration that enables complete vegetative propagation.

[0354] (5) Once shoot regeneration is complete, regenerated plants are transferred to soil, where they can grow normally.

[0355] EXAMPLE 2

[0356] Wounded plant tissues readily uptake both small interfering RNAs (RNAi, 21-24 nt) and double-stranded RNAs. Uptake of these biomolecules is most effective after application with a high pressure air brush spray gun (Dalakouras 2016, Front. Plant Sep). The RNAi inhibition of DRDD enzymes by small RNAs and / or double-stranded RNAs matching DRDD transcript sequences inhibit DRDD enzymes in leaf cuttings, thus unlocking regeneration.

[0357] Methodology.

[0358] (1) Young seedlings are grown in sterile conditions on 0.5 x MS medium+ 1% sucrose under standard growth conditions (22°C, 16h light + 8h dark, 50% humidity).

[0359] (2) Once grown, true leaves are excised at the base of the leaf blade and placed adaxial surface down on filter papers soaked in liquid Gamborg B5 medium. Leaf cuttings are subjected to a high-pressure spray delivery of 10 pM 22 nt small RNAs (synthesized and obtained from IDT) with specific sequence complementarity to the first exons of DRDD coding regions. For example, in soybean the siRNAs are: 5'-GAGAAACAAGCUUCAAGGGCAG-3' (SEQ ID NO: 22) and 5'-GUUCCUUGGGUCCCCACCACCC-3' (SEQ ID NO: 23). In rice, the siRNAs are: 5'-GUCAAGAAGCAACGCCCUCGAG-3' (SEQ ID NO: 24), 5'- GUAAAGAAAAGAGGUUCUCGGG-3' (SEQ ID NO: 25), 5'- GUGAAAAGAAAACGCUCUCGAGC-3' (SEQ ID NO: 26).

[0360] (3) After spraying, leaf cuttings are placed on solidified Gamborg B5 medium, abaxial surface down.

[0361] (4) Leaf cuttings are incubated under standard growth conditions (as described in step 1) for 2-5 weeks until both roots and shoot organs have naturally regenerated. Without small RNA inhibition of DRDD enzymes, plants only regenerate roots, and lack shoot regeneration. Inhibition of DRDD activity results in spontaneous shoot regeneration that enables complete vegetative propagation.

[0362] (5) Once shoot regeneration is complete, regenerated plants are transferred to soil, where they can grow normally.

[0363] EXAMPLE 3

[0364] Methodology.

[0365] (1) Young seedlings are grown in sterile conditions on 0.5 x MS medium + 1% sucrose under standard growth conditions (22°C, 16h light + 8h dark, 50% humidity).

[0366] (2) Once grown, true leaves are excised at the base of the leaf blade. At this point, gene editing or genetic transformation knockout of DRDD genes is performed via Agrobacterium inoculation, infiltration, or via any other method of delivery. In certain embodiments, the plants are monocots, and in other embodiments the plants are dicots. (3) After transformation, excised leaves are placed abaxial surface down on Gamborg B5 medium.

[0367] (4) Leaf cuttings are incubated under standard growth conditions (as described in step 1) for 2-5 weeks until both roots and shoot organs have naturally regenerated. Without genetic inhibition of DRDD enzymes, plants only regenerate roots, and lack shoot regeneration. Inhibition of DRDD activity results in spontaneous shoot regeneration that enables complete vegetative propagation.

[0368] (5) Once shoot regeneration is complete, regenerated plants are transferred to soil, where they can grow normally.

[0369] Although the foregoing specification and examples fully disclose and enable the present invention, they are not intended to limit the scope of the invention, which is defined by the claims appended hereto.

[0370] All publications, patents and patent applications are incorporated herein by reference. While in the foregoing specification this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

[0371] The use of the terms “a” and “an” and “the” and similar referents in the context of describing the invention are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (z.e., meaning “including, but not limited to”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., “such as”) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0372] When used in this specification and the claims as an adverb rather than a preposition, "about" means "approximately" and comprises the stated value and every non-negative value within 10% of that value; in other words, "about 100%" includes 90% and 110% and every value in between.

