Antigen-binding protein specifically binding 25-hydroxyvitamin d3

Abstract

Disclosed in the present invention is an antigen-binding protein specifically binding 25-hydroxyvitamin D3, belonging to the technical field of biology. The present invention provides an antigen-binding protein, which is significantly different from existing anti-25-hydroxyvitamin D3 monoclonal antibodies and has a better application prospect. Said antigen-binding protein comprises two heavy chains and two light chains, variable regions of the heavy chains containing heavy chain CDR1-3 amino acid sequences as shown in SEQ ID NO. 1-3, and variable regions of the light chains containing light chain CDR1-3 amino acid sequences as shown in SEQ ID NO. 4-6. The antigen-binding protein of the present invention has good affinity and specificity, and therefore can be used for developing immunoassay methods for measurement of 25-hydroxyvitamin D3.

Description

An antigen binding protein that specifically binds to 25-hydroxyvitamin D3 Technical Field

[0001] The invention relates to an antigen-binding protein specifically binding to 25-hydroxyvitamin D3, belonging to the field of biotechnology. Background Art

[0002] Vitamin D3, also known as cholecalciferol, is a fat-soluble vitamin. The human body synthesizes vitamin D3. Under the influence of ultraviolet light, 7-dehydrocholesterol in the skin's epidermis undergoes a series of reactions to produce vitamin D3. Vitamin D3 has multiple functions, including regulating calcium and phosphorus balance, maintaining bone health, regulating immune function, preventing cardiovascular disease, and regulating fat and energy metabolism. Vitamin D3 can be taken as an oral dietary supplement to prevent vitamin D deficiency and as a medication to treat related conditions such as rickets, familial hypophosphatemia, hypoparathyroidism, hypocalcemia, and calciporosis. Foods such as fish, beef liver, eggs, and cheese contain vitamin D3, and a balanced diet can help prevent vitamin D deficiency.

[0003] In the human body, vitamin D3 exists in two metabolic forms. Under the catalytic action of vitamin D3 hydroxylase, vitamin D3 is metabolized in the liver to 25-hydroxyvitamin D3, also known as calcidiol. 25(OH)D3 can be further hydroxylated by 25(OH)D-1α-hydroxylase in the kidneys to form 1,25-(OH)2D3, also known as calcitriol, the active form of vitamin D3. 1,25-(OH)2D3 has a short half-life and low blood concentrations. In contrast, 25(OH)D3 in blood is typically tightly bound to vitamin D-binding protein, exhibiting excellent stability and a long half-life. Its concentration is directly correlated with the body's vitamin D content. In medical diagnosis, the measurement of 25(OH)D3 in plasma or serum can be used to determine a person's vitamin D level.

[0004] At present, the main detection methods for 25(OH)D3 are instrumental analysis methods and immunoassay methods. Among them, instrumental analysis methods include high performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS / MS), which have the advantages of high sensitivity, strong specificity, and good accuracy. LC-MS / MS is the gold standard for determining 25(OH)D3 content. However, instrumental analysis methods rely on sophisticated instruments, professional operators, and complex sample pre-treatment processes, which are costly, time-consuming, and have low detection efficiency and throughput. Immunoassay is a detection method based on antigen-antibody binding reaction, which has the advantages of being rapid, sensitive, and efficient, and is suitable for the technical requirements of point-of-care testing (POCT) in clinical diagnosis.

[0005] Antibodies are core reagents in immunoassays. Traditional monoclonal antibodies require a production process involving mouse immunization, hybridoma cell fusion, monoclonal screening, cell expansion, and ascites fluid production. Traditional monoclonal antibodies have the following limitations: During hybridoma cell cryopreservation, thawing, and passaging, antibody gene drift or loss can occur, leading to decreased monoclonal antibody performance. During ascites fluid production, individual mouse variability can lead to hemolysis, which can affect antibody quality. Furthermore, long-term storage of hybridoma cells relies heavily on liquid nitrogen, which requires constant replenishment and is expensive. Recombinant antibodies, based on genetic engineering, circumvent these limitations. Compared to antibodies produced using the traditional ascites fluid method, recombinant antibodies offer advantages such as: reproducibility, with the antibody gene information permanently preserved without loss, ensuring accuracy and batch-to-batch consistency; remodelability, with the ability to alter the antibody species or subtype through genetic recombination, or enhance antibody performance; the elimination of the need for experimental animals, minimizing harm to animals; and high purity, with recombinant antibodies expressed in the absence of serum, avoiding contamination by serum components. Therefore, the development of recombinant antibodies against 25-hydroxyvitamin D3 can establish a rapid immunoassay method with better stability and higher consistency.