[0373] Unless stated otherwise, every range or interval includes both endpoints and every value in between.

[0374] The invention has been described as “comprising” certain steps and / or elements, which those of skill in the art also “consist of’ or “consist essentially of’ those steps and / or elements. As used herein, the transitional term “comprising” is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. Where the invention is intended to be more narrowly defined, the terms “consisting of’ or “consisting essentially of’ also are used to describe the invention. As used herein, the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim. The transitional phrase “consisting essentially of’ limits the scope of a claim to the specified elements or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, a claim reciting “consisting essentially of’ occupies a middle ground between closed claims reciting a “consisting of’ format and fully open claims that recite “comprising.”

[0375] Embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

WHAT IS CLAIMED IS:

1. A method of propagating a plant comprising:(a) excising a cutting from a plant,(b) performing gene manipulation in the excised cutting,(c) placing the excised cutting on propagation medium, and(d) incubating the excised cutting under standard growth conditions.

2. The method of claim 1, wherein in step (d) the incubation period is until shoot organs have regenerated to form a regenerated plant.

3. The method of claim 2, wherein in step (d) the incubation period is until both root and shoot organs have regenerated to form a regenerated plant.

4. The method of any one of claims 1-3, wherein in step (d) the incubation period is for about 2-5 weeks.

5. The method of any one of claims 1-4, further comprising(e) transferring the regenerated plant to soil.

6. The method of any one of claims 1-5, wherein the gene editing or genetic transformation is by gene editing or genetic transformation.

7. The method of any one of claims 1-6, wherein the cutting is excised at the base of a leaf blade.

8. The method of any one of claims 1-7, wherein the gene manipulation inhibits all four DRDD enzymes.

9. The method of any one of claims 1-8, wherein the plant is a monocot or a dicot.

10. The method of any one of claims 1-8, wherein the plant is selected from com, canola, alfalfa, rice, soy, potato, wheat, sugarcane, cassava, sorghum, tomato, oat or barley.

11. The method of any one of claims 1-10, wherein the cutting is a leaf.

12. The method of claim 11, wherein the excised leaf is placed abaxial surface down on the propagation medium.

13. The method of any one of claims 1-10, wherein the cutting is a stem cutting.

14. The method of claim 12a, wherein the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

15. The method of any one of claim 1-14, wherein the propagation medium is shoot induction medium (SIM).

16. The method of any one of claim 1-14, wherein the propagation medium lacks hormones.

17. The method of claim 16, wherein the propagation medium is Gamborg’s B5 medium.

18. A method of propagating a plant comprising:(a) excising a cutting from a plant,(b) placing the excised cutting on propagation medium containing chemical inhibitors for DRDD enzymes, wherein the propagation medium , and(c) incubating the excised cutting under standard growth conditions.

19. The method of claim 18, wherein in step (c) the incubation period is until shoot organs have regenerated to form a regenerated plant.

20. The method of claim 18, wherein in step (c) the incubation period is until both root and shoot organs have regenerated to form a regenerated plant.

21. The method of claim 19 or 20, wherein in step (c) the incubation period is for about 2-5 weeks.

22. The method of any one of claims 18-21, further comprising (d) transferring the regenerated plant to soil.

23. The method of any one of claims 18-22, wherein the chemical inhibitor is a DNA glycosylase inhibitor, an AP endonuclease inhibitor, or a short patch repair inhibitor.

24. The method of claim 23, wherein the chemical inhibitor is a DNA glycosylase inhibitor.

25. The method of claim 24, wherein the DNA glycosylase inhibitor is juglone, 2- thioxanthine or tryptophan-p-1 (Trp-P-1).

26. The method of claim 23, wherein the chemical inhibitor is an AP endonuclease inhibitor.

27. The method of claim 26, wherein the AP endonuclease inhibitor is as 3-CCPPA, 7 nitroindole carboxylic acid, 2-BBIDA, E3330, Lucanthone or AR03.