[0006] In addition, a variety of antibodies against 25-hydroxyvitamin D have been disclosed in the prior art. For example, Chinese patent CN105352958A discloses a total 25-hydroxyvitamin D detection kit, in which the antibody used can react with vitamin D2 and D3 simultaneously; patent CN103857698A also discloses an antibody against 25-hydroxyvitamin D2 and D3; CN101273062A also discloses an anti-25-hydroxyvitamin D antibody that can react with both 25-hydroxyvitamin D2 and 25-hydroxyvitamin D3, two forms of 25-hydroxyvitamin D. However, the antibodies disclosed above cannot distinguish between different types of 25-hydroxyvitamin D (such as vitamin D2 and D3). Moreover, the current antibodies against 25-hydroxyvitamin D3 have limited detection effects due to the introduction of cross-linking groups during the preparation process.

[0007] Summary of the Invention

[0008] To address the above problems, the present invention provides a highly sensitive and specific recombinant antigen-binding protein against 25-hydroxyvitamin D3. Based on the above properties, the antigen-binding protein is expected to be used for the detection of 25-hydroxyvitamin D3.

[0009] The first object of the present invention is to provide an antigen-binding protein that specifically binds to 25-hydroxyvitamin D3, wherein the antigen-binding protein contains a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises the complementary determining regions VH-CDR1, VH-CDR2, and VH-CDR3 as shown in the amino acid sequences of SEQ ID NOs.1-3, and the light chain variable region comprises the complementary determining regions VL-CDR1, VL-CDR2, and VL-CDR3 as shown in the amino acid sequences of SEQ ID NOs.4-6.

[0010] Furthermore, the antigen binding protein may be an antibody or an antigen binding fragment thereof.

[0011] Furthermore, the antigen-binding fragment comprises Fab, Fab', Fv fragment, F(ab')2, scFv, di-scFv and / or dAb.

[0012] Furthermore, the present invention includes molecules containing heavy chain variable regions and light chain variable regions of antigen binding proteins containing CDRs, as long as their CDRs have more than 80% (preferably more than 90%, and optimally more than 95%, such as 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) homology with the above-mentioned CDR sequences.

[0013] Furthermore, the heavy chain variable region of the antigen-binding protein comprises framework regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4, with complementarity determining regions disposed between adjacent framework regions, i.e., VH-CDR1, VH-CDR2, and VH-CDR3, separated by framework regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4. Thus, the heavy chain variable region of the antigen-binding protein is sequentially disposed with VH-FR1, VH-CDR1, VH-FR2, VH-CDR2, VH-FR3, VH-CDR3, and VH-FR4.

[0014] Furthermore, the framework regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4 respectively comprise the sequences shown in SEQ ID NOs. 7-10 or sequences having a homology of not less than 90% thereto.

[0015] Furthermore, the light chain variable region of the antigen-binding protein comprises framework regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4, with complementarity determining regions disposed between adjacent framework regions, i.e., VL-CDR1, VL-CDR2, and VL-CDR3, separated by framework regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4. Thus, the light chain variable region of the antigen-binding protein is sequentially disposed with VL-FR1, VL-CDR1, VL-FR2, VL-CDR2, VL-FR3, VL-CDR3, and VL-FR4.

[0016] Furthermore, the framework regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4 respectively comprise the sequences shown in SEQ ID NOs. 11-14 or sequences having a homology of not less than 90% thereto.

[0017] Furthermore, the antibody is a murine antibody or a humanized antibody.

[0018] Furthermore, the antigen binding protein also comprises a constant region.

[0019] Furthermore, the species of origin of the constant region is cattle, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose or human;

[0020] Furthermore, the constant region is selected from one of mouse IgG1, IgG2a, IgG2b, IgG3 or human IgG1, IgG2, IgG3, IgG4, and IgM.