28. The method of claim 23, wherein the chemical inhibitor is a short patch repair inhibitor.

29. The method of claim 28, wherein the short patch repair inhibitor is oleanolic acid,Edgeworin, Myristinin A, oleanolic acid or Harbatinic acid.

30. The method of claim 23, wherein the chemical inhibitor is a base analog.

31. The method of claim 30, wherein the base analog is IdU.

32. The method of any one of claims 18-31, wherein the chemical inhibitor inhibits all four DRDD enzymes.

33. The method of any one of claims 18-32, wherein the plant is a monocot or a dicot.

34. The method of any one of claims 18-33, wherein the plant is selected from com, canola, alfalfa, rice, soy, potato, wheat, sugarcane, cassava, sorghum, tomato, oat or barley.

35. The method of any one of claims 18-34, wherein the cutting is a leaf.

36. The method of claim 35, wherein the excised leaf is placed abaxial surface down on the propagation medium.

37. The method of any one of claims 18-34, wherein the cutting is a stem cutting.

38. The method of claim 37, wherein the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

39. The method of any one of claim 18-38, wherein the propagation medium is shoot induction medium (SIM).

40. The method of any one of claim 18-38, wherein the propagation medium lacks hormones.

41. The method of claim 40, wherein the propagation medium is Gamborg’s B5 medium.

42. A method of propagating a plant comprising:(a) excising a cutting from a plant,(b) delivering an RNAi molecule to the cutting,(c) placing the excised cutting on propagation medium, and(d) incubating the excised cutting under standard growth conditions.

43. The method of claim 42, wherein in step (d) the incubation period is until shoot organs have regenerated to form a regenerated plant.

44. The method of claim 42, wherein in step (d) the incubation period is until both root and shoot organs have regenerated to form a regenerated plant.

45. The method of any one of claims 42-44, wherein in step (d) the incubation period is for about 2-5 weeks.

46. The method of any one of claims 42-45, further comprising(e) transferring the regenerated plant to soil.

47. The method of any one of claims 42-46, wherein the RNAi molecule is an siRNA molecule that inhibits a DRDD enzyme.

48. The method of claim 47, wherein the siRNA molecule is an inverted repeat hairpin RNA targeting the first exon of DRDD genes.

49. The method of claim 48, wherein the siRNA is selected from the group consisting of(a)UCGGUAGUUUAUAUUUGUUUUUACGCAUUCUUCAUUGACUGUAUGUAUUUGAUGUUGAUACCCUGGGCUGUCUUAUUUUAUAGGUGGAUGCUGGGAGGCCACAUAGGAGGCCUGUGUGAUCCAAGUGUGCUGCUCCUGAGUUGAAAUUGC AUAGCCAUAUAGCAACUACUGGUGUAAACUUGAGAGAUGAAGUAGUGAAA GGAAAUAUGCAGGAUUUUGGACAAUGGCUGCCUCAAUCUCAGACCACUGC CGAUCUAUAUUUCUCCAGUAUUCCAAUACCAUCACAGUUCGAUACUUCCA UAGAGACGCAGACUAGAACUUCUGCAGUUGUAUCGUCAGAGAAAGAAUCU GCUAAUUCGUUCGUCCCUCAUAAUGGUACUGGGCUUGUUGAACGCAUUAG CAAUGAUGCUGGGCUAACUGAAGUAGUUGGAAGUAGUGCUGGACCAACUG AAUGUAUUGACUUGAACAAGACACCAGCACGGAAACCCAAGAAGAAAAAG CACAGGCCAAAGGUGCUAAAGGACGAUAAACCAUCGAAGACACCUAAAUC UGCUACUCCAAUACCUUCAACAGAAAAGGUAGAAAAACCAUCUGGAAAGA GAAAAUAUGUCCGCAAGAAAUAUCUACCCGCUUCGCGUCGGCAUCCGGUC AGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACU UUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUUCUUGCGGACAUAUUUUCUCUUUCCAGAUGGUUUUUCUACCUUUUCUGUUGAAGGUAUUGGAGUAGCAGAUUUAGGUGUCUUCGAUGGUUUAUCGUCCUUUAGCACCUUUGGCCUGUGCUUUUUCUUCUUGGGUUUCCGUGCUGGUGUCUUGUUCAAGUCAAUACAUUCAGUUGGUCCAGCACUACUUCCAACUACUUCAGUUAGCCCAGCAUCAUUGCUAAUGCGUUCAACAAGCCCAGUACCAUUAUGAGGGACGAACGAAUUAGCAGAUUCUUUCUCUGACGAUACAACUGCAGAAGUUCUAGUCUGCGUCUCUAUGGAAGUAUCGAACUGUGAUGGUAUUGGAAUACUGGAGAAAUAUAGAUCGGCAGUGGUCUGAGAUUGAGGCAGCCAUUGUCCAAAAUCCUGCAUAUUUCCUUUCACUACUUCAUCUCUCAAGUUUACACCAGUAGUUGCUAUAUGGCUAUGCAAUUUCAACUCAGGAGCAGCACACUUGGAUCACACAGGCCUCCUAUGUGGCCUCCCAGCAUCCACCUAUAAAAUAAGACAGCCCAGGGUAUCAACAUCAAAUACAUACAGUCAAUGAAGAAUGCGUAAAAACAAAUAUAAACUACCGA (SEQ ID NO: 1);(b)UUAAAAAACAUAAACCAAGGCCUAAAGUGGAUCUUGAUGCAGAAACAGAGAGAACCUGGAAACUAUUGAUGGGCAAAGGAGGAAGUGAAGGCCUUGAAGGAACUGACAAGGAAAAAGAGAAGUGGUGGGACGAAGAAAGAAAUGUUUUUCACGGACGAGUUGAUUCCUUCAUUGCACGGAUGCAUCUUAUUCAAGGAGAUAGACGCUUUUCAAAGUGGAAAGGAUCUGUUGUUGACUCGGUGAUAGGUGUUUUCCUCACUCAGAAUGUUUCAGACCAUCUUUCAAGCUCUGCCUUUAUGUCUCUAGCAUCAAGGUUUCCUCUUCAGUCAAAAAGCAGCAAGAAAUCAUAUGAUGUUGACACAAACACAUUGCUUAAAGAAGCAGAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUCUGCUUCUUUAAGCAAUGUGUUUGUGUCAACAUCAUAUGAUUUCUUGCUGCUUUUUGACUGAAGAGGAAACCUUGAUGCUAGAGACAUAAAGGCAGAGCUUGAAAGAUGGUCUGAAACAUUCUGAGUGAGGAAAACACCUAUCACCGAGUCAACAACAGAUCCUUUCCACUUUGAAAAGCGUCUAUCUCCUUGAAUAAGAUGCAUCCGUGCAAUGAAGGAAUCAACUCGUCCGUGAAAAACAUUUCUUUCUUCGUCCCACCACUUCUCUUUUUCCUUGUCAGUUCCUUCAAGGCCUUCACUUCCUCCUUUGCCCAUCAAUAGUUUCCAGGUUCUCUCUGUUUCUGCAUCAAGAUCCACUUUAGGCCUUGGUUUAUGUUUUUUAA (SEQ ID NO: 2);(c)AAGAAAGAAGAGUGUUCAGAGGACGGGUUGAUUCAUUCAUUGCUCGUAUGCAUCUAGUUCAGGGGGAUAGGCGUUUCUCUCGAUGGAAAGGAUCAGUCGUGGAUUCAGUCGUGGGUGUAUUUCUUACCCAGAAUGUUUCAGAUCAUCUUUCUAGUUCUGCUUUCAUGGCGGUUGCUGCCAAAUUUCCUGUUAAGAUAGAGGUCCCUAAAAAACCUGUGGCUGAGAUGUCUCAUACUCCUGAACAGAAGGAUAGUUGUUCUGGACUGUUUGGUGAUUCUAUCAAAUUGCAGGGCAAUAUAUACAUUGAAGAGAUAAGUGACAUUAAAUCGUUAAUUACUACAGAAGAUAAUGAAGAAAGUAAUAAAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUUAUUACUUUCUUCAUUAUCUUCUGUAGUAAUUAACGAUUUAAUGUCACUUAUCUCUUCAAUGUAUAUAUUGCCCUGCAAUUUGAUAGAAUCACCAAACAGUCCAGAACAACUAUCCUUCUGUUCAGGAGUAUGAGACAUCUCAGCCACAGGUUUUUUAGGGACCUCUAUCUUAACAGGAAAUUUGGCAGCAACCGCCAUGAAAGCAGAACUAGAAAGAUGAUCUGAAACAUUCUGGGUAAGAAAUACACCCACGACUGAAUCCACGACUGAUCCUUUCCAUCGAGAGAAACGCCUAUCCCCCUGAACUAGAUGCAUACGAGCAAUGAAUGAAUCAACCCGUCCUCUGAACACUCUUCUUUCUU (SEQ IDNO: 3);(d)CCACUAUGAUGUGGAACUUAUUAAUGGGGCCAGAUAUGGGUGAUGGUGCUGAAGGGUUGGACAAGGAUAAAGAGAAGUGGCUUGACGAAGAAAGAAGAGUGUUCAGAGGACGGGUUGAUUCAUUCAUUGCUCGUAUGCAUCUAGUUCAGGGGGACAGGCGUUUCUCUCGAUGGAAAGGAUCAGUUGUGGACUCAGUUGUGGGUGUAUUUCUUACCCAGAAUGUUUCAGAUCAUCUUUCUAGUUCUGCUUUCAUGGGGGUUGCUGCCAAAUUUCCAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUGGAAAUUUGGCAGCAACCCCCAUGAAAGCAGAACUAGAAAGAUGAUCUGAAACAUUCUGGGUAAGAAAUACACCCACAACUGAGUCCACAACUGAUCCUUUCCAUCGAGAGAAACGCCUGUCCCCCUGAACUAGAUGCAUACGAGCAAUGAAUGAAUCAACCCGUCCUCUGAACACUCUUCUUUCUUCGUCAAGCCACUUCUCUUUAUCCUUGUCCAACCCUUCAGCACCAUCACCCAUAUCUGGCCCCAUUAAUAAGUUCCACAUCAUAGUGG (SEQ ID NO: 4);(e)GCAAAGGUUCAUAUAGAUAAUGAGACGGAUAGAGUCUGGAAGCUUUUGAUGGAGAGUAUCGAUAGCGAAGGUGUUGACGGAUCAGACGAGAAGAAGGCCAAAUGGUGGGAGGAAGAACGUAAUGUGUUUAGAGGAAGAGCUGACUCAUUCAUAGCACGAAUGCAUCUUGUUCAAGGUGAUAGACGCUUUACACCUUGGAAAGGAUCAGUUGUUGAUUCUGUGGUUGGAGUGUUUCUCACUCAAAACGUUUCUGAUCAUCUCUCAAGCUCUGCGUUUAUGUCACUAGCUGCGGAGUAUCCAGUACCUUUUGUACCCAGCAGUGACUUUGAAGUAGGAGAAAGUAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUCACUUUCUCCUACUUCAAAGUCACUGCUGGGUACAAAAGGUACUGGAUACUCCGCAGCUAGUGACAUAAACGCAGAGCUUGAGAGAUGAUCAGAAACGUUUUGAGUGAGAAACACUCCAACCACAGAAUCAACAACUGAUCCUUUCCAAGGUGUAAAGCGUCUAUCACCUUGAACAAGAUGCAUUCGUGCUAUGAAUGAGUCAGCUCUUCCUCUAAACACAUUACGUUCUUCCUCCCACCAUUUGGCCUUCUUCUCGUCUGAUCCGUCAACACCUUCGCUAUCGAUACUCUCCAUCAAAAGCUUCCAGACUCUAUCCGUCUCAUUAUCUAUAUGAACCUUUGC (SEQ ID NO: 5);(AACAGAUAAGGGAAAGGAGAAGUGGUGGGAAGAGGAAAGGAGGAUAUUCAAAGGACGAGCUGAUUCAUUCAUUGCACGGAUGCAUCUUGUACAAGGAGAUAGACGCUUCUCAAAAUGGAAGGGAUCAGUUGUUGACUCAGUGAUAGGAGUUUUCCUGACCCAGAAUGUUUCAGACCAUCUCUCAAGCUCUGCAUUCAUGUCCUUGGCAGCACGAUUUCCUCUUAAGUCAAACAAGAGAACAUGUAACAUAGAUGGUACAAACAUAUUGGUUGAAGAACCAGAAGUGUGUAUACGUGCAAAUGAAAGCAUCCAAUGGCAUGAACUUUUGAGGCAUCCAGGAAGCAGCCAAAGCUCUAUUACAAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUGUAAUAGAGCUUUGGCUGCUUCCUGGAUGCCUCAAAAGUUCAUGCCAUUGGAUGCUUUCAUUUGCACGUAUACACACUUCUGGUUCUUCAACCAAUAUGUUUGUACCAUCUAUGUUACAUGUUCUCUUGUUUGACUUAAGAGGAAAUCGUGCUGCCAAGGACAUGAAUGCAGAGCUUGAGAGAUGGUCUGAAACAUUCUGGGUCAGGAAAACUCCUAUCACUGAGUCAACAACUGAUCCCUUCCAUUUUGAGAAGCGUCUAUCUCCUUGUACAAGAUGCAUCCGUGCAAUGAAUGAAUCAGCUCGUCCUUUGAAUAUCCUC CUUUCCUCUUCCCACCACUUCUCCUUUCCCUUAUCUGUU (SEQ ID NO: 6); and(g)UUUGAGCCAAUCAGGAAACGAAACCAACGUCCUAAAGUAGACCUAGAUCCGGAAUCAGAAAGAUUGUGGAACCUGUUGAUGGGUGAUGAAGGAAGUAAGGGCGCUGAAAACAUGGAUAAUGAAAAAGAAAAAUGGUGGGAAAAUGAAAGGCGAGUGUUUCGUGGGCGAACAGACUCAUUCAUUGCCCGUAUGCAUCUUGUUCAAGGGGAUAGAAGAUUCUCACGAUGGAAAGGAUCCGUAGUUGACUCGGUGAUUGGUGUCUUUCUCACACAGAAUGUUUCUGAUCAUCUUUCAAGUUCUGCCUUCAUGGCACUGGCAGCAAAAUUCCCCGUUAAGUCAACAACCGCCGACAAAACAUGCUGCCAAGAAUAUCUACCCGCUUCGCGUCGGCAUCCGGUCAGUGGCAGUGAAGGGCGAACAGUUCCUGAUUAACCACAAACCGUUCUACUUUACUGGCUUUGGUCGUCAUGAAGAUGCGGACUUGCGUGGCAAAGGAUUCGAUAACGUGCUGAUGGUGCACGACCACGCAUUAAUUCUUGGCAGCAUGUUUUGUCGGCGGUUGUUGACUUAACGGGGAAUUUUGCUGCCAGUGCCAUGAAGGCAGAACUUGAAAGAUGAUCAGAAACAUUCUGUGUGAGAAAGACACCAAUCACCGAGUCAACUACGGAUCCUUUCCAUCGUGAGAAUCUUCUAUCCCCUUGAACAAGAUGCAUACGGGCAAUGAAUGAGUCUGUUCGCCCACGAAACACUCGCCUUUCAUUUUCCCACCAUUUUUCUUUUUCAUUAUCCAUGUUUUCA GCGCCCUUACUUCCUUCAUCACCCAUCAACAGGUUCCACAAUCUUUCUGAUUCCGGAUCUAGGUCUACUUUAGGACGUUGGUUUCGUUUCCUGAUUGGCUCAAA (SEQ ID NO: 7).