[0021] Furthermore, the constant region is derived from mouse; the amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.15; and the amino acid sequence of the light chain constant region is shown in SEQ ID NO.16.

[0022] The second object of the present invention is to provide a nucleic acid molecule encoding the above antigen-binding protein. The nucleic acid molecule is DNA or RNA.

[0023] The third object of the present invention is to provide an expression vector containing the above nucleic acid molecule.

[0024] Furthermore, the expression vector may be a viral vector or a non-viral vector, such as DNA, RNA, a viral vector (such as lentivirus, adenovirus, AAV virus, retrovirus or a combination thereof), a plasmid, a transposon, other gene transfer systems, liposome nanoparticles, etc.

[0025] The fourth object of the present invention is to provide a host cell containing the above antigen-binding protein.

[0026] Furthermore, the host cell can be a prokaryotic cell or a eukaryotic cell, such as a plant cell, an animal cell, a microorganism, etc. Preferably, the host cell is a Chinese hamster ovary (CHO) cell, a human embryonic kidney cell (HEK293), a HeLa cell, a baby hamster kidney cell, a NSO mouse myeloma cell, or other mammalian cells.

[0027] A fifth object of the present invention is to provide a monovalent antibody, a bivalent antibody or a multivalent antibody comprising the above antigen-binding protein.

[0028] The sixth object of the present invention is to provide a recombinant protein or immunoconjugate containing the above antigen-binding protein.

[0029] Furthermore, the recombinant protein contains an antigen binding protein and a tag sequence that assists expression and / or purification.

[0030] Furthermore, the immunoconjugate contains an antigen binding protein and a conjugated moiety, such as a detectable label.

[0031] The seventh object of the present invention is to provide a detection kit for 25-hydroxyvitamin D3, comprising the antigen-binding protein, nucleic acid molecule, expression vector, host cell, monovalent antibody, bivalent antibody, multivalent antibody, recombinant protein or immunoconjugate.

[0032] Furthermore, the detection includes flow cytometry, cell immunofluorescence detection, enzyme-linked immunosorbent assay (ELISA) detection, etc.

[0033] Furthermore, the above kit can be used to detect 25-hydroxyvitamin D3 in vivo or in vitro.

[0034] Beneficial effects of the present invention:

[0035] After extensive screening, the present invention successfully obtained an antigen-binding protein that specifically binds to 25-hydroxyvitamin D3. The antigen-binding protein has a unique variable region sequence and has high affinity and specificity for the 25-hydroxyvitamin D3 antigen. The recombinant antigen-binding protein developed by the present invention has a clear sequence and can effectively avoid gene mutations. The antigen-binding protein has small batch-to-batch differences, stable quality, and complete structure, which is more conducive to the development of a stable rapid immunoassay detection method. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] FIG1 is an agarose gel electrophoresis diagram of the antibody variable region gene obtained by PCR amplification in the present invention.

[0037] FIG2 is an SDS-PAGE protein electrophoresis diagram of the recombinant antibody of the present invention.

[0038] Figure 3 is the ic-ELISA standard curve of the anti-25-hydroxyvitamin D3 recombinant antibody of the present invention against 25-hydroxyvitamin D3 (concentrations from low to high are 0, 1.37, 4.12, 12.35, 37.04, 111.11, 333.33, and 1000 ng / mL). DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0040] Definition of terms

[0041] As used herein, the term "specifically binds" generally refers to binding of an antibody to an epitope via its antigen binding domain, and that such binding requires some complementarity between the antigen binding domain and the epitope. According to this definition, an antibody is said to "specifically bind" to an antigen when it binds to the epitope via its antigen binding domain more readily than it would to a random, unrelated epitope.

[0042] In the present invention, the terms "isolated" or "purified" generally refer to a molecule (e.g., an antibody, nucleic acid, etc.) that is at least partially separated from other molecules with which it is normally associated in its native state. An "isolated or purified polypeptide" or "isolated or purified nucleic acid" is substantially free of other biological molecules, such as nucleic acids, proteins, lipids, carbohydrates, cell debris, and growth medium.

[0043] In the present invention, the term "antigen binding protein" is used in its broad sense and means a protein comprising a portion that binds to an antigen or target and optionally comprising a framework or framework portion that allows the antigen binding portion to adopt a configuration that promotes binding of the antigen binding protein to the antigen. Examples of antigen binding proteins include human antibodies, humanized antibodies; chimeric antibodies; recombinant antibodies; single-chain antibodies; bifunctional antibodies; trifunctional antibodies; tetrafunctional antibodies; Fab fragments; F(ab')2 fragments; IgD antibodies; IgE antibodies; IgM antibodies; IgG1 antibodies; IgG2 antibodies; IgG3 antibodies; or IgG4 antibodies and fragments thereof. Antigen binding proteins may include, for example, chimeric antigen receptors with transplanted CDRs or CDR derivatives, alternative protein frameworks, or artificial frameworks. Such frameworks include, but are not limited to, antibody-derived frameworks comprising mutations introduced to, for example, stabilize the three-dimensional structure of the antigen binding protein; and fully synthetic frameworks comprising, for example, biocompatible polymers.

[0044] In the present invention, the term "antibody" is used in the broadest sense and specifically covers, but is not limited to, monoclonal antibodies (including full-length monoclonal antibodies comprising two light chains and two heavy chains), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), humanized antibodies, fully human antibodies, chimeric antibodies, heavy chain antibodies, and camelized single domain antibodies (e.g., heavy chain variable domain antibodies). Antibodies generally have the structure of immunoglobulins and may comprise proteins comprising at least two heavy chains (HC) and two light chains (LC) interconnected by disulfide bonds, or antigen-binding fragments thereof. Each heavy chain comprises a heavy chain variable region (VH) and a heavy chain constant region. The amino acid composition and arrangement order of the constant region of the immunoglobulin heavy chain differ, and therefore their antigenicity also differs. Accordingly, immunoglobulins can be divided into five classes, or so-called immunoglobulin isotypes, namely IgM, IgD, IgG, IgA, and IgE, with their corresponding heavy chains being μ chain, δ chain, γ chain, α chain, and ε chain, respectively. Igs of the same class can be further divided into subclasses based on the amino acid composition of their hinge regions and the number and location of disulfide bonds in their heavy chains. For example, IgG can be divided into IgG1, IgG2, IgG3, and IgG4. Light chains are classified as either kappa or lambda chains based on differences in their constant regions. Each of the five Ig classes can have either kappa or lambda chains.

[0045] In the present invention, the term "variable" generally refers to that some parts of the sequence of the variable domain of an antibody vary strongly, which forms the binding and specificity of various specific antibodies to their specific antigens. However, variability is not evenly distributed throughout the entire variable region of an antibody. It is concentrated in three segments in the light and heavy chain variable regions, referred to as complementarity determining regions (CDRs) or hypervariable regions (HVRs). The more highly conserved parts of the variable domain are referred to as frameworks (FRs). The variable domains of natural heavy and light chains each contain four FR regions, most of which adopt a β-sheet configuration, connected by three CDRs, forming loops connected, and in some cases forming part of the β-sheet structure. The CDRs in each chain are closely together through the FR region and, together with the CDRs from the other chain, form the antigen binding site of the antibody, while the constant region does not directly participate in the binding of the antibody to the antigen. In the art, the CDRs of an antibody can be defined by a variety of methods, such as the Kabat definition rules, the Chothia definition rules, or the IMGT definition rules based on sequence variability.

[0046] The sequence information involved in the present invention is as follows:

[0047] Example 1: Isolation and identification of variable region genes of anti-25-hydroxyvitamin D3 monoclonal antibodies

[0048] Resuscitate the hybridoma cell line producing anti-25-hydroxyvitamin D3 monoclonal antibody in a culture flask, and collect 5-10×10 6To each cell, add 1 mL of Trizol reagent, pipette to mix, and thoroughly mix to lyse; add 200 μL of chloroform to the lysate, shake for 15 seconds to obtain an emulsion, let it stand at 4°C for 5 minutes, and then centrifuge at 12,000 g for 15 minutes; take 450 μL of the upper colorless aqueous phase, add an equal volume of pre-cooled isopropanol, mix by inversion, let it stand at 4°C for 10 minutes, and then centrifuge at 12,000 g for 10 minutes; discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, and centrifuge at 12,000 g for 10 minutes; discard the supernatant, resuspend the precipitate in 100 μL of RNase-free water, and store at -80°C.