50. The method of claim 49, wherein the siRNA is a short double stranded RNA comprised of sense and antisense RNA molecules, wherein the sense and antisense RNAs comprise(a) sense: 5'- GGCGCUUUUCUCCUUGGAAAGGAUCAGUAGUGGACUCUGUAGU-3' (SEQ ID NO: 8) and antisense: 5'- ACUACAGAGUCCACUACUGAUCCUUUCCAAGGAGAAAAGCGCC-3' (SEQ ID NO: 9);(b) sense: 5'- UGUUUUCCUCACUCAGAAUGUUUCAGACCAUCUUUCAAGCUCUGCCUUUA UGU-3' (SEQ ID NO: 10) and antisense: 5'- ACAUAAAGGCAGAGCUUGAAAGAUGGUCUGAAACAUUCUGAGUGAGGAAA ACA-3' (SEQ ID NO: 11);(c) sense: 5'- CAGAUCAUCUUUCUAGUUCUGCUUUCAUGGCGGUUGC-3' (SEQ ID NO: 12) and antisense: 5'- GCAACCGCCAUGAAAGCAGAACUAGAAAGAUGAUCUG-3' (SEQ ID NO: 13);(d) sense: 5'- CUCGAUGGAAAGGAUCAGUUGUGGACUCAGUUGUGGGUGUAUUUC-3 ' (SEQ ID NO: 14) and antisense: 5'-GAAAUACACCCAC AACUGAGUCCACAACUGAUCCUUUCC AUCGAG-3 ' (SEQ ID NO: 15);(e) sense: 5'- UGGAAAGGAUCAGUUGUUGAUUCUGUGGUUGGAGUGUUUCUCACUCAAAA -3' (SEQ ID NO: 16) and antisense: 5'- UUUUGAGUGAGAAACACUCCAACCACAGAAUCAACAACUGAUCCUUUCCA -3' (SEQ ID NO: 17);(f) sense: 5'- UGGAAGGGAUCAGUUGUUGACUCAGUGAUAGGAGUUUUCCUGACCCAGAA UGU-3' (SEQ ID NO: 18) and antisense: 5'-ACAUUCUGGGUCAGGAAAACUCCUAUCACUGAGUCAACAACUGAUCCCUUCCA-3' (SEQ ID NO: 19); and(g) sense: 5'-AUGCAUCUUGUUCAAGGGGAUAGAAGAUUCUCACGAUGGAAAGGAUC-3' (SEQ ID NO: 20) and antisense: 5'- GAUCCUUUCCAUCGUGAGAAUCUUCUAUCCCCUUGAACAAGAUGCAU-3' (SEQ ID NO: 21).

51. The method of any one of claims 42-50, wherein a plurality of RNAi molecules are delivered to the excised cutting, where in all four DRDD enzyme genes are inhibited.

52. The method of any one of claims 42-51, wherein the plant is a monocot or a dicot.

53. The method of any one of claims 42-52, wherein the plant is selected from com, canola, alfalfa, rice, soy, potato, wheat, sugarcane, cassava, sorghum, tomato, oats or barley.

54. The method of any one of claims 42-53, wherein the cutting is a leaf.

55. The method of claim 54, wherein the excised leaf is placed abaxial surface down on the propagation medium.

56. The method of any one of claims 42-53, wherein the cutting is a stem cutting.

57. The method of claim 56, wherein the stem cutting is a hypocotyl or stem internode excised below the shoot apical meristem.

58. The method of any one of claim 42-57, wherein the propagation medium is shoot induction medium (SIM).

59. The method of any one of claim 42-58, wherein the propagation medium lacks hormones.

60. The method of claim 59, wherein the propagation medium is Gamborg’s B5 medium.

61. A plant regenerated according to the method of any one of claims 1-60.