[0049] Using RNA as a template, The RACE 5' / 3' Kit (purchased from Takara) was used for first-strand cDNA synthesis and rapid cDNA end amplification, respectively. Different gene-specific primers corresponded to the heavy and light chains of the antibody, designated H-5'GSP and L-5'GSP, respectively. The sequence of H-5'GSP is GATTACGCCAAGCTTCTCAATTTTCTTGTCCACCTTGGTGC, and the sequence of L-5'GSP is GATTACGCCAAGCTTCTCATTCCTGTTGAAGCTCTTGACAATGGG. As shown in Figure 1, bright target bands were observed by agarose gel electrophoresis, containing the VH and VL gene segments, respectively.

[0050] The target gene was purified using a gel recovery kit to 20 μL. The purified product was cloned into a linearized pRACE plasmid by in-fusion, transformed into Stellar competent cells, and plated on LB solid medium (containing ampicillin). The next day, 6-8 single colonies were taken from each of the VH and VL genes, expanded, and sent to a gene sequencing company for sequencing. The sequencing primers were M13-F / R universal primers. The gene sequences obtained by the above sequencing were imported into the Kabat antibody database for comparison analysis to identify the VH and VL genes, as well as the CDR regions and framework regions. The VH gene sequence was 357 bp in length, preceded by a 57 bp signal peptide sequence; the VL gene sequence was 321 bp in length, preceded by a 60 bp signal peptide sequence.

[0051] Example 2: Construction of recombinant antibody expression plasmid

[0052] Based on the sequenced heavy and light chain variable region genes of the anti-25-hydroxyvitamin D3 monoclonal antibody, specific primers were designed. Using the pRACE heavy and light chain plasmids as templates, the heavy and light chain variable region genes were amplified by PCR. These genes were then homologously recombined into the pcDNA3.4 backbone plasmid containing the heavy and light chain constant regions, respectively, to generate recombinant antibody expression plasmids containing the full-length heavy and light chain genes. The heavy and light chain expression plasmids were transformed into Top 10 competent cells, and single colonies were picked and sequenced to verify sequence accuracy. Single colonies corresponding to the correctly sequenced heavy and light chain expression plasmids were cultured and expanded, and the heavy and light chain expression plasmids were extracted using an endotoxin-free plasmid extraction kit.

[0053] Example 3: Expression and purification of recombinant antibodies

[0054] Take a tube of HEK293F suspension cells from the liquid nitrogen tank, the number of cells is ≥10 7 After rapid thawing in a 37°C water bath, transfer to 30 mL of pre-warmed culture medium and culture in a 125 mL shake flask to a final density of approximately 0.3 × 10 6 cells / mL, using Sino Biological's SMM-293TII medium. The incubator conditions were set at 37°C, 125 rpm, 5% CO2, and humidity >80% for 3-4 days. Cells can grow to 3×10 6 cells / mL, with a viability greater than 95%, continue to passage twice, ensuring a doubling time of about 24 hours, and use them as seed cells.

[0055] The day before transfection, 1.5 × 10 6 HEK293F cells were inoculated into a 500 mL shake flask at a density of 120 mL. The next day, the cells grew to 3 × 10 6 cells / mL, cell viability > 95%, start cell transfection. The total amount of heavy chain and light chain expression plasmids is 4μg per ml of culture volume, the heavy chain to light chain ratio is 1:1.5, the transfection reagent is PEI, and the amount of PEI is 2.5 times the amount of plasmid. Mix the plasmid and PEI in fresh culture medium, let it stand at room temperature for 15-20 minutes, slowly add it to the shake flask, and then add an appropriate amount of fresh culture medium to dilute the cells to a final density of 2×10 6 cells / mL and return to the shaker incubator for culture. Add 3.5% of the culture volume of feed solution 20-24 hours after transfection, and continue adding 3.5% of the culture volume of feed solution on days 3 and 5 after transfection. Harvest the cell culture supernatant on day 7 after transfection or when cell viability is <60%.

[0056] The cell culture supernatant was collected by high-speed centrifugation to remove cells and cell debris. The supernatant was filtered through a 0.45 μm membrane filter and the antibody was purified using a Protein G affinity chromatography column. The antibody was dialyzed into 0.01 M PBS buffer and stored at -20°C. A small amount of antibody was analyzed by reducing SDS-PAGE electrophoresis. As shown in Figure 2, two protein bands were observed: one heavy chain with a molecular weight of approximately 50 kDa and the other light chain with a molecular weight of approximately 25 kDa.

[0057] Example 4: Performance testing of recombinant antibodies

[0058] The above recombinant antibody was applied to the IC-ELISA detection of 25-hydroxyvitamin D3. The specific steps were as follows: the coated original 25-hydroxyvitamin D3-BSA was washed with 0.05M carbonate buffer (pH 9.6) Dilute to 0.3 μg / mL, add 100 μL / well to a 96-well microtiter plate, and incubate at 37°C for 2 h; wash three times with PBST washing solution, 3 min each time; add 200 μL / well blocking solution, and incubate at 37°C for 2 h; add serially diluted 25-hydroxyvitamin D3 standard (50 μL / well) and recombinant antibody (0.3 μg / mL, 50 μL / well), and incubate at 37°C for 30 min; after washing, add HRP goat anti-mouse IgG (100 μL / well) and incubate at 37°C for 30 min; after washing, add TMB substrate solution (100 μL / well) and react at 37°C for 15 min; add stop solution (50 μL / well) to stop the reaction, and measure the absorbance at 450 nm with a microtiter plate.

[0059] The standard curve of the inhibition of the recombinant antibody on 25-hydroxyvitamin D3 is shown in FIG3 , and its sensitivity (IC 50 ) was 26.6 ng / mL, and the detection limit (IC 10 ) was 3.0 ng / mL, indicating that the recombinant antibody has good sensitivity for 25-hydroxyvitamin D3. In addition, the recombinant antibody did not cross-react with 25-hydroxyvitamin D2 in the ic-ELISA, indicating that it has good specificity and can be used for 25-hydroxyvitamin D3 immunoassay.

[0060] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. An antigen binding protein that specifically binds to 25-hydroxyvitamin D3, characterized in that: The antigen binding protein contains a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises complementary determining regions VH-CDR1, VH-CDR2, and VH-CDR3 as shown in amino acid sequences such as SEQ ID NO.1-3, and the light chain variable region comprises complementary determining regions VL-CDR1, VL-CDR2, and VL-CDR3 as shown in amino acid sequences such as SEQ ID NO.4-6.

2. The antigen-binding protein according to claim 1, characterized in that The heavy chain variable region contains framework regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4; the framework regions VH-FR1, VH-FR2, VH-FR3, and VH-FR4 respectively contain the sequences shown in SEQ ID NO.7-10 or sequences with a homology of not less than 90% thereto.

3. The antigen-binding protein according to claim 1, characterized in that The light chain variable region contains framework regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4; the framework regions VL-FR1, VL-FR2, VL-FR3, and VL-FR4 respectively contain the sequences shown in SEQ ID NO.11-14 or sequences with a homology of not less than 90% thereto.

4. The antigen-binding protein according to claim 1, characterized in that The antigen binding protein comprises a constant region.

5. The antigen-binding protein according to claim 4, characterized in that The amino acid sequence of the heavy chain constant region is shown in SEQ ID NO.15; the amino acid sequence of the light chain constant region is shown in SEQ ID NO.

16.

6. A nucleic acid molecule encoding the antigen binding protein according to any one of claims 1 to 5.

7. An expression vector comprising the nucleic acid molecule according to claim 6.

8. A host cell containing the antigen binding protein according to any one of claims 1 to 5.

9. A monovalent antibody, a bivalent antibody, a multivalent antibody, a recombinant protein or an immunoconjugate comprising the antigen-binding protein according to any one of claims 1 to 5.

10. A detection kit for 25-hydroxyvitamin D3, characterized in that: Comprising the antigen binding protein according to any one of claims 1 to 5, the nucleic acid molecule according to claim 6, the expression vector according to claim 7, the host cell according to claim 8 or the monovalent antibody, bivalent antibody, multivalent antibody, recombinant protein or immunoconjugate according to claim 9.

Images